galaxy-dev
Threads by month
- ----- 2026 -----
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
August 2009
- 12 participants
- 156 discussions
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/ab5f39f838c0
changeset: 2597:ab5f39f838c0
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Fri Aug 21 17:14:35 2009 -0400
description:
Better naming for collected datasets in JobToOutputDatasetAssociation
1 file(s) affected in this change:
lib/galaxy/tools/__init__.py
diffs (21 lines):
diff -r b77721ef035d -r ab5f39f838c0 lib/galaxy/tools/__init__.py
--- a/lib/galaxy/tools/__init__.py Fri Aug 21 17:03:42 2009 -0400
+++ b/lib/galaxy/tools/__init__.py Fri Aug 21 17:14:35 2009 -0400
@@ -1543,7 +1543,7 @@
job = assoc.job
break
if job:
- assoc = self.app.model.JobToOutputDatasetAssociation( '__new_child_file_%s__' % designation, child_dataset )
+ assoc = self.app.model.JobToOutputDatasetAssociation( '__new_child_file_%s|%s__' % ( name, designation ), child_dataset )
assoc.job = job
assoc.flush()
child_dataset.state = outdata.state
@@ -1594,7 +1594,7 @@
job = assoc.job
break
if job:
- assoc = self.app.model.JobToOutputDatasetAssociation( '__new_primary_file_%s__' % designation, primary_data )
+ assoc = self.app.model.JobToOutputDatasetAssociation( '__new_primary_file_%s|%s__' % ( name, designation ), primary_data )
assoc.job = job
assoc.flush()
primary_data.state = outdata.state
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/3049432643f4
changeset: 2598:3049432643f4
user: Kanwei Li <kanwei(a)gmail.com>
date: Wed Aug 19 17:55:28 2009 -0400
description:
Merge trunk
2 file(s) affected in this change:
templates/history/shared_grid.mako
templates/history/stored_grid.mako
diffs (1946 lines):
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/coverage.py
--- a/lib/galaxy/datatypes/coverage.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/datatypes/coverage.py Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
import pkg_resources
pkg_resources.require( "bx-python" )
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from galaxy.datatypes.sniff import *
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/data.py
--- a/lib/galaxy/datatypes/data.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/datatypes/data.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,4 +1,4 @@
-import logging, os, sys, time, sets, tempfile
+import logging, os, sys, time, tempfile
from galaxy import util
from galaxy.util.odict import odict
from galaxy.util.bunch import Bunch
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/genetics.py
--- a/lib/galaxy/datatypes/genetics.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/datatypes/genetics.py Wed Aug 19 17:55:28 2009 -0400
@@ -12,7 +12,7 @@
august 20 2007
"""
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from cgi import escape
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/datatypes/interval.py
--- a/lib/galaxy/datatypes/interval.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/datatypes/interval.py Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
import pkg_resources
pkg_resources.require( "bx-python" )
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from galaxy.datatypes.sniff import *
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/model/__init__.py
--- a/lib/galaxy/model/__init__.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/model/__init__.py Wed Aug 19 17:55:28 2009 -0400
@@ -5,8 +5,7 @@
the relationship cardinalities are obvious (e.g. prefer Dataset to Data)
"""
-import os.path, os, errno
-import sha
+import os.path, os, errno, sys
import galaxy.datatypes
from galaxy.util.bunch import Bunch
from galaxy import util
@@ -14,8 +13,7 @@
import galaxy.datatypes.registry
from galaxy.datatypes.metadata import MetadataCollection
from galaxy.security import RBACAgent, get_permitted_actions
-
-
+from galaxy.util.hash_util import *
import logging
log = logging.getLogger( __name__ )
@@ -40,10 +38,10 @@
def set_password_cleartext( self, cleartext ):
"""Set 'self.password' to the digest of 'cleartext'."""
- self.password = sha.new( cleartext ).hexdigest()
+ self.password = new_secure_hash( text_type=cleartext )
def check_password( self, cleartext ):
"""Check if 'cleartext' matches 'self.password' when hashed."""
- return self.password == sha.new( cleartext ).hexdigest()
+ return self.password == new_secure_hash( text_type=cleartext )
def all_roles( self ):
roles = [ ura.role for ura in self.roles ]
for group in [ uga.group for uga in self.groups ]:
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/tools/__init__.py
--- a/lib/galaxy/tools/__init__.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/tools/__init__.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,15 +1,13 @@
"""
Classes encapsulating galaxy tools and tool configuration.
"""
-
import pkg_resources;
pkg_resources.require( "simplejson" )
import logging, os, string, sys, tempfile, glob, shutil
import simplejson
-import sha, hmac, binascii
-
+import binascii
from UserDict import DictMixin
from galaxy.util.odict import odict
from galaxy.util.bunch import Bunch
@@ -26,6 +24,7 @@
from galaxy.util.none_like import NoneDataset
from galaxy.datatypes import sniff
from cgi import FieldStorage
+from galaxy.util.hash_util import *
log = logging.getLogger( __name__ )
@@ -211,7 +210,7 @@
value["__page__"] = self.page
value = simplejson.dumps( value )
# Make it secure
- a = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ a = hmac_new( app.config.tool_secret, value )
b = binascii.hexlify( value )
return "%s:%s" % ( a, b )
def decode( self, value, tool, app ):
@@ -221,7 +220,7 @@
# Extract and verify hash
a, b = value.split( ":" )
value = binascii.unhexlify( b )
- test = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ test = hmac_new( app.config.tool_secret, value )
assert a == test
# Restore from string
values = json_fix( simplejson.loads( value ) )
@@ -453,7 +452,6 @@
self.tests = None
# Determine if this tool can be used in workflows
self.is_workflow_compatible = self.check_workflow_compatible()
-
def parse_inputs( self, root ):
"""
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/util/hash_util.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/util/hash_util.py Wed Aug 19 17:55:28 2009 -0400
@@ -0,0 +1,28 @@
+import sys, logging
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
+import hmac
+
+log = logging.getLogger( __name__ )
+
+"""
+Utility functions for bi-directional Python version compatibility. Python 2.5
+introduced hashlib which replaced sha in Python 2.4 and previous versions.
+"""
+def new_secure_hash( text_type=None ):
+ if using_24:
+ if text_type:
+ return sha.new( text_type ).hexdigest()
+ return sha.new()
+ else:
+ if text_type:
+ return hashlib.sha1( text_type ).hexdigest()
+ return hashlib.sha1()
+def hmac_new( key, value ):
+ if using_24:
+ return hmac.new( key, value, sha ).hexdigest()
+ else:
+ return hmac.new( key, value, hashlib.sha1 ).hexdigest()
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,9 +1,14 @@
-import shutil, StringIO, operator, urllib, gzip, tempfile, sets, string, sys
+import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys
from datetime import datetime, timedelta
from galaxy import util, datatypes
from galaxy.web.base.controller import *
from galaxy.model.orm import *
from galaxy.web.controllers.forms import get_all_forms, get_form_widgets
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
import logging
log = logging.getLogger( __name__ )
@@ -1236,16 +1241,16 @@
if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
if len( in_roles ) > 1:
# Get the set of all users that are being associated with the dataset
- in_roles_set = sets.Set()
+ in_roles_set = set()
for role in in_roles:
in_roles_set.add( role )
- users_set = sets.Set()
+ users_set = set()
for role in in_roles:
for ura in role.users:
users_set.add( ura.user )
# Make sure that at least 1 user has every role being associated with the dataset
for user in users_set:
- user_roles_set = sets.Set()
+ user_roles_set = set()
for ura in user.roles:
user_roles_set.add( ura.role )
if in_roles_set.issubset( user_roles_set ):
@@ -1421,16 +1426,16 @@
if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
if len( in_roles ) > 1:
# Get the set of all users that are being associated with the dataset
- in_roles_set = sets.Set()
+ in_roles_set = set()
for role in in_roles:
in_roles_set.add( role )
- users_set = sets.Set()
+ users_set = set()
for role in in_roles:
for ura in role.users:
users_set.add( ura.user )
# Make sure that at least 1 user has every role being associated with the dataset
for user in users_set:
- user_roles_set = sets.Set()
+ user_roles_set = set()
for ura in user.roles:
user_roles_set.add( ura.role )
if in_roles_set.issubset( user_roles_set ):
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/async.py
--- a/lib/galaxy/web/controllers/async.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/async.py Wed Aug 19 17:55:28 2009 -0400
@@ -6,8 +6,8 @@
from galaxy import jobs, util, datatypes, web
-import logging, urllib
-import sha, hmac
+import logging, urllib, sys
+from galaxy.util.hash_util import *
log = logging.getLogger( __name__ )
@@ -58,7 +58,7 @@
return "Data %s does not exist or has already been deleted" % data_id
if STATUS == 'OK':
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) )
if key != data_secret:
return "You do not have permission to alter data %s." % data_id
# push the job into the queue
@@ -116,7 +116,7 @@
trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id )
try:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) )
galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key )
params.update( { 'GALAXY_URL' :galaxy_url } )
params.update( { 'data_id' :data.id } )
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/dataset.py
--- a/lib/galaxy/web/controllers/dataset.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/dataset.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,4 +1,4 @@
-import logging, os, sets, string, shutil, re, socket, mimetypes, smtplib, urllib
+import logging, os, string, shutil, re, socket, mimetypes, smtplib, urllib
from galaxy.web.base.controller import *
from galaxy import util, datatypes, jobs, web, model
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/genetrack.py
--- a/lib/galaxy/web/controllers/genetrack.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/genetrack.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,11 +1,10 @@
-import time, glob, os
+import time, glob, os, sys
from itertools import cycle
-import sha
-
from mako import exceptions
from mako.template import Template
from mako.lookup import TemplateLookup
from galaxy.web.base.controller import *
+from galaxy.util.hash_util import *
try:
import pkg_resources
@@ -265,7 +264,7 @@
tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot]
# check against a hash, display an image that already exists if it was previously created.
- hash = sha.new()
+ hash = new_secure_hash()
hash.update(str(dataset_id))
for key in sorted(kwds.keys()):
hash.update(str(kwds[key]))
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/history.py
--- a/lib/galaxy/web/controllers/history.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/history.py Wed Aug 19 17:55:28 2009 -0400
@@ -161,7 +161,7 @@
status, message = self._list_undelete( trans, histories )
trans.sa_session.flush()
# Render the list view
- return self.stored_list_grid( trans, status=status, message=message, template='/history/stored_grid.mako', **kwargs )
+ return self.stored_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs )
def _list_delete( self, trans, histories ):
"""Delete histories"""
n_deleted = 0
@@ -239,14 +239,14 @@
if operation == "clone":
if not id:
message = "Select a history to clone"
- return self.shared_list_grid( trans, status='error', message=message, template='/history/shared_grid.mako', **kwargs )
+ return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs )
# When cloning shared histories, only copy active datasets
new_kwargs = { 'clone_choice' : 'active' }
return self.clone( trans, id, **new_kwargs )
elif operation == 'unshare':
if not id:
message = "Select a history to unshare"
- return self.shared_list_grid( trans, status='error', message=message, template='/history/shared_grid.mako', **kwargs )
+ return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs )
ids = util.listify( id )
histories = []
for history_id in ids:
@@ -260,7 +260,7 @@
message = "Unshared %d shared histories" % len( ids )
status = 'done'
# Render the list view
- return self.shared_list_grid( trans, status=status, message=message, template='/history/shared_grid.mako', **kwargs )
+ return self.shared_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs )
@web.expose
def delete_current( self, trans ):
"""Delete just the active history -- this does not require a logged in user."""
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/requests.py
--- a/lib/galaxy/web/controllers/requests.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/requests.py Wed Aug 19 17:55:28 2009 -0400
@@ -152,16 +152,12 @@
helptext=''))
# library associated
if request.library:
- request_details.append(dict(label='Library',
- value=request.library.name,
- helptext='Associated library where the resultant \
- dataset will be stored'))
+ value = request.library.name
else:
- request_details.append(dict(label='Library',
- value=None,
- helptext='Associated library where the resultant \
- dataset will be stored'))
-
+ value = None
+ request_details.append( dict( label='Data library',
+ value=value,
+ helptext='Data library where the resultant dataset will be stored' ) )
# form fields
for index, field in enumerate(request.type.request_form.fields):
if field['required']:
@@ -492,18 +488,17 @@
else:
lib_list.add_option(lib.name, lib.id)
if lib_id == 'new':
- lib_list.add_option('Create a new library', 'new', selected=True)
+ lib_list.add_option('Create a new data library', 'new', selected=True)
else:
- lib_list.add_option('Create a new library', 'new')
- widget = dict(label='Library',
+ lib_list.add_option('Create a new data library', 'new')
+ widget = dict(label='Data library',
widget=lib_list,
- helptext='Associated library where the resultant \
- dataset will be stored.')
+ helptext='Data library where the resultant dataset will be stored.')
if lib_id == 'new':
- new_lib = dict(label='Create a new Library',
+ new_lib = dict(label='Create a new data library',
widget=TextField('new_library_name', 40,
util.restore_text( params.get( 'new_library_name', '' ) )),
- helptext='Enter a library name here to request a new library')
+ helptext='Enter a name here to request a new data library')
return [widget, new_lib]
else:
return [widget]
@@ -558,7 +553,7 @@
'''
empty_fields = []
if not request.library:
- empty_fields.append('Library')
+ empty_fields.append('Data library')
# check rest of the fields of the form
for index, field in enumerate(request.type.request_form.fields):
if field['required'] == 'required' and request.values.content[index] in ['', None]:
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/requests_admin.py
--- a/lib/galaxy/web/controllers/requests_admin.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/requests_admin.py Wed Aug 19 17:55:28 2009 -0400
@@ -144,10 +144,9 @@
value=str(request.user.email),
helptext=''))
# library associated
- request_details.append(dict(label='Library',
+ request_details.append(dict(label='Data library',
value=trans.app.model.Library.get(request.library_id).name,
- helptext='Associated library where the resultant \
- dataset will be stored'))
+ helptext='Data library where the resultant dataset will be stored'))
# form fields
for index, field in enumerate(request.type.request_form.fields):
if field['required']:
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/root.py
--- a/lib/galaxy/web/controllers/root.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/root.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,7 +1,7 @@
"""
Contains the main interface in the Universe class
"""
-import logging, os, sets, string, shutil, urllib, re, socket
+import logging, os, string, shutil, urllib, re, socket
from cgi import escape, FieldStorage
from galaxy import util, datatypes, jobs, web, util
from galaxy.web.base.controller import *
@@ -60,7 +60,6 @@
trans.response.set_content_type('text/xml')
return trans.fill_template_mako( "root/history_as_xml.mako", history=history, show_deleted=util.string_as_bool( show_deleted ) )
else:
- template = "root/history.mako"
show_deleted = util.string_as_bool( show_deleted )
query = trans.sa_session.query( model.HistoryDatasetAssociation ) \
.filter( model.HistoryDatasetAssociation.history == history ) \
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/controllers/tool_runner.py
--- a/lib/galaxy/web/controllers/tool_runner.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/controllers/tool_runner.py Wed Aug 19 17:55:28 2009 -0400
@@ -117,7 +117,6 @@
tool_state_string = util.object_to_string(state.encode(tool, trans.app))
# Setup context for template
history = trans.get_history()
- template = "tool_form.mako"
vars = dict( tool_state=state, errors = {} )
# Is the "add frame" stuff neccesary here?
add_frame = AddFrameData()
@@ -125,17 +124,13 @@
if from_noframe is not None:
add_frame.wiki_url = trans.app.config.wiki_url
add_frame.from_noframe = True
- return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars )
-
-
+ return trans.fill_template( "tool_form.mako", history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars )
@web.expose
def redirect( self, trans, redirect_url=None, **kwd ):
if not redirect_url:
return trans.show_error_message( "Required URL for redirection missing" )
trans.log_event( "Redirecting to: %s" % redirect_url )
return trans.fill_template( 'root/redirect.mako', redirect_url=redirect_url )
-
-
@web.json
def upload_async_create( self, trans, tool_id=None, **kwd ):
"""
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/web/framework/__init__.py
--- a/lib/galaxy/web/framework/__init__.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/web/framework/__init__.py Wed Aug 19 17:55:28 2009 -0400
@@ -93,8 +93,8 @@
"""
Exception to make throwing errors from deep in controllers easier
"""
- def __init__( self, message, type="info" ):
- self.message = message
+ def __init__( self, err_msg, type="info" ):
+ self.err_msg = err_msg
self.type = type
def error( message ):
@@ -117,7 +117,7 @@
self.security = galaxy_app.security
def handle_controller_exception( self, e, trans, **kwargs ):
if isinstance( e, MessageException ):
- return trans.show_message( e.message, e.type )
+ return trans.show_message( e.err_msg, e.type )
def make_body_iterable( self, trans, body ):
if isinstance( body, FormBuilder ):
body = trans.show_form( body )
diff -r ea6708c96cd1 -r 3049432643f4 lib/galaxy/webapps/reports/controllers/root.py
--- a/lib/galaxy/webapps/reports/controllers/root.py Wed Aug 19 17:27:00 2009 -0400
+++ b/lib/galaxy/webapps/reports/controllers/root.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,8 +1,8 @@
-import sys, os, operator, sets, string, shutil, re, socket, urllib
+import sys, os, operator, string, shutil, re, socket, urllib, time
from galaxy import web
from cgi import escape, FieldStorage
from galaxy.webapps.reports.base.controller import *
-import logging, sets, time
+import logging
log = logging.getLogger( __name__ )
class Report( BaseController ):
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/center.mako
--- a/templates/admin/center.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/center.mako Wed Aug 19 17:55:28 2009 -0400
@@ -17,7 +17,7 @@
<li>
<strong>Manage groups</strong> - provides a view of all groups along with the members of the group and the roles associated with
each group (both private and non-private roles). Non-private roles include a link to a page that allows you to manage the users
- and groups that are associated with the role. The page also includes a view of the library datasets that are associated with the
+ and groups that are associated with the role. The page also includes a view of the data library datasets that are associated with the
role and the permissions applied to each dataset.
</li>
<p/>
@@ -32,9 +32,9 @@
<p/>
<ul>
<li>
- <strong>Manage libraries</strong> - Dataset libraries enable a Galaxy administrator to upload datasets into a library. Currently,
- only administrators can create dataset libraries, but permission to perform the following functions on the library can be granted to
- users (a library item is one of: a library, a library folder, a library dataset).
+ <strong>Manage data libraries</strong> - Data libraries enable a Galaxy administrator to upload datasets into a data library. Currently,
+ only administrators can create data libraries, but permission to perform the following functions on the data library can be granted to
+ users (a library item is one of: a data library, a library folder, a library dataset).
<p/>
<ul>
<li><strong>add library item</strong> - Role members can add library items to this library or folder</li>
@@ -42,12 +42,12 @@
<li><strong>manage library permissions</strong> - Role members can manage permissions applied to this library item</li>
</ul>
<p/>
- The default behavior is for no permissions to be applied to a library item, but applied permissions are inherited downward, so it is
- important to set desired permissions on a new library when it is created. When this is done, new folders and datasets added to the
- library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be
+ The default behavior is for no permissions to be applied to a data library item, but applied permissions are inherited downward, so it is
+ important to set desired permissions on a new data library when it is created. When this is done, new folders and datasets added to the
+ data library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be
automatically inherited by all contained datasets and sub-folders.
<p/>
- The "Libraries" menu item allows users to access the datasets in a library as long as they are not restricted from accessing them.
+ The "Data Libraries" menu item allows users to access the datasets in a data library as long as they are not restricted from accessing them.
Importing a library dataset into a history will not make a copy of the dataset, but will be a "pointer" to the dataset on disk. This
approach allows for multiple users to use a single (possibly very large) dataset file.
</li>
@@ -72,7 +72,7 @@
</ul>
</li>
</ul>
-<p><strong>Data Security and Dataset Libraries</strong></p>
+<p><strong>Data Security and Data Libraries</strong></p>
<p/>
<strong>Security</strong> - Data security in Galaxy is a new feature, so familiarize yourself with the details which can be found
here or in our <a href="http://g2.trac.bx.psu.edu/wiki/SecurityFeatures" target="_blank">data security page</a>. The data security
@@ -121,8 +121,8 @@
<strong>access</strong> - users associated with the role can import this dataset into their history for analysis.
<p>
If no roles with the "access" permission are associated with a dataset, the dataset is "public" and may be accessed by
- anyone. Public library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session)
- from the list of libraries displayed when the "Libraries" menu item is selected.
+ anyone. Public data library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session)
+ from the list of data libraries displayed when the "Data Libraries" menu item is selected.
</p>
<p>
Associating a dataset with a role that includes the "access" permission restricts the set of users that can access it.
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/dataset_security/role.mako
--- a/templates/admin/dataset_security/role.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/dataset_security/role.mako Wed Aug 19 17:55:28 2009 -0400
@@ -84,7 +84,7 @@
<br clear="left"/>
<br/>
%if len( library_dataset_actions ) > 0:
- <h3>Library datasets associated with role '${role.name}'</h3>
+ <h3>Data library datasets associated with role '${role.name}'</h3>
<table class="manage-table colored" border="0" cellspacing="0" cellpadding="0" width="100%">
<tr>
<td>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/index.mako
--- a/templates/admin/index.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/index.mako Wed Aug 19 17:55:28 2009 -0400
@@ -89,7 +89,7 @@
</div>
<div class="toolSectionBody">
<div class="toolSectionBg">
- <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage libraries</a></div>
+ <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div>
</div>
</div>
<div class="toolSectionPad"></div>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/browse_libraries.mako
--- a/templates/admin/library/browse_libraries.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/browse_libraries.mako Wed Aug 19 17:55:28 2009 -0400
@@ -1,19 +1,19 @@
<%inherit file="/base.mako"/>
<%namespace file="/message.mako" import="render_msg" />
-<%def name="title()">Browse Libraries</%def>
+<%def name="title()">Browse Data Libraries</%def>
<h2>
%if deleted:
Deleted
%endif
- Libraries
+ Data Libraries
</h2>
<ul class="manage-table-actions">
%if not deleted:
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a>
</li>
<li>
<a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/browse_library.mako
--- a/templates/admin/library/browse_library.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/browse_library.mako Wed Aug 19 17:55:28 2009 -0400
@@ -162,16 +162,16 @@
%if deleted:
Deleted
%endif
- Library '${library.name}'
+ Data Library “${library.name}”
</h2>
<ul class="manage-table-actions">
%if not deleted:
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a>
</li>
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this library</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a>
</li>
%endif
</ul>
@@ -200,24 +200,24 @@
library_item_ids = {}
library_item_ids[ 'library' ] = library.id
%>
- <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this library's information</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a>
## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition
##%if library.info_association:
## <% form_id = library.info_association[0].template.id %>
- ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this library's information template</a>
+ ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this data library's information template</a>
##%else:
%if not library.info_association:
- <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a>
%endif
- <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this library's permissions</a>
- <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this library and its contents</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a>
+ <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a>
%if show_deleted:
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted library items</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a>
%else:
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted library items</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a>
%endif
%elif not library.purged:
- <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this library</a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a>
%endif
</div>
</th>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/folder_info.mako
--- a/templates/admin/library/folder_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/folder_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/folder_permissions.mako
--- a/templates/admin/library/folder_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/folder_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_edit_info.mako
--- a/templates/admin/library/ldda_edit_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/ldda_edit_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -12,7 +12,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_info.mako
--- a/templates/admin/library/ldda_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/ldda_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -20,7 +20,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/ldda_permissions.mako
--- a/templates/admin/library/ldda_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/ldda_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -15,7 +15,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_dataset_info.mako
--- a/templates/admin/library/library_dataset_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/library_dataset_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_dataset_permissions.mako
--- a/templates/admin/library/library_dataset_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/library_dataset_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_info.mako
--- a/templates/admin/library/library_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/library_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/library_permissions.mako
--- a/templates/admin/library/library_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/library_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_dataset.mako
--- a/templates/admin/library/new_dataset.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/new_dataset.mako Wed Aug 19 17:55:28 2009 -0400
@@ -4,7 +4,7 @@
<% import os, os.path %>
-<b>Create new library datasets</b>
+<b>Create new data library datasets</b>
<a id="upload-librarydataset--popup" class="popup-arrow" style="display: none;">▼</a>
<div popupmenu="upload-librarydataset--popup">
<a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a>
@@ -16,7 +16,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -142,7 +142,7 @@
<textarea name="message" rows="3" cols="35"></textarea>
</div>
<div class="toolParamHelp" style="clear: both;">
- This information will be displayed in the "Information" column for this dataset in the library browser
+ This information will be displayed in the "Information" column for this dataset in the data library browser
</div>
<div style="clear: both"></div>
</div>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_folder.mako
--- a/templates/admin/library/new_folder.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/new_folder.mako Wed Aug 19 17:55:28 2009 -0400
@@ -4,7 +4,7 @@
<br/<br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/new_library.mako
--- a/templates/admin/library/new_library.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/new_library.mako Wed Aug 19 17:55:28 2009 -0400
@@ -6,13 +6,13 @@
%endif
<div class="toolForm">
- <div class="toolFormTitle">Create a new library</div>
+ <div class="toolFormTitle">Create a new data library</div>
<div class="toolFormBody">
<form name="library" action="${h.url_for( controller='admin', action='library' )}" method="post" >
<div class="form-row">
<label>Name:</label>
<div style="float: left; width: 250px; margin-right: 10px;">
- <input type="text" name="name" value="New Library" size="40"/>
+ <input type="text" name="name" value="New data library" size="40"/>
</div>
<div style="clear: both"></div>
</div>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/library/select_info_template.mako
--- a/templates/admin/library/select_info_template.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/library/select_info_template.mako Wed Aug 19 17:55:28 2009 -0400
@@ -4,7 +4,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/admin/requests/show_request.mako
--- a/templates/admin/requests/show_request.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/admin/requests/show_request.mako Wed Aug 19 17:55:28 2009 -0400
@@ -48,7 +48,7 @@
%if not rd['value']:
<i>None</i>
%else:
- %if rd['label'] == 'Library':
+ %if rd['label'] == 'Data library':
<a href="${h.url_for( controller='admin', action='browse_library', id=request.library.id )}">${rd['value']}</a>
%else:
${rd['value']}
diff -r ea6708c96cd1 -r 3049432643f4 templates/base_panels.mako
--- a/templates/base_panels.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/base_panels.mako Wed Aug 19 17:55:28 2009 -0400
@@ -139,14 +139,14 @@
${tab( "workflow", "Workflow", h.url_for( controller='workflow', action='index' ))}
- ${tab( "libraries", "Libraries", h.url_for( controller='library', action='index' ))}
+ ${tab( "libraries", "Data Libraries", h.url_for( controller='library', action='index' ))}
%if trans.request_types():
<td class="tab">
<a>Lab</a>
<div class="submenu">
<ul>
- <li><a target="requests" href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li>
+ <li><a href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li>
</ul>
</div>
</td>
diff -r ea6708c96cd1 -r 3049432643f4 templates/history/grid.mako
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/templates/history/grid.mako Wed Aug 19 17:55:28 2009 -0400
@@ -0,0 +1,196 @@
+<%inherit file="/base.mako"/>
+<%def name="title()">${grid.title}</%def>
+
+%if message:
+ <p>
+ <div class="${message_type}message transient-message">${message}</div>
+ <div style="clear: both"></div>
+ </p>
+%endif
+
+<%def name="javascripts()">
+ ${parent.javascripts()}
+ <script type="text/javascript">
+ ## TODO: generalize and move into galaxy.base.js
+ $(document).ready(function() {
+ $(".grid").each( function() {
+ var grid = this;
+ var checkboxes = $(this).find("input.grid-row-select-checkbox");
+ var update = $(this).find( "span.grid-selected-count" );
+ $(checkboxes).each( function() {
+ $(this).change( function() {
+ var n = $(checkboxes).filter("[checked]").size();
+ update.text( n );
+ });
+ })
+ });
+ });
+ ## Can this be moved into base.mako?
+ %if refresh_frames:
+ %if 'masthead' in refresh_frames:
+ ## Refresh masthead == user changes (backward compatibility)
+ if ( parent.user_changed ) {
+ %if trans.user:
+ parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} );
+ %else:
+ parent.user_changed( null, false );
+ %endif
+ }
+ %endif
+ %if 'history' in refresh_frames:
+ if ( parent.frames && parent.frames.galaxy_history ) {
+ parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}";
+ if ( parent.force_right_panel ) {
+ parent.force_right_panel( 'show' );
+ }
+ }
+ %endif
+ %if 'tools' in refresh_frames:
+ if ( parent.frames && parent.frames.galaxy_tools ) {
+ parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}";
+ if ( parent.force_left_panel ) {
+ parent.force_left_panel( 'show' );
+ }
+ }
+ %endif
+ %endif
+ </script>
+</%def>
+
+<%def name="stylesheets()">
+ <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
+ <style>
+ ## Not generic to all grids -- move to base?
+ .count-box {
+ min-width: 1.1em;
+ padding: 5px;
+ border-width: 1px;
+ border-style: solid;
+ text-align: center;
+ display: inline-block;
+ }
+ </style>
+</%def>
+
+%if grid.standard_filters:
+ <div class="grid-header">
+ <h2>${grid.title}</h2>
+ <span class="title">Filter:</span>
+ %for i, filter in enumerate( grid.standard_filters ):
+ %if i > 0:
+ <span>|</span>
+ %endif
+ <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span>
+ %endfor
+ </div>
+%endif
+
+<form name="history_actions" action="${url()}" method="post" >
+ <table class="grid">
+ <thead>
+ <tr>
+ <th></th>
+ %for column in grid.columns:
+ %if column.visible:
+ <%
+ href = ""
+ extra = ""
+ if column.sortable:
+ if sort_key == column.key:
+ if sort_order == "asc":
+ href = url( sort=( "-" + column.key ) )
+ extra = "↓"
+ else:
+ href = url( sort=( column.key ) )
+ extra = "↑"
+ else:
+ href = url( sort=column.key )
+ %>
+ <th\
+ %if column.ncells > 1:
+ colspan="${column.ncells}"
+ %endif
+ >
+ %if href:
+ <a href="${href}">${column.label}</a>
+ %else:
+ ${column.label}
+ %endif
+ <span>${extra}</span>
+ </th>
+ %endif
+ %endfor
+ <th></th>
+ </tr>
+ </thead>
+ <tbody>
+ %for i, item in enumerate( query ):
+ <tr \
+ %if current_item == item:
+ class="current" \
+ %endif
+ >
+ ## Item selection column
+ <td style="width: 1.5em;">
+ <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" />
+ </td>
+ ## Data columns
+ %for column in grid.columns:
+ %if column.visible:
+ <%
+ # Link
+ link = column.get_link( trans, grid, item )
+ if link:
+ href = url( **link )
+ else:
+ href = None
+ # Value (coerced to list so we can loop)
+ value = column.get_value( trans, grid, item )
+ if column.ncells == 1:
+ value = [ value ]
+ %>
+ %for cellnum, v in enumerate( value ):
+ <%
+ # Attach popup menu?
+ if column.attach_popup and cellnum == 0:
+ extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i
+ else:
+ extra = ""
+ %>
+ %if href:
+ <td><a href="${href}">${v}</a> ${extra}</td>
+ %else:
+ <td >${v}${extra}</td>
+ %endif
+ </td>
+ %endfor
+ %endif
+ %endfor
+ ## Actions column
+ <td>
+ <div popupmenu="grid-${i}-popup">
+ %for operation in grid.operations:
+ %if operation.allowed( item ):
+ <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a>
+ %endif
+ %endfor
+ </div>
+ </td>
+ </tr>
+ %endfor
+ </tbody>
+ <tfoot>
+ <tr>
+ <td></td>
+ <td colspan="100">
+ For <span class="grid-selected-count"></span> selected histories:
+ %for operation in grid.operations:
+ %if operation.allow_multiple:
+ <input type="submit" name="operation" value="${operation.label}" class="action-button">
+ %endif
+ %endfor
+ </td>
+ </tr>
+ </tfoot>
+ </table>
+</form>
diff -r ea6708c96cd1 -r 3049432643f4 templates/history/shared_grid.mako
--- a/templates/history/shared_grid.mako Wed Aug 19 17:27:00 2009 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,197 +0,0 @@
-<%inherit file="/base.mako"/>
-<%namespace file="/message.mako" import="render_msg" />
-
-<%def name="title()">${grid.title}</%def>
-
-<%def name="javascripts()">
- ${parent.javascripts()}
- <script type="text/javascript">
- ## TODO: generalize and move into galaxy.base.js
- $(document).ready(function() {
- $(".grid").each( function() {
- var grid = this;
- var checkboxes = $(this).find("input.grid-row-select-checkbox");
- var update = $(this).find( "span.grid-selected-count" );
- $(checkboxes).each( function() {
- $(this).change( function() {
- var n = $(checkboxes).filter("[checked]").size();
- update.text( n );
- });
- })
- });
- });
- ## Can this be moved into base.mako?
- %if refresh_frames:
- %if 'masthead' in refresh_frames:
- ## Refresh masthead == user changes (backward compatibility)
- if ( parent.user_changed ) {
- %if trans.user:
- parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} );
- %else:
- parent.user_changed( null, false );
- %endif
- }
- %endif
- %if 'history' in refresh_frames:
- if ( parent.frames && parent.frames.galaxy_history ) {
- parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}";
- if ( parent.force_right_panel ) {
- parent.force_right_panel( 'show' );
- }
- }
- %endif
- %if 'tools' in refresh_frames:
- if ( parent.frames && parent.frames.galaxy_tools ) {
- parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}";
- if ( parent.force_left_panel ) {
- parent.force_left_panel( 'show' );
- }
- }
- %endif
- %endif
- </script>
-</%def>
-
-<%def name="stylesheets()">
- <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
- <style>
- ## Not generic to all grids -- move to base?
- .count-box {
- min-width: 1.1em;
- padding: 5px;
- border-width: 1px;
- border-style: solid;
- text-align: center;
- display: inline-block;
- }
- </style>
-</%def>
-
-%if grid.standard_filters:
- <div class="grid-header">
- <h2>${grid.title}</h2>
- <span class="title">Filter:</span>
- %for i, filter in enumerate( grid.standard_filters ):
- %if i > 0:
- <span>|</span>
- %endif
- <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span>
- %endfor
- </div>
-%endif
-
-%if message:
- <p>
- <div class="${message_type}message transient-message">${message}</div>
- <div style="clear: both"></div>
- </p>
-%endif
-%if msg:
- ${render_msg( msg, messagetype )}
-%endif
-
-<form name="history_shared_by_others" action="${url()}" method="post" >
- <table class="grid">
- <thead>
- <tr>
- <th></th>
- %for column in grid.columns:
- %if column.visible:
- <%
- href = ""
- extra = ""
- if column.sortable:
- if sort_key == column.key:
- if sort_order == "asc":
- href = url( sort=( "-" + column.key ) )
- extra = "↓"
- else:
- href = url( sort=( column.key ) )
- extra = "↑"
- else:
- href = url( sort=column.key )
- %>
- <th\
- %if column.ncells > 1:
- colspan="${column.ncells}"
- %endif
- >
- %if href:
- <a href="${href}">${column.label}</a>
- %else:
- ${column.label}
- %endif
- <span>${extra}</span>
- </th>
- %endif
- %endfor
- <th></th>
- </tr>
- </thead>
- <tbody>
- %for i, history in enumerate( query ):
- <tr>
- ## Item selection column
- <td style="width: 1.5em;">
- <input type="checkbox" name="id" value=${trans.security.encode_id( history.id )} class="grid-row-select-checkbox" />
- </td>
- ## Data columns
- %for column in grid.columns:
- %if column.visible:
- <%
- # Link
- link = column.get_link( trans, grid, history )
- if link:
- href = url( **link )
- else:
- href = None
- # Value (coerced to list so we can loop)
- value = column.get_value( trans, grid, history )
- if column.ncells == 1:
- value = [ value ]
- %>
- %for cellnum, v in enumerate( value ):
- <%
- # Attach popup menu?
- if column.attach_popup and cellnum == 0:
- extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i
- else:
- extra = ""
- %>
- %if href:
- <td><a href="${href}">${v}</a> ${extra}</td>
- %else:
- <td >${v}${extra}</td>
- %endif
- </td>
- %endfor
- %endif
- %endfor
- ## Actions column
- <td>
- <div popupmenu="grid-${i}-popup">
- %for operation in grid.operations:
- %if operation.allowed( history ):
- <a class="action-button" href="${url( operation=operation.label, id=history.id )}">${operation.label}</a>
- %endif
- %endfor
- </div>
- </td>
- </tr>
- %endfor
- </tbody>
- <tfoot>
- <tr>
- <td></td>
- <td colspan="100">
- For <span class="grid-selected-count"></span> selected histories:
- %for operation in grid.operations:
- %if operation.allow_multiple:
- <input type="submit" name="operation" value="${operation.label}" class="action-button">
- %endif
- %endfor
- </td>
- </tr>
- </tfoot>
- </table>
-</form>
diff -r ea6708c96cd1 -r 3049432643f4 templates/history/stored_grid.mako
--- a/templates/history/stored_grid.mako Wed Aug 19 17:27:00 2009 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,196 +0,0 @@
-<%inherit file="/base.mako"/>
-<%def name="title()">${grid.title}</%def>
-
-%if message:
- <p>
- <div class="${message_type}message transient-message">${message}</div>
- <div style="clear: both"></div>
- </p>
-%endif
-
-<%def name="javascripts()">
- ${parent.javascripts()}
- <script type="text/javascript">
- ## TODO: generalize and move into galaxy.base.js
- $(document).ready(function() {
- $(".grid").each( function() {
- var grid = this;
- var checkboxes = $(this).find("input.grid-row-select-checkbox");
- var update = $(this).find( "span.grid-selected-count" );
- $(checkboxes).each( function() {
- $(this).change( function() {
- var n = $(checkboxes).filter("[checked]").size();
- update.text( n );
- });
- })
- });
- });
- ## Can this be moved into base.mako?
- %if refresh_frames:
- %if 'masthead' in refresh_frames:
- ## Refresh masthead == user changes (backward compatibility)
- if ( parent.user_changed ) {
- %if trans.user:
- parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} );
- %else:
- parent.user_changed( null, false );
- %endif
- }
- %endif
- %if 'history' in refresh_frames:
- if ( parent.frames && parent.frames.galaxy_history ) {
- parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}";
- if ( parent.force_right_panel ) {
- parent.force_right_panel( 'show' );
- }
- }
- %endif
- %if 'tools' in refresh_frames:
- if ( parent.frames && parent.frames.galaxy_tools ) {
- parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}";
- if ( parent.force_left_panel ) {
- parent.force_left_panel( 'show' );
- }
- }
- %endif
- %endif
- </script>
-</%def>
-
-<%def name="stylesheets()">
- <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
- <style>
- ## Not generic to all grids -- move to base?
- .count-box {
- min-width: 1.1em;
- padding: 5px;
- border-width: 1px;
- border-style: solid;
- text-align: center;
- display: inline-block;
- }
- </style>
-</%def>
-
-%if grid.standard_filters:
- <div class="grid-header">
- <h2>${grid.title}</h2>
- <span class="title">Filter:</span>
- %for i, filter in enumerate( grid.standard_filters ):
- %if i > 0:
- <span>|</span>
- %endif
- <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span>
- %endfor
- </div>
-%endif
-
-<form name="history_actions" action="${url()}" method="post" >
- <table class="grid">
- <thead>
- <tr>
- <th></th>
- %for column in grid.columns:
- %if column.visible:
- <%
- href = ""
- extra = ""
- if column.sortable:
- if sort_key == column.key:
- if sort_order == "asc":
- href = url( sort=( "-" + column.key ) )
- extra = "↓"
- else:
- href = url( sort=( column.key ) )
- extra = "↑"
- else:
- href = url( sort=column.key )
- %>
- <th\
- %if column.ncells > 1:
- colspan="${column.ncells}"
- %endif
- >
- %if href:
- <a href="${href}">${column.label}</a>
- %else:
- ${column.label}
- %endif
- <span>${extra}</span>
- </th>
- %endif
- %endfor
- <th></th>
- </tr>
- </thead>
- <tbody>
- %for i, item in enumerate( query ):
- <tr \
- %if current_item == item:
- class="current" \
- %endif
- >
- ## Item selection column
- <td style="width: 1.5em;">
- <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" />
- </td>
- ## Data columns
- %for column in grid.columns:
- %if column.visible:
- <%
- # Link
- link = column.get_link( trans, grid, item )
- if link:
- href = url( **link )
- else:
- href = None
- # Value (coerced to list so we can loop)
- value = column.get_value( trans, grid, item )
- if column.ncells == 1:
- value = [ value ]
- %>
- %for cellnum, v in enumerate( value ):
- <%
- # Attach popup menu?
- if column.attach_popup and cellnum == 0:
- extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i
- else:
- extra = ""
- %>
- %if href:
- <td><a href="${href}">${v}</a> ${extra}</td>
- %else:
- <td >${v}${extra}</td>
- %endif
- </td>
- %endfor
- %endif
- %endfor
- ## Actions column
- <td>
- <div popupmenu="grid-${i}-popup">
- %for operation in grid.operations:
- %if operation.allowed( item ):
- <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a>
- %endif
- %endfor
- </div>
- </td>
- </tr>
- %endfor
- </tbody>
- <tfoot>
- <tr>
- <td></td>
- <td colspan="100">
- For <span class="grid-selected-count"></span> selected histories:
- %for operation in grid.operations:
- %if operation.allow_multiple:
- <input type="submit" name="operation" value="${operation.label}" class="action-button">
- %endif
- %endfor
- </td>
- </tr>
- </tfoot>
- </table>
-</form>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/browse_libraries.mako
--- a/templates/library/browse_libraries.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/browse_libraries.mako Wed Aug 19 17:55:28 2009 -0400
@@ -1,9 +1,9 @@
<%inherit file="/base.mako"/>
<%namespace file="/message.mako" import="render_msg" />
-<%def name="title()">Browse Libraries</%def>
+<%def name="title()">Browse Data Libraries</%def>
-<h2>Libraries</h2>
+<h2>Data Libraries</h2>
%if msg:
${render_msg( msg, messagetype )}
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/browse_library.mako
--- a/templates/library/browse_library.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/browse_library.mako Wed Aug 19 17:55:28 2009 -0400
@@ -2,7 +2,7 @@
<%namespace file="/message.mako" import="render_msg" />
<% from galaxy import util %>
-<%def name="title()">Browse Library</%def>
+<%def name="title()">Browse data library</%def>
<%def name="stylesheets()">
<link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
<link href="${h.url_for('/static/style/library.css')}" rel="stylesheet" type="text/css" />
@@ -38,14 +38,21 @@
descendents = descendents.add( child_descendents );
});
// Set up expand / hide link
+ // HACK: assume descendents are invisible. The caller actually
+ // ensures this for the root node. However, if we start
+ // remembering folder states, we'll need something
+ // more sophisticated here.
+ var visible = false;
$(q).find( "span.expandLink").click( function() {
- if ( children.is( ":visible" ) ) {
+ if ( visible ) {
descendents.hide();
descendents.removeClass( "expanded" );
q.removeClass( "expanded" );
+ visible = false;
} else {
children.show();
q.addClass( "expanded" );
+ visible = true;
}
});
// Check/uncheck boxes in subfolders.
@@ -211,7 +218,7 @@
%endfor
</%def>
-<h2>Library “${library.name}”</h2>
+<h2>Data Library “${library.name}”</h2>
<ul class="manage-table-actions">
%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ):
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/folder_info.mako
--- a/templates/library/folder_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/folder_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/folder_permissions.mako
--- a/templates/library/folder_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/folder_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_edit_info.mako
--- a/templates/library/ldda_edit_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/ldda_edit_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -12,7 +12,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_info.mako
--- a/templates/library/ldda_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/ldda_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -19,7 +19,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/ldda_permissions.mako
--- a/templates/library/ldda_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/ldda_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -15,7 +15,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_dataset_info.mako
--- a/templates/library/library_dataset_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/library_dataset_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_dataset_permissions.mako
--- a/templates/library/library_dataset_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/library_dataset_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_info.mako
--- a/templates/library/library_info.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/library_info.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/library_permissions.mako
--- a/templates/library/library_permissions.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/library_permissions.mako Wed Aug 19 17:55:28 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/new_dataset.mako
--- a/templates/library/new_dataset.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/new_dataset.mako Wed Aug 19 17:55:28 2009 -0400
@@ -16,7 +16,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -68,7 +68,7 @@
%elif upload_option == 'upload_directory':
<div class="form-row">
<%
- # Directories of files from the Libraries view are restricted to a
+ # Directories of files from the Data Libraries view are restricted to a
# sub-directory named the same as the current user's email address
# contained within the configured setting for user_library_import_dir
user_library_import_dir = os.path.join( trans.app.config.user_library_import_dir, trans.user.email )
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/new_folder.mako
--- a/templates/library/new_folder.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/new_folder.mako Wed Aug 19 17:55:28 2009 -0400
@@ -4,7 +4,7 @@
<br/<br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/library/select_info_template.mako
--- a/templates/library/select_info_template.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/library/select_info_template.mako Wed Aug 19 17:55:28 2009 -0400
@@ -4,7 +4,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/edit_request.mako
--- a/templates/requests/edit_request.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/requests/edit_request.mako Wed Aug 19 17:55:28 2009 -0400
@@ -58,7 +58,7 @@
<div class="form-row">
<label>${field['label']}</label>
${field['widget'].get_html()}
- %if field['label'] == 'Library' and new_library:
+ %if field['label'] == 'Data library' and new_library:
${new_library.get_html()}
%endif
<div class="toolParamHelp" style="clear: both;">
diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/new_request.mako
--- a/templates/requests/new_request.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/requests/new_request.mako Wed Aug 19 17:55:28 2009 -0400
@@ -58,7 +58,7 @@
<div class="form-row">
<label>${field['label']}</label>
${field['widget'].get_html()}
- %if field['label'] == 'Library' and new_library:
+ %if field['label'] == 'Data library' and new_library:
${new_library.get_html()}
%endif
<div class="toolParamHelp" style="clear: both;">
diff -r ea6708c96cd1 -r 3049432643f4 templates/requests/show_request.mako
--- a/templates/requests/show_request.mako Wed Aug 19 17:27:00 2009 -0400
+++ b/templates/requests/show_request.mako Wed Aug 19 17:55:28 2009 -0400
@@ -79,7 +79,7 @@
%if not rd['value']:
<i>None</i>
%else:
- %if rd['label'] == 'Library':
+ %if rd['label'] == 'Data library':
%if rd['value']:
<a href="${h.url_for( controller='library', action='browse_library', id=request.library.id )}">${rd['value']}</a>
%else:
diff -r ea6708c96cd1 -r 3049432643f4 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Wed Aug 19 17:27:00 2009 -0400
+++ b/test/base/twilltestcase.py Wed Aug 19 17:55:28 2009 -0400
@@ -1003,7 +1003,7 @@
"""Create a new library"""
self.home()
self.visit_url( "%s/admin/library?new=True" % self.url )
- self.check_page_for_string( 'Create a new library' )
+ self.check_page_for_string( 'Create a new data library' )
tc.fv( "1", "1", name ) # form field 1 is the field named name...
tc.fv( "1", "2", description ) # form field 1 is the field named name...
tc.submit( "create_library_button" )
diff -r ea6708c96cd1 -r 3049432643f4 test/functional/test_security_and_libraries.py
--- a/test/functional/test_security_and_libraries.py Wed Aug 19 17:27:00 2009 -0400
+++ b/test/functional/test_security_and_libraries.py Wed Aug 19 17:55:28 2009 -0400
@@ -1451,7 +1451,7 @@
check_edit_page2( latest_3_lddas )
self.home()
def test_195_upload_directory_of_files_from_libraries_view( self ):
- """Testing uploading a directory of files to a root folder from the Libraries view"""
+ """Testing uploading a directory of files to a root folder from the Data Libraries view"""
# admin_user will not have the option sto upload a directory of files from the
# Libraries view since a sub-directory named the same as their email is not contained
# in the configured user_library_import_dir. However, since members of role_one have
diff -r ea6708c96cd1 -r 3049432643f4 tools/data_source/genbank.py
--- a/tools/data_source/genbank.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/data_source/genbank.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,6 +1,6 @@
#!/usr/bin/env python
from Bio import GenBank
-import sys, os, sets, textwrap
+import sys, os, textwrap
assert sys.version_info[:2] >= ( 2, 4 )
diff -r ea6708c96cd1 -r 3049432643f4 tools/data_source/ucsc_proxy.py
--- a/tools/data_source/ucsc_proxy.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/data_source/ucsc_proxy.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,6 +1,6 @@
#!/usr/bin/env python
import urllib
-import sys, os, sets
+import sys, os
assert sys.version_info[:2] >= ( 2, 4 )
diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/get_flanks.py
--- a/tools/new_operations/get_flanks.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/new_operations/get_flanks.py Wed Aug 19 17:55:28 2009 -0400
@@ -9,7 +9,7 @@
-o, --off=N: Offset
"""
-import sys, sets, re, os
+import sys, re, os
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
from bx.cookbook import doc_optparse
diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/operation_filter.py
--- a/tools/new_operations/operation_filter.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/new_operations/operation_filter.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,8 +1,13 @@
# runs after the job (and after the default post-filter)
-import sets, os
+import os
from galaxy import eggs
from galaxy import jobs
from galaxy.tools.parameters import DataToolParameter
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
#def exec_before_process(app, inp_data, out_data, param_dict, tool=None):
# """Sets the name of the data"""
@@ -11,8 +16,8 @@
# raise Exception, '<p><font color="yellow">Both Queries must be from the same genome build</font></p>'
def validate_input( trans, error_map, param_values, page_param_map ):
- dbkeys = sets.Set()
- data_param_names = sets.Set()
+ dbkeys = set()
+ data_param_names = set()
data_params = 0
for name, param in page_param_map.iteritems():
if isinstance( param, DataToolParameter ):
diff -r ea6708c96cd1 -r 3049432643f4 tools/new_operations/subtract_query.py
--- a/tools/new_operations/subtract_query.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/new_operations/subtract_query.py Wed Aug 19 17:55:28 2009 -0400
@@ -5,12 +5,16 @@
Subtract an entire query from another query
usage: %prog in_file_1 in_file_2 begin_col end_col output
"""
-
-import sys, sets, re
-
+import sys, re
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
from bx.cookbook import doc_optparse
+
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
diff -r ea6708c96cd1 -r 3049432643f4 tools/regVariation/windowSplitter.py
--- a/tools/regVariation/windowSplitter.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/regVariation/windowSplitter.py Wed Aug 19 17:55:28 2009 -0400
@@ -7,7 +7,7 @@
-l, --cols=N,N,N,N: Columns for chrom, start, end, strand in file
"""
-import sys, sets, re, os
+import sys, re, os
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/column_maker.py
--- a/tools/stats/column_maker.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/stats/column_maker.py Wed Aug 19 17:55:28 2009 -0400
@@ -2,7 +2,7 @@
# This tool takes a tab-delimited textfile as input and creates another column in the file which is the result of
# a computation performed on every row in the original file. The tool will skip over invalid lines within the file,
# informing the user about the number of lines skipped.
-import sys, sets, re, os.path
+import sys, re, os.path
from galaxy import eggs
from galaxy.tools import validation
from galaxy.datatypes import metadata
diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/filtering.py
--- a/tools/stats/filtering.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/stats/filtering.py Wed Aug 19 17:55:28 2009 -0400
@@ -2,8 +2,13 @@
# This tool takes a tab-delimited text file as input and creates filters on columns based on certain properties.
# The tool will skip over invalid lines within the file, informing the user about the number of lines skipped.
-import sys, sets, re, os.path
+import sys, re, os.path
from galaxy import eggs
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
@@ -13,7 +18,7 @@
for item in items_to_strip:
if filter_condition.find( item ) >= 0:
filter_condition = filter_condition.replace( item, ' ' )
- operands = sets.Set( filter_condition.split( ' ' ) )
+ operands = set( filter_condition.split( ' ' ) )
return operands
def stop_err( msg ):
diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/grouping.py
--- a/tools/stats/grouping.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/stats/grouping.py Wed Aug 19 17:55:28 2009 -0400
@@ -3,7 +3,7 @@
"""
This tool provides the SQL "group by" functionality.
"""
-import sys, string, re, commands, tempfile, random, sets
+import sys, string, re, commands, tempfile, random
from rpy import *
def stop_err(msg):
diff -r ea6708c96cd1 -r 3049432643f4 tools/stats/gsummary.py
--- a/tools/stats/gsummary.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/stats/gsummary.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,7 +1,12 @@
#!/usr/bin/python
-import sys, sets, re, tempfile
+import sys, re, tempfile
from rpy import *
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
@@ -33,7 +38,7 @@
for word in re.compile( '[a-zA-Z]+' ).findall( expression ):
if word and not word in math_allowed:
stop_err( "Invalid expression '%s': term '%s' is not recognized or allowed" %( expression, word ) )
- symbols = sets.Set()
+ symbols = set()
for symbol in re.compile( '[^a-z0-9\s]+' ).findall( expression ):
if symbol and not symbol in ops_allowed:
stop_err( "Invalid expression '%s': operator '%s' is not recognized or allowed" % ( expression, symbol ) )
diff -r ea6708c96cd1 -r 3049432643f4 tools/visualization/build_ucsc_custom_track_code.py
--- a/tools/visualization/build_ucsc_custom_track_code.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/visualization/build_ucsc_custom_track_code.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,6 +1,10 @@
# runs after the job (and after the default post-filter)
-from sets import Set as set
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
def validate_input( trans, error_map, param_values, page_param_map ):
dbkeys = set()
diff -r ea6708c96cd1 -r 3049432643f4 tools/visualization/genetrack_code.py
--- a/tools/visualization/genetrack_code.py Wed Aug 19 17:27:00 2009 -0400
+++ b/tools/visualization/genetrack_code.py Wed Aug 19 17:55:28 2009 -0400
@@ -1,4 +1,4 @@
-import sets, os
+import os
from galaxy import eggs
from galaxy import jobs
from galaxy.tools.parameters import DataToolParameter
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/bedfce38e652
changeset: 2599:bedfce38e652
user: Kanwei Li <kanwei(a)gmail.com>
date: Thu Aug 20 10:59:13 2009 -0400
description:
Merge trunk
0 file(s) affected in this change:
diffs (438 lines):
diff -r 3049432643f4 -r bedfce38e652 datatypes_conf.xml.sample
--- a/datatypes_conf.xml.sample Wed Aug 19 17:55:28 2009 -0400
+++ b/datatypes_conf.xml.sample Thu Aug 20 10:59:13 2009 -0400
@@ -3,6 +3,7 @@
<registration converters_path="lib/galaxy/datatypes/converters">
<datatype extension="ab1" type="galaxy.datatypes.images:Ab1" mimetype="application/octet-stream" display_in_upload="true"/>
<datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/>
+ <datatype extension="bam" type="galaxy.datatypes.images:Bam" mimetype="application/octet-stream"/>
<datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true">
<converter file="bed_to_gff_converter.xml" target_datatype="gff"/>
<converter file="interval_to_coverage.xml" target_datatype="coverage"/>
@@ -49,6 +50,7 @@
<datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/>
<datatype extension="qualsolid" type="galaxy.datatypes.qualityscore:QualityScoreSOLiD" display_in_upload="true"/>
<datatype extension="qual454" type="galaxy.datatypes.qualityscore:QualityScore454" display_in_upload="true"/>
+ <datatype extension="sam" type="galaxy.datatypes.tabular:Sam" display_in_upload="true"/>
<datatype extension="scf" type="galaxy.datatypes.images:Scf" mimetype="application/octet-stream" display_in_upload="true"/>
<datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/>
<datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/>
@@ -205,5 +207,6 @@
<sniffer type="galaxy.datatypes.interval:Gff"/>
<sniffer type="galaxy.datatypes.interval:Gff3"/>
<sniffer type="galaxy.datatypes.interval:Interval"/>
+ <sniffer type="galaxy.datatypes.tabular:Sam"/>
</sniffers>
</datatypes>
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/images.py
--- a/lib/galaxy/datatypes/images.py Wed Aug 19 17:55:28 2009 -0400
+++ b/lib/galaxy/datatypes/images.py Thu Aug 20 10:59:13 2009 -0400
@@ -4,6 +4,8 @@
import data
import logging
+from galaxy.datatypes.metadata import MetadataElement
+from galaxy.datatypes import metadata
from galaxy.datatypes.sniff import *
from urllib import urlencode, quote_plus
import zipfile
@@ -187,7 +189,7 @@
return 'text/html'
def sniff( self, filename ):
"""
- Determines wether the file is in html format
+ Determines whether the file is in html format
>>> fname = get_test_fname( 'complete.bed' )
>>> Html().sniff( fname )
@@ -233,3 +235,25 @@
return dataset.peek
except:
return "peek unavailable"
+
+class Bam( data.Binary ):
+ """Class describing a BAM binary file"""
+ file_ext = "bam"
+ MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True )
+ def set_peek( self, dataset ):
+ if not dataset.dataset.purged:
+ export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey})
+ dataset.peek = "Binary bam alignments file"
+ dataset.blurb = data.nice_size( dataset.get_size() )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+ def display_peek(self, dataset):
+ try:
+ return dataset.peek
+ except:
+ return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) )
+ def get_mime(self):
+ """Returns the mime type of the datatype"""
+ return 'application/octet-stream'
+
\ No newline at end of file
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/registry.py
--- a/lib/galaxy/datatypes/registry.py Wed Aug 19 17:55:28 2009 -0400
+++ b/lib/galaxy/datatypes/registry.py Thu Aug 20 10:59:13 2009 -0400
@@ -111,6 +111,7 @@
self.datatypes_by_extension = {
'ab1' : images.Ab1(),
'axt' : sequence.Axt(),
+ 'bam' : images.Bam(),
'bed' : interval.Bed(),
'binseq.zip' : images.Binseq(),
'blastxml' : xml.BlastXml(),
@@ -130,6 +131,7 @@
'qualsolid' : qualityscore.QualityScoreSOLiD(),
'qualsolexa' : qualityscore.QualityScoreSolexa(),
'qual454' : qualityscore.QualityScore454(),
+ 'sam' : tabular.Sam(),
'scf' : images.Scf(),
'tabular' : tabular.Tabular(),
'taxonomy' : tabular.Taxonomy(),
@@ -140,6 +142,7 @@
self.mimetypes_by_extension = {
'ab1' : 'application/octet-stream',
'axt' : 'text/plain',
+ 'bam' : 'application/octet-stream',
'bed' : 'text/plain',
'binseq.zip' : 'application/zip',
'blastxml' : 'text/plain',
@@ -157,6 +160,7 @@
'qualsolid' : 'text/plain',
'qualsolexa' : 'text/plain',
'qual454' : 'text/plain',
+ 'sam' : 'text/plain',
'scf' : 'application/octet-stream',
'tabular' : 'text/plain',
'taxonomy' : 'text/plain',
@@ -184,7 +188,8 @@
interval.CustomTrack(),
interval.Gff(),
interval.Gff3(),
- interval.Interval()
+ interval.Interval(),
+ tabular.Sam()
]
def append_to_sniff_order():
# Just in case any supported data types are not included in the config's sniff_order section.
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/tabular.py
--- a/lib/galaxy/datatypes/tabular.py Wed Aug 19 17:55:28 2009 -0400
+++ b/lib/galaxy/datatypes/tabular.py Thu Aug 20 10:59:13 2009 -0400
@@ -11,6 +11,7 @@
from cgi import escape
from galaxy.datatypes import metadata
from galaxy.datatypes.metadata import MetadataElement
+from sniff import *
log = logging.getLogger(__name__)
@@ -236,3 +237,84 @@
out = "Can't create peek %s" % exc
return out
+class Sam( Tabular ):
+ file_ext = 'sam'
+ def __init__(self, **kwd):
+ """Initialize taxonomy datatype"""
+ Tabular.__init__( self, **kwd )
+ self.column_names = ['QNAME', 'FLAG', 'RNAME', 'POS', 'MAPQ', 'CIGAR',
+ 'MRNM', 'MPOS', 'ISIZE', 'SEQ', 'QUAL', 'OPT'
+ ]
+ def make_html_table( self, dataset, skipchars=[] ):
+ """Create HTML table, used for displaying peek"""
+ out = ['<table cellspacing="0" cellpadding="3">']
+ try:
+ # Generate column header
+ out.append( '<tr>' )
+ for i, name in enumerate( self.column_names ):
+ out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) )
+ # This data type requires at least 11 columns in the data
+ if dataset.metadata.columns - len( self.column_names ) > 0:
+ for i in range( len( self.column_names ), dataset.metadata.columns ):
+ out.append( '<th>%s</th>' % str( i+1 ) )
+ out.append( '</tr>' )
+ out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) )
+ out.append( '</table>' )
+ out = "".join( out )
+ except Exception, exc:
+ out = "Can't create peek %s" % exc
+ return out
+ def sniff( self, filename ):
+ """
+ Determines whether the file is in SAM format
+
+ A file in SAM format consists of lines of tab-separated data.
+ The following header line may be the first line:
+ @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL
+ or
+ @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+ Data in the OPT column is optional and can consist of tab-separated data
+
+ For complete details see http://samtools.sourceforge.net/SAM1.pdf
+
+ Rules for sniffing as True:
+ There must be 11 or more columns of data on each line
+ Columns 2 (FLAG), 4(POS), 5 (MAPQ), 8 (MPOS), and 9 (ISIZE) must be numbers (9 can be negative)
+ We will only check that up to the first 5 alignments are correctly formatted.
+
+ >>> fname = get_test_fname( 'sequence.maf' )
+ >>> Sam().sniff( fname )
+ False
+ >>> fname = get_test_fname( '1.sam' )
+ >>> Sam().sniff( fname )
+ True
+ """
+ try:
+ fh = open( filename )
+ count = 0
+ while True:
+ line = fh.readline()
+ line = line.strip()
+ if not line:
+ break #EOF
+ if line:
+ if line[0] != '@':
+ linePieces = line.split('\t')
+ if len(linePieces) < 11:
+ return False
+ try:
+ check = int(linePieces[1])
+ check = int(linePieces[3])
+ check = int(linePieces[4])
+ check = int(linePieces[7])
+ check = int(linePieces[8])
+ except ValueError:
+ return False
+ count += 1
+ if count == 5:
+ return True
+ if count < 5 and count > 0:
+ return True
+ except:
+ pass
+ return False
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/datatypes/test/1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/1.sam Thu Aug 20 10:59:13 2009 -0400
@@ -0,0 +1,97 @@
+@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(#
+1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$
+1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$######
+1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$####
+1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'#
+1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&%
+1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$###
+1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$
+1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#&
+1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$#
+1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#'
+1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$##
+1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/
+1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$
+1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$
+1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'#
+1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&#
+1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$###
+1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%#
+1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_68_466 69 * 0 0 * * 0 0 GTGATCGTCGGTGCCAGTCCCTGT #(%)+##$#$#%#+$%##$#####
+1378_68_466 133 * 0 0 * * 0 0 GTGTCATCTGAGGTAAAGCATTGT /##$09#$#.=$#$76+$%1'###
+1378_68_1692 117 chr13.nib:1-114142980 36365609 0 24M = 36365609 0 TTGAACCGGGCACGGGTCTTCTGG #$#######%###$##%&'%)###
+1378_68_1692 153 chr13.nib:1-114142980 36365609 37 10M1D13M = 36365609 0 CTGCACATACAGAATATTCATAG 0010/!"0/!!021/132231// XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:10^T13
+1378_80_664 69 * 0 0 * * 0 0 CTGCTTTGATCCCCGGTGGAGCAC 7#%###$$6#######$##$$$##
+1378_80_664 133 * 0 0 * * 0 0 TGTCTGCGTTGTATCTCTGGTGTA %##%,%$$#&$$###$#$%##'%#
+1378_85_1786 69 * 0 0 * * 0 0 ATACTATGTCGATCTGTAAAAAAA )&.)#3%(a)$&%-,2#&+.-%0&./
+1378_85_1786 133 * 0 0 * * 0 0 CCCTAGGAGCGTATACCGGACGAG ,'&/%/@,&1,&'/)&,6&&1)((
+1378_86_1011 69 * 0 0 * * 0 0 CTACGTTATTGCTCTGTTTGTCCT ######$%##$$$%###%#$####
+1378_86_1011 133 * 0 0 * * 0 0 AGGCGATGGGATATTATTTTACTT :$###)%##$9$###1$$#$2###
+1378_86_1789 89 chr12.nib:1-132349534 39007065 37 23M = 39007065 0 GCTTTCCATAGATGTGTAATTTC J2K]]Z5!GN?@U]]]VX]UYYP XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_86_1789 181 chr12.nib:1-132349534 39007065 0 24M = 39007065 0 ACAACTTAAATAATCATGGACCGG 02,5$$0&6#%?*,$'#%&/15.1
+1378_91_1596 69 * 0 0 * * 0 0 TTAGCGGTTGACTATCTGCTGACA *&+'#9'(%*'#//,&<),/)'*#
+1378_91_1596 133 * 0 0 * * 0 0 GCTTTTTCATTCGGTGCCTTTGGA '>%/3%=()8'#.%?50$&5>%)%
+1378_94_1595 69 chr7.nib:1-158821424 127518258 0 24M = 127518258 0 CGTGCGACAGCCCATGTTTTCAGA -=..5,3826&*+.+#+#%%6;%#
+1378_94_1595 137 chr7.nib:1-158821424 127518258 37 23M = 127518258 0 TGAGATAAACACCTAACATGCTC M]]FN]]\V]]]Q>T]KIG:LVN XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_95_1039 69 * 0 0 * * 0 0 CGGCGTCCATCTTCGCCTTGAGAT $##.#$##$$#%$#$%%$###$)$
+1378_95_1039 133 * 0 0 * * 0 0 GTTCTGTGCCAGGTGAGGTACGGA &##,./#$&)6##+,'#$$0(##$
+1378_95_1767 65 chr11.nib:1-134452384 65333552 25 23M chr3.nib:1-199501827 123725482 0 CAACTGGTGGCATCTGGACAAAC W[[TZYY]]RO<BI7!!:!!>@2 XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_95_1767 129 chr3.nib:1-199501827 123725482 37 6M1I16M chr11.nib:1-134452384 65333552 0 ATTTATCTGTCTCATTCATTATT <AGB8B"!V]]UO/&JB4DE88E XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_96_1037 69 * 0 0 * * 0 0 ATCCCCCAAGATGCCTGTTGATTG $#$'##$$$#%$$#%###+##$#$
+1378_96_1037 133 * 0 0 * * 0 0 CTGCTGGGCCATTTGACTTACTCA '$#+#(##-%5##+*&###-.$$$
+1378_96_1764 81 chr15.nib:1-100338915 89251272 25 23M chr7.nib:1-158821424 19412615 0 AGAAATGGTCGCACCCTCTGGTT E*2ZEHX\SN]O>SYRL):LIOL XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_96_1764 161 chr7.nib:1-158821424 19412615 37 23M chr15.nib:1-100338915 89251272 0 GTATAGCCCACAACGCCTAATAT ZMBS]UW]UYR\]QPZ[SMYL7C XT:A:U CM:i:0 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_98_1574 69 * 0 0 * * 0 0 GTTCTGCCGGTGTCTGTGGCGGGC $$#+&$$####%$$$###$%#%%#
+1378_98_1574 133 * 0 0 * * 0 0 AGGCGAGTGTGGGGGTTGTTTGAG +%%$#)##%##$####%###$%$#
+1378_107_1647 69 * 0 0 * * 0 0 AGGCCTACTACGCGTCATTGATAG &#$$#$(.#%#$$####&$%##($
+1378_107_1647 133 * 0 0 * * 0 0 GGTCTGGTTCTATGTTGGTCGACT ###'$$#$$$(#%###(#$##$%#
+1378_111_829 69 chr9.nib:1-140273252 82506894 0 24M = 82506894 0 TGCGGCACTTGCTTCTTCGTATTT %#%##%#$%#$#%###$$##&#$$
+1378_111_829 137 chr9.nib:1-140273252 82506894 37 4M1I18M = 82506894 0 GATGCGTAATCTAGTAAAATAAG 0/362//00/5516500210451 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_111_1900 69 * 0 0 * * 0 0 TCCCCTCGCTCGGCTCTGTGCTGT $&%*$#(#)##$#'##%(##$#$%
+1378_111_1900 133 * 0 0 * * 0 0 GCACGCCTTTGGGCTAAGCCGTAA )$)'#%$########$'#&%$#(#
+1378_112_1483 69 * 0 0 * * 0 0 TGTCCAGCTATGCGGCTTCCTCCT %#$+#%#&#$#####%####%$##
+1378_112_1483 133 * 0 0 * * 0 0 TGGAGTGGTGTGTTTGCTGAGCCA #$#)#############$#%#%'%
+1378_125_1287 69 * 0 0 * * 0 0 TGTCTCTGGGGGGCCTGGTTAGGT $##13$'%#$###$$###$$$#&#
+1378_125_1287 133 * 0 0 * * 0 0 TGACGTGGGTTGTCCCGTGAGATT ##$%%#$###$##$$#&%##$(%%
+1378_126_468 117 chr11.nib:1-134452384 72541052 0 24M = 72541052 0 TGCCTCTATACAGATTAGTCCTCT )7,7..?97594@8=,=?813@>7
+1378_126_468 153 chr11.nib:1-134452384 72541052 0 23M = 72541052 0 AGGCAAGACTCTGTCTCAAAAAA PK5G]]PDT\]SEXY[]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:15713 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_127_664 69 * 0 0 * * 0 0 AGAGGTTGGTGTCTTGTCGCAGCT ##'#$######$$%######$$$#
+1378_127_664 133 * 0 0 * * 0 0 TCGCTTTGCCTATGTTTGTTCGGA #%$%#&##$%#%%###$$###)-'
+1378_129_463 97 chr8.nib:1-146274826 29931771 37 23M chr19.nib:1-63811651 5702213 0 GTAGCTCTGTTTCACATTAGGGG J>AQ[G>C?NM:GD=)*PLORIF XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_129_463 145 chr19.nib:1-63811651 5702213 0 23M chr8.nib:1-146274826 29931771 0 AAAAAAAAAAAAAAAAAAAAAAA JOI:AHGD==@KQB78HF>KA8> XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:583698 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_129_875 69 * 0 0 * * 0 0 TTTCTATGGCTTACGCTGTCTGCC #$($##%####%$#$#####$###
+1378_129_875 133 * 0 0 * * 0 0 GACCTTTACGTATTGGGGGTTGGC ###)###+###$##$#&%##$,#$
+1378_140_1251 69 * 0 0 * * 0 0 ATCCTAGCGCGGTGTCTTGGGGAC #$%1#$$$##$##$#$#$##$%$$
+1378_140_1251 133 * 0 0 * * 0 0 TTTCCTTCGTGTGCGTGCGGAGTG #%#%$##$$$######.$$$%#%(
+1378_141_809 69 * 0 0 * * 0 0 TGTCCTCCAGTGTCTGTTGGGTGT %&,-##$$#(%###$#$$'###'#
+1378_141_809 133 * 0 0 * * 0 0 TCTCGTGGTTTCTTTTTTATGTGT ##%)##$$#####%$#$#%%#'##
+1378_144_983 69 * 0 0 * * 0 0 AGCGCCCGGTTGGTGCGGCTCGTC -$(&%*$#*#))#$$$#%%$#$##
+1378_144_983 133 * 0 0 * * 0 0 GTTCGTTCGTGGTGTACGAGGGTG #(#%#####($#%##$$#%##%#)
+1378_153_270 69 * 0 0 * * 0 0 AGTCCTTGTCCCCTGGGTTTTCCC +''$#&%$%#$##&$$($#&#$$#
+1378_153_270 133 * 0 0 * * 0 0 GGCCGTGTGCGGGTGTAGATTGGA %$##($######&##$&$$$$%##
+1378_155_1689 65 chrX.nib:1-154913754 106941539 37 23M = 106940385 -1154 ATCTCCTCTTCCTTCCATTCCAC \]]]Y]]]]]UV]]]ZYZZ]]RV XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_155_1689 129 chrX.nib:1-154913754 106940385 37 23M = 106941539 1154 GACTATGAGGTTTTCATTCAACA ]]]]\\]]]YW]]]WRZ]]WIOK XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_157_1580 69 * 0 0 * * 0 0 TGGGCCTCGGTGCCCTTGGTCTGT #%)$##'#$$$&#####%#$#$##
+1378_157_1580 133 * 0 0 * * 0 0 GGGATTGAAGGGATGTATGCTAGG #%$&%#$$'%$%#$##*#%$$$$#
+1378_161_317 69 * 0 0 * * 0 0 TTGGCCGGCAACCCCGGTACCTAA 7<,<'@)@>.)2@/')'&(?/-<(
+1378_161_317 133 * 0 0 * * 0 0 AATCCATACCCACAAAAGCAGGCC .&%','(@''?7//+&)+2.+)0)
+1378_177_735 113 chr2.nib:1-242951149 222173182 25 23M = 222173882 700 TTGTTCAGCGCCGATTGTCAATC KPNICFMS]]]Z]]]]Y]]]]]] XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:1G21
+1378_177_735 177 chr2.nib:1-242951149 222173882 37 23M = 222173182 -700 AGAATTCCTAACAAAATGTGAAG ES6-]]]]]]]]]]]]]]]]]]] XT:A:U CM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_181_1684 69 * 0 0 * * 0 0 CGACTCCCGCATTCACGGTCAAGT &*#,##$#&$*$$#$#$$$#%$##
+1378_181_1684 133 * 0 0 * * 0 0 TTTCTGTTGTGGTTTTGTTGGGGT $##'$%'##%##$%$#$$####$*
+1378_187_1407 69 * 0 0 * * 0 0 TGGCGTCCACTCGTGGGTCTATCG $#$'%#$%$%&$%#####$#$#%#
+1378_187_1407 133 * 0 0 * * 0 0 TTGGGTGAAATCTTGTCGAGTGGA ####&##$$###$#####%##%%)
+1378_203_721 97 chr1.nib:1-247249719 245680524 25 23M chr2.nib:1-242951149 213173999 0 GTAAAATTTGTGGAGATTTAAGT ]VEFFEZ]XPW]TOVINQ,;T!! XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_203_721 145 chr2.nib:1-242951149 213173999 37 4M1I18M chr1.nib:1-247249719 245680524 0 ACCTAACAAAATTGTTCAATATG F>8AWT<AV]Q9B"+]O@IF=K] XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_206_2039 113 chr4.nib:1-191273063 103793427 0 23M chr18.nib:1-76117153 57165542 0 ACACACACACACACACACACACA NKWZVWZ]]XV[]]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_206_2039 177 chr18.nib:1-76117153 57165542 0 23M chr4.nib:1-191273063 103793427 0 CACACACACACACACACACACAC NAJ[SPT[]]]W[]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/tools/actions/metadata.py
--- a/lib/galaxy/tools/actions/metadata.py Wed Aug 19 17:55:28 2009 -0400
+++ b/lib/galaxy/tools/actions/metadata.py Thu Aug 20 10:59:13 2009 -0400
@@ -1,4 +1,4 @@
-from . import ToolAction
+from __init__ import ToolAction
from galaxy.datatypes.metadata import JobExternalOutputMetadataWrapper
import logging
diff -r 3049432643f4 -r bedfce38e652 lib/galaxy/tools/actions/upload.py
--- a/lib/galaxy/tools/actions/upload.py Wed Aug 19 17:55:28 2009 -0400
+++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 10:59:13 2009 -0400
@@ -1,5 +1,5 @@
import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile
-from . import ToolAction
+from __init__ import ToolAction
from galaxy import datatypes, jobs
from galaxy.datatypes import sniff
from galaxy import model, util
diff -r 3049432643f4 -r bedfce38e652 static/scripts/galaxy.workflow_editor.canvas.js
--- a/static/scripts/galaxy.workflow_editor.canvas.js Wed Aug 19 17:55:28 2009 -0400
+++ b/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 10:59:13 2009 -0400
@@ -439,25 +439,11 @@
});
});
},
- enable_auto_save : function() {
- // Implements auto-saving based on whether the inputs change. We consider
- // "changed" to be when a field is accessed and not necessarily modified
- // because of an issue where "onchange" is not triggered when activating
- // another node, or saving the workflow.
- outer_this = this;
- $(".toolFormBody").find("input,textarea,select").each( function() {
- $(this).focus( function() {
- outer_this.active_form_has_changes = true;
- });
- });
- },
check_changes_in_active_form : function() {
// If active form has changed, save it
if (this.active_form_has_changes) {
this.has_changes = true;
- $(".toolFormBody").find("form").each( function() {
- $(this).submit();
- });
+ $("#right-content").find("form").submit();
this.active_form_has_changes = false;
}
},
diff -r 3049432643f4 -r bedfce38e652 templates/workflow/editor.mako
--- a/templates/workflow/editor.mako Wed Aug 19 17:55:28 2009 -0400
+++ b/templates/workflow/editor.mako Thu Aug 20 10:59:13 2009 -0400
@@ -303,6 +303,15 @@
$(this).remove();
make_popupmenu( b, options );
});
+ // Implements auto-saving based on whether the inputs change. We consider
+ // "changed" to be when a field is accessed and not necessarily modified
+ // because of an issue where "onchange" is not triggered when activating
+ // another node, or saving the workflow.
+ $(this).find("input,textarea,select").each( function() {
+ $(this).focus( function() {
+ workflow.active_form_has_changes = true;
+ });
+ });
});
}
diff -r 3049432643f4 -r bedfce38e652 test-data/1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.sam Thu Aug 20 10:59:13 2009 -0400
@@ -0,0 +1,29 @@
+@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(#
+1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$
+1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$######
+1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$####
+1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'#
+1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&%
+1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$###
+1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$
+1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#&
+1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$#
+1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#'
+1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$##
+1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/
+1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$
+1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$
+1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'#
+1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&#
+1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$###
+1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%#
+1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
\ No newline at end of file
diff -r 3049432643f4 -r bedfce38e652 test/functional/test_sniffing_and_metadata_settings.py
--- a/test/functional/test_sniffing_and_metadata_settings.py Wed Aug 19 17:55:28 2009 -0400
+++ b/test/functional/test_sniffing_and_metadata_settings.py Thu Aug 20 10:59:13 2009 -0400
@@ -226,6 +226,16 @@
assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database"
if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger':
raise AssertionError, "fastqsanger data type was not correctly sniffed."
+ def test_090_sam_datatype( self ):
+ """Testing correctly sniffing sam format upon upload"""
+ self.upload_file( '1.sam' )
+ self.verify_dataset_correctness( '1.sam' )
+ self.check_history_for_string( '1.sam format: <span class="sam">sam</span>, database: \? Info: uploaded sam file' )
+ latest_hda = galaxy.model.HistoryDatasetAssociation.query() \
+ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first()
+ assert latest_hda is not None, "Problem retrieving sam hda from the database"
+ if not latest_hda.name == '1.sam' and not latest_hda.extension == 'sam':
+ raise AssertionError, "sam data type was not correctly sniffed."
def test_9999_clean_up( self ):
self.delete_history( id=self.security.encode_id( history1.id ) )
self.logout()
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/574cc8f15d2e
changeset: 2590:574cc8f15d2e
user: anton(a)nekrut-mbp.bx.psu.edu
date: Thu Aug 20 17:33:39 2009 -0400
description:
Fixed a stupid and truly horrible paired end splitter bug
3 file(s) affected in this change:
static/welcome.html
tools/metag_tools/split_paired_reads.py
tools/solid_tools/maq_cs_wrapper.py
diffs (76 lines):
diff -r a7f9325bb319 -r 574cc8f15d2e static/welcome.html
--- a/static/welcome.html Thu Aug 20 11:43:28 2009 -0400
+++ b/static/welcome.html Thu Aug 20 17:33:39 2009 -0400
@@ -71,7 +71,7 @@
<table border="0" cellpadding="0" cellspacing="0" width="100%">
<tr>
<td>
- <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:500,scroll:'no'})">
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/quickie1_TabSeq.flv',width:640,height:500,scroll:'no'})">
<div class="quickie">
<img src="images/qk/quickie1_small.png" border="0">
</div>
diff -r a7f9325bb319 -r 574cc8f15d2e tools/metag_tools/split_paired_reads.py
--- a/tools/metag_tools/split_paired_reads.py Thu Aug 20 11:43:28 2009 -0400
+++ b/tools/metag_tools/split_paired_reads.py Thu Aug 20 17:33:39 2009 -0400
@@ -1,7 +1,7 @@
#! /usr/bin/python
"""
-Split Solexa paired end reads
+Split fixed length paired end reads
"""
import os, sys
@@ -12,9 +12,13 @@
outfile_end1 = open(sys.argv[2], 'w')
outfile_end2 = open(sys.argv[3], 'w')
- for i, line in enumerate(file(infile)):
+ i = 0
+
+ for line in file( infile ):
line = line.rstrip()
- if not line or line.startswith('#'): continue
+
+ if not line:
+ continue
end1 = ''
end2 = ''
@@ -42,5 +46,9 @@
outfile_end1.write('%s\n' %(end1))
outfile_end2.write('%s\n' %(end2))
+ i += 1
+
+ if i % 4 != 0 :
+ sys.stderr.write("WARNING: Number of lines in the input file was not divisible by 4.\nCheck consistency of the input fastq file.\n")
outfile_end1.close()
outfile_end2.close()
\ No newline at end of file
diff -r a7f9325bb319 -r 574cc8f15d2e tools/solid_tools/maq_cs_wrapper.py
--- a/tools/solid_tools/maq_cs_wrapper.py Thu Aug 20 11:43:28 2009 -0400
+++ b/tools/solid_tools/maq_cs_wrapper.py Thu Aug 20 17:33:39 2009 -0400
@@ -48,9 +48,9 @@
cmd1 = "solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,tmps.name,f3_read_fname,f3_qual_fname,r3_read_fname,r3_qual_fname)
try:
os.system(cmd1)
- os.system('zcat -f %s >> %s' %(tmpf.name,tmpffastq.name))
- os.system('zcat -f %s >> %s' %(tmpr.name,tmprfastq.name))
- os.system('zcat -f %s >> %s' %(tmps.name,tmpsfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpf.name,tmpffastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpr.name,tmprfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmps.name,tmpsfastq.name))
except Exception, eq:
stop_err("Error converting data to fastq format." + str(eq))
@@ -135,7 +135,7 @@
cmd1 = "solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,None,None,f3_read_fname,f3_qual_fname,None,None)
try:
os.system(cmd1)
- os.system('zcat -f %s >> %s' %(tmpf.name,tmpfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpf.name,tmpfastq.name))
tmpf.close()
except:
stop_err("Error converting data to fastq format.")
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/0fb05cc2b05f
changeset: 2591:0fb05cc2b05f
user: Nate Coraor <nate(a)bx.psu.edu>
date: Fri Aug 21 09:56:35 2009 -0400
description:
Force FieldStorage to write tempfiles and never use StringIOs.
2 file(s) affected in this change:
lib/galaxy/tools/actions/upload.py
lib/galaxy/web/framework/base.py
diffs (44 lines):
diff -r 574cc8f15d2e -r 0fb05cc2b05f lib/galaxy/tools/actions/upload.py
--- a/lib/galaxy/tools/actions/upload.py Thu Aug 20 17:33:39 2009 -0400
+++ b/lib/galaxy/tools/actions/upload.py Fri Aug 21 09:56:35 2009 -0400
@@ -20,12 +20,10 @@
for upload_dataset in incoming['files']:
f = upload_dataset['file_data']
if isinstance( f, FieldStorage ):
- # very small files can be StringIOs
- if 'name' in dir( f.file ) and f.file.name != '<fdopen>':
- local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' )
- f.file.close()
- else:
- local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0]
+ assert not isinstance( f.file, StringIO.StringIO )
+ assert f.file.name != '<fdopen>'
+ local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' )
+ f.file.close()
upload_dataset['file_data'] = dict( filename = f.filename,
local_filename = local_filename )
if upload_dataset['url_paste'].strip() != '':
diff -r 574cc8f15d2e -r 0fb05cc2b05f lib/galaxy/web/framework/base.py
--- a/lib/galaxy/web/framework/base.py Thu Aug 20 17:33:39 2009 -0400
+++ b/lib/galaxy/web/framework/base.py Fri Aug 21 09:56:35 2009 -0400
@@ -216,11 +216,18 @@
# tempfiles. Necessary for externalizing the upload tool. It's a little hacky
# but for performance reasons it's way better to use Paste's tempfile than to
# create a new one and copy.
-import cgi
+import cgi, tempfile
class FieldStorage( cgi.FieldStorage ):
def make_file(self, binary=None):
- import tempfile
return tempfile.NamedTemporaryFile()
+ def read_lines(self):
+ # Always make a new file
+ self.file = self.make_file()
+ self.__file = None
+ if self.outerboundary:
+ self.read_lines_to_outerboundary()
+ else:
+ self.read_lines_to_eof()
cgi.FieldStorage = FieldStorage
class Request( webob.Request ):
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/2c1916d89194
changeset: 2592:2c1916d89194
user: guru
date: Fri Aug 21 11:40:51 2009 -0400
description:
Change dbkey of unmapped liftover dataset to the input dataset's dbkey.
1 file(s) affected in this change:
tools/extract/liftOver_wrapper_code.py
diffs (11 lines):
diff -r 0fb05cc2b05f -r 2c1916d89194 tools/extract/liftOver_wrapper_code.py
--- a/tools/extract/liftOver_wrapper_code.py Fri Aug 21 09:56:35 2009 -0400
+++ b/tools/extract/liftOver_wrapper_code.py Fri Aug 21 11:40:51 2009 -0400
@@ -3,7 +3,6 @@
to_dbkey = param_dict['to_dbkey'].split('.')[0].split('To')[1]
to_dbkey = to_dbkey[0].lower()+to_dbkey[1:]
out_data['out_file1'].set_dbkey(to_dbkey)
- out_data['out_file2'].set_dbkey(to_dbkey)
out_data['out_file1'].name = out_data['out_file1'].name + " [ MAPPED COORDINATES ]"
out_data['out_file2'].name = out_data['out_file2'].name + " [ UNMAPPED COORDINATES ]"
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/55b0c25aa164
changeset: 2594:55b0c25aa164
user: rc
date: Fri Aug 21 15:17:26 2009 -0400
description:
Added request editing functional test
Fixed a few bugs on the admin side request error handling and editing
6 file(s) affected in this change:
lib/galaxy/web/controllers/requests.py
lib/galaxy/web/controllers/requests_admin.py
templates/admin/requests/show_request.mako
templates/user/address.mako
test/base/twilltestcase.py
test/functional/test_forms_and_requests.py
diffs (353 lines):
diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests.py
--- a/lib/galaxy/web/controllers/requests.py Thu Aug 20 16:54:44 2009 -0400
+++ b/lib/galaxy/web/controllers/requests.py Fri Aug 21 15:17:26 2009 -0400
@@ -141,6 +141,9 @@
helptext=''))
request_details.append(dict(label='Type',
value=request.type.name,
+ helptext=''))
+ request_details.append(dict(label='State',
+ value=request.state,
helptext=''))
request_details.append(dict(label='Date created',
value=request.create_time,
diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests_admin.py
--- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400
+++ b/lib/galaxy/web/controllers/requests_admin.py Fri Aug 21 15:17:26 2009 -0400
@@ -32,7 +32,7 @@
]
operations = [
grids.GridOperation( "Submit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() and item.samples ) ),
- grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ),
+ grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ),
grids.GridOperation( "Delete", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ),
grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ),
]
@@ -71,14 +71,15 @@
'''
List all request made by the current user
'''
- status = message = None
+ message = util.restore_text( kwargs.get( 'message', '' ) )
+ status = kwargs.get( 'status', 'done' )
self.request_grid.default_filter = dict(state=trans.app.model.Request.states.SUBMITTED,
deleted=False)
if 'operation' in kwargs:
operation = kwargs['operation'].lower()
if operation == "show_request":
id = trans.security.decode_id(kwargs['id'])
- return self.__show_request(trans, id)
+ return self.__show_request(trans, id, status, message)
elif operation == "submit":
id = trans.security.decode_id(kwargs['id'])
return self.__submit(trans, id)
@@ -110,7 +111,7 @@
try:
request = trans.app.model.Request.get(int(params.get('request_id', None)))
except:
- return trans.response.send_redirect( web.url_for( controller='requests',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
status='error',
message="Invalid request ID",
@@ -125,13 +126,13 @@
kwd['messagetype'] = 'error'
kwd['msg'] = msg
kwd['show'] = 'True'
- return trans.response.send_redirect( web.url_for( controller='requests',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='edit',
**kwd) )
request = self.__save_request(trans, request, **kwd)
msg = 'The changes made to the request named %s has been saved' % request.name
if params.get('save_changes_request_button', False) == 'Save changes':
- return trans.response.send_redirect( web.url_for( controller='requests',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
message=msg ,
status='done') )
@@ -139,7 +140,7 @@
new_kwd = {}
new_kwd['request_id'] = request.id
new_kwd['edit_samples_button'] = 'Edit samples'
- return trans.response.send_redirect( web.url_for( controller='requests',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='show_request',
msg=msg ,
messagetype='done',
@@ -177,7 +178,7 @@
widget=TextField('desc', 40, desc),
helptext='(Optional)'))
# libraries selectbox
- libui = self.__library_ui(trans, trans.user, request, **kwd)
+ libui = self.__library_ui(trans, request.user, request, **kwd)
widgets = widgets + libui
widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd)
return trans.fill_template( '/admin/requests/edit_request.mako',
@@ -212,6 +213,7 @@
kwd['id'] = trans.security.encode_id(request.id)
return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
+ show_filter=trans.app.model.Request.states.UNSUBMITTED,
status='done',
message='The request <b>%s</b> has been deleted.' % request.name,
**kwd) )
@@ -233,6 +235,7 @@
kwd['id'] = trans.security.encode_id(request.id)
return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
+ show_filter=trans.app.model.Request.states.UNSUBMITTED,
status='done',
message='The request <b>%s</b> has been undeleted.' % request.name,
**kwd) )
@@ -290,7 +293,7 @@
if msg:
return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='edit',
- messagetype = 'error',
+ messagetype='error',
msg=msg,
request_id=request.id,
show='True') )
@@ -328,11 +331,11 @@
for field_index in range(len(request.type.sample_form.fields)):
sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) ))
self.current_samples.append([sample_name, sample_values])
- def __show_request(self, trans, id):
+ def __show_request(self, trans, id, messagetype, msg):
try:
request = trans.app.model.Request.get(id)
except:
- return trans.response.send_redirect( web.url_for( controller='requests',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
status='error',
message="Invalid request ID",
@@ -348,7 +351,8 @@
current_samples = self.current_samples,
sample_copy=self.__copy_sample(),
details_state=self.details_state,
- edit_mode=self.edit_mode)
+ edit_mode=self.edit_mode,
+ msg=msg, messagetype=messagetype)
@web.expose
@web.require_admin
def show_request(self, trans, **kwd):
@@ -381,7 +385,9 @@
return trans.response.send_redirect( web.url_for( controller='requests_admin',
action='list',
status='error',
- message='Error in importing <b>%s</b> samples file' % file_obj.file,
+ operation='show_request',
+ id=trans.security.encode_id(request.id),
+ message='Error in importing samples from the given file.',
**kwd))
elif params.get('add_sample_button', False) == 'Add New':
# save the all (saved+unsaved) sample info in 'current_samples'
@@ -526,20 +532,20 @@
# list of widgets to be rendered on the request form
request_details = []
# main details
+ request_details.append(dict(label='User',
+ value=str(request.user.email),
+ helptext=''))
request_details.append(dict(label='Description',
value=request.desc,
helptext=''))
request_details.append(dict(label='Type',
value=request.type.name,
helptext=''))
+ request_details.append(dict(label='State',
+ value=request.state,
+ helptext=''))
request_details.append(dict(label='Date created',
value=request.create_time,
- helptext=''))
- request_details.append(dict(label='Date updated',
- value=request.create_time,
- helptext=''))
- request_details.append(dict(label='User',
- value=str(request.user.email),
helptext=''))
# library associated
if request.library:
@@ -778,7 +784,7 @@
value = util.restore_text(params.get('field_%i' % index, ''))
if value == 'new':
# save this new address in the list of this user's addresses
- user_address = trans.app.model.UserAddress( user=trans.user )
+ user_address = trans.app.model.UserAddress( user=user )
user_address.desc = util.restore_text(params.get('field_%i_short_desc' % index, ''))
user_address.name = util.restore_text(params.get('field_%i_name' % index, ''))
user_address.institution = util.restore_text(params.get('field_%i_institution' % index, ''))
@@ -812,7 +818,6 @@
request.user = user
request.values = form_values
request.library = library
- request.state = trans.app.model.Request.states.UNSUBMITTED
request.flush()
return request
@web.expose
diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/admin/requests/show_request.mako
--- a/templates/admin/requests/show_request.mako Thu Aug 20 16:54:44 2009 -0400
+++ b/templates/admin/requests/show_request.mako Fri Aug 21 15:17:26 2009 -0400
@@ -162,7 +162,7 @@
<tr>
<div class="form-row">
<td>
- %if current_samples:
+ %if current_samples and not request.complete():
<input type="submit" name="edit_samples_button" value="Edit samples"/>
%endif
</td>
diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/user/address.mako
--- a/templates/user/address.mako Thu Aug 20 16:54:44 2009 -0400
+++ b/templates/user/address.mako Fri Aug 21 15:17:26 2009 -0400
@@ -33,51 +33,48 @@
</div>
-
-<div class="toolForm">
- ##<div class="toolFormTitle">Addresses</div>
- <div class="toolFormBody">
- <% trans.user.refresh() %>
- %if not trans.user.addresses:
- <label>There are no addresses</label>
- %else:
- <table class="grid">
- <tbody>
- %for index, address in enumerate(addresses):
- <tr class="libraryRow libraryOrFolderRow" id="libraryRow">
-
- <td>
- <div class="form-row">
- <label>${address.desc}</label>
- ${address.display()}
- </div>
- <div class="form-row">
- <ul class="manage-table-actions">
- <li>
- %if not address.deleted:
- <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id,
- short_desc=address.desc,
- name=address.name, institution=address.institution,
- address1=address.address, city=address.city,
- state=address.state, postal_code=address.postal_code,
- country=address.country, phone=address.phone)}">
- <span>Edit</span></a>
- <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}">
- <span>Delete address</span></a>
- %else:
- <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}">
- <span>Undelete address</span></a>
- %endif
-
- </li>
- </ul>
- </div>
- </td>
- </tr>
- %endfor
- </tbody>
- </table>
- %endif
+%if not addresses:
+ <label>There are no addresses</label>
+%else:
+ <div class="toolForm">
+ <div class="toolFormBody">
+ <% trans.user.refresh() %>
+ <table class="grid">
+ <tbody>
+ %for index, address in enumerate(addresses):
+ <tr class="libraryRow libraryOrFolderRow" id="libraryRow">
+ <td>
+ <div class="form-row">
+ <label>${address.desc}</label>
+ ${address.display()}
+ </div>
+ <div class="form-row">
+ <ul class="manage-table-actions">
+ <li>
+ %if not address.deleted:
+ <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id,
+ short_desc=address.desc,
+ name=address.name, institution=address.institution,
+ address1=address.address, city=address.city,
+ state=address.state, postal_code=address.postal_code,
+ country=address.country, phone=address.phone)}">
+ <span>Edit</span></a>
+ <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}">
+ <span>Delete</span></a>
+ %else:
+ <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}">
+ <span>Undelete</span></a>
+ %endif
+
+ </li>
+ </ul>
+ </div>
+ </td>
+ </tr>
+ %endfor
+ </tbody>
+ </table>
+ %endif
+ </div>
</div>
-</div>
%endif
\ No newline at end of file
diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400
+++ b/test/base/twilltestcase.py Fri Aug 21 15:17:26 2009 -0400
@@ -1088,6 +1088,16 @@
for index, field_value in enumerate(fields):
tc.fv( "1", "field_%i" % index, field_value )
tc.submit( "create_request_button" )
+ def edit_request( self, request_id, name, new_name, new_desc, new_library_id, new_fields):
+ self.home()
+ self.visit_url( "%s/requests/edit?request_id=%i&show=True" % (self.url, request_id) )
+ self.check_page_for_string( 'Edit request "%s"' % name )
+ tc.fv( "1", "name", new_name )
+ tc.fv( "1", "desc", new_desc )
+ tc.fv( "1", "library_id", str(new_library_id) )
+ for index, field_value in enumerate(new_fields):
+ tc.fv( "1", "field_%i" % index, field_value )
+ tc.submit( "save_changes_request_button" )
def add_samples( self, request_id, request_name, samples ):
self.home()
self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) ))
diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/functional/test_forms_and_requests.py
--- a/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400
+++ b/test/functional/test_forms_and_requests.py Fri Aug 21 15:17:26 2009 -0400
@@ -167,7 +167,7 @@
user_address.flush()
user_address.user.refresh()
def test_030_create_request( self ):
- """Testing creating and submitting a request as a regular user"""
+ """Testing creating, editing and submitting a request as a regular user"""
# login as a regular user
self.logout()
self.login( email='test1(a)bx.psu.edu' )
@@ -193,6 +193,12 @@
self.check_page_for_string( 'Unsubmitted' )
for field_value in fields:
self.check_page_for_string( field_value )
+ # edit this request
+ fields = ['field one value (editted)', 'field two value (editted)', str(user_address.id)]
+ self.edit_request(request_one.id, request_one.name, request_one.name+' (Renamed)', request_one.desc+' (Re-described)', library_one.id, fields)
+ request_one.refresh()
+ self.check_page_for_string( request_name+' (Renamed)' )
+ self.check_page_for_string( request_desc+' (Re-described)' )
# submit the request
self.submit_request( request_one.id, request_one.name )
request_one.refresh()
@@ -264,4 +270,5 @@
+
\ No newline at end of file
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/fc4c0c7e5da9
changeset: 2593:fc4c0c7e5da9
user: rc
date: Thu Aug 20 16:54:44 2009 -0400
description:
Fixed a bug in rendering form wrt AddressField
Fixed other bugs admin's request UI
6 file(s) affected in this change:
lib/galaxy/web/controllers/forms.py
lib/galaxy/web/controllers/requests_admin.py
lib/galaxy/web/framework/__init__.py
templates/admin/requests/grid.mako
test/base/twilltestcase.py
test/functional/test_forms_and_requests.py
diffs (290 lines):
diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/forms.py
--- a/lib/galaxy/web/controllers/forms.py Thu Aug 20 11:43:28 2009 -0400
+++ b/lib/galaxy/web/controllers/forms.py Thu Aug 20 16:54:44 2009 -0400
@@ -421,12 +421,14 @@
return [ fdc.latest_form for fdc in fdc_list ]
-def get_form_widgets( trans, form, contents=[], **kwd ):
+def get_form_widgets( trans, form, contents=[], user=None, **kwd ):
'''
Return the list of widgets that comprise a form definition,
including field contents if any.
'''
params = util.Params( kwd )
+ if not user:
+ user = trans.user
widgets = []
for index, field in enumerate( form.fields ):
field_name = 'field_%i' % index
@@ -458,7 +460,7 @@
field_widget.set_size( 3, 40 )
field_widget.value = value
elif field['type'] == 'AddressField':
- field_widget.user = trans.user
+ field_widget.user = user
field_widget.value = value
field_widget.params = params
elif field[ 'type' ] == 'SelectField':
diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/requests_admin.py
--- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 11:43:28 2009 -0400
+++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400
@@ -177,10 +177,9 @@
widget=TextField('desc', 40, desc),
helptext='(Optional)'))
# libraries selectbox
- libraries = get_authorized_libs(trans, trans.user)
- libui = self.__library_ui(libraries, request, **kwd)
+ libui = self.__library_ui(trans, trans.user, request, **kwd)
widgets = widgets + libui
- widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd)
+ widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd)
return trans.fill_template( '/admin/requests/edit_request.mako',
select_request_type=select_request_type,
request_type=request.type,
@@ -673,13 +672,9 @@
util.restore_text( params.get( 'desc', '' ) )),
helptext='(Optional)'))
# libraries selectbox
- if not user:
- libraries = []
- else:
- libraries = get_authorized_libs(trans, user)
- libui = self.__library_ui(libraries, **kwd)
+ libui = self.__library_ui(trans, user, **kwd)
widgets = widgets + libui
- widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd)
+ widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], user=user, **kwd)
return trans.fill_template( '/admin/requests/new_request.mako',
select_request_type=select_request_type,
request_type=request_type,
@@ -706,9 +701,13 @@
select_user.add_option(user.email, user.id)
return select_user
- def __library_ui(self, libraries, request=None, **kwd):
+ def __library_ui(self, trans, user, request=None, **kwd):
params = util.Params( kwd )
lib_id = params.get( 'library_id', 'none' )
+ if not user:
+ libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all()
+ else:
+ libraries = get_authorized_libs(trans, user)
lib_list = SelectField('library_id', refresh_on_change=True,
refresh_on_change_values=['new'])
if request and lib_id == 'none':
@@ -724,13 +723,12 @@
else:
lib_list.add_option(lib.name, lib.id)
if lib_id == 'new':
- lib_list.add_option('Create a new library', 'new', selected=True)
+ lib_list.add_option('Create a new data library', 'new', selected=True)
else:
- lib_list.add_option('Create a new library', 'new')
- widget = dict(label='Library',
+ lib_list.add_option('Create a new data library', 'new')
+ widget = dict(label='Data library',
widget=lib_list,
- helptext='Associated library where the resultant \
- dataset will be stored.')
+ helptext='Data library where the resultant dataset will be stored.')
if lib_id == 'new':
new_lib = dict(label='Create a new Library',
widget=TextField('new_library_name', 40,
diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/framework/__init__.py
--- a/lib/galaxy/web/framework/__init__.py Thu Aug 20 11:43:28 2009 -0400
+++ b/lib/galaxy/web/framework/__init__.py Thu Aug 20 16:54:44 2009 -0400
@@ -641,7 +641,6 @@
self.name = name
self.action = action
self.submit_text = submit_text
- #self.submit_name = submit_text+"_button"
self.inputs = []
def add_input( self, type, name, label, value=None, error=None, help=None, use_label=True ):
self.inputs.append( FormInput( type, label, name, value, error, help, use_label ) )
diff -r a7f9325bb319 -r fc4c0c7e5da9 templates/admin/requests/grid.mako
--- a/templates/admin/requests/grid.mako Thu Aug 20 11:43:28 2009 -0400
+++ b/templates/admin/requests/grid.mako Thu Aug 20 16:54:44 2009 -0400
@@ -76,7 +76,7 @@
<div class="grid-header">
<h2>${grid.title}</h2>
- %if len(trans.user.requests):
+ %if len(trans.app.model.Request.query().all()):
##<span class="title">Filter:</span>
%for i, filter in enumerate( grid.standard_filters ):
%if i > 0:
diff -r a7f9325bb319 -r fc4c0c7e5da9 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Thu Aug 20 11:43:28 2009 -0400
+++ b/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400
@@ -1077,6 +1077,17 @@
for index, field_value in enumerate(fields):
tc.fv( "1", "field_%i" % index, field_value )
tc.submit( "create_request_button" )
+ def create_request_admin( self, request_type_id, user_id, name, desc, library_id, fields ):
+ self.home()
+ self.visit_url( "%s/requests_admin/new?create=True&select_request_type=%i" % (self.url, request_type_id) )
+ self.check_page_for_string( 'Add a new request' )
+ tc.fv( "1", "select_user", str(user_id) )
+ tc.fv( "1", "name", name )
+ tc.fv( "1", "desc", desc )
+ tc.fv( "1", "library_id", str(library_id) )
+ for index, field_value in enumerate(fields):
+ tc.fv( "1", "field_%i" % index, field_value )
+ tc.submit( "create_request_button" )
def add_samples( self, request_id, request_name, samples ):
self.home()
self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) ))
diff -r a7f9325bb319 -r fc4c0c7e5da9 test/functional/test_forms_and_requests.py
--- a/test/functional/test_forms_and_requests.py Thu Aug 20 11:43:28 2009 -0400
+++ b/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400
@@ -100,28 +100,13 @@
global request_type
request_type = galaxy.model.RequestType.filter( and_( galaxy.model.RequestType.table.c.name==request_type_name ) ).all()[-1]
assert request_type is not None, 'Problem retrieving request type named "%s" from the database' % request_type_name
- def test_025_create_address( self ):
- """Testing address creation"""
- #self.create_address( user_address1 )
- #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] )
- ## TODO: FIX HACK
- ## the user address creation should be done as a test.
- global user_address
- user_address = galaxy.model.UserAddress()
- user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test(a)bx.psu.edu' ).first()
- user_address.desc = address1[ 'short_desc' ]
- user_address.name = address1[ 'name' ]
- user_address.institution = address1[ 'institution' ]
- user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ]
- user_address.city = address1[ 'city' ]
- user_address.state = address1[ 'state' ]
- user_address.postal_code = address1[ 'postal_code' ]
- user_address.country = address1[ 'country' ]
- user_address.phone = address1[ 'phone' ]
- user_address.flush()
- user_address.user.refresh()
- def test_030_create_request( self ):
- """Testing creating and submitting a request"""
+ def test_025_create_address_and_library( self ):
+ """Testing address & library creation"""
+ # first create a regular user
+ self.logout()
+ self.login( email='test1(a)bx.psu.edu' )
+ self.logout()
+ self.login( email='test(a)bx.psu.edu' )
# first create a library for the request so that it can be submitted later
lib_name = 'TestLib001'
self.create_library( lib_name, '' )
@@ -144,12 +129,48 @@
break
if not admin_user_private_role:
raise AssertionError( "Private role not found for user '%s'" % admin_user.email )
+ global regular_user1
+ regular_user1 = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first()
+ assert regular_user1 is not None, 'Problem retrieving user with email "test1(a)bx.psu.edu" from the database'
+ # Get the regular user's private role for later use
+ global regular_user1_private_role
+ regular_user1_private_role = None
+ for role in regular_user1.all_roles():
+ if role.name == regular_user1.email and role.description == 'Private Role for %s' % regular_user1.email:
+ regular_user1_private_role = role
+ break
+ if not regular_user1_private_role:
+ raise AssertionError( "Private role not found for user '%s'" % regular_user1.email )
# Set permissions on the library, sort for later testing
permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ]
permissions_out = []
- # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted to
+ # Role one members are: admin_user, regular_user1. Each of these users will be permitted to
# LIBRARY_ADD, LIBRARY_MODIFY, LIBRARY_MANAGE for library items.
- self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out )
+ self.set_library_permissions( str( library_one.id ), library_one.name, str( regular_user1_private_role.id ), permissions_in, permissions_out )
+ # create address
+ #self.create_address( user_address1 )
+ #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] )
+ ## TODO: FIX HACK
+ ## the user address creation should be done as a test.
+ global user_address
+ user_address = galaxy.model.UserAddress()
+ user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first()
+ user_address.desc = address1[ 'short_desc' ]
+ user_address.name = address1[ 'name' ]
+ user_address.institution = address1[ 'institution' ]
+ user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ]
+ user_address.city = address1[ 'city' ]
+ user_address.state = address1[ 'state' ]
+ user_address.postal_code = address1[ 'postal_code' ]
+ user_address.country = address1[ 'country' ]
+ user_address.phone = address1[ 'phone' ]
+ user_address.flush()
+ user_address.user.refresh()
+ def test_030_create_request( self ):
+ """Testing creating and submitting a request as a regular user"""
+ # login as a regular user
+ self.logout()
+ self.login( email='test1(a)bx.psu.edu' )
# set field values
fields = ['field one value', 'field two value', str(user_address.id)]
# create the request
@@ -162,7 +183,6 @@
galaxy.model.Request.table.c.deleted==False ) ).first()
# check if the request's state is now set to 'unsubmitted'
assert request_one.state is not request_one.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.UNSUBMITTED )
-
# sample fields
samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ),
( 'Sample Two', [ 'S2 Field 0 Value' ] ) ]
@@ -181,6 +201,8 @@
def test_035_request_lifecycle( self ):
"""Testing request lifecycle as it goes through all the states"""
# goto admin manage requests page
+ self.logout()
+ self.login( email='test(a)bx.psu.edu' )
self.home()
self.visit_page( 'requests_admin/list' )
self.check_page_for_string( request_one.name )
@@ -203,10 +225,43 @@
request_one.refresh()
# check if the request's state is now set to 'complete'
assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.COMPLETE )
+# def test_40_admin_create_request_on_behalf_of_regular_user( self ):
+# """Testing creating and submitting a request as an admin on behalf of a regular user"""
+# self.logout()
+# self.login( email='test(a)bx.psu.edu' )
+## permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ]
+## permissions_out = []
+## self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out )
+# # set field values
+# fields = ['field one value', 'field two value', str(user_address.id)]
+# # create the request
+# request_name, request_desc = 'Request Two', 'Request Two Description'
+# self.create_request_admin(request_type.id, regular_user1.id, request_name, request_desc, library_one.id, fields)
+# self.check_page_for_string( request_name )
+# self.check_page_for_string( request_desc )
+# global request_two
+# request_one = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name,
+# galaxy.model.Request.table.c.deleted==False ) ).first()
+# # check if the request's state is now set to 'unsubmitted'
+# assert request_two.state is not request_two.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.UNSUBMITTED )
+# # sample fields
+# samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ),
+# ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ]
+# # add samples to this request
+# self.add_samples( request_two.id, request_two.name, samples )
+# for sample_name, fields in samples:
+# self.check_page_for_string( sample_name )
+# self.check_page_for_string( 'Unsubmitted' )
+# for field_value in fields:
+# self.check_page_for_string( field_value )
+# # submit the request
+# self.submit_request( request_two.id, request_two.name )
+# request_two.refresh()
+# # check if the request's state is now set to 'submitted'
+# assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.SUBMITTED )
-
\ No newline at end of file
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/108533bf35b8
changeset: 2595:108533bf35b8
user: rc
date: Fri Aug 21 15:18:17 2009 -0400
description:
Merge with 2c1916d89194f6802102cab13e67bebcf68d1d75
0 file(s) affected in this change:
diffs (131 lines):
diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/tools/actions/upload.py
--- a/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:17:26 2009 -0400
+++ b/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:18:17 2009 -0400
@@ -20,12 +20,10 @@
for upload_dataset in incoming['files']:
f = upload_dataset['file_data']
if isinstance( f, FieldStorage ):
- # very small files can be StringIOs
- if 'name' in dir( f.file ) and f.file.name != '<fdopen>':
- local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' )
- f.file.close()
- else:
- local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0]
+ assert not isinstance( f.file, StringIO.StringIO )
+ assert f.file.name != '<fdopen>'
+ local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' )
+ f.file.close()
upload_dataset['file_data'] = dict( filename = f.filename,
local_filename = local_filename )
if upload_dataset['url_paste'].strip() != '':
diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/web/framework/base.py
--- a/lib/galaxy/web/framework/base.py Fri Aug 21 15:17:26 2009 -0400
+++ b/lib/galaxy/web/framework/base.py Fri Aug 21 15:18:17 2009 -0400
@@ -216,11 +216,18 @@
# tempfiles. Necessary for externalizing the upload tool. It's a little hacky
# but for performance reasons it's way better to use Paste's tempfile than to
# create a new one and copy.
-import cgi
+import cgi, tempfile
class FieldStorage( cgi.FieldStorage ):
def make_file(self, binary=None):
- import tempfile
return tempfile.NamedTemporaryFile()
+ def read_lines(self):
+ # Always make a new file
+ self.file = self.make_file()
+ self.__file = None
+ if self.outerboundary:
+ self.read_lines_to_outerboundary()
+ else:
+ self.read_lines_to_eof()
cgi.FieldStorage = FieldStorage
class Request( webob.Request ):
diff -r 55b0c25aa164 -r 108533bf35b8 static/welcome.html
--- a/static/welcome.html Fri Aug 21 15:17:26 2009 -0400
+++ b/static/welcome.html Fri Aug 21 15:18:17 2009 -0400
@@ -71,7 +71,7 @@
<table border="0" cellpadding="0" cellspacing="0" width="100%">
<tr>
<td>
- <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:500,scroll:'no'})">
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/quickie1_TabSeq.flv',width:640,height:500,scroll:'no'})">
<div class="quickie">
<img src="images/qk/quickie1_small.png" border="0">
</div>
diff -r 55b0c25aa164 -r 108533bf35b8 tools/extract/liftOver_wrapper_code.py
--- a/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:17:26 2009 -0400
+++ b/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:18:17 2009 -0400
@@ -3,7 +3,6 @@
to_dbkey = param_dict['to_dbkey'].split('.')[0].split('To')[1]
to_dbkey = to_dbkey[0].lower()+to_dbkey[1:]
out_data['out_file1'].set_dbkey(to_dbkey)
- out_data['out_file2'].set_dbkey(to_dbkey)
out_data['out_file1'].name = out_data['out_file1'].name + " [ MAPPED COORDINATES ]"
out_data['out_file2'].name = out_data['out_file2'].name + " [ UNMAPPED COORDINATES ]"
diff -r 55b0c25aa164 -r 108533bf35b8 tools/metag_tools/split_paired_reads.py
--- a/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:17:26 2009 -0400
+++ b/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:18:17 2009 -0400
@@ -1,7 +1,7 @@
#! /usr/bin/python
"""
-Split Solexa paired end reads
+Split fixed length paired end reads
"""
import os, sys
@@ -12,9 +12,13 @@
outfile_end1 = open(sys.argv[2], 'w')
outfile_end2 = open(sys.argv[3], 'w')
- for i, line in enumerate(file(infile)):
+ i = 0
+
+ for line in file( infile ):
line = line.rstrip()
- if not line or line.startswith('#'): continue
+
+ if not line:
+ continue
end1 = ''
end2 = ''
@@ -42,5 +46,9 @@
outfile_end1.write('%s\n' %(end1))
outfile_end2.write('%s\n' %(end2))
+ i += 1
+
+ if i % 4 != 0 :
+ sys.stderr.write("WARNING: Number of lines in the input file was not divisible by 4.\nCheck consistency of the input fastq file.\n")
outfile_end1.close()
outfile_end2.close()
\ No newline at end of file
diff -r 55b0c25aa164 -r 108533bf35b8 tools/solid_tools/maq_cs_wrapper.py
--- a/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:17:26 2009 -0400
+++ b/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:18:17 2009 -0400
@@ -48,9 +48,9 @@
cmd1 = "solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,tmps.name,f3_read_fname,f3_qual_fname,r3_read_fname,r3_qual_fname)
try:
os.system(cmd1)
- os.system('zcat -f %s >> %s' %(tmpf.name,tmpffastq.name))
- os.system('zcat -f %s >> %s' %(tmpr.name,tmprfastq.name))
- os.system('zcat -f %s >> %s' %(tmps.name,tmpsfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpf.name,tmpffastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpr.name,tmprfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmps.name,tmpsfastq.name))
except Exception, eq:
stop_err("Error converting data to fastq format." + str(eq))
@@ -135,7 +135,7 @@
cmd1 = "solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,None,None,f3_read_fname,f3_qual_fname,None,None)
try:
os.system(cmd1)
- os.system('zcat -f %s >> %s' %(tmpf.name,tmpfastq.name))
+ os.system('gunzip -c %s >> %s' %(tmpf.name,tmpfastq.name))
tmpf.close()
except:
stop_err("Error converting data to fastq format.")
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/881dd4c2de9f
changeset: 2587:881dd4c2de9f
user: rc
date: Thu Aug 20 10:52:08 2009 -0400
description:
Fixed indentation
1 file(s) affected in this change:
test/functional/test_security_and_libraries.py
diffs (21 lines):
diff -r 98fa3b9cd980 -r 881dd4c2de9f test/functional/test_security_and_libraries.py
--- a/test/functional/test_security_and_libraries.py Thu Aug 20 10:46:52 2009 -0400
+++ b/test/functional/test_security_and_libraries.py Thu Aug 20 10:52:08 2009 -0400
@@ -196,7 +196,7 @@
dhps.sort()
# Compare DefaultHistoryPermissions and actions_in - should be the same
if dhps != actions_in:
- raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \
+ raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \
% ( str( dhps ), latest_history.id, str( actions_in ) ) )
# Make sure DatasetPermissionss are correct
if len( latest_dataset.actions ) != len( latest_history.default_permissions ):
@@ -209,7 +209,7 @@
dps.sort()
# Compare DatasetPermissionss and DefaultHistoryPermissions - should be the same
if dps != dhps:
- raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \
+ raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \
% ( str( dps ), latest_dataset.id, str( dhps ) ) )
self.logout()
def test_020_create_new_user_account_as_admin( self ):
1
0