August 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2597: Better naming for collected datasets in JobToO...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ab5f39f838c0 changeset: 2597:ab5f39f838c0 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Fri Aug 21 17:14:35 2009 -0400 description: Better naming for collected datasets in JobToOutputDatasetAssociation 1 file(s) affected in this change: lib/galaxy/tools/__init__.py diffs (21 lines): diff -r b77721ef035d -r ab5f39f838c0 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Fri Aug 21 17:03:42 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Fri Aug 21 17:14:35 2009 -0400 @@ -1543,7 +1543,7 @@ job = assoc.job break if job: - assoc = self.app.model.JobToOutputDatasetAssociation( '__new_child_file_%s__' % designation, child_dataset ) + assoc = self.app.model.JobToOutputDatasetAssociation( '__new_child_file_%s|%s__' % ( name, designation ), child_dataset ) assoc.job = job assoc.flush() child_dataset.state = outdata.state @@ -1594,7 +1594,7 @@ job = assoc.job break if job: - assoc = self.app.model.JobToOutputDatasetAssociation( '__new_primary_file_%s__' % designation, primary_data ) + assoc = self.app.model.JobToOutputDatasetAssociation( '__new_primary_file_%s|%s__' % ( name, designation ), primary_data ) assoc.job = job assoc.flush() primary_data.state = outdata.state

1 0

[hg] galaxy 2598: Merge trunk
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3049432643f4 changeset: 2598:3049432643f4 user: Kanwei Li <kanwei(a)gmail.com> date: Wed Aug 19 17:55:28 2009 -0400 description: Merge trunk 2 file(s) affected in this change: templates/history/shared_grid.mako templates/history/stored_grid.mako diffs (1946 lines): diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/coverage.py --- a/lib/galaxy/datatypes/coverage.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/datatypes/coverage.py Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sys, time, sets, tempfile +import logging, os, sys, time, tempfile from galaxy import util from galaxy.util.odict import odict from galaxy.util.bunch import Bunch diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Wed Aug 19 17:55:28 2009 -0400 @@ -12,7 +12,7 @@ august 20 2007 """ -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from cgi import escape diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/datatypes/interval.py Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/model/__init__.py Wed Aug 19 17:55:28 2009 -0400 @@ -5,8 +5,7 @@ the relationship cardinalities are obvious (e.g. prefer Dataset to Data) """ -import os.path, os, errno -import sha +import os.path, os, errno, sys import galaxy.datatypes from galaxy.util.bunch import Bunch from galaxy import util @@ -14,8 +13,7 @@ import galaxy.datatypes.registry from galaxy.datatypes.metadata import MetadataCollection from galaxy.security import RBACAgent, get_permitted_actions - - +from galaxy.util.hash_util import * import logging log = logging.getLogger( __name__ ) @@ -40,10 +38,10 @@ def set_password_cleartext( self, cleartext ): """Set 'self.password' to the digest of 'cleartext'.""" - self.password = sha.new( cleartext ).hexdigest() + self.password = new_secure_hash( text_type=cleartext ) def check_password( self, cleartext ): """Check if 'cleartext' matches 'self.password' when hashed.""" - return self.password == sha.new( cleartext ).hexdigest() + return self.password == new_secure_hash( text_type=cleartext ) def all_roles( self ): roles = [ ura.role for ura in self.roles ] for group in [ uga.group for uga in self.groups ]: diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,15 +1,13 @@ """ Classes encapsulating galaxy tools and tool configuration. """ - import pkg_resources; pkg_resources.require( "simplejson" ) import logging, os, string, sys, tempfile, glob, shutil import simplejson -import sha, hmac, binascii - +import binascii from UserDict import DictMixin from galaxy.util.odict import odict from galaxy.util.bunch import Bunch @@ -26,6 +24,7 @@ from galaxy.util.none_like import NoneDataset from galaxy.datatypes import sniff from cgi import FieldStorage +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -211,7 +210,7 @@ value["__page__"] = self.page value = simplejson.dumps( value ) # Make it secure - a = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + a = hmac_new( app.config.tool_secret, value ) b = binascii.hexlify( value ) return "%s:%s" % ( a, b ) def decode( self, value, tool, app ): @@ -221,7 +220,7 @@ # Extract and verify hash a, b = value.split( ":" ) value = binascii.unhexlify( b ) - test = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + test = hmac_new( app.config.tool_secret, value ) assert a == test # Restore from string values = json_fix( simplejson.loads( value ) ) @@ -453,7 +452,6 @@ self.tests = None # Determine if this tool can be used in workflows self.is_workflow_compatible = self.check_workflow_compatible() - def parse_inputs( self, root ): """ diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/util/hash_util.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/util/hash_util.py Wed Aug 19 17:55:28 2009 -0400 @@ -0,0 +1,28 @@ +import sys, logging +using_24 = sys.version_info[:2] < ( 2, 5 ) +if using_24: + import sha +else: + import hashlib +import hmac + +log = logging.getLogger( __name__ ) + +""" +Utility functions for bi-directional Python version compatibility. Python 2.5 +introduced hashlib which replaced sha in Python 2.4 and previous versions. +""" +def new_secure_hash( text_type=None ): + if using_24: + if text_type: + return sha.new( text_type ).hexdigest() + return sha.new() + else: + if text_type: + return hashlib.sha1( text_type ).hexdigest() + return hashlib.sha1() +def hmac_new( key, value ): + if using_24: + return hmac.new( key, value, sha ).hexdigest() + else: + return hmac.new( key, value, hashlib.sha1 ).hexdigest() diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,9 +1,14 @@ -import shutil, StringIO, operator, urllib, gzip, tempfile, sets, string, sys +import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys from datetime import datetime, timedelta from galaxy import util, datatypes from galaxy.web.base.controller import * from galaxy.model.orm import * from galaxy.web.controllers.forms import get_all_forms, get_form_widgets +# Older py compatibility +try: + set() +except: + from sets import Set as set import logging log = logging.getLogger( __name__ ) @@ -1236,16 +1241,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): @@ -1421,16 +1426,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/async.py --- a/lib/galaxy/web/controllers/async.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/async.py Wed Aug 19 17:55:28 2009 -0400 @@ -6,8 +6,8 @@ from galaxy import jobs, util, datatypes, web -import logging, urllib -import sha, hmac +import logging, urllib, sys +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -58,7 +58,7 @@ return "Data %s does not exist or has already been deleted" % data_id if STATUS == 'OK': - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) if key != data_secret: return "You do not have permission to alter data %s." % data_id # push the job into the queue @@ -116,7 +116,7 @@ trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id ) try: - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key ) params.update( { 'GALAXY_URL' :galaxy_url } ) params.update( { 'data_id' :data.id } ) diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sets, string, shutil, re, socket, mimetypes, smtplib, urllib +import logging, os, string, shutil, re, socket, mimetypes, smtplib, urllib from galaxy.web.base.controller import * from galaxy import util, datatypes, jobs, web, model diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/genetrack.py --- a/lib/galaxy/web/controllers/genetrack.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/genetrack.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,11 +1,10 @@ -import time, glob, os +import time, glob, os, sys from itertools import cycle -import sha - from mako import exceptions from mako.template import Template from mako.lookup import TemplateLookup from galaxy.web.base.controller import * +from galaxy.util.hash_util import * try: import pkg_resources @@ -265,7 +264,7 @@ tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot] # check against a hash, display an image that already exists if it was previously created. - hash = sha.new() + hash = new_secure_hash() hash.update(str(dataset_id)) for key in sorted(kwds.keys()): hash.update(str(kwds[key])) diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Wed Aug 19 17:55:28 2009 -0400 @@ -161,7 +161,7 @@ status, message = self._list_undelete( trans, histories ) trans.sa_session.flush() # Render the list view - return self.stored_list_grid( trans, status=status, message=message, template='/history/stored_grid.mako', **kwargs ) + return self.stored_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) def _list_delete( self, trans, histories ): """Delete histories""" n_deleted = 0 @@ -239,14 +239,14 @@ if operation == "clone": if not id: message = "Select a history to clone" - return self.shared_list_grid( trans, status='error', message=message, template='/history/shared_grid.mako', **kwargs ) + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) # When cloning shared histories, only copy active datasets new_kwargs = { 'clone_choice' : 'active' } return self.clone( trans, id, **new_kwargs ) elif operation == 'unshare': if not id: message = "Select a history to unshare" - return self.shared_list_grid( trans, status='error', message=message, template='/history/shared_grid.mako', **kwargs ) + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) ids = util.listify( id ) histories = [] for history_id in ids: @@ -260,7 +260,7 @@ message = "Unshared %d shared histories" % len( ids ) status = 'done' # Render the list view - return self.shared_list_grid( trans, status=status, message=message, template='/history/shared_grid.mako', **kwargs ) + return self.shared_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) @web.expose def delete_current( self, trans ): """Delete just the active history -- this does not require a logged in user.""" diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Wed Aug 19 17:55:28 2009 -0400 @@ -152,16 +152,12 @@ helptext='')) # library associated if request.library: - request_details.append(dict(label='Library', - value=request.library.name, - helptext='Associated library where the resultant \ - dataset will be stored')) + value = request.library.name else: - request_details.append(dict(label='Library', - value=None, - helptext='Associated library where the resultant \ - dataset will be stored')) - + value = None + request_details.append( dict( label='Data library', + value=value, + helptext='Data library where the resultant dataset will be stored' ) ) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: @@ -492,18 +488,17 @@ else: lib_list.add_option(lib.name, lib.id) if lib_id == 'new': - lib_list.add_option('Create a new library', 'new', selected=True) + lib_list.add_option('Create a new data library', 'new', selected=True) else: - lib_list.add_option('Create a new library', 'new') - widget = dict(label='Library', + lib_list.add_option('Create a new data library', 'new') + widget = dict(label='Data library', widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored.') + helptext='Data library where the resultant dataset will be stored.') if lib_id == 'new': - new_lib = dict(label='Create a new Library', + new_lib = dict(label='Create a new data library', widget=TextField('new_library_name', 40, util.restore_text( params.get( 'new_library_name', '' ) )), - helptext='Enter a library name here to request a new library') + helptext='Enter a name here to request a new data library') return [widget, new_lib] else: return [widget] @@ -558,7 +553,7 @@ ''' empty_fields = [] if not request.library: - empty_fields.append('Library') + empty_fields.append('Data library') # check rest of the fields of the form for index, field in enumerate(request.type.request_form.fields): if field['required'] == 'required' and request.values.content[index] in ['', None]: diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Wed Aug 19 17:55:28 2009 -0400 @@ -144,10 +144,9 @@ value=str(request.user.email), helptext='')) # library associated - request_details.append(dict(label='Library', + request_details.append(dict(label='Data library', value=trans.app.model.Library.get(request.library_id).name, - helptext='Associated library where the resultant \ - dataset will be stored')) + helptext='Data library where the resultant dataset will be stored')) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,7 +1,7 @@ """ Contains the main interface in the Universe class """ -import logging, os, sets, string, shutil, urllib, re, socket +import logging, os, string, shutil, urllib, re, socket from cgi import escape, FieldStorage from galaxy import util, datatypes, jobs, web, util from galaxy.web.base.controller import * @@ -60,7 +60,6 @@ trans.response.set_content_type('text/xml') return trans.fill_template_mako( "root/history_as_xml.mako", history=history, show_deleted=util.string_as_bool( show_deleted ) ) else: - template = "root/history.mako" show_deleted = util.string_as_bool( show_deleted ) query = trans.sa_session.query( model.HistoryDatasetAssociation ) \ .filter( model.HistoryDatasetAssociation.history == history ) \ diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/tool_runner.py --- a/lib/galaxy/web/controllers/tool_runner.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/controllers/tool_runner.py Wed Aug 19 17:55:28 2009 -0400 @@ -117,7 +117,6 @@ tool_state_string = util.object_to_string(state.encode(tool, trans.app)) # Setup context for template history = trans.get_history() - template = "tool_form.mako" vars = dict( tool_state=state, errors = {} ) # Is the "add frame" stuff neccesary here? add_frame = AddFrameData() @@ -125,17 +124,13 @@ if from_noframe is not None: add_frame.wiki_url = trans.app.config.wiki_url add_frame.from_noframe = True - return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) - - + return trans.fill_template( "tool_form.mako", history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) @web.expose def redirect( self, trans, redirect_url=None, **kwd ): if not redirect_url: return trans.show_error_message( "Required URL for redirection missing" ) trans.log_event( "Redirecting to: %s" % redirect_url ) return trans.fill_template( 'root/redirect.mako', redirect_url=redirect_url ) - - @web.json def upload_async_create( self, trans, tool_id=None, **kwd ): """ diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Wed Aug 19 17:55:28 2009 -0400 @@ -93,8 +93,8 @@ """ Exception to make throwing errors from deep in controllers easier """ - def __init__( self, message, type="info" ): - self.message = message + def __init__( self, err_msg, type="info" ): + self.err_msg = err_msg self.type = type def error( message ): @@ -117,7 +117,7 @@ self.security = galaxy_app.security def handle_controller_exception( self, e, trans, **kwargs ): if isinstance( e, MessageException ): - return trans.show_message( e.message, e.type ) + return trans.show_message( e.err_msg, e.type ) def make_body_iterable( self, trans, body ): if isinstance( body, FormBuilder ): body = trans.show_form( body ) diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/webapps/reports/controllers/root.py --- a/lib/galaxy/webapps/reports/controllers/root.py Wed Aug 19 17:27:00 2009 -0400 +++ b/lib/galaxy/webapps/reports/controllers/root.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,8 +1,8 @@ -import sys, os, operator, sets, string, shutil, re, socket, urllib +import sys, os, operator, string, shutil, re, socket, urllib, time from galaxy import web from cgi import escape, FieldStorage from galaxy.webapps.reports.base.controller import * -import logging, sets, time +import logging log = logging.getLogger( __name__ ) class Report( BaseController ): diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/center.mako --- a/templates/admin/center.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/center.mako Wed Aug 19 17:55:28 2009 -0400 @@ -17,7 +17,7 @@ <li> <strong>Manage groups</strong> - provides a view of all groups along with the members of the group and the roles associated with each group (both private and non-private roles). Non-private roles include a link to a page that allows you to manage the users - and groups that are associated with the role. The page also includes a view of the library datasets that are associated with the + and groups that are associated with the role. The page also includes a view of the data library datasets that are associated with the role and the permissions applied to each dataset. </li> <p/> @@ -32,9 +32,9 @@ <p/> <ul> <li> - <strong>Manage libraries</strong> - Dataset libraries enable a Galaxy administrator to upload datasets into a library. Currently, - only administrators can create dataset libraries, but permission to perform the following functions on the library can be granted to - users (a library item is one of: a library, a library folder, a library dataset). + <strong>Manage data libraries</strong> - Data libraries enable a Galaxy administrator to upload datasets into a data library. Currently, + only administrators can create data libraries, but permission to perform the following functions on the data library can be granted to + users (a library item is one of: a data library, a library folder, a library dataset). <p/> <ul> <li><strong>add library item</strong> - Role members can add library items to this library or folder</li> @@ -42,12 +42,12 @@ <li><strong>manage library permissions</strong> - Role members can manage permissions applied to this library item</li> </ul> <p/> - The default behavior is for no permissions to be applied to a library item, but applied permissions are inherited downward, so it is - important to set desired permissions on a new library when it is created. When this is done, new folders and datasets added to the - library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be + The default behavior is for no permissions to be applied to a data library item, but applied permissions are inherited downward, so it is + important to set desired permissions on a new data library when it is created. When this is done, new folders and datasets added to the + data library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be automatically inherited by all contained datasets and sub-folders. <p/> - The "Libraries" menu item allows users to access the datasets in a library as long as they are not restricted from accessing them. + The "Data Libraries" menu item allows users to access the datasets in a data library as long as they are not restricted from accessing them. Importing a library dataset into a history will not make a copy of the dataset, but will be a "pointer" to the dataset on disk. This approach allows for multiple users to use a single (possibly very large) dataset file. </li> @@ -72,7 +72,7 @@ </ul> </li> </ul> -<p><strong>Data Security and Dataset Libraries</strong></p> +<p><strong>Data Security and Data Libraries</strong></p> <p/> <strong>Security</strong> - Data security in Galaxy is a new feature, so familiarize yourself with the details which can be found here or in our <a href="http://g2.trac.bx.psu.edu/wiki/SecurityFeatures" target="_blank">data security page</a>. The data security @@ -121,8 +121,8 @@ <strong>access</strong> - users associated with the role can import this dataset into their history for analysis. <p> If no roles with the "access" permission are associated with a dataset, the dataset is "public" and may be accessed by - anyone. Public library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) - from the list of libraries displayed when the "Libraries" menu item is selected. + anyone. Public data library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) + from the list of data libraries displayed when the "Data Libraries" menu item is selected. </p> <p> Associating a dataset with a role that includes the "access" permission restricts the set of users that can access it. diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/dataset_security/role.mako --- a/templates/admin/dataset_security/role.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/dataset_security/role.mako Wed Aug 19 17:55:28 2009 -0400 @@ -84,7 +84,7 @@ <br clear="left"/> <br/> %if len( library_dataset_actions ) > 0: - <h3>Library datasets associated with role '${role.name}'</h3> + <h3>Data library datasets associated with role '${role.name}'</h3> <table class="manage-table colored" border="0" cellspacing="0" cellpadding="0" width="100%"> <tr> <td> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/index.mako --- a/templates/admin/index.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/index.mako Wed Aug 19 17:55:28 2009 -0400 @@ -89,7 +89,7 @@ </div> <div class="toolSectionBody"> <div class="toolSectionBg"> - <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage libraries</a></div> + <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div> </div> </div> <div class="toolSectionPad"></div> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/browse_libraries.mako --- a/templates/admin/library/browse_libraries.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/browse_libraries.mako Wed Aug 19 17:55:28 2009 -0400 @@ -1,19 +1,19 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<%def name="title()">Browse Libraries</%def> +<%def name="title()">Browse Data Libraries</%def> <h2> %if deleted: Deleted %endif - Libraries + Data Libraries </h2> <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a> </li> <li> <a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/browse_library.mako Wed Aug 19 17:55:28 2009 -0400 @@ -162,16 +162,16 @@ %if deleted: Deleted %endif - Library '${library.name}' + Data Library “${library.name}” </h2> <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a> </li> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a> + <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a> </li> %endif </ul> @@ -200,24 +200,24 @@ library_item_ids = {} library_item_ids[ 'library' ] = library.id %> - <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this library's information</a> + <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a> ## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition ##%if library.info_association: ## <% form_id = library.info_association[0].template.id %> - ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this library's information template</a> + ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this data library's information template</a> ##%else: %if not library.info_association: - <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a> + <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a> %endif - <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this library's permissions</a> - <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this library and its contents</a> + <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a> + <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a> %if show_deleted: - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted library items</a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a> %else: - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted library items</a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a> %endif %elif not library.purged: - <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this library</a> + <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a> %endif </div> </th> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/folder_info.mako --- a/templates/admin/library/folder_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/folder_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/folder_permissions.mako --- a/templates/admin/library/folder_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/folder_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_edit_info.mako --- a/templates/admin/library/ldda_edit_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/ldda_edit_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -12,7 +12,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_info.mako --- a/templates/admin/library/ldda_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/ldda_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -20,7 +20,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_permissions.mako --- a/templates/admin/library/ldda_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/ldda_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -15,7 +15,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_dataset_info.mako --- a/templates/admin/library/library_dataset_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/library_dataset_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_dataset_permissions.mako --- a/templates/admin/library/library_dataset_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/library_dataset_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_info.mako --- a/templates/admin/library/library_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/library_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_permissions.mako --- a/templates/admin/library/library_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/library_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_dataset.mako --- a/templates/admin/library/new_dataset.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/new_dataset.mako Wed Aug 19 17:55:28 2009 -0400 @@ -4,7 +4,7 @@ <% import os, os.path %> -<b>Create new library datasets</b> +<b>Create new data library datasets</b> <a id="upload-librarydataset--popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="upload-librarydataset--popup"> <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a> @@ -16,7 +16,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -142,7 +142,7 @@ <textarea name="message" rows="3" cols="35"></textarea> </div> <div class="toolParamHelp" style="clear: both;"> - This information will be displayed in the "Information" column for this dataset in the library browser + This information will be displayed in the "Information" column for this dataset in the data library browser </div> <div style="clear: both"></div> </div> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_folder.mako --- a/templates/admin/library/new_folder.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/new_folder.mako Wed Aug 19 17:55:28 2009 -0400 @@ -4,7 +4,7 @@ <br/<br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_library.mako --- a/templates/admin/library/new_library.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/new_library.mako Wed Aug 19 17:55:28 2009 -0400 @@ -6,13 +6,13 @@ %endif <div class="toolForm"> - <div class="toolFormTitle">Create a new library</div> + <div class="toolFormTitle">Create a new data library</div> <div class="toolFormBody"> <form name="library" action="${h.url_for( controller='admin', action='library' )}" method="post" > <div class="form-row"> <label>Name:</label> <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="text" name="name" value="New Library" size="40"/> + <input type="text" name="name" value="New data library" size="40"/> </div> <div style="clear: both"></div> </div> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/select_info_template.mako --- a/templates/admin/library/select_info_template.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/library/select_info_template.mako Wed Aug 19 17:55:28 2009 -0400 @@ -4,7 +4,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/admin/requests/show_request.mako Wed Aug 19 17:55:28 2009 -0400 @@ -48,7 +48,7 @@ %if not rd['value']: <i>None</i> %else: - %if rd['label'] == 'Library': + %if rd['label'] == 'Data library': <a href="${h.url_for( controller='admin', action='browse_library', id=request.library.id )}">${rd['value']}</a> %else: ${rd['value']} diff -r ea6708c96cd1 -r 3049432643f4 templates/base_panels.mako --- a/templates/base_panels.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/base_panels.mako Wed Aug 19 17:55:28 2009 -0400 @@ -139,14 +139,14 @@ ${tab( "workflow", "Workflow", h.url_for( controller='workflow', action='index' ))} - ${tab( "libraries", "Libraries", h.url_for( controller='library', action='index' ))} + ${tab( "libraries", "Data Libraries", h.url_for( controller='library', action='index' ))} %if trans.request_types(): <td class="tab"> <a>Lab</a> <div class="submenu"> <ul> - <li><a target="requests" href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li> + <li><a href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li> </ul> </div> </td> diff -r ea6708c96cd1 -r 3049432643f4 templates/history/grid.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/history/grid.mako Wed Aug 19 17:55:28 2009 -0400 @@ -0,0 +1,196 @@ +<%inherit file="/base.mako"/> +<%def name="title()">${grid.title}</%def> + +%if message: + <p> + <div class="${message_type}message transient-message">${message}</div> + <div style="clear: both"></div> + </p> +%endif + +<%def name="javascripts()"> + ${parent.javascripts()} + <script type="text/javascript"> + ## TODO: generalize and move into galaxy.base.js + $(document).ready(function() { + $(".grid").each( function() { + var grid = this; + var checkboxes = $(this).find("input.grid-row-select-checkbox"); + var update = $(this).find( "span.grid-selected-count" ); + $(checkboxes).each( function() { + $(this).change( function() { + var n = $(checkboxes).filter("[checked]").size(); + update.text( n ); + }); + }) + }); + }); + ## Can this be moved into base.mako? + %if refresh_frames: + %if 'masthead' in refresh_frames: + ## Refresh masthead == user changes (backward compatibility) + if ( parent.user_changed ) { + %if trans.user: + parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} ); + %else: + parent.user_changed( null, false ); + %endif + } + %endif + %if 'history' in refresh_frames: + if ( parent.frames && parent.frames.galaxy_history ) { + parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}"; + if ( parent.force_right_panel ) { + parent.force_right_panel( 'show' ); + } + } + %endif + %if 'tools' in refresh_frames: + if ( parent.frames && parent.frames.galaxy_tools ) { + parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}"; + if ( parent.force_left_panel ) { + parent.force_left_panel( 'show' ); + } + } + %endif + %endif + </script> +</%def> + +<%def name="stylesheets()"> + <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> + <style> + ## Not generic to all grids -- move to base? + .count-box { + min-width: 1.1em; + padding: 5px; + border-width: 1px; + border-style: solid; + text-align: center; + display: inline-block; + } + </style> +</%def> + +%if grid.standard_filters: + <div class="grid-header"> + <h2>${grid.title}</h2> + <span class="title">Filter:</span> + %for i, filter in enumerate( grid.standard_filters ): + %if i > 0: + <span>|</span> + %endif + <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span> + %endfor + </div> +%endif + +<form name="history_actions" action="${url()}" method="post" > + <table class="grid"> + <thead> + <tr> + <th></th> + %for column in grid.columns: + %if column.visible: + <% + href = "" + extra = "" + if column.sortable: + if sort_key == column.key: + if sort_order == "asc": + href = url( sort=( "-" + column.key ) ) + extra = "↓" + else: + href = url( sort=( column.key ) ) + extra = "↑" + else: + href = url( sort=column.key ) + %> + <th\ + %if column.ncells > 1: + colspan="${column.ncells}" + %endif + > + %if href: + <a href="${href}">${column.label}</a> + %else: + ${column.label} + %endif + <span>${extra}</span> + </th> + %endif + %endfor + <th></th> + </tr> + </thead> + <tbody> + %for i, item in enumerate( query ): + <tr \ + %if current_item == item: + class="current" \ + %endif + > + ## Item selection column + <td style="width: 1.5em;"> + <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" /> + </td> + ## Data columns + %for column in grid.columns: + %if column.visible: + <% + # Link + link = column.get_link( trans, grid, item ) + if link: + href = url( **link ) + else: + href = None + # Value (coerced to list so we can loop) + value = column.get_value( trans, grid, item ) + if column.ncells == 1: + value = [ value ] + %> + %for cellnum, v in enumerate( value ): + <% + # Attach popup menu? + if column.attach_popup and cellnum == 0: + extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i + else: + extra = "" + %> + %if href: + <td><a href="${href}">${v}</a> ${extra}</td> + %else: + <td >${v}${extra}</td> + %endif + </td> + %endfor + %endif + %endfor + ## Actions column + <td> + <div popupmenu="grid-${i}-popup"> + %for operation in grid.operations: + %if operation.allowed( item ): + <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %endif + %endfor + </div> + </td> + </tr> + %endfor + </tbody> + <tfoot> + <tr> + <td></td> + <td colspan="100"> + For <span class="grid-selected-count"></span> selected histories: + %for operation in grid.operations: + %if operation.allow_multiple: + <input type="submit" name="operation" value="${operation.label}" class="action-button"> + %endif + %endfor + </td> + </tr> + </tfoot> + </table> +</form> diff -r ea6708c96cd1 -r 3049432643f4 templates/history/shared_grid.mako --- a/templates/history/shared_grid.mako Wed Aug 19 17:27:00 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,197 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - -<%def name="title()">${grid.title}</%def> - -<%def name="javascripts()"> - ${parent.javascripts()} - <script type="text/javascript"> - ## TODO: generalize and move into galaxy.base.js - $(document).ready(function() { - $(".grid").each( function() { - var grid = this; - var checkboxes = $(this).find("input.grid-row-select-checkbox"); - var update = $(this).find( "span.grid-selected-count" ); - $(checkboxes).each( function() { - $(this).change( function() { - var n = $(checkboxes).filter("[checked]").size(); - update.text( n ); - }); - }) - }); - }); - ## Can this be moved into base.mako? - %if refresh_frames: - %if 'masthead' in refresh_frames: - ## Refresh masthead == user changes (backward compatibility) - if ( parent.user_changed ) { - %if trans.user: - parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} ); - %else: - parent.user_changed( null, false ); - %endif - } - %endif - %if 'history' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_history ) { - parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}"; - if ( parent.force_right_panel ) { - parent.force_right_panel( 'show' ); - } - } - %endif - %if 'tools' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_tools ) { - parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}"; - if ( parent.force_left_panel ) { - parent.force_left_panel( 'show' ); - } - } - %endif - %endif - </script> -</%def> - -<%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> - <style> - ## Not generic to all grids -- move to base? - .count-box { - min-width: 1.1em; - padding: 5px; - border-width: 1px; - border-style: solid; - text-align: center; - display: inline-block; - } - </style> -</%def> - -%if grid.standard_filters: - <div class="grid-header"> - <h2>${grid.title}</h2> - <span class="title">Filter:</span> - %for i, filter in enumerate( grid.standard_filters ): - %if i > 0: - <span>|</span> - %endif - <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span> - %endfor - </div> -%endif - -%if message: - <p> - <div class="${message_type}message transient-message">${message}</div> - <div style="clear: both"></div> - </p> -%endif -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<form name="history_shared_by_others" action="${url()}" method="post" > - <table class="grid"> - <thead> - <tr> - <th></th> - %for column in grid.columns: - %if column.visible: - <% - href = "" - extra = "" - if column.sortable: - if sort_key == column.key: - if sort_order == "asc": - href = url( sort=( "-" + column.key ) ) - extra = "↓" - else: - href = url( sort=( column.key ) ) - extra = "↑" - else: - href = url( sort=column.key ) - %> - <th\ - %if column.ncells > 1: - colspan="${column.ncells}" - %endif - > - %if href: - <a href="${href}">${column.label}</a> - %else: - ${column.label} - %endif - <span>${extra}</span> - </th> - %endif - %endfor - <th></th> - </tr> - </thead> - <tbody> - %for i, history in enumerate( query ): - <tr> - ## Item selection column - <td style="width: 1.5em;"> - <input type="checkbox" name="id" value=${trans.security.encode_id( history.id )} class="grid-row-select-checkbox" /> - </td> - ## Data columns - %for column in grid.columns: - %if column.visible: - <% - # Link - link = column.get_link( trans, grid, history ) - if link: - href = url( **link ) - else: - href = None - # Value (coerced to list so we can loop) - value = column.get_value( trans, grid, history ) - if column.ncells == 1: - value = [ value ] - %> - %for cellnum, v in enumerate( value ): - <% - # Attach popup menu? - if column.attach_popup and cellnum == 0: - extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i - else: - extra = "" - %> - %if href: - <td><a href="${href}">${v}</a> ${extra}</td> - %else: - <td >${v}${extra}</td> - %endif - </td> - %endfor - %endif - %endfor - ## Actions column - <td> - <div popupmenu="grid-${i}-popup"> - %for operation in grid.operations: - %if operation.allowed( history ): - <a class="action-button" href="${url( operation=operation.label, id=history.id )}">${operation.label}</a> - %endif - %endfor - </div> - </td> - </tr> - %endfor - </tbody> - <tfoot> - <tr> - <td></td> - <td colspan="100"> - For <span class="grid-selected-count"></span> selected histories: - %for operation in grid.operations: - %if operation.allow_multiple: - <input type="submit" name="operation" value="${operation.label}" class="action-button"> - %endif - %endfor - </td> - </tr> - </tfoot> - </table> -</form> diff -r ea6708c96cd1 -r 3049432643f4 templates/history/stored_grid.mako --- a/templates/history/stored_grid.mako Wed Aug 19 17:27:00 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,196 +0,0 @@ -<%inherit file="/base.mako"/> -<%def name="title()">${grid.title}</%def> - -%if message: - <p> - <div class="${message_type}message transient-message">${message}</div> - <div style="clear: both"></div> - </p> -%endif - -<%def name="javascripts()"> - ${parent.javascripts()} - <script type="text/javascript"> - ## TODO: generalize and move into galaxy.base.js - $(document).ready(function() { - $(".grid").each( function() { - var grid = this; - var checkboxes = $(this).find("input.grid-row-select-checkbox"); - var update = $(this).find( "span.grid-selected-count" ); - $(checkboxes).each( function() { - $(this).change( function() { - var n = $(checkboxes).filter("[checked]").size(); - update.text( n ); - }); - }) - }); - }); - ## Can this be moved into base.mako? - %if refresh_frames: - %if 'masthead' in refresh_frames: - ## Refresh masthead == user changes (backward compatibility) - if ( parent.user_changed ) { - %if trans.user: - parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} ); - %else: - parent.user_changed( null, false ); - %endif - } - %endif - %if 'history' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_history ) { - parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}"; - if ( parent.force_right_panel ) { - parent.force_right_panel( 'show' ); - } - } - %endif - %if 'tools' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_tools ) { - parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}"; - if ( parent.force_left_panel ) { - parent.force_left_panel( 'show' ); - } - } - %endif - %endif - </script> -</%def> - -<%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> - <style> - ## Not generic to all grids -- move to base? - .count-box { - min-width: 1.1em; - padding: 5px; - border-width: 1px; - border-style: solid; - text-align: center; - display: inline-block; - } - </style> -</%def> - -%if grid.standard_filters: - <div class="grid-header"> - <h2>${grid.title}</h2> - <span class="title">Filter:</span> - %for i, filter in enumerate( grid.standard_filters ): - %if i > 0: - <span>|</span> - %endif - <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span> - %endfor - </div> -%endif - -<form name="history_actions" action="${url()}" method="post" > - <table class="grid"> - <thead> - <tr> - <th></th> - %for column in grid.columns: - %if column.visible: - <% - href = "" - extra = "" - if column.sortable: - if sort_key == column.key: - if sort_order == "asc": - href = url( sort=( "-" + column.key ) ) - extra = "↓" - else: - href = url( sort=( column.key ) ) - extra = "↑" - else: - href = url( sort=column.key ) - %> - <th\ - %if column.ncells > 1: - colspan="${column.ncells}" - %endif - > - %if href: - <a href="${href}">${column.label}</a> - %else: - ${column.label} - %endif - <span>${extra}</span> - </th> - %endif - %endfor - <th></th> - </tr> - </thead> - <tbody> - %for i, item in enumerate( query ): - <tr \ - %if current_item == item: - class="current" \ - %endif - > - ## Item selection column - <td style="width: 1.5em;"> - <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" /> - </td> - ## Data columns - %for column in grid.columns: - %if column.visible: - <% - # Link - link = column.get_link( trans, grid, item ) - if link: - href = url( **link ) - else: - href = None - # Value (coerced to list so we can loop) - value = column.get_value( trans, grid, item ) - if column.ncells == 1: - value = [ value ] - %> - %for cellnum, v in enumerate( value ): - <% - # Attach popup menu? - if column.attach_popup and cellnum == 0: - extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i - else: - extra = "" - %> - %if href: - <td><a href="${href}">${v}</a> ${extra}</td> - %else: - <td >${v}${extra}</td> - %endif - </td> - %endfor - %endif - %endfor - ## Actions column - <td> - <div popupmenu="grid-${i}-popup"> - %for operation in grid.operations: - %if operation.allowed( item ): - <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> - %endif - %endfor - </div> - </td> - </tr> - %endfor - </tbody> - <tfoot> - <tr> - <td></td> - <td colspan="100"> - For <span class="grid-selected-count"></span> selected histories: - %for operation in grid.operations: - %if operation.allow_multiple: - <input type="submit" name="operation" value="${operation.label}" class="action-button"> - %endif - %endfor - </td> - </tr> - </tfoot> - </table> -</form> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/browse_libraries.mako --- a/templates/library/browse_libraries.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/browse_libraries.mako Wed Aug 19 17:55:28 2009 -0400 @@ -1,9 +1,9 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<%def name="title()">Browse Libraries</%def> +<%def name="title()">Browse Data Libraries</%def> -<h2>Libraries</h2> +<h2>Data Libraries</h2> %if msg: ${render_msg( msg, messagetype )} diff -r ea6708c96cd1 -r 3049432643f4 templates/library/browse_library.mako --- a/templates/library/browse_library.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/browse_library.mako Wed Aug 19 17:55:28 2009 -0400 @@ -2,7 +2,7 @@ <%namespace file="/message.mako" import="render_msg" /> <% from galaxy import util %> -<%def name="title()">Browse Library</%def> +<%def name="title()">Browse data library</%def> <%def name="stylesheets()"> <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> <link href="${h.url_for('/static/style/library.css')}" rel="stylesheet" type="text/css" /> @@ -38,14 +38,21 @@ descendents = descendents.add( child_descendents ); }); // Set up expand / hide link + // HACK: assume descendents are invisible. The caller actually + // ensures this for the root node. However, if we start + // remembering folder states, we'll need something + // more sophisticated here. + var visible = false; $(q).find( "span.expandLink").click( function() { - if ( children.is( ":visible" ) ) { + if ( visible ) { descendents.hide(); descendents.removeClass( "expanded" ); q.removeClass( "expanded" ); + visible = false; } else { children.show(); q.addClass( "expanded" ); + visible = true; } }); // Check/uncheck boxes in subfolders. @@ -211,7 +218,7 @@ %endfor </%def> -<h2>Library “${library.name}”</h2> +<h2>Data Library “${library.name}”</h2> <ul class="manage-table-actions"> %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): diff -r ea6708c96cd1 -r 3049432643f4 templates/library/folder_info.mako --- a/templates/library/folder_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/folder_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/folder_permissions.mako --- a/templates/library/folder_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/folder_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -12,7 +12,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_info.mako --- a/templates/library/ldda_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/ldda_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -19,7 +19,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_permissions.mako --- a/templates/library/ldda_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/ldda_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -15,7 +15,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_dataset_info.mako --- a/templates/library/library_dataset_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/library_dataset_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_dataset_permissions.mako --- a/templates/library/library_dataset_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/library_dataset_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_info.mako --- a/templates/library/library_info.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/library_info.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_permissions.mako --- a/templates/library/library_permissions.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/library_permissions.mako Wed Aug 19 17:55:28 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/new_dataset.mako --- a/templates/library/new_dataset.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/new_dataset.mako Wed Aug 19 17:55:28 2009 -0400 @@ -16,7 +16,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -68,7 +68,7 @@ %elif upload_option == 'upload_directory': <div class="form-row"> <% - # Directories of files from the Libraries view are restricted to a + # Directories of files from the Data Libraries view are restricted to a # sub-directory named the same as the current user's email address # contained within the configured setting for user_library_import_dir user_library_import_dir = os.path.join( trans.app.config.user_library_import_dir, trans.user.email ) diff -r ea6708c96cd1 -r 3049432643f4 templates/library/new_folder.mako --- a/templates/library/new_folder.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/new_folder.mako Wed Aug 19 17:55:28 2009 -0400 @@ -4,7 +4,7 @@ <br/<br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/library/select_info_template.mako --- a/templates/library/select_info_template.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/library/select_info_template.mako Wed Aug 19 17:55:28 2009 -0400 @@ -4,7 +4,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a> + <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/edit_request.mako --- a/templates/requests/edit_request.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/requests/edit_request.mako Wed Aug 19 17:55:28 2009 -0400 @@ -58,7 +58,7 @@ <div class="form-row"> <label>${field['label']}</label> ${field['widget'].get_html()} - %if field['label'] == 'Library' and new_library: + %if field['label'] == 'Data library' and new_library: ${new_library.get_html()} %endif <div class="toolParamHelp" style="clear: both;"> diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/new_request.mako --- a/templates/requests/new_request.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/requests/new_request.mako Wed Aug 19 17:55:28 2009 -0400 @@ -58,7 +58,7 @@ <div class="form-row"> <label>${field['label']}</label> ${field['widget'].get_html()} - %if field['label'] == 'Library' and new_library: + %if field['label'] == 'Data library' and new_library: ${new_library.get_html()} %endif <div class="toolParamHelp" style="clear: both;"> diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/show_request.mako --- a/templates/requests/show_request.mako Wed Aug 19 17:27:00 2009 -0400 +++ b/templates/requests/show_request.mako Wed Aug 19 17:55:28 2009 -0400 @@ -79,7 +79,7 @@ %if not rd['value']: <i>None</i> %else: - %if rd['label'] == 'Library': + %if rd['label'] == 'Data library': %if rd['value']: <a href="${h.url_for( controller='library', action='browse_library', id=request.library.id )}">${rd['value']}</a> %else: diff -r ea6708c96cd1 -r 3049432643f4 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Wed Aug 19 17:27:00 2009 -0400 +++ b/test/base/twilltestcase.py Wed Aug 19 17:55:28 2009 -0400 @@ -1003,7 +1003,7 @@ """Create a new library""" self.home() self.visit_url( "%s/admin/library?new=True" % self.url ) - self.check_page_for_string( 'Create a new library' ) + self.check_page_for_string( 'Create a new data library' ) tc.fv( "1", "1", name ) # form field 1 is the field named name... tc.fv( "1", "2", description ) # form field 1 is the field named name... tc.submit( "create_library_button" ) diff -r ea6708c96cd1 -r 3049432643f4 test/functional/test_security_and_libraries.py --- a/test/functional/test_security_and_libraries.py Wed Aug 19 17:27:00 2009 -0400 +++ b/test/functional/test_security_and_libraries.py Wed Aug 19 17:55:28 2009 -0400 @@ -1451,7 +1451,7 @@ check_edit_page2( latest_3_lddas ) self.home() def test_195_upload_directory_of_files_from_libraries_view( self ): - """Testing uploading a directory of files to a root folder from the Libraries view""" + """Testing uploading a directory of files to a root folder from the Data Libraries view""" # admin_user will not have the option sto upload a directory of files from the # Libraries view since a sub-directory named the same as their email is not contained # in the configured user_library_import_dir. However, since members of role_one have diff -r ea6708c96cd1 -r 3049432643f4 tools/data_source/genbank.py --- a/tools/data_source/genbank.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/data_source/genbank.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,6 +1,6 @@ #!/usr/bin/env python from Bio import GenBank -import sys, os, sets, textwrap +import sys, os, textwrap assert sys.version_info[:2] >= ( 2, 4 ) diff -r ea6708c96cd1 -r 3049432643f4 tools/data_source/ucsc_proxy.py --- a/tools/data_source/ucsc_proxy.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/data_source/ucsc_proxy.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,6 +1,6 @@ #!/usr/bin/env python import urllib -import sys, os, sets +import sys, os assert sys.version_info[:2] >= ( 2, 4 ) diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/get_flanks.py --- a/tools/new_operations/get_flanks.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/new_operations/get_flanks.py Wed Aug 19 17:55:28 2009 -0400 @@ -9,7 +9,7 @@ -o, --off=N: Offset """ -import sys, sets, re, os +import sys, re, os from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) from bx.cookbook import doc_optparse diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/operation_filter.py --- a/tools/new_operations/operation_filter.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/new_operations/operation_filter.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,8 +1,13 @@ # runs after the job (and after the default post-filter) -import sets, os +import os from galaxy import eggs from galaxy import jobs from galaxy.tools.parameters import DataToolParameter +# Older py compatibility +try: + set() +except: + from sets import Set as set #def exec_before_process(app, inp_data, out_data, param_dict, tool=None): # """Sets the name of the data""" @@ -11,8 +16,8 @@ # raise Exception, '<p><font color="yellow">Both Queries must be from the same genome build</font></p>' def validate_input( trans, error_map, param_values, page_param_map ): - dbkeys = sets.Set() - data_param_names = sets.Set() + dbkeys = set() + data_param_names = set() data_params = 0 for name, param in page_param_map.iteritems(): if isinstance( param, DataToolParameter ): diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/subtract_query.py --- a/tools/new_operations/subtract_query.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/new_operations/subtract_query.py Wed Aug 19 17:55:28 2009 -0400 @@ -5,12 +5,16 @@ Subtract an entire query from another query usage: %prog in_file_1 in_file_2 begin_col end_col output """ - -import sys, sets, re - +import sys, re from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) from bx.cookbook import doc_optparse + +# Older py compatibility +try: + set() +except: + from sets import Set as set assert sys.version_info[:2] >= ( 2, 4 ) diff -r ea6708c96cd1 -r 3049432643f4 tools/regVariation/windowSplitter.py --- a/tools/regVariation/windowSplitter.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/regVariation/windowSplitter.py Wed Aug 19 17:55:28 2009 -0400 @@ -7,7 +7,7 @@ -l, --cols=N,N,N,N: Columns for chrom, start, end, strand in file """ -import sys, sets, re, os +import sys, re, os from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/column_maker.py --- a/tools/stats/column_maker.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/stats/column_maker.py Wed Aug 19 17:55:28 2009 -0400 @@ -2,7 +2,7 @@ # This tool takes a tab-delimited textfile as input and creates another column in the file which is the result of # a computation performed on every row in the original file. The tool will skip over invalid lines within the file, # informing the user about the number of lines skipped. -import sys, sets, re, os.path +import sys, re, os.path from galaxy import eggs from galaxy.tools import validation from galaxy.datatypes import metadata diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/filtering.py --- a/tools/stats/filtering.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/stats/filtering.py Wed Aug 19 17:55:28 2009 -0400 @@ -2,8 +2,13 @@ # This tool takes a tab-delimited text file as input and creates filters on columns based on certain properties. # The tool will skip over invalid lines within the file, informing the user about the number of lines skipped. -import sys, sets, re, os.path +import sys, re, os.path from galaxy import eggs +# Older py compatibility +try: + set() +except: + from sets import Set as set assert sys.version_info[:2] >= ( 2, 4 ) @@ -13,7 +18,7 @@ for item in items_to_strip: if filter_condition.find( item ) >= 0: filter_condition = filter_condition.replace( item, ' ' ) - operands = sets.Set( filter_condition.split( ' ' ) ) + operands = set( filter_condition.split( ' ' ) ) return operands def stop_err( msg ): diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/grouping.py --- a/tools/stats/grouping.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/stats/grouping.py Wed Aug 19 17:55:28 2009 -0400 @@ -3,7 +3,7 @@ """ This tool provides the SQL "group by" functionality. """ -import sys, string, re, commands, tempfile, random, sets +import sys, string, re, commands, tempfile, random from rpy import * def stop_err(msg): diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/gsummary.py --- a/tools/stats/gsummary.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/stats/gsummary.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,7 +1,12 @@ #!/usr/bin/python -import sys, sets, re, tempfile +import sys, re, tempfile from rpy import * +# Older py compatibility +try: + set() +except: + from sets import Set as set assert sys.version_info[:2] >= ( 2, 4 ) @@ -33,7 +38,7 @@ for word in re.compile( '[a-zA-Z]+' ).findall( expression ): if word and not word in math_allowed: stop_err( "Invalid expression '%s': term '%s' is not recognized or allowed" %( expression, word ) ) - symbols = sets.Set() + symbols = set() for symbol in re.compile( '[^a-z0-9\s]+' ).findall( expression ): if symbol and not symbol in ops_allowed: stop_err( "Invalid expression '%s': operator '%s' is not recognized or allowed" % ( expression, symbol ) ) diff -r ea6708c96cd1 -r 3049432643f4 tools/visualization/build_ucsc_custom_track_code.py --- a/tools/visualization/build_ucsc_custom_track_code.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/visualization/build_ucsc_custom_track_code.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,6 +1,10 @@ # runs after the job (and after the default post-filter) -from sets import Set as set +# Older py compatibility +try: + set() +except: + from sets import Set as set def validate_input( trans, error_map, param_values, page_param_map ): dbkeys = set() diff -r ea6708c96cd1 -r 3049432643f4 tools/visualization/genetrack_code.py --- a/tools/visualization/genetrack_code.py Wed Aug 19 17:27:00 2009 -0400 +++ b/tools/visualization/genetrack_code.py Wed Aug 19 17:55:28 2009 -0400 @@ -1,4 +1,4 @@ -import sets, os +import os from galaxy import eggs from galaxy import jobs from galaxy.tools.parameters import DataToolParameter

1 0

[hg] galaxy 2599: Merge trunk
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/bedfce38e652 changeset: 2599:bedfce38e652 user: Kanwei Li <kanwei(a)gmail.com> date: Thu Aug 20 10:59:13 2009 -0400 description: Merge trunk 0 file(s) affected in this change: diffs (438 lines): diff -r 3049432643f4 -r bedfce38e652 datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Wed Aug 19 17:55:28 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Aug 20 10:59:13 2009 -0400 @@ -3,6 +3,7 @@ <registration converters_path="lib/galaxy/datatypes/converters"> <datatype extension="ab1" type="galaxy.datatypes.images:Ab1" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/> + <datatype extension="bam" type="galaxy.datatypes.images:Bam" mimetype="application/octet-stream"/> <datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true"> <converter file="bed_to_gff_converter.xml" target_datatype="gff"/> <converter file="interval_to_coverage.xml" target_datatype="coverage"/> @@ -49,6 +50,7 @@ <datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/> <datatype extension="qualsolid" type="galaxy.datatypes.qualityscore:QualityScoreSOLiD" display_in_upload="true"/> <datatype extension="qual454" type="galaxy.datatypes.qualityscore:QualityScore454" display_in_upload="true"/> + <datatype extension="sam" type="galaxy.datatypes.tabular:Sam" display_in_upload="true"/> <datatype extension="scf" type="galaxy.datatypes.images:Scf" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/> <datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/> @@ -205,5 +207,6 @@ <sniffer type="galaxy.datatypes.interval:Gff"/> <sniffer type="galaxy.datatypes.interval:Gff3"/> <sniffer type="galaxy.datatypes.interval:Interval"/> + <sniffer type="galaxy.datatypes.tabular:Sam"/> </sniffers> </datatypes> diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Wed Aug 19 17:55:28 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Thu Aug 20 10:59:13 2009 -0400 @@ -4,6 +4,8 @@ import data import logging +from galaxy.datatypes.metadata import MetadataElement +from galaxy.datatypes import metadata from galaxy.datatypes.sniff import * from urllib import urlencode, quote_plus import zipfile @@ -187,7 +189,7 @@ return 'text/html' def sniff( self, filename ): """ - Determines wether the file is in html format + Determines whether the file is in html format >>> fname = get_test_fname( 'complete.bed' ) >>> Html().sniff( fname ) @@ -233,3 +235,25 @@ return dataset.peek except: return "peek unavailable" + +class Bam( data.Binary ): + """Class describing a BAM binary file""" + file_ext = "bam" + MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True ) + def set_peek( self, dataset ): + if not dataset.dataset.purged: + export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey}) + dataset.peek = "Binary bam alignments file" + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def display_peek(self, dataset): + try: + return dataset.peek + except: + return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) ) + def get_mime(self): + """Returns the mime type of the datatype""" + return 'application/octet-stream' + \ No newline at end of file diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Wed Aug 19 17:55:28 2009 -0400 +++ b/lib/galaxy/datatypes/registry.py Thu Aug 20 10:59:13 2009 -0400 @@ -111,6 +111,7 @@ self.datatypes_by_extension = { 'ab1' : images.Ab1(), 'axt' : sequence.Axt(), + 'bam' : images.Bam(), 'bed' : interval.Bed(), 'binseq.zip' : images.Binseq(), 'blastxml' : xml.BlastXml(), @@ -130,6 +131,7 @@ 'qualsolid' : qualityscore.QualityScoreSOLiD(), 'qualsolexa' : qualityscore.QualityScoreSolexa(), 'qual454' : qualityscore.QualityScore454(), + 'sam' : tabular.Sam(), 'scf' : images.Scf(), 'tabular' : tabular.Tabular(), 'taxonomy' : tabular.Taxonomy(), @@ -140,6 +142,7 @@ self.mimetypes_by_extension = { 'ab1' : 'application/octet-stream', 'axt' : 'text/plain', + 'bam' : 'application/octet-stream', 'bed' : 'text/plain', 'binseq.zip' : 'application/zip', 'blastxml' : 'text/plain', @@ -157,6 +160,7 @@ 'qualsolid' : 'text/plain', 'qualsolexa' : 'text/plain', 'qual454' : 'text/plain', + 'sam' : 'text/plain', 'scf' : 'application/octet-stream', 'tabular' : 'text/plain', 'taxonomy' : 'text/plain', @@ -184,7 +188,8 @@ interval.CustomTrack(), interval.Gff(), interval.Gff3(), - interval.Interval() + interval.Interval(), + tabular.Sam() ] def append_to_sniff_order(): # Just in case any supported data types are not included in the config's sniff_order section. diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/tabular.py --- a/lib/galaxy/datatypes/tabular.py Wed Aug 19 17:55:28 2009 -0400 +++ b/lib/galaxy/datatypes/tabular.py Thu Aug 20 10:59:13 2009 -0400 @@ -11,6 +11,7 @@ from cgi import escape from galaxy.datatypes import metadata from galaxy.datatypes.metadata import MetadataElement +from sniff import * log = logging.getLogger(__name__) @@ -236,3 +237,84 @@ out = "Can't create peek %s" % exc return out +class Sam( Tabular ): + file_ext = 'sam' + def __init__(self, **kwd): + """Initialize taxonomy datatype""" + Tabular.__init__( self, **kwd ) + self.column_names = ['QNAME', 'FLAG', 'RNAME', 'POS', 'MAPQ', 'CIGAR', + 'MRNM', 'MPOS', 'ISIZE', 'SEQ', 'QUAL', 'OPT' + ] + def make_html_table( self, dataset, skipchars=[] ): + """Create HTML table, used for displaying peek""" + out = ['<table cellspacing="0" cellpadding="3">'] + try: + # Generate column header + out.append( '<tr>' ) + for i, name in enumerate( self.column_names ): + out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) ) + # This data type requires at least 11 columns in the data + if dataset.metadata.columns - len( self.column_names ) > 0: + for i in range( len( self.column_names ), dataset.metadata.columns ): + out.append( '<th>%s</th>' % str( i+1 ) ) + out.append( '</tr>' ) + out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) ) + out.append( '</table>' ) + out = "".join( out ) + except Exception, exc: + out = "Can't create peek %s" % exc + return out + def sniff( self, filename ): + """ + Determines whether the file is in SAM format + + A file in SAM format consists of lines of tab-separated data. + The following header line may be the first line: + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL + or + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT + Data in the OPT column is optional and can consist of tab-separated data + + For complete details see http://samtools.sourceforge.net/SAM1.pdf + + Rules for sniffing as True: + There must be 11 or more columns of data on each line + Columns 2 (FLAG), 4(POS), 5 (MAPQ), 8 (MPOS), and 9 (ISIZE) must be numbers (9 can be negative) + We will only check that up to the first 5 alignments are correctly formatted. + + >>> fname = get_test_fname( 'sequence.maf' ) + >>> Sam().sniff( fname ) + False + >>> fname = get_test_fname( '1.sam' ) + >>> Sam().sniff( fname ) + True + """ + try: + fh = open( filename ) + count = 0 + while True: + line = fh.readline() + line = line.strip() + if not line: + break #EOF + if line: + if line[0] != '@': + linePieces = line.split('\t') + if len(linePieces) < 11: + return False + try: + check = int(linePieces[1]) + check = int(linePieces[3]) + check = int(linePieces[4]) + check = int(linePieces[7]) + check = int(linePieces[8]) + except ValueError: + return False + count += 1 + if count == 5: + return True + if count < 5 and count > 0: + return True + except: + pass + return False diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/test/1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/1.sam Thu Aug 20 10:59:13 2009 -0400 @@ -0,0 +1,97 @@ +@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT +1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(# +1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$ +1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$###### +1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$#### +1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'# +1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&% +1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$### +1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$ +1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#& +1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$# +1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#' +1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$## +1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/ +1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$ +1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$ +1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'# +1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&# +1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$### +1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%# +1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_68_466 69 * 0 0 * * 0 0 GTGATCGTCGGTGCCAGTCCCTGT #(%)+##$#$#%#+$%##$##### +1378_68_466 133 * 0 0 * * 0 0 GTGTCATCTGAGGTAAAGCATTGT /##$09#$#.=$#$76+$%1'### +1378_68_1692 117 chr13.nib:1-114142980 36365609 0 24M = 36365609 0 TTGAACCGGGCACGGGTCTTCTGG #$#######%###$##%&'%)### +1378_68_1692 153 chr13.nib:1-114142980 36365609 37 10M1D13M = 36365609 0 CTGCACATACAGAATATTCATAG 0010/!"0/!!021/132231// XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:10^T13 +1378_80_664 69 * 0 0 * * 0 0 CTGCTTTGATCCCCGGTGGAGCAC 7#%###$$6#######$##$$$## +1378_80_664 133 * 0 0 * * 0 0 TGTCTGCGTTGTATCTCTGGTGTA %##%,%$$#&$$###$#$%##'%# +1378_85_1786 69 * 0 0 * * 0 0 ATACTATGTCGATCTGTAAAAAAA )&.)#3%(a)$&%-,2#&+.-%0&./ +1378_85_1786 133 * 0 0 * * 0 0 CCCTAGGAGCGTATACCGGACGAG ,'&/%/@,&1,&'/)&,6&&1)(( +1378_86_1011 69 * 0 0 * * 0 0 CTACGTTATTGCTCTGTTTGTCCT ######$%##$$$%###%#$#### +1378_86_1011 133 * 0 0 * * 0 0 AGGCGATGGGATATTATTTTACTT :$###)%##$9$###1$$#$2### +1378_86_1789 89 chr12.nib:1-132349534 39007065 37 23M = 39007065 0 GCTTTCCATAGATGTGTAATTTC J2K]]Z5!GN?@U]]]VX]UYYP XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_86_1789 181 chr12.nib:1-132349534 39007065 0 24M = 39007065 0 ACAACTTAAATAATCATGGACCGG 02,5$$0&6#%?*,$'#%&/15.1 +1378_91_1596 69 * 0 0 * * 0 0 TTAGCGGTTGACTATCTGCTGACA *&+'#9'(%*'#//,&<),/)'*# +1378_91_1596 133 * 0 0 * * 0 0 GCTTTTTCATTCGGTGCCTTTGGA '>%/3%=()8'#.%?50$&5>%)% +1378_94_1595 69 chr7.nib:1-158821424 127518258 0 24M = 127518258 0 CGTGCGACAGCCCATGTTTTCAGA -=..5,3826&*+.+#+#%%6;%# +1378_94_1595 137 chr7.nib:1-158821424 127518258 37 23M = 127518258 0 TGAGATAAACACCTAACATGCTC M]]FN]]\V]]]Q>T]KIG:LVN XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1039 69 * 0 0 * * 0 0 CGGCGTCCATCTTCGCCTTGAGAT $##.#$##$$#%$#$%%$###$)$ +1378_95_1039 133 * 0 0 * * 0 0 GTTCTGTGCCAGGTGAGGTACGGA &##,./#$&)6##+,'#$$0(##$ +1378_95_1767 65 chr11.nib:1-134452384 65333552 25 23M chr3.nib:1-199501827 123725482 0 CAACTGGTGGCATCTGGACAAAC W[[TZYY]]RO<BI7!!:!!>@2 XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1767 129 chr3.nib:1-199501827 123725482 37 6M1I16M chr11.nib:1-134452384 65333552 0 ATTTATCTGTCTCATTCATTATT <AGB8B"!V]]UO/&JB4DE88E XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_96_1037 69 * 0 0 * * 0 0 ATCCCCCAAGATGCCTGTTGATTG $#$'##$$$#%$$#%###+##$#$ +1378_96_1037 133 * 0 0 * * 0 0 CTGCTGGGCCATTTGACTTACTCA '$#+#(##-%5##+*&###-.$$$ +1378_96_1764 81 chr15.nib:1-100338915 89251272 25 23M chr7.nib:1-158821424 19412615 0 AGAAATGGTCGCACCCTCTGGTT E*2ZEHX\SN]O>SYRL):LIOL XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_96_1764 161 chr7.nib:1-158821424 19412615 37 23M chr15.nib:1-100338915 89251272 0 GTATAGCCCACAACGCCTAATAT ZMBS]UW]UYR\]QPZ[SMYL7C XT:A:U CM:i:0 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_98_1574 69 * 0 0 * * 0 0 GTTCTGCCGGTGTCTGTGGCGGGC $$#+&$$####%$$$###$%#%%# +1378_98_1574 133 * 0 0 * * 0 0 AGGCGAGTGTGGGGGTTGTTTGAG +%%$#)##%##$####%###$%$# +1378_107_1647 69 * 0 0 * * 0 0 AGGCCTACTACGCGTCATTGATAG &#$$#$(.#%#$$####&$%##($ +1378_107_1647 133 * 0 0 * * 0 0 GGTCTGGTTCTATGTTGGTCGACT ###'$$#$$$(#%###(#$##$%# +1378_111_829 69 chr9.nib:1-140273252 82506894 0 24M = 82506894 0 TGCGGCACTTGCTTCTTCGTATTT %#%##%#$%#$#%###$$##&#$$ +1378_111_829 137 chr9.nib:1-140273252 82506894 37 4M1I18M = 82506894 0 GATGCGTAATCTAGTAAAATAAG 0/362//00/5516500210451 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_111_1900 69 * 0 0 * * 0 0 TCCCCTCGCTCGGCTCTGTGCTGT $&%*$#(#)##$#'##%(##$#$% +1378_111_1900 133 * 0 0 * * 0 0 GCACGCCTTTGGGCTAAGCCGTAA )$)'#%$########$'#&%$#(# +1378_112_1483 69 * 0 0 * * 0 0 TGTCCAGCTATGCGGCTTCCTCCT %#$+#%#&#$#####%####%$## +1378_112_1483 133 * 0 0 * * 0 0 TGGAGTGGTGTGTTTGCTGAGCCA #$#)#############$#%#%'% +1378_125_1287 69 * 0 0 * * 0 0 TGTCTCTGGGGGGCCTGGTTAGGT $##13$'%#$###$$###$$$#&# +1378_125_1287 133 * 0 0 * * 0 0 TGACGTGGGTTGTCCCGTGAGATT ##$%%#$###$##$$#&%##$(%% +1378_126_468 117 chr11.nib:1-134452384 72541052 0 24M = 72541052 0 TGCCTCTATACAGATTAGTCCTCT )7,7..?97594@8=,=?813@>7 +1378_126_468 153 chr11.nib:1-134452384 72541052 0 23M = 72541052 0 AGGCAAGACTCTGTCTCAAAAAA PK5G]]PDT\]SEXY[]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:15713 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_127_664 69 * 0 0 * * 0 0 AGAGGTTGGTGTCTTGTCGCAGCT ##'#$######$$%######$$$# +1378_127_664 133 * 0 0 * * 0 0 TCGCTTTGCCTATGTTTGTTCGGA #%$%#&##$%#%%###$$###)-' +1378_129_463 97 chr8.nib:1-146274826 29931771 37 23M chr19.nib:1-63811651 5702213 0 GTAGCTCTGTTTCACATTAGGGG J>AQ[G>C?NM:GD=)*PLORIF XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_129_463 145 chr19.nib:1-63811651 5702213 0 23M chr8.nib:1-146274826 29931771 0 AAAAAAAAAAAAAAAAAAAAAAA JOI:AHGD==@KQB78HF>KA8> XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:583698 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_129_875 69 * 0 0 * * 0 0 TTTCTATGGCTTACGCTGTCTGCC #$($##%####%$#$#####$### +1378_129_875 133 * 0 0 * * 0 0 GACCTTTACGTATTGGGGGTTGGC ###)###+###$##$#&%##$,#$ +1378_140_1251 69 * 0 0 * * 0 0 ATCCTAGCGCGGTGTCTTGGGGAC #$%1#$$$##$##$#$#$##$%$$ +1378_140_1251 133 * 0 0 * * 0 0 TTTCCTTCGTGTGCGTGCGGAGTG #%#%$##$$$######.$$$%#%( +1378_141_809 69 * 0 0 * * 0 0 TGTCCTCCAGTGTCTGTTGGGTGT %&,-##$$#(%###$#$$'###'# +1378_141_809 133 * 0 0 * * 0 0 TCTCGTGGTTTCTTTTTTATGTGT ##%)##$$#####%$#$#%%#'## +1378_144_983 69 * 0 0 * * 0 0 AGCGCCCGGTTGGTGCGGCTCGTC -$(&%*$#*#))#$$$#%%$#$## +1378_144_983 133 * 0 0 * * 0 0 GTTCGTTCGTGGTGTACGAGGGTG #(#%#####($#%##$$#%##%#) +1378_153_270 69 * 0 0 * * 0 0 AGTCCTTGTCCCCTGGGTTTTCCC +''$#&%$%#$##&$$($#&#$$# +1378_153_270 133 * 0 0 * * 0 0 GGCCGTGTGCGGGTGTAGATTGGA %$##($######&##$&$$$$%## +1378_155_1689 65 chrX.nib:1-154913754 106941539 37 23M = 106940385 -1154 ATCTCCTCTTCCTTCCATTCCAC \]]]Y]]]]]UV]]]ZYZZ]]RV XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_155_1689 129 chrX.nib:1-154913754 106940385 37 23M = 106941539 1154 GACTATGAGGTTTTCATTCAACA ]]]]\\]]]YW]]]WRZ]]WIOK XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_157_1580 69 * 0 0 * * 0 0 TGGGCCTCGGTGCCCTTGGTCTGT #%)$##'#$$$&#####%#$#$## +1378_157_1580 133 * 0 0 * * 0 0 GGGATTGAAGGGATGTATGCTAGG #%$&%#$$'%$%#$##*#%$$$$# +1378_161_317 69 * 0 0 * * 0 0 TTGGCCGGCAACCCCGGTACCTAA 7<,<'@)@>.)2@/')'&(?/-<( +1378_161_317 133 * 0 0 * * 0 0 AATCCATACCCACAAAAGCAGGCC .&%','(@''?7//+&)+2.+)0) +1378_177_735 113 chr2.nib:1-242951149 222173182 25 23M = 222173882 700 TTGTTCAGCGCCGATTGTCAATC KPNICFMS]]]Z]]]]Y]]]]]] XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:1G21 +1378_177_735 177 chr2.nib:1-242951149 222173882 37 23M = 222173182 -700 AGAATTCCTAACAAAATGTGAAG ES6-]]]]]]]]]]]]]]]]]]] XT:A:U CM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_181_1684 69 * 0 0 * * 0 0 CGACTCCCGCATTCACGGTCAAGT &*#,##$#&$*$$#$#$$$#%$## +1378_181_1684 133 * 0 0 * * 0 0 TTTCTGTTGTGGTTTTGTTGGGGT $##'$%'##%##$%$#$$####$* +1378_187_1407 69 * 0 0 * * 0 0 TGGCGTCCACTCGTGGGTCTATCG $#$'%#$%$%&$%#####$#$#%# +1378_187_1407 133 * 0 0 * * 0 0 TTGGGTGAAATCTTGTCGAGTGGA ####&##$$###$#####%##%%) +1378_203_721 97 chr1.nib:1-247249719 245680524 25 23M chr2.nib:1-242951149 213173999 0 GTAAAATTTGTGGAGATTTAAGT ]VEFFEZ]XPW]TOVINQ,;T!! XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_203_721 145 chr2.nib:1-242951149 213173999 37 4M1I18M chr1.nib:1-247249719 245680524 0 ACCTAACAAAATTGTTCAATATG F>8AWT<AV]Q9B"+]O@IF=K] XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_206_2039 113 chr4.nib:1-191273063 103793427 0 23M chr18.nib:1-76117153 57165542 0 ACACACACACACACACACACACA NKWZVWZ]]XV[]]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_206_2039 177 chr18.nib:1-76117153 57165542 0 23M chr4.nib:1-191273063 103793427 0 CACACACACACACACACACACAC NAJ[SPT[]]]W[]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/tools/actions/metadata.py --- a/lib/galaxy/tools/actions/metadata.py Wed Aug 19 17:55:28 2009 -0400 +++ b/lib/galaxy/tools/actions/metadata.py Thu Aug 20 10:59:13 2009 -0400 @@ -1,4 +1,4 @@ -from . import ToolAction +from __init__ import ToolAction from galaxy.datatypes.metadata import JobExternalOutputMetadataWrapper import logging diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Wed Aug 19 17:55:28 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 10:59:13 2009 -0400 @@ -1,5 +1,5 @@ import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile -from . import ToolAction +from __init__ import ToolAction from galaxy import datatypes, jobs from galaxy.datatypes import sniff from galaxy import model, util diff -r 3049432643f4 -r bedfce38e652 static/scripts/galaxy.workflow_editor.canvas.js --- a/static/scripts/galaxy.workflow_editor.canvas.js Wed Aug 19 17:55:28 2009 -0400 +++ b/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 10:59:13 2009 -0400 @@ -439,25 +439,11 @@ }); }); }, - enable_auto_save : function() { - // Implements auto-saving based on whether the inputs change. We consider - // "changed" to be when a field is accessed and not necessarily modified - // because of an issue where "onchange" is not triggered when activating - // another node, or saving the workflow. - outer_this = this; - $(".toolFormBody").find("input,textarea,select").each( function() { - $(this).focus( function() { - outer_this.active_form_has_changes = true; - }); - }); - }, check_changes_in_active_form : function() { // If active form has changed, save it if (this.active_form_has_changes) { this.has_changes = true; - $(".toolFormBody").find("form").each( function() { - $(this).submit(); - }); + $("#right-content").find("form").submit(); this.active_form_has_changes = false; } }, diff -r 3049432643f4 -r bedfce38e652 templates/workflow/editor.mako --- a/templates/workflow/editor.mako Wed Aug 19 17:55:28 2009 -0400 +++ b/templates/workflow/editor.mako Thu Aug 20 10:59:13 2009 -0400 @@ -303,6 +303,15 @@ $(this).remove(); make_popupmenu( b, options ); }); + // Implements auto-saving based on whether the inputs change. We consider + // "changed" to be when a field is accessed and not necessarily modified + // because of an issue where "onchange" is not triggered when activating + // another node, or saving the workflow. + $(this).find("input,textarea,select").each( function() { + $(this).focus( function() { + workflow.active_form_has_changes = true; + }); + }); }); } diff -r 3049432643f4 -r bedfce38e652 test-data/1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.sam Thu Aug 20 10:59:13 2009 -0400 @@ -0,0 +1,29 @@ +@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT +1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(# +1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$ +1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$###### +1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$#### +1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'# +1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&% +1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$### +1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$ +1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#& +1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$# +1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#' +1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$## +1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/ +1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$ +1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$ +1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'# +1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&# +1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$### +1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%# +1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 \ No newline at end of file diff -r 3049432643f4 -r bedfce38e652 test/functional/test_sniffing_and_metadata_settings.py --- a/test/functional/test_sniffing_and_metadata_settings.py Wed Aug 19 17:55:28 2009 -0400 +++ b/test/functional/test_sniffing_and_metadata_settings.py Thu Aug 20 10:59:13 2009 -0400 @@ -226,6 +226,16 @@ assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database" if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger': raise AssertionError, "fastqsanger data type was not correctly sniffed." + def test_090_sam_datatype( self ): + """Testing correctly sniffing sam format upon upload""" + self.upload_file( '1.sam' ) + self.verify_dataset_correctness( '1.sam' ) + self.check_history_for_string( '1.sam format: <span class="sam">sam</span>, database: \? Info: uploaded sam file' ) + latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ + .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() + assert latest_hda is not None, "Problem retrieving sam hda from the database" + if not latest_hda.name == '1.sam' and not latest_hda.extension == 'sam': + raise AssertionError, "sam data type was not correctly sniffed." def test_9999_clean_up( self ): self.delete_history( id=self.security.encode_id( history1.id ) ) self.logout()

1 0

[hg] galaxy 2590: Fixed a stupid and truly horrible paired end s...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/574cc8f15d2e changeset: 2590:574cc8f15d2e user: anton(a)nekrut-mbp.bx.psu.edu date: Thu Aug 20 17:33:39 2009 -0400 description: Fixed a stupid and truly horrible paired end splitter bug 3 file(s) affected in this change: static/welcome.html tools/metag_tools/split_paired_reads.py tools/solid_tools/maq_cs_wrapper.py diffs (76 lines): diff -r a7f9325bb319 -r 574cc8f15d2e static/welcome.html --- a/static/welcome.html Thu Aug 20 11:43:28 2009 -0400 +++ b/static/welcome.html Thu Aug 20 17:33:39 2009 -0400 @@ -71,7 +71,7 @@ <table border="0" cellpadding="0" cellspacing="0" width="100%"> <tr> <td> - <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:500,scroll:'no'})"> + <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/quickie1_TabSeq.flv',width:640,height:500,scroll:'no'})"> <div class="quickie"> <img src="images/qk/quickie1_small.png" border="0"> </div> diff -r a7f9325bb319 -r 574cc8f15d2e tools/metag_tools/split_paired_reads.py --- a/tools/metag_tools/split_paired_reads.py Thu Aug 20 11:43:28 2009 -0400 +++ b/tools/metag_tools/split_paired_reads.py Thu Aug 20 17:33:39 2009 -0400 @@ -1,7 +1,7 @@ #! /usr/bin/python """ -Split Solexa paired end reads +Split fixed length paired end reads """ import os, sys @@ -12,9 +12,13 @@ outfile_end1 = open(sys.argv[2], 'w') outfile_end2 = open(sys.argv[3], 'w') - for i, line in enumerate(file(infile)): + i = 0 + + for line in file( infile ): line = line.rstrip() - if not line or line.startswith('#'): continue + + if not line: + continue end1 = '' end2 = '' @@ -42,5 +46,9 @@ outfile_end1.write('%s\n' %(end1)) outfile_end2.write('%s\n' %(end2)) + i += 1 + + if i % 4 != 0 : + sys.stderr.write("WARNING: Number of lines in the input file was not divisible by 4.\nCheck consistency of the input fastq file.\n") outfile_end1.close() outfile_end2.close() \ No newline at end of file diff -r a7f9325bb319 -r 574cc8f15d2e tools/solid_tools/maq_cs_wrapper.py --- a/tools/solid_tools/maq_cs_wrapper.py Thu Aug 20 11:43:28 2009 -0400 +++ b/tools/solid_tools/maq_cs_wrapper.py Thu Aug 20 17:33:39 2009 -0400 @@ -48,9 +48,9 @@ cmd1 = "solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,tmps.name,f3_read_fname,f3_qual_fname,r3_read_fname,r3_qual_fname) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpffastq.name)) - os.system('zcat -f %s >> %s' %(tmpr.name,tmprfastq.name)) - os.system('zcat -f %s >> %s' %(tmps.name,tmpsfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpffastq.name)) + os.system('gunzip -c %s >> %s' %(tmpr.name,tmprfastq.name)) + os.system('gunzip -c %s >> %s' %(tmps.name,tmpsfastq.name)) except Exception, eq: stop_err("Error converting data to fastq format." + str(eq)) @@ -135,7 +135,7 @@ cmd1 = "solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,None,None,f3_read_fname,f3_qual_fname,None,None) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpfastq.name)) tmpf.close() except: stop_err("Error converting data to fastq format.")

1 0

[hg] galaxy 2591: Force FieldStorage to write tempfiles and neve...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/0fb05cc2b05f changeset: 2591:0fb05cc2b05f user: Nate Coraor <nate(a)bx.psu.edu> date: Fri Aug 21 09:56:35 2009 -0400 description: Force FieldStorage to write tempfiles and never use StringIOs. 2 file(s) affected in this change: lib/galaxy/tools/actions/upload.py lib/galaxy/web/framework/base.py diffs (44 lines): diff -r 574cc8f15d2e -r 0fb05cc2b05f lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Aug 20 17:33:39 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Fri Aug 21 09:56:35 2009 -0400 @@ -20,12 +20,10 @@ for upload_dataset in incoming['files']: f = upload_dataset['file_data'] if isinstance( f, FieldStorage ): - # very small files can be StringIOs - if 'name' in dir( f.file ) and f.file.name != '<fdopen>': - local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) - f.file.close() - else: - local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0] + assert not isinstance( f.file, StringIO.StringIO ) + assert f.file.name != '<fdopen>' + local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) + f.file.close() upload_dataset['file_data'] = dict( filename = f.filename, local_filename = local_filename ) if upload_dataset['url_paste'].strip() != '': diff -r 574cc8f15d2e -r 0fb05cc2b05f lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Thu Aug 20 17:33:39 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Fri Aug 21 09:56:35 2009 -0400 @@ -216,11 +216,18 @@ # tempfiles. Necessary for externalizing the upload tool. It's a little hacky # but for performance reasons it's way better to use Paste's tempfile than to # create a new one and copy. -import cgi +import cgi, tempfile class FieldStorage( cgi.FieldStorage ): def make_file(self, binary=None): - import tempfile return tempfile.NamedTemporaryFile() + def read_lines(self): + # Always make a new file + self.file = self.make_file() + self.__file = None + if self.outerboundary: + self.read_lines_to_outerboundary() + else: + self.read_lines_to_eof() cgi.FieldStorage = FieldStorage class Request( webob.Request ):

1 0

[hg] galaxy 2592: Change dbkey of unmapped liftover dataset to t...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/2c1916d89194 changeset: 2592:2c1916d89194 user: guru date: Fri Aug 21 11:40:51 2009 -0400 description: Change dbkey of unmapped liftover dataset to the input dataset's dbkey. 1 file(s) affected in this change: tools/extract/liftOver_wrapper_code.py diffs (11 lines): diff -r 0fb05cc2b05f -r 2c1916d89194 tools/extract/liftOver_wrapper_code.py --- a/tools/extract/liftOver_wrapper_code.py Fri Aug 21 09:56:35 2009 -0400 +++ b/tools/extract/liftOver_wrapper_code.py Fri Aug 21 11:40:51 2009 -0400 @@ -3,7 +3,6 @@ to_dbkey = param_dict['to_dbkey'].split('.')[0].split('To')[1] to_dbkey = to_dbkey[0].lower()+to_dbkey[1:] out_data['out_file1'].set_dbkey(to_dbkey) - out_data['out_file2'].set_dbkey(to_dbkey) out_data['out_file1'].name = out_data['out_file1'].name + " [ MAPPED COORDINATES ]" out_data['out_file2'].name = out_data['out_file2'].name + " [ UNMAPPED COORDINATES ]"

1 0

[hg] galaxy 2594: Added request editing functional test
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/55b0c25aa164 changeset: 2594:55b0c25aa164 user: rc date: Fri Aug 21 15:17:26 2009 -0400 description: Added request editing functional test Fixed a few bugs on the admin side request error handling and editing 6 file(s) affected in this change: lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py templates/admin/requests/show_request.mako templates/user/address.mako test/base/twilltestcase.py test/functional/test_forms_and_requests.py diffs (353 lines): diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Aug 20 16:54:44 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Fri Aug 21 15:17:26 2009 -0400 @@ -141,6 +141,9 @@ helptext='')) request_details.append(dict(label='Type', value=request.type.name, + helptext='')) + request_details.append(dict(label='State', + value=request.state, helptext='')) request_details.append(dict(label='Date created', value=request.create_time, diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Fri Aug 21 15:17:26 2009 -0400 @@ -32,7 +32,7 @@ ] operations = [ grids.GridOperation( "Submit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() and item.samples ) ), - grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), + grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), grids.GridOperation( "Delete", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), ] @@ -71,14 +71,15 @@ ''' List all request made by the current user ''' - status = message = None + message = util.restore_text( kwargs.get( 'message', '' ) ) + status = kwargs.get( 'status', 'done' ) self.request_grid.default_filter = dict(state=trans.app.model.Request.states.SUBMITTED, deleted=False) if 'operation' in kwargs: operation = kwargs['operation'].lower() if operation == "show_request": id = trans.security.decode_id(kwargs['id']) - return self.__show_request(trans, id) + return self.__show_request(trans, id, status, message) elif operation == "submit": id = trans.security.decode_id(kwargs['id']) return self.__submit(trans, id) @@ -110,7 +111,7 @@ try: request = trans.app.model.Request.get(int(params.get('request_id', None))) except: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", @@ -125,13 +126,13 @@ kwd['messagetype'] = 'error' kwd['msg'] = msg kwd['show'] = 'True' - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='edit', **kwd) ) request = self.__save_request(trans, request, **kwd) msg = 'The changes made to the request named %s has been saved' % request.name if params.get('save_changes_request_button', False) == 'Save changes': - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', message=msg , status='done') ) @@ -139,7 +140,7 @@ new_kwd = {} new_kwd['request_id'] = request.id new_kwd['edit_samples_button'] = 'Edit samples' - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='show_request', msg=msg , messagetype='done', @@ -177,7 +178,7 @@ widget=TextField('desc', 40, desc), helptext='(Optional)')) # libraries selectbox - libui = self.__library_ui(trans, trans.user, request, **kwd) + libui = self.__library_ui(trans, request.user, request, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd) return trans.fill_template( '/admin/requests/edit_request.mako', @@ -212,6 +213,7 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', + show_filter=trans.app.model.Request.states.UNSUBMITTED, status='done', message='The request <b>%s</b> has been deleted.' % request.name, **kwd) ) @@ -233,6 +235,7 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', + show_filter=trans.app.model.Request.states.UNSUBMITTED, status='done', message='The request <b>%s</b> has been undeleted.' % request.name, **kwd) ) @@ -290,7 +293,7 @@ if msg: return trans.response.send_redirect( web.url_for( controller='requests_admin', action='edit', - messagetype = 'error', + messagetype='error', msg=msg, request_id=request.id, show='True') ) @@ -328,11 +331,11 @@ for field_index in range(len(request.type.sample_form.fields)): sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) self.current_samples.append([sample_name, sample_values]) - def __show_request(self, trans, id): + def __show_request(self, trans, id, messagetype, msg): try: request = trans.app.model.Request.get(id) except: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", @@ -348,7 +351,8 @@ current_samples = self.current_samples, sample_copy=self.__copy_sample(), details_state=self.details_state, - edit_mode=self.edit_mode) + edit_mode=self.edit_mode, + msg=msg, messagetype=messagetype) @web.expose @web.require_admin def show_request(self, trans, **kwd): @@ -381,7 +385,9 @@ return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', - message='Error in importing <b>%s</b> samples file' % file_obj.file, + operation='show_request', + id=trans.security.encode_id(request.id), + message='Error in importing samples from the given file.', **kwd)) elif params.get('add_sample_button', False) == 'Add New': # save the all (saved+unsaved) sample info in 'current_samples' @@ -526,20 +532,20 @@ # list of widgets to be rendered on the request form request_details = [] # main details + request_details.append(dict(label='User', + value=str(request.user.email), + helptext='')) request_details.append(dict(label='Description', value=request.desc, helptext='')) request_details.append(dict(label='Type', value=request.type.name, helptext='')) + request_details.append(dict(label='State', + value=request.state, + helptext='')) request_details.append(dict(label='Date created', value=request.create_time, - helptext='')) - request_details.append(dict(label='Date updated', - value=request.create_time, - helptext='')) - request_details.append(dict(label='User', - value=str(request.user.email), helptext='')) # library associated if request.library: @@ -778,7 +784,7 @@ value = util.restore_text(params.get('field_%i' % index, '')) if value == 'new': # save this new address in the list of this user's addresses - user_address = trans.app.model.UserAddress( user=trans.user ) + user_address = trans.app.model.UserAddress( user=user ) user_address.desc = util.restore_text(params.get('field_%i_short_desc' % index, '')) user_address.name = util.restore_text(params.get('field_%i_name' % index, '')) user_address.institution = util.restore_text(params.get('field_%i_institution' % index, '')) @@ -812,7 +818,6 @@ request.user = user request.values = form_values request.library = library - request.state = trans.app.model.Request.states.UNSUBMITTED request.flush() return request @web.expose diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Thu Aug 20 16:54:44 2009 -0400 +++ b/templates/admin/requests/show_request.mako Fri Aug 21 15:17:26 2009 -0400 @@ -162,7 +162,7 @@ <tr> <div class="form-row"> <td> - %if current_samples: + %if current_samples and not request.complete(): <input type="submit" name="edit_samples_button" value="Edit samples"/> %endif </td> diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/user/address.mako --- a/templates/user/address.mako Thu Aug 20 16:54:44 2009 -0400 +++ b/templates/user/address.mako Fri Aug 21 15:17:26 2009 -0400 @@ -33,51 +33,48 @@ </div> - -<div class="toolForm"> - ##<div class="toolFormTitle">Addresses</div> - <div class="toolFormBody"> - <% trans.user.refresh() %> - %if not trans.user.addresses: - <label>There are no addresses</label> - %else: - <table class="grid"> - <tbody> - %for index, address in enumerate(addresses): - <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - - <td> - <div class="form-row"> - <label>${address.desc}</label> - ${address.display()} - </div> - <div class="form-row"> - <ul class="manage-table-actions"> - <li> - %if not address.deleted: - <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id, - short_desc=address.desc, - name=address.name, institution=address.institution, - address1=address.address, city=address.city, - state=address.state, postal_code=address.postal_code, - country=address.country, phone=address.phone)}"> - <span>Edit</span></a> - <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}"> - <span>Delete address</span></a> - %else: - <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}"> - <span>Undelete address</span></a> - %endif - - </li> - </ul> - </div> - </td> - </tr> - %endfor - </tbody> - </table> - %endif +%if not addresses: + <label>There are no addresses</label> +%else: + <div class="toolForm"> + <div class="toolFormBody"> + <% trans.user.refresh() %> + <table class="grid"> + <tbody> + %for index, address in enumerate(addresses): + <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> + <td> + <div class="form-row"> + <label>${address.desc}</label> + ${address.display()} + </div> + <div class="form-row"> + <ul class="manage-table-actions"> + <li> + %if not address.deleted: + <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id, + short_desc=address.desc, + name=address.name, institution=address.institution, + address1=address.address, city=address.city, + state=address.state, postal_code=address.postal_code, + country=address.country, phone=address.phone)}"> + <span>Edit</span></a> + <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}"> + <span>Delete</span></a> + %else: + <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}"> + <span>Undelete</span></a> + %endif + + </li> + </ul> + </div> + </td> + </tr> + %endfor + </tbody> + </table> + %endif + </div> </div> -</div> %endif \ No newline at end of file diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400 +++ b/test/base/twilltestcase.py Fri Aug 21 15:17:26 2009 -0400 @@ -1088,6 +1088,16 @@ for index, field_value in enumerate(fields): tc.fv( "1", "field_%i" % index, field_value ) tc.submit( "create_request_button" ) + def edit_request( self, request_id, name, new_name, new_desc, new_library_id, new_fields): + self.home() + self.visit_url( "%s/requests/edit?request_id=%i&show=True" % (self.url, request_id) ) + self.check_page_for_string( 'Edit request "%s"' % name ) + tc.fv( "1", "name", new_name ) + tc.fv( "1", "desc", new_desc ) + tc.fv( "1", "library_id", str(new_library_id) ) + for index, field_value in enumerate(new_fields): + tc.fv( "1", "field_%i" % index, field_value ) + tc.submit( "save_changes_request_button" ) def add_samples( self, request_id, request_name, samples ): self.home() self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) )) diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Fri Aug 21 15:17:26 2009 -0400 @@ -167,7 +167,7 @@ user_address.flush() user_address.user.refresh() def test_030_create_request( self ): - """Testing creating and submitting a request as a regular user""" + """Testing creating, editing and submitting a request as a regular user""" # login as a regular user self.logout() self.login( email='test1(a)bx.psu.edu' ) @@ -193,6 +193,12 @@ self.check_page_for_string( 'Unsubmitted' ) for field_value in fields: self.check_page_for_string( field_value ) + # edit this request + fields = ['field one value (editted)', 'field two value (editted)', str(user_address.id)] + self.edit_request(request_one.id, request_one.name, request_one.name+' (Renamed)', request_one.desc+' (Re-described)', library_one.id, fields) + request_one.refresh() + self.check_page_for_string( request_name+' (Renamed)' ) + self.check_page_for_string( request_desc+' (Re-described)' ) # submit the request self.submit_request( request_one.id, request_one.name ) request_one.refresh() @@ -264,4 +270,5 @@ + \ No newline at end of file

1 0

[hg] galaxy 2593: Fixed a bug in rendering form wrt AddressField
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/fc4c0c7e5da9 changeset: 2593:fc4c0c7e5da9 user: rc date: Thu Aug 20 16:54:44 2009 -0400 description: Fixed a bug in rendering form wrt AddressField Fixed other bugs admin's request UI 6 file(s) affected in this change: lib/galaxy/web/controllers/forms.py lib/galaxy/web/controllers/requests_admin.py lib/galaxy/web/framework/__init__.py templates/admin/requests/grid.mako test/base/twilltestcase.py test/functional/test_forms_and_requests.py diffs (290 lines): diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/forms.py --- a/lib/galaxy/web/controllers/forms.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/controllers/forms.py Thu Aug 20 16:54:44 2009 -0400 @@ -421,12 +421,14 @@ return [ fdc.latest_form for fdc in fdc_list ] -def get_form_widgets( trans, form, contents=[], **kwd ): +def get_form_widgets( trans, form, contents=[], user=None, **kwd ): ''' Return the list of widgets that comprise a form definition, including field contents if any. ''' params = util.Params( kwd ) + if not user: + user = trans.user widgets = [] for index, field in enumerate( form.fields ): field_name = 'field_%i' % index @@ -458,7 +460,7 @@ field_widget.set_size( 3, 40 ) field_widget.value = value elif field['type'] == 'AddressField': - field_widget.user = trans.user + field_widget.user = user field_widget.value = value field_widget.params = params elif field[ 'type' ] == 'SelectField': diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400 @@ -177,10 +177,9 @@ widget=TextField('desc', 40, desc), helptext='(Optional)')) # libraries selectbox - libraries = get_authorized_libs(trans, trans.user) - libui = self.__library_ui(libraries, request, **kwd) + libui = self.__library_ui(trans, trans.user, request, **kwd) widgets = widgets + libui - widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd) + widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd) return trans.fill_template( '/admin/requests/edit_request.mako', select_request_type=select_request_type, request_type=request.type, @@ -673,13 +672,9 @@ util.restore_text( params.get( 'desc', '' ) )), helptext='(Optional)')) # libraries selectbox - if not user: - libraries = [] - else: - libraries = get_authorized_libs(trans, user) - libui = self.__library_ui(libraries, **kwd) + libui = self.__library_ui(trans, user, **kwd) widgets = widgets + libui - widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd) + widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], user=user, **kwd) return trans.fill_template( '/admin/requests/new_request.mako', select_request_type=select_request_type, request_type=request_type, @@ -706,9 +701,13 @@ select_user.add_option(user.email, user.id) return select_user - def __library_ui(self, libraries, request=None, **kwd): + def __library_ui(self, trans, user, request=None, **kwd): params = util.Params( kwd ) lib_id = params.get( 'library_id', 'none' ) + if not user: + libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() + else: + libraries = get_authorized_libs(trans, user) lib_list = SelectField('library_id', refresh_on_change=True, refresh_on_change_values=['new']) if request and lib_id == 'none': @@ -724,13 +723,12 @@ else: lib_list.add_option(lib.name, lib.id) if lib_id == 'new': - lib_list.add_option('Create a new library', 'new', selected=True) + lib_list.add_option('Create a new data library', 'new', selected=True) else: - lib_list.add_option('Create a new library', 'new') - widget = dict(label='Library', + lib_list.add_option('Create a new data library', 'new') + widget = dict(label='Data library', widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored.') + helptext='Data library where the resultant dataset will be stored.') if lib_id == 'new': new_lib = dict(label='Create a new Library', widget=TextField('new_library_name', 40, diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Thu Aug 20 16:54:44 2009 -0400 @@ -641,7 +641,6 @@ self.name = name self.action = action self.submit_text = submit_text - #self.submit_name = submit_text+"_button" self.inputs = [] def add_input( self, type, name, label, value=None, error=None, help=None, use_label=True ): self.inputs.append( FormInput( type, label, name, value, error, help, use_label ) ) diff -r a7f9325bb319 -r fc4c0c7e5da9 templates/admin/requests/grid.mako --- a/templates/admin/requests/grid.mako Thu Aug 20 11:43:28 2009 -0400 +++ b/templates/admin/requests/grid.mako Thu Aug 20 16:54:44 2009 -0400 @@ -76,7 +76,7 @@ <div class="grid-header"> <h2>${grid.title}</h2> - %if len(trans.user.requests): + %if len(trans.app.model.Request.query().all()): ##<span class="title">Filter:</span> %for i, filter in enumerate( grid.standard_filters ): %if i > 0: diff -r a7f9325bb319 -r fc4c0c7e5da9 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Aug 20 11:43:28 2009 -0400 +++ b/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400 @@ -1077,6 +1077,17 @@ for index, field_value in enumerate(fields): tc.fv( "1", "field_%i" % index, field_value ) tc.submit( "create_request_button" ) + def create_request_admin( self, request_type_id, user_id, name, desc, library_id, fields ): + self.home() + self.visit_url( "%s/requests_admin/new?create=True&select_request_type=%i" % (self.url, request_type_id) ) + self.check_page_for_string( 'Add a new request' ) + tc.fv( "1", "select_user", str(user_id) ) + tc.fv( "1", "name", name ) + tc.fv( "1", "desc", desc ) + tc.fv( "1", "library_id", str(library_id) ) + for index, field_value in enumerate(fields): + tc.fv( "1", "field_%i" % index, field_value ) + tc.submit( "create_request_button" ) def add_samples( self, request_id, request_name, samples ): self.home() self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) )) diff -r a7f9325bb319 -r fc4c0c7e5da9 test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Thu Aug 20 11:43:28 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400 @@ -100,28 +100,13 @@ global request_type request_type = galaxy.model.RequestType.filter( and_( galaxy.model.RequestType.table.c.name==request_type_name ) ).all()[-1] assert request_type is not None, 'Problem retrieving request type named "%s" from the database' % request_type_name - def test_025_create_address( self ): - """Testing address creation""" - #self.create_address( user_address1 ) - #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) - ## TODO: FIX HACK - ## the user address creation should be done as a test. - global user_address - user_address = galaxy.model.UserAddress() - user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test(a)bx.psu.edu' ).first() - user_address.desc = address1[ 'short_desc' ] - user_address.name = address1[ 'name' ] - user_address.institution = address1[ 'institution' ] - user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] - user_address.city = address1[ 'city' ] - user_address.state = address1[ 'state' ] - user_address.postal_code = address1[ 'postal_code' ] - user_address.country = address1[ 'country' ] - user_address.phone = address1[ 'phone' ] - user_address.flush() - user_address.user.refresh() - def test_030_create_request( self ): - """Testing creating and submitting a request""" + def test_025_create_address_and_library( self ): + """Testing address & library creation""" + # first create a regular user + self.logout() + self.login( email='test1(a)bx.psu.edu' ) + self.logout() + self.login( email='test(a)bx.psu.edu' ) # first create a library for the request so that it can be submitted later lib_name = 'TestLib001' self.create_library( lib_name, '' ) @@ -144,12 +129,48 @@ break if not admin_user_private_role: raise AssertionError( "Private role not found for user '%s'" % admin_user.email ) + global regular_user1 + regular_user1 = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() + assert regular_user1 is not None, 'Problem retrieving user with email "test1(a)bx.psu.edu" from the database' + # Get the regular user's private role for later use + global regular_user1_private_role + regular_user1_private_role = None + for role in regular_user1.all_roles(): + if role.name == regular_user1.email and role.description == 'Private Role for %s' % regular_user1.email: + regular_user1_private_role = role + break + if not regular_user1_private_role: + raise AssertionError( "Private role not found for user '%s'" % regular_user1.email ) # Set permissions on the library, sort for later testing permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] permissions_out = [] - # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted to + # Role one members are: admin_user, regular_user1. Each of these users will be permitted to # LIBRARY_ADD, LIBRARY_MODIFY, LIBRARY_MANAGE for library items. - self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) + self.set_library_permissions( str( library_one.id ), library_one.name, str( regular_user1_private_role.id ), permissions_in, permissions_out ) + # create address + #self.create_address( user_address1 ) + #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) + ## TODO: FIX HACK + ## the user address creation should be done as a test. + global user_address + user_address = galaxy.model.UserAddress() + user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() + user_address.desc = address1[ 'short_desc' ] + user_address.name = address1[ 'name' ] + user_address.institution = address1[ 'institution' ] + user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] + user_address.city = address1[ 'city' ] + user_address.state = address1[ 'state' ] + user_address.postal_code = address1[ 'postal_code' ] + user_address.country = address1[ 'country' ] + user_address.phone = address1[ 'phone' ] + user_address.flush() + user_address.user.refresh() + def test_030_create_request( self ): + """Testing creating and submitting a request as a regular user""" + # login as a regular user + self.logout() + self.login( email='test1(a)bx.psu.edu' ) # set field values fields = ['field one value', 'field two value', str(user_address.id)] # create the request @@ -162,7 +183,6 @@ galaxy.model.Request.table.c.deleted==False ) ).first() # check if the request's state is now set to 'unsubmitted' assert request_one.state is not request_one.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.UNSUBMITTED ) - # sample fields samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] @@ -181,6 +201,8 @@ def test_035_request_lifecycle( self ): """Testing request lifecycle as it goes through all the states""" # goto admin manage requests page + self.logout() + self.login( email='test(a)bx.psu.edu' ) self.home() self.visit_page( 'requests_admin/list' ) self.check_page_for_string( request_one.name ) @@ -203,10 +225,43 @@ request_one.refresh() # check if the request's state is now set to 'complete' assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.COMPLETE ) +# def test_40_admin_create_request_on_behalf_of_regular_user( self ): +# """Testing creating and submitting a request as an admin on behalf of a regular user""" +# self.logout() +# self.login( email='test(a)bx.psu.edu' ) +## permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] +## permissions_out = [] +## self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) +# # set field values +# fields = ['field one value', 'field two value', str(user_address.id)] +# # create the request +# request_name, request_desc = 'Request Two', 'Request Two Description' +# self.create_request_admin(request_type.id, regular_user1.id, request_name, request_desc, library_one.id, fields) +# self.check_page_for_string( request_name ) +# self.check_page_for_string( request_desc ) +# global request_two +# request_one = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name, +# galaxy.model.Request.table.c.deleted==False ) ).first() +# # check if the request's state is now set to 'unsubmitted' +# assert request_two.state is not request_two.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.UNSUBMITTED ) +# # sample fields +# samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), +# ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] +# # add samples to this request +# self.add_samples( request_two.id, request_two.name, samples ) +# for sample_name, fields in samples: +# self.check_page_for_string( sample_name ) +# self.check_page_for_string( 'Unsubmitted' ) +# for field_value in fields: +# self.check_page_for_string( field_value ) +# # submit the request +# self.submit_request( request_two.id, request_two.name ) +# request_two.refresh() +# # check if the request's state is now set to 'submitted' +# assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.SUBMITTED ) - \ No newline at end of file

1 0

[hg] galaxy 2595: Merge with 2c1916d89194f6802102cab13e67bebcf68...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/108533bf35b8 changeset: 2595:108533bf35b8 user: rc date: Fri Aug 21 15:18:17 2009 -0400 description: Merge with 2c1916d89194f6802102cab13e67bebcf68d1d75 0 file(s) affected in this change: diffs (131 lines): diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:17:26 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:18:17 2009 -0400 @@ -20,12 +20,10 @@ for upload_dataset in incoming['files']: f = upload_dataset['file_data'] if isinstance( f, FieldStorage ): - # very small files can be StringIOs - if 'name' in dir( f.file ) and f.file.name != '<fdopen>': - local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) - f.file.close() - else: - local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0] + assert not isinstance( f.file, StringIO.StringIO ) + assert f.file.name != '<fdopen>' + local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) + f.file.close() upload_dataset['file_data'] = dict( filename = f.filename, local_filename = local_filename ) if upload_dataset['url_paste'].strip() != '': diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Fri Aug 21 15:17:26 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Fri Aug 21 15:18:17 2009 -0400 @@ -216,11 +216,18 @@ # tempfiles. Necessary for externalizing the upload tool. It's a little hacky # but for performance reasons it's way better to use Paste's tempfile than to # create a new one and copy. -import cgi +import cgi, tempfile class FieldStorage( cgi.FieldStorage ): def make_file(self, binary=None): - import tempfile return tempfile.NamedTemporaryFile() + def read_lines(self): + # Always make a new file + self.file = self.make_file() + self.__file = None + if self.outerboundary: + self.read_lines_to_outerboundary() + else: + self.read_lines_to_eof() cgi.FieldStorage = FieldStorage class Request( webob.Request ): diff -r 55b0c25aa164 -r 108533bf35b8 static/welcome.html --- a/static/welcome.html Fri Aug 21 15:17:26 2009 -0400 +++ b/static/welcome.html Fri Aug 21 15:18:17 2009 -0400 @@ -71,7 +71,7 @@ <table border="0" cellpadding="0" cellspacing="0" width="100%"> <tr> <td> - <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:500,scroll:'no'})"> + <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/quickie1_TabSeq.flv',width:640,height:500,scroll:'no'})"> <div class="quickie"> <img src="images/qk/quickie1_small.png" border="0"> </div> diff -r 55b0c25aa164 -r 108533bf35b8 tools/extract/liftOver_wrapper_code.py --- a/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:18:17 2009 -0400 @@ -3,7 +3,6 @@ to_dbkey = param_dict['to_dbkey'].split('.')[0].split('To')[1] to_dbkey = to_dbkey[0].lower()+to_dbkey[1:] out_data['out_file1'].set_dbkey(to_dbkey) - out_data['out_file2'].set_dbkey(to_dbkey) out_data['out_file1'].name = out_data['out_file1'].name + " [ MAPPED COORDINATES ]" out_data['out_file2'].name = out_data['out_file2'].name + " [ UNMAPPED COORDINATES ]" diff -r 55b0c25aa164 -r 108533bf35b8 tools/metag_tools/split_paired_reads.py --- a/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:18:17 2009 -0400 @@ -1,7 +1,7 @@ #! /usr/bin/python """ -Split Solexa paired end reads +Split fixed length paired end reads """ import os, sys @@ -12,9 +12,13 @@ outfile_end1 = open(sys.argv[2], 'w') outfile_end2 = open(sys.argv[3], 'w') - for i, line in enumerate(file(infile)): + i = 0 + + for line in file( infile ): line = line.rstrip() - if not line or line.startswith('#'): continue + + if not line: + continue end1 = '' end2 = '' @@ -42,5 +46,9 @@ outfile_end1.write('%s\n' %(end1)) outfile_end2.write('%s\n' %(end2)) + i += 1 + + if i % 4 != 0 : + sys.stderr.write("WARNING: Number of lines in the input file was not divisible by 4.\nCheck consistency of the input fastq file.\n") outfile_end1.close() outfile_end2.close() \ No newline at end of file diff -r 55b0c25aa164 -r 108533bf35b8 tools/solid_tools/maq_cs_wrapper.py --- a/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:18:17 2009 -0400 @@ -48,9 +48,9 @@ cmd1 = "solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,tmps.name,f3_read_fname,f3_qual_fname,r3_read_fname,r3_qual_fname) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpffastq.name)) - os.system('zcat -f %s >> %s' %(tmpr.name,tmprfastq.name)) - os.system('zcat -f %s >> %s' %(tmps.name,tmpsfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpffastq.name)) + os.system('gunzip -c %s >> %s' %(tmpr.name,tmprfastq.name)) + os.system('gunzip -c %s >> %s' %(tmps.name,tmpsfastq.name)) except Exception, eq: stop_err("Error converting data to fastq format." + str(eq)) @@ -135,7 +135,7 @@ cmd1 = "solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,None,None,f3_read_fname,f3_qual_fname,None,None) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpfastq.name)) tmpf.close() except: stop_err("Error converting data to fastq format.")

1 0

[hg] galaxy 2587: Fixed indentation
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/881dd4c2de9f changeset: 2587:881dd4c2de9f user: rc date: Thu Aug 20 10:52:08 2009 -0400 description: Fixed indentation 1 file(s) affected in this change: test/functional/test_security_and_libraries.py diffs (21 lines): diff -r 98fa3b9cd980 -r 881dd4c2de9f test/functional/test_security_and_libraries.py --- a/test/functional/test_security_and_libraries.py Thu Aug 20 10:46:52 2009 -0400 +++ b/test/functional/test_security_and_libraries.py Thu Aug 20 10:52:08 2009 -0400 @@ -196,7 +196,7 @@ dhps.sort() # Compare DefaultHistoryPermissions and actions_in - should be the same if dhps != actions_in: - raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \ + raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \ % ( str( dhps ), latest_history.id, str( actions_in ) ) ) # Make sure DatasetPermissionss are correct if len( latest_dataset.actions ) != len( latest_history.default_permissions ): @@ -209,7 +209,7 @@ dps.sort() # Compare DatasetPermissionss and DefaultHistoryPermissions - should be the same if dps != dhps: - raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \ + raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \ % ( str( dps ), latest_dataset.id, str( dhps ) ) ) self.logout() def test_020_create_new_user_account_as_admin( self ):

1 0