
Hi: I use the solid PE sequencing data and mapped with the bioscope tools(AB company supported) ,which is better for solid data mapping ,so I don't use the bowtie to map . Igain the BAM file! Now ,I want use the cufflinks to calculate the gene expression. But there is a error. [15:08:06] Inspecting reads and determining fragment length distribution. BAM record error: found spliced alignment without XS attribute BAM record error: found spliced alignment without XS attribute the BAM file : 323_358_2010 73 chr1 343 0 45M5H * 0 0 CCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCT IIIIIIIIIII))C/1<DE''@DAHD379AID1;7BI+'7))I?3 RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:2 CQ:Z:A=ABA<<>@?<4)='))415'-4118-'1)9>'+1'<6+'1)85+)-+6- CS:Z:T20023010023110230100030100230100230100030000200000 423_236_1955 81 chr1 550 0 8H42M = 699451 698945 GTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGG GF>IIII%%III))8IIII?IIII%%IIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:5 SM:i:3 CQ:Z:9BA<AAB>;?AB:55;A%9?AB,4:@@*/)7>2<%5@<:3,;-.%8.*;5 CS:Z:T20302222311033322303302232133302223222131122330223 298_1884_1495 113 chr1 562 0 7H43M chr3 199392032 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGG 5AI;6:>AIIII>?I7FIEIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:2 CM:i:0 SM:i:3 CQ:Z:BB@7<AB8@ABA=2;=>82:?A388.A&28(77;64.1*-/<&0:9/%3? CS:Z:T20221231112210030222231103332200330223213312222022 62_1428_1954 89 chr1 562 1 50M * 0 0 ACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAATGC *=AIII4/CII=%%I((=EIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII RG:Z:20110328192522421 NH:i:0 CM:i:4 SM:i:0 CQ:Z:@B@BABB=ABBB?@A=B>>@@?<;?>B>=<??'7(;A%&849+%0:@.4* CS:Z:T13130222022123111221003022223110331222033022321331 I have sorted the bam file and the gtf file. cufflinks -G refGene_hg18.gtf -p 3 -r human_hg18.fa -o test test.pe.bam (the version of cufflinks is v0.9.2 ) Who know the reason ,and what shoud I do! best wishes! Shiyong Li 2011-04-11 lishiyong