Problem with Cuffcompare
Hello, I'm using Galaxy tool from about two months. I'm very new to this community. I ran into some problems when using the tools for NGS: RNA Analysis. I would like to get from the community. Here is the description of the problem. I've four different datasets (fastqsanger format). I ran the NGS: RNA Analysis tools like "Tophat for Illumina", "Cufflinks", "Cuffcompare". The Tophat and cufflinks tools are working fine but the cuffcompare is giveing out an error message like the below. Dataset generation errors *Dataset 57: Cuffcompare on data 20, data 23, and others: combined transcripts* Tool execution generated the following error message: Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). No fasta index found for ./input1. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length! The tool produced the following additional output: cuffcompare v1.0.3 (2403) cuffcompare -o cc_output -s ./input1 ./input2 ./input3 ./input4 Can anyone help me to figure out what the problem is? Let me know if you need more information. Thank you. -- Chandrasekhar
Tool execution generated the following error message: Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). No fasta index found for ./input1. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length! Chandu,
Cufflinks/compare/diff requires that your reference genome dataset have the following format:
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT ...
Note that all lines of sequence data have the same length. The problem you're seeing is because there are lines in your sequence data that are not the same length, e.g.
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG ...
The FASTA Width tool in Galaxy can help you format your dataset correctly. Good luck, J.
Thank you for the response. I can't check my reference genome dataset because I'm using reference provided by Galaxy (*Mosquito (Anopheles gambiae): AgamP3*). Is there any solution? Thank you. -- Chandu On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks <jeremy.goecks@emory.edu>wrote:
Tool execution generated the following error message:
Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). No fasta index found for ./input1. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length!
Chandu,
Cufflinks/compare/diff requires that your reference genome dataset have the following format:
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT ...
Note that all lines of sequence data have the same length.
The problem you're seeing is because there are lines in your sequence data that are not the same length, e.g.
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG ...
The FASTA Width tool in Galaxy can help you format your dataset correctly.
Good luck, J.
Chandu, Are you running your analysis on our public server ( main.g2.bx.psu.edu )? If so, can you share your history me please (Options-->Share/Publish-->Share with a User-->my email address). Thanks, J. On Oct 11, 2011, at 4:26 PM, Chandu Galaxy wrote:
Thank you for the response. I can't check my reference genome dataset because I'm using reference provided by Galaxy (Mosquito (Anopheles gambiae): AgamP3). Is there any solution? Thank you.
-- Chandu
On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks <jeremy.goecks@emory.edu> wrote:
Tool execution generated the following error message: Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). No fasta index found for ./input1. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length! Chandu,
Cufflinks/compare/diff requires that your reference genome dataset have the following format:
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT ...
Note that all lines of sequence data have the same length.
The problem you're seeing is because there are lines in your sequence data that are not the same length, e.g.
my_chrom AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG ...
The FASTA Width tool in Galaxy can help you format your dataset correctly.
Good luck, J.
participants (2)
-
Chandu Galaxy -
Jeremy Goecks