6:50 p.m.
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been organized and sorted by species. The format of
the data is as follows:
HD4AU5D01BHBCQCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
HD4AU5D01A093MCTCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
etc...for each species
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you,
Dominique Cowart
User name: dac330
4:25 p.m.
On Thu, Aug 2, 2012 at 7:50 PM, D. A. Cowart <dac330(a)psu.edu> wrote:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read length and
identify the range of read lengths for my 454 data. The data has already
been organized and sorted by species. The format of the data is as follows:
That was probably FASTA format (but mangled in the email).
I have attempted to use the "Summary Statistics" button,
however it appears
to only be for numerical data and not sequence data. Is this tool/task
available via Galaxy?
Use the "Compute sequence length" tool to compute the read lengths,
and then you should be able to compute some statistics about the lengths.
Peter
11:29 a.m.
New subject: Summary Statistics
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been divided into columns:
HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
2:40 p.m.
New subject: Summary Statistics
Hi,
"Summary Statistics" is ok, but before you need to use the tool 'Compute
sequence length'.
Ciao,
Bjoern
Am 23.05.2014 13:29, schrieb Dominique Cowart:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been divided into columns:
>HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
2:54 p.m.
New subject: Summary Statistics
Hi Dominique,
There are a few ways to do this.
If you have the data in fasta format in your history already, skip
converting to fasta-> tabular and just use that with the tool "FASTA
manipulation -> Compute sequence length". Then run the statistics tool
on the output.
Or, if this is the format you have to start with (tabular), the tool
"Text Manipulation -> Compute" can be used with the option
"length(c2)"
to generate the length of column 2. Adjust the "c2" portion as needed if
this is not your complete file or if you had to do extra manipulations
to isolate these columns (potentially skip those steps and use the
earlier file).
Thanks!
Jen
Galaxy team
ps. This mailing list has moved to _/Galaxy Biostar/_ and will be
closing soon. Please join us there! Here is how to get set up:
https://wiki.galaxyproject.org/Support/Biostar
On 5/23/14 4:29 AM, Dominique Cowart wrote:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been divided into columns:
>HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
3:04 p.m.
New subject: Summary Statistics
Hi Dominique,
I’d use the original fasta file and input it into the 'Fasta Manipulation > Compute
Sequence Length' tool
Then, using the output, run the 'Statistics > Summary Statistics for any numerical
column' tool on c2.
That will give you all the info you’re after.
Cheers,
Graham
Dr. Graham Etherington
Bioinformatics Support Officer,
The Sainsbury Laboratory,
Norwich Research Park,
Norwich NR4 7UH.
UK
Tel: +44 (0)1603 450601
Twitter: @bioinformatiks
From: Dominique Cowart <dac330@gmail.com<mailto:dac330@gmail.com>>
Date: Friday, 23 May 2014 12:29
To: "galaxy-user@bx.psu.edu<mailto:galaxy-user@bx.psu.edu>"
<galaxy-user@bx.psu.edu<mailto:galaxy-user@bx.psu.edu>>
Subject: [galaxy-user] Summary Statistics
Hello,
I am attempting to use Galaxy to calculate the mean sequence read length and identify the
range of read lengths for my 454 data. The data has already been divided into columns:
HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it appears to
only be for numerical data and not sequence data. Is this tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
2756
days inactive
3415
days old
galaxy-user@lists.galaxyproject.org
5 comments
6 participants
participants (6)
-
Björn Grüning -
D. A. Cowart -
Dominique Cowart -
graham etherington (TSL) -
Jennifer Jackson -
Peter Cock