Hi Dominique, I’d use the original fasta file and input it into the 'Fasta Manipulation > Compute Sequence Length' tool Then, using the output, run the 'Statistics > Summary Statistics for any numerical column' tool on c2. That will give you all the info you’re after. Cheers, Graham Dr. Graham Etherington Bioinformatics Support Officer, The Sainsbury Laboratory, Norwich Research Park, Norwich NR4 7UH. UK Tel: +44 (0)1603 450601 Twitter: @bioinformatiks From: Dominique Cowart <dac330@gmail.com<mailto:dac330@gmail.com>> Date: Friday, 23 May 2014 12:29 To: "galaxy-user@bx.psu.edu<mailto:galaxy-user@bx.psu.edu>" <galaxy-user@bx.psu.edu<mailto:galaxy-user@bx.psu.edu>> Subject: [galaxy-user] Summary Statistics Hello, I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been divided into columns:
HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy? Thank you in advance, Dominique Cowart