Hello!
I am fairly new to using Galaxy and have a question about the FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just recently generated from Illumina's NGS instruments. I am aware that the first step to perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the "Input FASTQ quality scores type" box. However, if I look at the raw data reads, I notice that Line 4 (which encodes the quality values for sequence in Line 2) has values outside of the Illumina 1.3+ range (some of them fall into the Sanger format. I am enclosing the Quality Score Comparison figure along with some of the raw RNA-Seq data): Quality Score Comparison SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[]^_`abcdefghijklmnopqrstuvwxyz{|}~ | | | | | | 33 59 64 73 104 126
S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads) I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads) X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads) Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format RNA-Seq raw data
@HWI-ST156_294:7:1:1058:2165:0/1
CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC
+
HHHHFGGHHHGFHHFHHEGHC<GGGEB.EE9D?DDEEEE4FFFCBB/.C=D
@HWI-ST156_294:7:1:1184:2191:0/1
CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG
+
EE;E=ECEEBE@EEEE=GBFGF/GFFC<FA;:@<8AEABB>A#########
@HWI-ST156_294:7:1:1018:2200:0/1
NCTGATTAAGGATAATGAGTTTTTAGTAGAACTAATGATGTTATTCCTTGG
+
###################################################
@HWI-ST156_294:7:1:1225:2217:0/1
GTTTTTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA
+
FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?############
As a test in FASTQ Groomer, I chose either the Sanger or Illumina 1.3+ as the input quality scores type and these are the results I got:
FASTQ Groomer on tn-read1 (using Sanger as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: 2 - 40
FASTQ Groomer on tn-read1 (using Illumina1.3+ as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: -29 - 9
Which one is right (I presume the Illumina 1.3+ one, but I can't find any sort of explanation)? I noticed that the "input decimal range" had different values (although they spanned the same length) in relation to which input was chosen. What would happen downstream in TopHat if Sanger was used instead of Illumina 1.3+ for these files? Is there any other reading material/websites/etc... out there that might help me better understand the quality score and which to use? Any info/help would be greatly appreciated.
Thanks, David
David K. Crossman, Ph.D. Systems Biologist/Analyst/Statistician Heflin Center for Genomic Science University of Alabama at Birmingham 720 20th Street South Kaul Room 420 Birmingham, AL 35294-0024 (205) 996-4045 (205) 996-4056 (fax) David K. Crossman, Ph.D.mailto:dkcrossm@uab.edu Heflin Center for Genomic Sciencehttp://www.heflingenetics.uab.edu/