galaxy-dev February 2010

galaxy-dev@lists.galaxyproject.org

32 participants
180 discussions

create multiple historie items
by vill 16 Mar '10

16 Mar '10

I have a perl script that splits a text file with genomic information (forward strand and reverse strand) in two separate files. One file for the forward strand and one file for the reverse strand. I have written a wrapper so that Galaxy can execute this script. When my script outputs one file this files is listed as a history item. When I let my script output the two files only one history item gets created. What I need to now is what extra variables do I need to output from the .xml file so that galaxy finds the two output files and puts both files in as a history item I have been looking at the "interval2maf .py and .xml" I just can't figure out how this works, it seems that the history_id is important and the species is a list array and for every species a file gets created in the databas/tmp directory and when the file is created the tmp dir is deleted. Adding and extra file from the .py into this tmp dir does not end up in the history items, renaming the files seems to end up with no history items at all. Cheers, //Michel

11 23

Changing wall times...
by Kyle Kurz 10 Mar '10

10 Mar '10

Hi, I was not the original installer of our Galaxy instance, but have been tasked with changing the wall time that is requested when a job is submitted to the pbs queue. I found the job_walltime option in the universe_wsgi.ini, but we seem to be using round robin submission which then, in turn, submits a job to the pbs queue, so this doesn't work for me. Does anyone know an easy way to change the default time of 1 hr on this? Thanks, Kyle -- *************************** Kyle Kurz EECS Box 142 Stocker Center Ohio University Athens, OH 45701 kyle.w.kurz(a)gmail.com 740.249.9729 ***************************

2 4

Where to place google analytics tracking code
by Martin Aryee 01 Mar '10

01 Mar '10

Hi, I'd like to use Google Analytics to track visits to our galaxy instance. It involves placing a <script></script> block (example below) on all the site's pages. The recommended location is just before the </body> tag. I'd like to insert the code snippet in one of the mako templates and am wondering which template would be most appropriate? Thanks, Martin. <script type="text/javascript"> var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www."); document.write(unescape("%3Cscript src='" + gaJsHost + " google-analytics.com/ga.js' type='text/javascript'%3E%3C/script%3E")); </script> <script type="text/javascript"> try{ var pageTracker = _gat._getTracker("UA-xxxxxx-x"); pageTracker._trackPageview(); } catch(err) {} </script>

2 2

Re: [galaxy-dev] Questions about Galaxy!
by WangJun 27 Feb '10

27 Feb '10

Dear Greg Von Kuster, I installed a local Galaxy instance for data submit test for our own GMap project. And I found a question: If I submit from GMap for the first time, then a error page appears. (attached the error information) However, if I use it from "Get Data" in Galaxy for the first time, it works very well. I guess the history_id does not exist when I submit from GMap for the first time. Also I found it's "Server error" if I submit data from UCSC table browser to the public Galaxy instance for the first time. I think I have the same question with them. Can you help to to find a solution? Thanks a lot! Best wishes, Kathleen 2010-01-19 发件人： Greg Von Kuster 发送时间： 2009-11-18 02:10:17 收件人： wangjun 抄送： galaxy-dev 主题： Re: [galaxy-dev] Questions about Galaxy! Kathleen, Please install a local instance of Galaxy and develop a data source tool that works between your Galaxy instance and GMap. You can download Galaxy from http://bitbucket.org/galaxy/galaxy-central/wiki/GetGalaxy. When you have your tool working, please submit it to us for possible inclusion in the public Galaxy instance. Thanks very much for your interest in doing this. Greg Von Kuster On Nov 17, 2009, at 11:27 AM, wangjun(a)mail.cbi.pku.edu.cn wrote: Hello Greg Von Kuster, You can access test GMap at http://202.38.125.5:8383/. Click the big button "search" and submit using the default params, then you can see four tracks. You can click the entry of the second track, for example the red one, then you can see the detail info in the right panel. Click the "view sequence", there is a button "submit to Galaxy", you can try it. Thanks a lot! Kathleen Kathleen, sorry, I thought you had your own local Galaxy instance. Can you give us more information on GMap? Do you have a wiki or something we can access online to read about it? Thanks! On Nov 17, 2009, at 10:37 AM, wangjun(a)mail.cbi.pku.edu.cn wrote: Hello Greg Von Kuster, I am talking about your public Galaxy instance, and we don't have local one. We find that UCSC's data can be saved in your site directly, so we hope that Galaxy can also save our GMap data directly. We use the same post method like UCSC and the data can be saved now, but the data title is wrong. So I am writing to you to hope that you can help us. Thanks you. Kathleen Hello Kathleen, Are you talking about your own local Galaxy instance or our main public Galaxy instance that is hosted here at Penn State University? Greg Von Kuster On Nov 17, 2009, at 10:10 AM, WangJun wrote: Hello Greg Von Kuster, Thanks for your reply, but I think you misunderstood my meaning. I am now working on a genome browser project GMap, and I hope that I can post request from GMap to Galaxy, then Galaxy can retrieve and save the data in the History space like the UCSC request. Untill now, I can post a request, including a url and params, and Galaxy can retrieve the data and save it. However, the title of the data is still "UCSC Main". I think that's because of the tool_id param's value is still "ucsc_table_direct1". I mean whether you can support us by adding a new tool_id named "CBI GMap". Then our post data can be shown with title "CBI GMap", not "UCSC Main". Thanks a lot! Kathleen 发件人： Greg Von Kuster 发送时间： 2009-11-17 21:49:22 收件人： WangJun 抄送：主题： Re: [galaxy-dev] Questions about Galaxy! Kathleen, I'm not sure I understand the question, but if you are simply creating a new tool that is very similar to the "ucsc_table_direct1" tool , and you want the ID of your new tool to be "CBIGMap" ( I would advise against space characters in the tool ID ), then your tools config tag can be something like this: <tool id="CBIGMap" name="CBIG Map" version="1.0.0" hidden="false" tool_type="data_source" URL_method="post"> If you have questions about how to add a new tool to your Galaxy instance, see our wiki at http://bitbucket.org/galaxy/galaxy- central/wiki/AddToolTutorial On Nov 17, 2009, at 8:38 AM, WangJun wrote: Hello Greg Von Kuster, Now I have solved the second problem.:) And for the first one, could you help me to add a new tool_id named "CBI GMap" to support our data source? This is a project in Center for Bioinformatics in Peking University in China. And I am a PhD student working on it. If you have other questions, please email me.:) <tool id="ucsc_table_direct1" name="UCSC Main" version="1.0.0" hidden="false" tool_type="data_source" URL_method="post"> Thanks a lot! Best, Kathleen 20091117 =================================================================== = Hello Greg Von Kuster, Thanks a lot for your reply. But I still have a question: I have a url, and I include three necessary params in the following form. After I post it to Galaxy, I can see that Galaxy fetch the data. However, there are two point that I want to ask: 1. the "tool_id" param. My data's title is still "UCSC Main", I think that's because I use the "ucsc_table_direct1" value for "tool_id", right? Then how do I change this title? Can I adjust it by other param to change the title? 2. If I submit data from UCSC, then I can see a white box containing the data in the History part. However, I can only see the data info without data if I submit from my own site. (You can refer to attachment for detail. The No.20 data is from UCSC, and I can see the sequence. While the No.22 data is from my site, and I can not see the sequence.) And I don't know why. <form method="POST" action="http://main.g2.bx.psu.edu/tool_runner"> <input type="HIDDEN" value="ucsc_table_direct1" name="tool_id"/> <input type="HIDDEN" value="http://202.38.125.5:8383/entry/ rice_nucleotide_frame_galaxy.jsp" name="URL"/> <input type="HIDDEN" value="<%=id%>" name="id"/> <input type="HIDDEN" value="<%=trackName%>" name="trackName"/> <input type="HIDDEN" value="<%=type%>" name="type"/> <input type="HIDDEN" value="rice" name="db"/> <input type="HIDDEN" value="Rice" name="org"/> <input type="SUBMIT" value="Send query to Galaxy" name="submitGalaxy"/> </form> (test data: http://202.38.125.5:8383/entry/ rice_nucleotide_frame_galaxy.jsp? id=LOC_Os02g01370&trackName=MSU_Osa1_Rice_Loci&type=seq ) Thank a lot! Best, Kathleen 20091117 发件人： Greg Von Kuster 发送时间： 2009-11-17 04:50:55 收件人： WangJun 抄送： galaxy-user(a)bx.psu.edu; galaxy-dev(a)bx.psu.edu 主题： Re: [galaxy-dev] Questions about Galaxy! Hello Kathleen, Please see our wiki at http://bitbucket.org/galaxy/galaxy-central/ wiki/DataSources for details about how Galaxy communicates with external data sources. Your "dataset platform" will need to build an url that includes all of the parameters that are needed to retrieve the data, and send that url to Galaxy in the URL parameter so that Galaxy can execute the post. On Nov 16, 2009, at 9:06 AM, WangJun wrote: Hi, This is a question about Galaxy interaction with UCSC data. I hava a dataset platform, and I want to add a button like the UCSC's "Send query to Galaxy". I find that it's actually a form: <form method="POST" action="http://main.g2.bx.psu.edu/ tool_runner"> <input type="HIDDEN" value="ucsc_table_direct1" name="tool_id"/> <input type="HIDDEN" value="http://genome.ucsc.edu/cgi-bin/ hgTables" name="URL"/> <input type="HIDDEN" value="296389734" name="hguid"/> <input type="HIDDEN" value="hg18" name="db"/> <input type="HIDDEN" value="Human" name="org"/> <input type="HIDDEN" value="multiz28way" name="hgta_table"/> <input type="HIDDEN" value="multiz28way" name="hgta_track"/> <input type="HIDDEN" value="range" name="hgta_regionType"/> <input type="HIDDEN" value="primaryTable" name="hgta_outputType"/> <input type="HIDDEN" value="chr3:130734948-130736581" name="position"/> <input type="HIDDEN" value="get output" name="hgta_doTopSubmit"/> <input type="HIDDEN" value="146683120" name="hgsid"/> <input type="SUBMIT" value="Send query to Galaxy" name="hgta_doGalaxyQuery"/> </form> I have a url and three params, and I tried. But I can't see my data in the right-side green box. And what's the tool_id param used for? Thanks in advance! Best, Kathleen 2009-11-16 _______________________________________________ galaxy-dev mailing list galaxy-dev(a)lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-dev Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu

3 7

Fwd: create multiple historie items
by Daniel Blankenberg 27 Feb '10

27 Feb '10

Begin forwarded message: > From: Edward Kirton <edward.kirton(a)gmail.com> > Date: February 26, 2010 8:34:19 PM EST > To: Daniel Blankenberg <dan(a)bx.psu.edu> > Subject: Re: [galaxy-dev] create multiple historie items > > unfortunately, no. neither c.s nor c[s] forms work. > > here's a simple test xml file that demonstrates that 2 files are > always created, even when 1 should be filtered by the conditional var. > > <tool id='conditional_filter_test' name='conditional filter test'> > <description>test</description> > <command> > #if $opt.numbfiles == '1': > echo $opt.string1 > $outfile1 > #else: > echo "1: $opt.string2" > $outfile1; > echo "2: $opt.string2" > $outfile2 > #end if > </command> > <inputs> > <conditional name='opt'> > <param name='numbfiles' type='select' label='how many files'> > <option value='1'>1</option> > <option value='2'>2</option> > </param> > <when value='1'> > <param name='string1' type='text' label='enter a string'/> > </when> > <when value='2'> > <param name='string2' type='text' label='Enter a String'/> > </when> > </conditional> > </inputs> > <outputs> > <data name='outfile1' format='txt'/> > <data name='outfile2' format='txt'> > <filter>opt[numbfiles] == 2</filter> > </data> > </outputs> > <help>test</help> > </tool> > > On Fri, Feb 19, 2010 at 6:19 AM, Daniel Blankenberg <dan(a)bx.psu.edu> wrote: >> >> Hello, >> Does e.g. do_full_assembly['create_ace_file'] work? >> Dan >

1 1

Re: [galaxy-dev] [galaxy-bugs] Galaxy tool error report from m.p.villerius@lumc.nl
by Kelly Vincent 26 Feb '10

26 Feb '10

Michel, The newest versions of SAM Tools are on our main public server now. If you could try again, that would be helpful. If it does fail again, please do share your history with me (kpvincent(a)bx.psu.edu). Otherwise, it's good that you were able to get it working locally. The error suppression is actually what we just dealt with with the latest version of the tools. Now it should capture the stderr and output it only if it was an actual error, instead of disrupting successful runs. Galaxy doesn't have any special PATH settings. You just need to make sure that the binary is available on your PATH environment variable when you run Galaxy. Out of the SAM Tools heading tools, only Merge BAM Files and Generate pileup actually rely on the samtools binary, so maybe that's why it seemed like the others were working. I'm not sure on your last question and will forward it to our list for someone else to answer. Regards, Kelly On Thu 25 Feb 2010, at 3:46 AM, vill wrote: > Hi Kelly, > > Yes I tried both places. The test.galaxy server is slow or not > responding right now. 25 Feb. 9:10 am Amsterdam time thus I can't test > samtools there. > The error I got on my local install is solved, I removed in the > sam_to_bam.py the following "2> /dev/null" and the error was can't > find > the path. > I copied samtools to the /usr/local/bin dir and now everything is > working. Strange because the other samtools seemed to work. > How do I add a extra PATH to GALAXY? > > It won't be any problem sharing my History if you need it. > > One other thing when we get data from UCSC main, the data will > become a > history item. When you look at this history item in the info: there > used > to be a link so you could view the data in the UCSC browser: > Info: UCSC Main on Human: > The txt is there but it is not a link, is this something we need to > add > in the configuration? > > //Michel > > > On Wed, 2010-02-24 at 10:38 -0500, Kelly Vincent wrote: >> Michel, >> >> Your other email indicated that you are running a local instance of >> Galaxy, but this error report is from our public server, so I'm >> assuming you tried it both places. Our SAM Tools wrappers have >> recently been slightly rewritten, in changeset 3426:1f05b0c4071f, >> although the changed versions haven't been uploaded to the public >> server yet. You should try rerunning the job with the new version (it >> should be providing more information when something fails). If you >> want to try it on main, I can let you know once it's been updated. >> Also, the new version is already on our test server (http://test.g2.bx.psu.edu/ >> ) if you want to try right away without upgrading your local install. >> If you try it on test and it fails, could you share your history with >> me (kpvincent(a)bx.psu.edu)? >> >> Thanks, >> Kelly >> >> >> On Mon 22 Feb 2010, at 8:40 AM, galaxy-bugs(a)bx.psu.edu wrote: >> >>> >>> GALAXY TOOL ERROR REPORT >>> ------------------------ >>> >>> This error report was sent from the Galaxy instance hosted on the >>> server >>> "main.g2.bx.psu.edu" >>> ----------------------------------------------------------------------------- >>> This is in reference to dataset id 1078127 from history id 322475 >>> ----------------------------------------------------------------------------- >>> You should be able to view the history containing the related >>> history item >>> >>> 4: SAM-to-BAM on data 3 and data 2 >>> >>> by logging in as a Galaxy admin user to the Galaxy instance >>> referenced above >>> and pointing your browser to the following link. >>> >>> main.g2.bx.psu.edu/history/view?id=e9709e1ba7514892 >>> ----------------------------------------------------------------------------- >>> The user 'm.p.villerius(a)lumc.nl' provided the following information: >>> >>> Uploaded a .sam file, uploaded my reference file and tried a sam to >>> bam conversion. >>> I also have an other error on my local Galaxy install -> >>> ################### >>> Traceback (most recent call last): >>> File "/usr/local/galaxy_dist/tools/samtools/sam_to_bam.py", line >>> 113, in >>> if __name__=="__main__": __main__() >>> File "/usr/local/galaxy_dist/tools/samtools/sam_to_bam.py", line >>> 103, in __main__ >>> shutil.move( sorted_bam_file, options.output1 ) >>> File "/usr/lib/python2.6/shutil.py", line 264, in move >>> copy2(src, real_dst) >>> File "/usr/lib/python2.6/shutil.py", line 99, in copy2 >>> copyfile(src, dst) >>> File "/usr/lib/python2.6/shutil.py", line 52, in copyfile >>> fsrc = open(src, 'rb') >>> IOError: [Errno 2] No such file or directory: '/tmp/381.1.all.q/ >>> tmpJzAOLW.bam' >>> ###################### >>> Same file and reference? >>> All works fine on command line. >>> ----------------------------------------------------------------------------- >>> job id: 855615 >>> tool id: sam_to_bam >>> ----------------------------------------------------------------------------- >>> job command line: >>> python /galaxy/home/g2main/galaxy_main/tools/samtools/sam_to_bam.py >>> --input1=/galaxy/home/g2main/galaxy_main/database/files/001/078/ >>> dataset_1078112.dat --dbkey=? --ref_file=/galaxy/home/g2main/ >>> galaxy_main/database/files/001/078/dataset_1078114.dat --output1=/ >>> galaxy/home/g2main/galaxy_main/database/tmp/job_working_directory/ >>> 855615/galaxy_dataset_1078127.dat --index_dir=/galaxy/home/g2main/ >>> galaxy_main/tool-data >>> ----------------------------------------------------------------------------- >>> job stderr: >>> /bin/sh: line 1: 20580 Segmentation fault samtools view -bt / >>> space/g2main/dataset_1078114.dat -o /space/g2main/tmpM7xmZe /galaxy/ >>> home/g2main/galaxy_main/database/files/001/078/dataset_1078112.dat >>> 2> /dev/null >>> /bin/sh: line 1: 20583 Aborted samtools sort /space/ >>> g2main/tmpM7xmZe /space/g2main/tmpmvKLRC 2> /dev/null >>> Traceback (most recent call last): >>> File "/galaxy/home/g2main/galaxy_main/tools/samtools/ >>> sam_to_bam.py", line 113, in <module> >>> if __name__=="__main__": __main__() >>> File "/galaxy/home/g2main/galaxy_main/tools/samtools/ >>> sam_to_bam.py", line 103, in __main__ >>> shutil.move( sorted_bam_file, options.output1 ) >>> File "/usr/lib/python2.5/shutil.py", line 199, in move >>> copy2(src,dst) >>> File "/usr/lib/python2.5/shutil.py", line 91, in copy2 >>> copyfile(src, dst) >>> File "/usr/lib/python2.5/shutil.py", line 46, in copyfile >>> fsrc = open(src, 'rb') >>> IOError: [Errno 2] No such file or directory: '/space/g2main/ >>> tmpmvKLRC.bam' >>> >>> ----------------------------------------------------------------------------- >>> job stdout: >>> >>> ----------------------------------------------------------------------------- >>> job info: >>> None >>> ----------------------------------------------------------------------------- >>> job traceback: >>> None >>> ----------------------------------------------------------------------------- >>> (This is an automated message). >>> _______________________________________________ >>> galaxy-bugs mailing list >>> galaxy-bugs(a)lists.bx.psu.edu >>> http://lists.bx.psu.edu/listinfo/galaxy-bugs >> > >

2 1

[hg] galaxy 3443: Fix locations of cached data for tests
by Greg Von Kuster 25 Feb '10

25 Feb '10

details: http://www.bx.psu.edu/hg/galaxy/rev/ea7f4e4b7214 changeset: 3443:ea7f4e4b7214 user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Feb 25 12:27:07 2010 -0500 description: Fix locations of cached data for tests diffstat: buildbot_setup.sh | 3 ++- test/base/twilltestcase.py | 2 +- tools/annotation_profiler/annotation_profiler.xml | 2 +- tools/annotation_profiler/annotation_profiler_for_interval.py | 2 +- tools/extract/liftOver_wrapper.xml | 2 +- tools/extract/phastOdds/phastOdds_tool.xml | 2 +- tools/filters/axt_to_lav.xml | 2 +- tools/filters/lav_to_bed.xml | 6 +++--- tools/metag_tools/rmap_wrapper.xml | 2 +- tools/metag_tools/rmapq_wrapper.xml | 2 +- tools/samtools/sam_to_bam.py | 8 ++++---- tools/stats/aggregate_binned_scores_in_intervals.xml | 4 ++-- 12 files changed, 19 insertions(+), 18 deletions(-) diffs (176 lines): diff -r 983d70363eeb -r ea7f4e4b7214 buildbot_setup.sh --- a/buildbot_setup.sh Thu Feb 25 11:28:14 2010 -0500 +++ b/buildbot_setup.sh Thu Feb 25 12:27:07 2010 -0500 @@ -26,6 +26,7 @@ LINKS=" /galaxy/data/location/alignseq.loc +/galaxy/data/annotation_profiler /galaxy/data/annotation_profiler/annotation_profiler.loc /galaxy/data/annotation_profiler/annotation_profiler_options.xml /galaxy/data/annotation_profiler/annotation_profiler_valid_builds.txt @@ -45,7 +46,7 @@ /galaxy/data/location/quality_scores.loc /galaxy/data/location/regions.loc /galaxy/data/location/sam_fa_indices.loc -/galaxy/data/location/taxonomy +/galaxy/data/taxonomy /galaxy/data/location/twobit.loc " diff -r 983d70363eeb -r ea7f4e4b7214 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Feb 25 11:28:14 2010 -0500 +++ b/test/base/twilltestcase.py Thu Feb 25 12:27:07 2010 -0500 @@ -1674,7 +1674,7 @@ url += "&ldda_ids=%s" % ldda_id self.visit_url( url ) tc.code( 200 ) - archive = self.write_temp_file( self.last_page(), suffix=format ) + archive = self.write_temp_file( self.last_page(), suffix='.' + format ) self.home() return archive def check_archive_contents( self, archive, lddas ): diff -r 983d70363eeb -r ea7f4e4b7214 tools/annotation_profiler/annotation_profiler.xml --- a/tools/annotation_profiler/annotation_profiler.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/annotation_profiler/annotation_profiler.xml Thu Feb 25 12:27:07 2010 -0500 @@ -1,6 +1,6 @@ <tool id="Annotation_Profiler_0" name="Profile Annotations" Version="1.0.0"> <description>for a set of genomic intervals</description> - <command interpreter="python">annotation_profiler_for_interval.py -i $input1 -c ${input1.metadata.chromCol} -s ${input1.metadata.startCol} -e ${input1.metadata.endCol} -o $out_file1 $keep_empty -p /depot/data2/galaxy/annotation_profiler/$dbkey $summary -l ${chromInfo} -b 3 -t $table_names</command> + <command interpreter="python">annotation_profiler_for_interval.py -i $input1 -c ${input1.metadata.chromCol} -s ${input1.metadata.startCol} -e ${input1.metadata.endCol} -o $out_file1 $keep_empty -p ${GALAXY_DATA_INDEX_DIR}/annotation_profiler/$dbkey $summary -l ${chromInfo} -b 3 -t $table_names</command> <inputs> <param format="interval" name="input1" type="data" label="Choose Intervals"> <validator type="dataset_metadata_in_file" filename="annotation_profiler_valid_builds.txt" metadata_name="dbkey" metadata_column="0" message="Profiling is not currently available for this species."/> diff -r 983d70363eeb -r ea7f4e4b7214 tools/annotation_profiler/annotation_profiler_for_interval.py --- a/tools/annotation_profiler/annotation_profiler_for_interval.py Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/annotation_profiler/annotation_profiler_for_interval.py Thu Feb 25 12:27:07 2010 -0500 @@ -290,7 +290,7 @@ parser.add_option( '-p','--path', dest='path', - type='str',default='/depot/data2/galaxy/annotation_profiler/hg18', + type='str',default='/galaxy/data/annotation_profiler/hg18', help='Path to profiled data for this organism' ) parser.add_option( diff -r 983d70363eeb -r ea7f4e4b7214 tools/extract/liftOver_wrapper.xml --- a/tools/extract/liftOver_wrapper.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/extract/liftOver_wrapper.xml Thu Feb 25 12:27:07 2010 -0500 @@ -27,7 +27,7 @@ <tests> <test> <param name="input" value="5.bed" dbkey="hg18" ftype="bed" /> - <param name="to_dbkey" value="/depot/data2/galaxy/hg18/liftOver/hg18ToPanTro2.over.chain" /> + <param name="to_dbkey" value="/galaxy/data/hg18/liftOver/hg18ToPanTro2.over.chain" /> <param name="minMatch" value="0.95" /> <output name="out_file1" file="5_liftover_mapped.bed"/> <output name="out_file2" file="5_liftover_unmapped.bed"/> diff -r 983d70363eeb -r ea7f4e4b7214 tools/extract/phastOdds/phastOdds_tool.xml --- a/tools/extract/phastOdds/phastOdds_tool.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/extract/phastOdds/phastOdds_tool.xml Thu Feb 25 12:27:07 2010 -0500 @@ -26,7 +26,7 @@ <tests> <test> <param name="input" value="4.bed" dbkey="hg17" ftype="bed"/> - <param name="score_file" value="/depot/data2/galaxy/phastOdds_precomputed/encode_SEP-2005_tba.v2_phastOdds" /> + <param name="score_file" value="/galaxy/data/phastOdds_precomputed/encode_SEP-2005_tba.v2_phastOdds" /> <param name="per_col" value="true" /> <output name="output" file="phastOdds_tool_out.interval" /> </test> diff -r 983d70363eeb -r ea7f4e4b7214 tools/filters/axt_to_lav.xml --- a/tools/filters/axt_to_lav.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/filters/axt_to_lav.xml Thu Feb 25 12:27:07 2010 -0500 @@ -1,6 +1,6 @@ <tool id="axt_to_lav_1" name="AXT to LAV"> <description>Converts an AXT formatted file to LAV format</description> - <command interpreter="python">axt_to_lav.py /depot/data2/galaxy/$dbkey_1/seq/%s.nib:$dbkey_1:${GALAXY_DATA_INDEX_DIR}/shared/ucsc/chrom/${dbkey_1}.len /depot/data2/galaxy/$dbkey_2/seq/%s.nib:$dbkey_2:${GALAXY_DATA_INDEX_DIR}/shared/ucsc/chrom/${dbkey_2}.len $align_input $lav_file $seq_file1 $seq_file2</command> + <command interpreter="python">axt_to_lav.py /galaxy/data/$dbkey_1/seq/%s.nib:$dbkey_1:${GALAXY_DATA_INDEX_DIR}/shared/ucsc/chrom/${dbkey_1}.len /depot/data2/galaxy/$dbkey_2/seq/%s.nib:$dbkey_2:${GALAXY_DATA_INDEX_DIR}/shared/ucsc/chrom/${dbkey_2}.len $align_input $lav_file $seq_file1 $seq_file2</command> <inputs> <param name="align_input" type="data" format="axt" label="Alignment File" optional="False"/> <param name="dbkey_1" type="genomebuild" label="Genome"/> diff -r 983d70363eeb -r ea7f4e4b7214 tools/filters/lav_to_bed.xml --- a/tools/filters/lav_to_bed.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/filters/lav_to_bed.xml Thu Feb 25 12:27:07 2010 -0500 @@ -33,8 +33,8 @@ #:lav s { - "/depot/data2/galaxy/hg16/seq/chr19.nib" 1 63811651 0 1 - "/depot/data2/galaxy/mm5/seq/chr11.nib" 1 121648857 0 1 + "/galaxy/data/hg16/seq/chr19.nib" 1 63811651 0 1 + "/galaxy/data/mm5/seq/chr11.nib" 1 121648857 0 1 } h { "> hg16.chr19" @@ -65,4 +65,4 @@ chr11 70573975 70574054 mm5_1 0 + </help> <code file="lav_to_bed_code.py"/> -</tool> \ No newline at end of file +</tool> diff -r 983d70363eeb -r ea7f4e4b7214 tools/metag_tools/rmap_wrapper.xml --- a/tools/metag_tools/rmap_wrapper.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/metag_tools/rmap_wrapper.xml Thu Feb 25 12:27:07 2010 -0500 @@ -41,7 +41,7 @@ <!-- <tests> <test> - <param name="database" value="/depot/data2/galaxy/faseq/test" /> + <param name="database" value="/galaxy/data/faseq/test" /> <param name="input_seq" value="rmap_wrapper_test1.fasta" ftype="fasta"/> <param name="read_len" value="36" /> <param name="align_len" value="36" /> diff -r 983d70363eeb -r ea7f4e4b7214 tools/metag_tools/rmapq_wrapper.xml --- a/tools/metag_tools/rmapq_wrapper.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/metag_tools/rmapq_wrapper.xml Thu Feb 25 12:27:07 2010 -0500 @@ -44,7 +44,7 @@ <!-- <tests> <test> - <param name="database" value="/depot/data2/galaxy/faseq/test" /> + <param name="database" value="/galaxy/data/faseq/test" /> <param name="input_seq" value="rmapq_wrapper_test1.fasta" ftype="fasta"/> <param name="input_score" value="rmapq_wrapper_test1.qual" ftype="qualsolexa" /> <param name="high_score" value="40" /> diff -r 983d70363eeb -r ea7f4e4b7214 tools/samtools/sam_to_bam.py --- a/tools/samtools/sam_to_bam.py Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/samtools/sam_to_bam.py Thu Feb 25 12:27:07 2010 -0500 @@ -45,14 +45,14 @@ cached_seqs_pointer_file = '%s/sam_fa_indices.loc' % options.index_dir if not os.path.exists( cached_seqs_pointer_file ): stop_err( 'The required file (%s) does not exist.' % cached_seqs_pointer_file ) - # If found for the dbkey, seq_path will look something like /depot/data2/galaxy/equCab2/sam_index/equCab2.fa, + # If found for the dbkey, seq_path will look something like /galaxy/data/equCab2/sam_index/equCab2.fa, # and the equCab2.fa file will contain fasta sequences. seq_path = check_seq_file( options.dbkey, cached_seqs_pointer_file ) tmp_dir = tempfile.mkdtemp() if options.ref_file == 'None': - # We're using locally cached reference sequences( e.g., /depot/data2/galaxy/equCab2/sam_index/equCab2.fa ). - # The indexes for /depot/data2/galaxy/equCab2/sam_index/equCab2.fa will be contained in - # a file named /depot/data2/galaxy/equCab2/sam_index/equCab2.fa.fai + # We're using locally cached reference sequences( e.g., /galaxy/data/equCab2/sam_index/equCab2.fa ). + # The indexes for /galaxy/data/equCab2/sam_index/equCab2.fa will be contained in + # a file named /galaxy/data/equCab2/sam_index/equCab2.fa.fai fai_index_file_base = seq_path fai_index_file_path = '%s.fai' % seq_path if not os.path.exists( fai_index_file_path ): diff -r 983d70363eeb -r ea7f4e4b7214 tools/stats/aggregate_binned_scores_in_intervals.xml --- a/tools/stats/aggregate_binned_scores_in_intervals.xml Thu Feb 25 11:28:14 2010 -0500 +++ b/tools/stats/aggregate_binned_scores_in_intervals.xml Thu Feb 25 12:27:07 2010 -0500 @@ -42,13 +42,13 @@ <test> <param name="input1" value="6.bed" dbkey="hg17" ftype="bed"/> <param name="score_source" value="cached"/> - <param name="datasets" value="/depot/data2/galaxy/binned_scores/hg17/phastcons_encode_sep2005_tba" /> + <param name="datasets" value="/galaxy/data/binned_scores/hg17/phastcons_encode_sep2005_tba" /> <output name="out_file1" file="aggregate_binned_scores_in_intervals.out" /> </test> <test> <param name="input1" value="9_hg18.bed" dbkey="hg18" ftype="bed"/> <param name="score_source" value="cached"/> - <param name="datasets" value="/depot/data2/galaxy/binned_scores/hg18/phastCons17way/ba" /> + <param name="datasets" value="/galaxy/data/binned_scores/hg18/phastCons17way/ba" /> <output name="out_file1" file="aggregate_binned_scores_in_intervals2.interval" /> </test> <test>

1 0

[hg] galaxy 3444: lims: bar code related state change bug fixed
by Greg Von Kuster 25 Feb '10

25 Feb '10

details: http://www.bx.psu.edu/hg/galaxy/rev/294b1283ea56 changeset: 3444:294b1283ea56 user: rc date: Thu Feb 25 14:59:43 2010 -0500 description: lims: bar code related state change bug fixed diffstat: lib/galaxy/web/controllers/requests_admin.py | 12 +++++++++++- 1 files changed, 11 insertions(+), 1 deletions(-) diffs (36 lines): diff -r ea7f4e4b7214 -r 294b1283ea56 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Feb 25 12:27:07 2010 -0500 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Feb 25 14:59:43 2010 -0500 @@ -421,7 +421,7 @@ # change the state of each of the samples of thus request new_state = request.type.states[0] for s in request.samples: - event = trans.app.model.SampleEvent(s, new_state, 'Samples submitted to the system') + event = trans.app.model.SampleEvent(s, new_state, 'Samples created.') trans.sa_session.add( event ) trans.sa_session.add( request ) trans.sa_session.flush() @@ -1018,6 +1018,7 @@ dataset_files=[]) trans.sa_session.add( s ) trans.sa_session.flush() + else: messagetype = 'done' msg = 'Changes made to the sample(s) are saved. ' @@ -1032,6 +1033,15 @@ messagetype = 'error' msg += bc_msg else: + if not sample.bar_code: + # if this is a 'new' (still in its first state) sample + # change the state to the next + if sample.current_state().id == request.type.states[0].id: + event = trans.app.model.SampleEvent(sample, + request.type.states[1], + 'Sample added to the system') + trans.sa_session.add( event ) + trans.sa_session.flush() sample.bar_code = current_samples[sample_index]['barcode'] trans.sa_session.add( sample ) trans.sa_session.flush()

1 0

[hg] galaxy 3442: lims: deactivate the enter key in requests pag...
by Greg Von Kuster 25 Feb '10

25 Feb '10

details: http://www.bx.psu.edu/hg/galaxy/rev/983d70363eeb changeset: 3442:983d70363eeb user: rc date: Thu Feb 25 11:28:14 2010 -0500 description: lims: deactivate the enter key in requests page so that the scanner can be used to enter barcodes for each sample diffstat: templates/admin/requests/show_request.mako | 13 +++++++++++-- 1 files changed, 11 insertions(+), 2 deletions(-) diffs (29 lines): diff -r 25015efefdd9 -r 983d70363eeb templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Wed Feb 24 18:55:30 2010 -0500 +++ b/templates/admin/requests/show_request.mako Thu Feb 25 11:28:14 2010 -0500 @@ -41,14 +41,23 @@ }); }); </script> + <style type="text/css"> .msg_head { padding: 0px 0px; cursor: pointer; } +</style> -} -</style> +<script type="text/javascript"> + function stopRKey(evt) { + var evt = (evt) ? evt : ((event) ? event : null); + var node = (evt.target) ? evt.target : ((evt.srcElement) ? evt.srcElement : null); + if ((evt.keyCode == 13) && (node.type=="text")) {return false;} + } + document.onkeypress = stopRKey +</script> + %if request.rejected(): ${render_msg( "Reason for rejection: "+request.last_comment(), "warning" )}

1 0

[hg] galaxy 3440: Update Combine FASTA and QUAL tool to allow th...
by Greg Von Kuster 25 Feb '10

25 Feb '10

details: http://www.bx.psu.edu/hg/galaxy/rev/674aaee19991 changeset: 3440:674aaee19991 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Wed Feb 24 16:50:06 2010 -0500 description: Update Combine FASTA and QUAL tool to allow the quality score file to be optional. When not provided, the output will be fastqsanger or fastqsolid (when a csfasta is provided) with each quality score being the maximal allowed value (93). diffstat: lib/galaxy_utils/sequence/fasta.py | 2 + lib/galaxy_utils/sequence/fastq.py | 25 + test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid | 576 +++++++++++++ test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger | 12 + tools/fastq/fastq_combiner.py | 11 +- tools/fastq/fastq_combiner.xml | 16 +- 6 files changed, 637 insertions(+), 5 deletions(-) diffs (725 lines): diff -r 46849d69d7e6 -r 674aaee19991 lib/galaxy_utils/sequence/fasta.py --- a/lib/galaxy_utils/sequence/fasta.py Wed Feb 24 16:48:22 2010 -0500 +++ b/lib/galaxy_utils/sequence/fasta.py Wed Feb 24 16:50:06 2010 -0500 @@ -53,6 +53,8 @@ def close( self ): return self.file.close() def get( self, sequence_id ): + if not isinstance( sequence_id, basestring ): + sequence_id = sequence_id.identifier rval = None if sequence_id in self.offset_dict: initial_offset = self.file.tell() diff -r 46849d69d7e6 -r 674aaee19991 lib/galaxy_utils/sequence/fastq.py --- a/lib/galaxy_utils/sequence/fastq.py Wed Feb 24 16:48:22 2010 -0500 +++ b/lib/galaxy_utils/sequence/fastq.py Wed Feb 24 16:50:06 2010 -0500 @@ -3,6 +3,7 @@ import string import transform from sequence import SequencingRead +from fasta import fastaSequence class fastqSequencingRead( SequencingRead ): format = 'sanger' #sanger is default @@ -456,6 +457,8 @@ def close( self ): return self.file.close() def get( self, sequence_id ): + if not isinstance( sequence_id, basestring ): + sequence_id = sequence_id.identifier rval = None if sequence_id in self.offset_dict: initial_offset = self.file.tell() @@ -593,3 +596,25 @@ fastq_read.sequence = fasta_seq.sequence fastq_read.quality = quality_seq.sequence return fastq_read + +class fastqFakeFastaScoreReader( object ): + def __init__( self, format = 'sanger', quality_encoding = None ): + self.fastq_read = fastqSequencingRead.get_class_by_format( format )() + if quality_encoding != 'decimal': + quality_encoding = 'ascii' + self.quality_encoding = quality_encoding + def close( self ): + return #nothing to close + def get( self, sequence ): + assert isinstance( sequence, fastaSequence ), 'fastqFakeFastaScoreReader requires a fastaSequence object as the parameter' + #add sequence to fastq_read, then get_sequence(), color space adapters do not have quality score values + self.fastq_read.sequence = sequence.sequence + new_sequence = fastaSequence() + new_sequence.identifier = sequence.identifier + if self.quality_encoding == 'ascii': + new_sequence.sequence = chr( self.fastq_read.ascii_max ) * len( self.fastq_read.get_sequence() ) + else: + new_sequence.sequence = ( "%i " % self.fastq_read.quality_max ) * len( self.fastq_read.get_sequence() ) + return new_sequence + def has_data( self ): + return '' #No actual data exist, none can be remaining diff -r 46849d69d7e6 -r 674aaee19991 test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_combiner_no_qual_ascii_out_1.fastqsolid Wed Feb 24 16:50:06 2010 -0500 @@ -0,0 +1,576 @@ +@1831_573_1004_F3 +T00030133312212111300011021310132222 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1050_F3 +T03330322230322112131010221102122113 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1067_F3 +T00023032023103330112220321200200002 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1219_F3 +T11211130300300301021212330201121310 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1242_F3 +T02132003121011302100130302112221121 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1333_F3 +T00200312330110101013212313222303112 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1362_F3 +T21203131001102231121211101111321131 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1448_F3 +T23101211223113320132212331313312022 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1490_F3 +T31312310323301210002210123101021011 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1523_F3 +T10322001220012223202202222001230222 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1578_F3 +T21202302100010020121100311022120111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1647_F3 +T10222233301013033120132223202022123 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1684_F3 +T13310013212312012302121010221231123 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1769_F3 +T33220123030232212032021032302233131 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1853_F3 +T11000012111222211310103212122102331 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1943_F3 +T20300123032210232001222122001132111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_573_1977_F3 +T22212302221310332321002303112011311 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_109_F3 +T13122332123301331032220222133301033 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_148_F3 +T01200113123030012202302312200010231 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_185_F3 +T21123333211302300321312212102123121 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_243_F3 +T30221011230013102201033131203302330 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_257_F3 +T00301133110002100302003000000102301 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_293_F3 +T23213210003000103010211331300320130 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_389_F3 +T21032213032101122333230212301312020 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_575_F3 +T33313322100212102033032123311211302 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_592_F3 +T33103330110123102223122023103310330 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_617_F3 +T20021031221222021210021322200223211 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_725_F3 +T32010020322130330333010031120313210 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_734_F3 +T31132301200020012302210322213222222 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_824_F3 +T30212100033032123311211302122020013 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_959_F3 +T11212130220131221111002020123311211 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1062_F3 +T30112230030300221001032033012211012 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1092_F3 +T02013221200031031212200000111130310 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1103_F3 +T20313113203302010303131123021310121 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1116_F3 +T21011310123202303021021112021231011 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1194_F3 +T23303101033322220312200222013013312 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1204_F3 +T21330132231321322010303023221203200 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1306_F3 +T10332133020311023221213100301001220 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1387_F3 +T12301331310032132101301303230121111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1431_F3 +T12011023331022213001123111301312011 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1560_F3 +T32212313302203320020222113111011111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1591_F3 +T23202101330322130221230222201123202 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1624_F3 +T20122200222132200313011102302210332 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1826_F3 +T13012312120112021233030302313201111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1903_F3 +T30232100103132133321330310210101221 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_574_1961_F3 +T02333101331223303300200011100032200 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_54_F3 +T13331330322230200102132110132013200 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_80_F3 +T33133322233322221003332230323312313 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_192_F3 +T30013012111133003301010212123302011 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_197_F3 +T33312113010133020301131330001310032 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_223_F3 +T10121010002202131221210302100121020 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_420_F3 +T31110103220000101310112112001020212 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_434_F3 +T30312132120223101113223301211113311 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_444_F3 +T33022120112320220100202132332113320 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_459_F3 +T31330310210101223330110231120131100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_506_F3 +T31210200111210121332321310110132301 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_569_F3 +T10210201321323001012232322323002203 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_622_F3 +T01100031122111023002323113231210111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_644_F3 +T11332003221203131231202200030110130 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_663_F3 +T32210013303112103322311101322021210 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_681_F3 +T23131132033020103031013233200101021 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_711_F3 +T03032331231101231020121210002332121 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_730_F3 +T31010102200110302123032330331011111 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_904_F3 +T20111213300020123200333321131121211 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_938_F3 +T13103102220022130222233301013033120 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_970_F3 +T23201311301023133303023011202220221 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_991_F3 +T33312212031111111012212120321121210 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1138_F3 +T23320002011320012120333103233301321 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1157_F3 +T13121323330203331222022230133102321 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1180_F3 +T32003310122102323303101123331133110 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1283_F3 +T02232200301300220130032321323131333 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1302_F3 +T01201303312333123130200123201013021 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1310_F3 +T31332131312021303211310220101211133 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1321_F3 +T11001010233200122122022023000203212 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1373_F3 +T21213011223311001221321132013121220 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1419_F3 +T33222200303001021230212332001013020 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1436_F3 +T13210313021212303321202113301220331 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1442_F3 +T33132010022331132101132123132020222 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1454_F3 +T11131130011012021120222231313211113 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1500_F3 +T11010000223111301132313011130103021 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1535_F3 +T21312012030320112110211013300131121 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1724_F3 +T33123002323300220213232301000010010 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1829_F3 +T21033321320111321230233302313101021 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1898_F3 +T31330110303103131001110300102101330 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_575_1964_F3 +T22010201103202213200201301300232123 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_32_F3 +T13012100120333032211330300332022110 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_74_F3 +T30103313210232220102021223012112100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_86_F3 +T10320000121033022010011030032211310 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_89_F3 +T02132333203332020020220033002121120 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_266_F3 +T30322223101312011300311121221333223 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_327_F3 +T22112331301313021321001332120332130 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_331_F3 +T32012133301311223023011232112333030 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_387_F3 +T00101211032031120300200222001230022 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_406_F3 +T00223133010210122221320212103132011 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_449_F3 +T31312001121222231100020132132100220 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_519_F3 +T03011321130130133213131202130321131 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_603_F3 +T21003032313302312320131221001330311 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_655_F3 +T02001023130302322122200313123123102 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_677_F3 +T13330131023320301031013230210103022 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_718_F3 +T31232113331022231333313223132231213 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_722_F3 +T31230320322120231333030031100313200 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_754_F3 +T30221231132103120112331303112133020 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_815_F3 +T23022113203032010120310102321001031 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_882_F3 +T13230020122320223230022031020110122 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_898_F3 +T10230132312121033222231132231233213 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_923_F3 +T21322010320202013210121223010123122 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_930_F3 +T21322103230123110323102012021020013 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1019_F3 +T22032121213231032210312001103122312 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1068_F3 +T00020232013101330112220321203220211 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1131_F3 +T10233122200222132200313011102302210 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1168_F3 +T31013300131121323122002113301002010 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1207_F3 +T21001132013000122220301213221213010 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1289_F3 +T03021210023110200323310302013121203 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1329_F3 +T01100302102020113003022000120002100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1367_F3 +T12231310311233110031222013332011023 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1416_F3 +T33021233100123120313103133211203221 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1461_F3 +T32022221221112233100210223002100100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1605_F3 +T30232100103132133321330310210101221 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1664_F3 +T31212101001312110320301201002011120 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1671_F3 +T22313332300211322113223102231322313 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1729_F3 +T11233312313010012320101302101023030 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1880_F3 +T13032121323320213301001310130212003 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1982_F3 +T00032312310201201333221212000011030 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_1987_F3 +T30022313313231221213220132001011320 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_2014_F3 +T31123201010100321122111102113021003 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_576_2028_F3 +T20131211210311112023201213120201100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_40_F3 +T11111212330120012020200031313303003 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_119_F3 +T33111010021103320103213121313000102 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_133_F3 +T33213323012231300122223032223331322 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_255_F3 +T00332022110020300332022020202002232 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_281_F3 +T03032301231212301013112222111210000 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_288_F3 +T01031120221303100221230021013201130 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_322_F3 +T12003213220230103303201000130312202 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_362_F3 +T31203302330110131230331210121110220 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_382_F3 +T32312123033111120321303230201332100 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_464_F3 +T13020221011130013102221333131203302 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_488_F3 +T13200302330322110200323132101120301 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_511_F3 +T32232133031023313331312220133230333 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_545_F3 +T00112131333222303222210031322103233 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_559_F3 +T32321101303233120102011130022122002 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_562_F3 +T32331101301233110121000220031120031 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_637_F3 +T22113312122202103031023120301031110 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_641_F3 +T13031301101121223221212020032131113 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +@1831_577_692_F3 +T01122320200330103121202301211100220 ++ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ diff -r 46849d69d7e6 -r 674aaee19991 test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_combiner_no_qual_decimal_out_1.fastqsanger Wed Feb 24 16:50:06 2010 -0500 @@ -0,0 +1,12 @@ +(a)SRR014849.50939 EIXKN4201BA2EC length=135 +GAAATTTCAGGGCCACCTTTTTTTTGATAGAATAATGGAGAAAATTAAAAGCTGTACATATACCAATGAACAATAAATCAATACATAAAAAAGGAGAAGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGG ++ +93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 +(a)SRR014849.110027 EIXKN4201APUB0 length=131 +CTTCAAATGATTCCGGGACTGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTTCGGTTCCAACTCGCCGTCCGAATAATCCGTTCAAAATCTTGGCCTGTCAAAACGACTTTACGACCAGAACGATCCG ++ +93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 +(a)SRR014849.203935 EIXKN4201B4HU6 length=144 +AACCCGTCCCATCAAAGATTTTGGTTGGAACCCGAAAGGGTTTTGAATTCAAACCCCTTTCGGTTCCAACTATTCAATTGTTTAACTTTTTTTAAATTGATGGTCTGTTGGACCATTTGTAATAATCCCCATCGGAATTTCTTT ++ +93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 diff -r 46849d69d7e6 -r 674aaee19991 tools/fastq/fastq_combiner.py --- a/tools/fastq/fastq_combiner.py Wed Feb 24 16:48:22 2010 -0500 +++ b/tools/fastq/fastq_combiner.py Wed Feb 24 16:50:06 2010 -0500 @@ -1,6 +1,6 @@ #Dan Blankenberg import sys, os, shutil -from galaxy_utils.sequence.fastq import fastqWriter, fastqSequencingRead, fastqCombiner +from galaxy_utils.sequence.fastq import fastqWriter, fastqSequencingRead, fastqCombiner, fastqFakeFastaScoreReader from galaxy_utils.sequence.fasta import fastaReader, fastaNamedReader def main(): @@ -23,15 +23,18 @@ format = 'illumina' out = fastqWriter( open( output_filename, 'wb' ), format = format, force_quality_encoding = force_quality_encoding ) - qual_input = fastaNamedReader( open( qual_filename, 'rb' ) ) + if qual_filename == 'None': + qual_input = fastqFakeFastaScoreReader( format, quality_encoding = force_quality_encoding ) + else: + qual_input = fastaNamedReader( open( qual_filename, 'rb' ) ) + fastq_combiner = fastqCombiner( format ) i = None skip_count = 0 for i, sequence in enumerate( fastaReader( open( fasta_filename, 'rb' ) ) ): - quality = qual_input.get( sequence.identifier ) + quality = qual_input.get( sequence ) if quality: fastq_read = fastq_combiner.combine( sequence, quality ) - #Should we check that fastq read is valid? for now, assume groomer will be used to verify out.write( fastq_read ) else: skip_count += 1 diff -r 46849d69d7e6 -r 674aaee19991 tools/fastq/fastq_combiner.xml --- a/tools/fastq/fastq_combiner.xml Wed Feb 24 16:48:22 2010 -0500 +++ b/tools/fastq/fastq_combiner.xml Wed Feb 24 16:50:06 2010 -0500 @@ -3,7 +3,7 @@ <command interpreter="python">fastq_combiner.py '$fasta_file' '${fasta_file.extension}' '$qual_file' '${qual_file.extension}' '$output_file' '$force_quality_encoding'</command> <inputs> <param name="fasta_file" type="data" format="fasta,csfasta" label="FASTA File" /> - <param name="qual_file" type="data" format="qual" label="Quality Score File" /> + <param name="qual_file" type="data" format="qual" label="Quality Score File" optional="True" /> <param name="force_quality_encoding" type="select" label="Force Quality Score encoding"> <option value="None">Use Source Encoding</option> <option value="ascii" selected="True">ASCII</option> @@ -45,11 +45,25 @@ <param name="force_quality_encoding" value="decimal" /> <output name="output_file" file="wrapping_as_sanger_decimal.fastqsanger" /> </test> + <test> + <param name="fasta_file" value="fastq_combiner_in_1.fasta" ftype="fasta" /> + <param name="qual_file" /> + <param name="force_quality_encoding" value="decimal" /> + <output name="output_file" file="fastq_combiner_no_qual_decimal_out_1.fastqsanger" /> + </test> + <test> + <param name="fasta_file" value="s2fq_phiX.csfasta" ftype="csfasta" /> + <param name="qual_file" /> + <param name="force_quality_encoding" value="ascii" /> + <output name="output_file" file="fastq_combiner_no_qual_ascii_out_1.fastqsolid" /> + </test> </tests> <help> **What it does** This tool joins a FASTA file to a Quality Score file, creating a single FASTQ block for each read. +Specifying a set of quality scores is optional; when not provided, the output will be fastqsanger or fastqsolid (when a csfasta is provided) with each quality score being the maximal allowed value (93). + </help> </tool>

1 0

Jump to page:

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

galaxy-dev February 2010