Hi Qianli,
It looks as if you are using the Extract DNA tool? GTF/GFF files have coordinates with a 1-based start position - and this was your input, but the output from this tool produces coordinates with a BED-style 0-based start position.
The genome index files used by the tool are in .2bit format and the source is encoded into the full name. The sequence content of the reference genome is not altered by the tool. Perhaps the interpretation of the coordinates is the source of the difference or you are sourcing a different version? If you have a question about where we sourced a genome, please let us know.
To see a quick description of both BED and GFF format together in the UI, click into the tool "Convert Formats -> GFF-to-BED converter". For more in-depth descriptions, please see our wiki: http://wiki.g2.bx.psu.edu/Learn/Datatypes
Next time, please send questions directly to our mailing list, with the "to" address as galaxy-user@bx.psu.edu.
Best,
Jen Galaxy team
On 6/8/12 7:07 AM, Qianli Shen wrote:
Hello
I ran a preliminary analysis using test genome and gff file. But the results is confusing me.
The fasta file is
Gm06
ATAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTA AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAC CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT AAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC
The gff3 file is
##gff-version 3 Gm06 GDB element 5 15 . + . ID=LEVEL1;Name=Glyma06g05000;
The output is
?_Gm06_4_15_+
ACCCTAAACCC
1 From the gff3 file we can see the start and end position is 5 and 15, why the start and end coordinate is 4 and 15 in the output file, which is really confusing. 2 How does the galaxy treat the genome file, are all the characters except for ACGT are removed from the genome file? Because I use substr function in Perl to test the output of galaxy, somethimes, there is mismatch.
I really appreciate all your help.
qianli
-- Qianli Shen Graduate Student Ohio State University Department of Horticulture and Crop Science Email: qianlipotential@gmail.com mailto:qianlipotential@gmail.com shen.361@buckeyemail.osu.edu http://goog_1606040974 http://goog_1606040974