Hi Rajarshi, How many barcodes do you have? If just a few, then the 'Filter and Sort -> Select' tool might be a good choice. This will do about the same thing as the "grep" in the top answer at Biostar, for the same type of question: http://www.biostars.org/p/15446/ I did check the tool shed and didn't find any tools that would do this. Maybe also post a inquiry galaxy-dev@bx.psu.edu and see if someone has developed a tool that will demultiplex fastq sequences with barcodes in the identifier, but hasn't loaded it into the tool shed yet? You could also open a request to have such a tool created (or the current barcode tool expanded): http://wiki.galaxyproject.org/Support#Trello_Issue_Board Good luck! Jen Galaxy team On 12/2/12 10:54 AM, Rajarshi Ghosh wrote:
I have lllumina sequences which are barcoded in the sequence identifier e.g.: @FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1 CTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGAAAAATTGTTTTGTGACCTCTCTC The '#TCGCAGGA" is the barcode. As the barcode is not on the 5' or 3' end I cannot use the barcode splitter. Is there a workaround in Galaxy for this? Thanks!
___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
-- Jennifer Jackson http://galaxyproject.org