Chandu, Are you running your analysis on our public server ( main.g2.bx.psu.edu )? If so, can you share your history me please (Options-->Share/Publish-->Share with a User-->my email address). Thanks, J. On Oct 11, 2011, at 4:26 PM, Chandu Galaxy wrote:
Thank you for the response. I can't check my reference genome dataset because I'm using reference provided by Galaxy (Mosquito (Anopheles gambiae): AgamP3). Is there any solution? Thank you.
-- Chandu
On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks <jeremy.goecks@emory.edu> wrote:
Tool execution generated the following error message: Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). No fasta index found for ./input1. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length! Chandu,
Cufflinks/compare/diff requires that your reference genome dataset have the following format:
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT ...
Note that all lines of sequence data have the same length.
The problem you're seeing is because there are lines in your sequence data that are not the same length, e.g.
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG ...
The FASTA Width tool in Galaxy can help you format your dataset correctly.
Good luck, J.