7 Mar
2012
7 Mar
'12
3:15 a.m.
Dear Galaxy I have a problem converting Interval to GFF. I used the tool BED-to-GFF<http://main.g2.bx.psu.edu/tool_runner?tool_id=bed2gff1>converter. My Interval file contains 18 coulmns: *chr1 33308998 33309020 + cel-let-7-5p 0 chr1 33308999 255 22M * 0 0 AGAGGAAGAAGGAAGAAAAGAA UGAGGUAGUAGGUUGUAUAGUU XA:i:0 MD:Z:22 NM:i:0* However my GFF output only contains 9, and it has removed the feature "* cel-let-7-5p":* chr1 bed2gff region_0 33308999 33309020 0 + . region_0; Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this? Best Robin