Hi,
"Summary Statistics" is ok, but before you need to use the tool 'Compute sequence length'.
Ciao, Bjoern
Am 23.05.2014 13:29, schrieb Dominique Cowart:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:
HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy?
Thank you in advance,
Dominique Cowart
The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists, please use the interface at:
To search Galaxy mailing lists use the unified search at: