Hello, My account login is: johnsonko@ninds.nih.gov<mailto:johnsonko@ninds.nih.gov> I am a first time Galaxy user. I have uploaded my sequences as format "fastq" into Galaxy and would like to next use "Groomer" to output Sanger fastq format so to go on with exploring quality via box plot, deciding on a trim length (if any), and map to genome using bwa or bowtie. However, I am running into a problem using "Groomer". I do not know what format my sequences are per setting the required input parameter. An example of my sequences is as follows: @SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA +SNPSTER6_0679:1:1:1083:939#0/1 BIQQIQQQTP[[[[[VVVVQPPPPPTWWWW[[YYTTTOVV____TWVXRWPTQPQWWWWWTOOVV___V_TROOWTWTWTQWQWTTRWRO ... how to tell if you have: "Sanger", "Solexa", "Illumina 1.3+", etc. I have tried to submit to "Groomer" different times using these options one at a time and none return with results. Need help please. Also, what is the expected time for "Groomer" to return results for a file containing 2.7 million reads. Thank you ... best, Kory -------------------------------------------- Kory R. Johnson, MS, PhD Sr. Bioinformatics Scientist [cid:image001.jpg@01CBC2E0.B2CEC7F0] www.kellygovernmentsolutions.com Providing Contract Services For: Bioinformatics Section, Information Technology & Bioinformatics Program, Division of Intramural Research (DIR), National Institute of Neurological Disorders & Stroke (NINDS), National Institutes of Health (NIH), Bethesda, Maryland Mailing Address: NINDS/NIH Clinical Center (Building 10) Office 5S223 9000 Rockville Pike Bethesda, MD 20892 Contact Information: Phone: 301-402-1956 Fax: 301-480-3563 email: johnsonko@ninds.nih.gov P Green Message: Please consider the environment before printing this e-mail. Thank you. Important Message: This electronic message transmission contains information intended for the recipient only. Such that, the information contained herein may be confidential, privaledged, or proprietary. If you are not the intended recipient, be aware that any disclosure, copying, distribution, or use of this information is strictly prohibited. If you have received this electronic information in error, please notify the sender immediately by telephone. Thank you. --------------------------------------------