galaxy-dev
Threads by month
- ----- 2026 -----
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
- 10009 discussions
16 Apr '10
details: http://www.bx.psu.edu/hg/galaxy/rev/5cc5e94345b8
changeset: 3566:5cc5e94345b8
user: fubar: ross Lazarus at gmail period com
date: Fri Mar 26 12:02:22 2010 -0400
description:
Add a tool_runner entry for hapmap - similar to the existing biomart one
Updated WGA/SNP entries in tool_conf.xml.sample
diffstat:
.hgignore | 4 +++
lib/galaxy/web/controllers/tool_runner.py | 6 +++++
tool_conf.xml.sample | 35 +++++++++++++++++++-----------
3 files changed, 32 insertions(+), 13 deletions(-)
diffs (93 lines):
diff -r 5f927f52191c -r 5cc5e94345b8 .hgignore
--- a/.hgignore Fri Mar 26 09:51:03 2010 -0400
+++ b/.hgignore Fri Mar 26 12:02:22 2010 -0400
@@ -1,5 +1,6 @@
syntax: glob
+.hg*
# Downloaded and locally built eggs
eggs
scripts/scramble/build
@@ -10,6 +11,8 @@
database/beaker_sessions
database/compiled_templates
database/files
+database/pbs
+database/tmp
database/*.sqlite
# Python bytecode
@@ -20,6 +23,7 @@
reports_wsgi.ini
datatypes_conf.xml
tool_conf.xml
+static/welcome.html.*
tool-data/*.loc
# Test output
diff -r 5f927f52191c -r 5cc5e94345b8 lib/galaxy/web/controllers/tool_runner.py
--- a/lib/galaxy/web/controllers/tool_runner.py Fri Mar 26 09:51:03 2010 -0400
+++ b/lib/galaxy/web/controllers/tool_runner.py Fri Mar 26 12:02:22 2010 -0400
@@ -25,6 +25,12 @@
"""Catches the tool id and redirects as needed"""
return self.index(trans, tool_id=tool_id, **kwd)
+ #test to get hapmap to work, ideally, we could pass tool_id to hapmap biomart and receive it back
+ @web.expose
+ def hapmapmart(self, trans, tool_id='hapmapmart', **kwd):
+ """Catches the tool id and redirects as needed"""
+ return self.index(trans, tool_id=tool_id, **kwd)
+
@web.expose
def default(self, trans, tool_id=None, **kwd):
"""Catches the tool id and redirects as needed"""
diff -r 5f927f52191c -r 5cc5e94345b8 tool_conf.xml.sample
--- a/tool_conf.xml.sample Fri Mar 26 09:51:03 2010 -0400
+++ b/tool_conf.xml.sample Fri Mar 26 12:02:22 2010 -0400
@@ -235,24 +235,33 @@
<tool file="genetrack/genetrack_indexer.xml" />
<tool file="genetrack/genetrack_peak_prediction.xml" />
</section>
- <section name="Rg Data" id="rgData1">
- <tool file="rgenetics/rgenetics_import.xml"/>
- <tool file="rgenetics/rgLpedPbed.xml"/>
+ <section name="SNP/WGA: Data; Filters" id="rgdat">
+ <label text="Data: Import and upload" id="rgimport" />
+ <tool file="data_source/upload.xml"/>
+ <tool file="data_source/access_libraries.xml" />
+ <tool file="data_source/hapmapmart.xml" />
+ <label text="Data: Filter and Clean" id="rgfilter" />
<tool file="rgenetics/rgClean.xml"/>
+ <tool file="rgenetics/rgPedSub.xml"/>
+ <tool file="rgenetics/rgLDIndep.xml"/>
+ <label text="Simulate" id="rgsim" />
+ <tool file="rgenetics/rgfakePhe.xml"/>
+ <tool file="rgenetics/rgfakePed.xml"/>
+ </section>
+ <section name="SNP/WGA: QC; LD; Plots" id="rgqcplot">
+ <label text="QC; Eigenstrat" id="rgvisual" />
<tool file="rgenetics/rgQC.xml"/>
+ <tool file="rgenetics/rgEigPCA.xml"/>
+ <label text="LD; Manhattan/QQ; GRR" id="rgld" />
+ <tool file="rgenetics/rgHaploView.xml"/>
+ <tool file="rgenetics/rgManQQ.xml"/>
+ <tool file="rgenetics/rgGRR.xml"/>
</section>
- <section name="Rg Simulate" id="rgSim1">
- <tool file="rgenetics/rgfakePhe.xml"/>
- </section>
- <section name="Rg Visualise" id="rgVis1">
- <tool file="rgenetics/rgQC.xml"/>
- <tool file="rgenetics/rgEigPCA2.xml"/>
- <tool file="rgenetics/rgQQ.xml"/>
- </section>
- <section name="Rg Model Data" id="rgModel1">
- <tool file="rgenetics/rgGLM.xml"/>
+ <section name="SNP/WGA: Statistical Models" id="rgmodel">
<tool file="rgenetics/rgCaCo.xml"/>
<tool file="rgenetics/rgTDT.xml"/>
+ <tool file="rgenetics/rgGLM.xml"/>
+ <tool file="rgenetics/rgManQQ.xml"/>
</section>
<!--
TODO: uncomment the following EMBOSS section whenever
1
0
16 Apr '10
details: http://www.bx.psu.edu/hg/galaxy/rev/3ac95cd927d7
changeset: 3565:3ac95cd927d7
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Fri Mar 26 12:00:55 2010 -0400
description:
Added new tabular/pileup join tool and associated test files. Also added pileup datatype.
diffstat:
datatypes_conf.xml.sample | 2 +
lib/galaxy/datatypes/registry.py | 3 +
lib/galaxy/datatypes/tabular.py | 93 ++
lib/galaxy/datatypes/test/10col.pileup | 30 +
lib/galaxy/datatypes/test/6col.pileup | 30 +
test-data/1.pileup | 1000 ++++++++++++++++++++++++++++++++
test-data/column_join_in1.pileup | 30 +
test-data/column_join_in2.pileup | 30 +
test-data/column_join_in3.pileup | 30 +
test-data/column_join_in4.pileup | 25 +
test-data/column_join_in5.pileup | 25 +
test-data/column_join_in6.pileup | 25 +
test-data/column_join_in7.pileup | 32 +
test-data/column_join_in8.pileup | 23 +
test-data/column_join_in9.pileup | 25 +
test-data/column_join_out1.pileup | 60 +
test-data/column_join_out2.pileup | 65 ++
test-data/column_join_out3.pileup | 70 ++
test/functional/test_get_data.py | 17 +
tool_conf.xml.sample | 1 +
20 files changed, 1616 insertions(+), 0 deletions(-)
diffs (1743 lines):
diff -r 5f927f52191c -r 3ac95cd927d7 datatypes_conf.xml.sample
--- a/datatypes_conf.xml.sample Fri Mar 26 09:51:03 2010 -0400
+++ b/datatypes_conf.xml.sample Fri Mar 26 12:00:55 2010 -0400
@@ -61,6 +61,7 @@
<converter file="maf_to_interval_converter.xml" target_datatype="interval"/>
</datatype>
<datatype extension="pdf" type="galaxy.datatypes.images:Image" mimetype="application/pdf"/>
+ <datatype extension="pileup" type="galaxy.datatypes.tabular:Pileup" display_in_upload="true" />
<datatype extension="png" type="galaxy.datatypes.images:Image" mimetype="image/png"/>
<datatype extension="qual" type="galaxy.datatypes.qualityscore:QualityScore" />
<datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/>
@@ -239,6 +240,7 @@
<sniffer type="galaxy.datatypes.interval:CustomTrack"/>
<sniffer type="galaxy.datatypes.interval:Gff"/>
<sniffer type="galaxy.datatypes.interval:Gff3"/>
+ <sniffer type="galaxy.datatypes.tabular:Pileup"/>
<sniffer type="galaxy.datatypes.interval:Interval"/>
<sniffer type="galaxy.datatypes.tabular:Sam"/>
</sniffers>
diff -r 5f927f52191c -r 3ac95cd927d7 lib/galaxy/datatypes/registry.py
--- a/lib/galaxy/datatypes/registry.py Fri Mar 26 09:51:03 2010 -0400
+++ b/lib/galaxy/datatypes/registry.py Fri Mar 26 12:00:55 2010 -0400
@@ -155,6 +155,7 @@
'laj' : images.Laj(),
'lav' : sequence.Lav(),
'maf' : sequence.Maf(),
+ 'pileup' : tabular.Pileup(),
'qualsolid' : qualityscore.QualityScoreSOLiD(),
'qualsolexa' : qualityscore.QualityScoreSolexa(),
'qual454' : qualityscore.QualityScore454(),
@@ -185,6 +186,7 @@
'laj' : 'text/plain',
'lav' : 'text/plain',
'maf' : 'text/plain',
+ 'pileup' : 'text/plain',
'qualsolid' : 'text/plain',
'qualsolexa' : 'text/plain',
'qual454' : 'text/plain',
@@ -218,6 +220,7 @@
interval.CustomTrack(),
interval.Gff(),
interval.Gff3(),
+ tabular.Pileup(),
interval.Interval(),
tabular.Sam()
]
diff -r 5f927f52191c -r 3ac95cd927d7 lib/galaxy/datatypes/tabular.py
--- a/lib/galaxy/datatypes/tabular.py Fri Mar 26 09:51:03 2010 -0400
+++ b/lib/galaxy/datatypes/tabular.py Fri Mar 26 12:00:55 2010 -0400
@@ -327,3 +327,96 @@
except:
pass
return False
+
+class Pileup( Tabular ):
+ """Tab delimited data in pileup (6- or 10-column) format"""
+ file_ext = "pileup"
+
+ """Add metadata elements"""
+ MetadataElement( name="chromCol", default=1, desc="Chrom column", param=metadata.ColumnParameter )
+ MetadataElement( name="startCol", default=2, desc="Start column", param=metadata.ColumnParameter )
+ MetadataElement( name="baseCol", default=3, desc="Reference base column", param=metadata.ColumnParameter )
+
+ def init_meta( self, dataset, copy_from=None ):
+ Tabular.init_meta( self, dataset, copy_from=copy_from )
+
+ def set_peek( self, dataset, line_count=None, is_multi_byte=False ):
+ """Set the peek and blurb text"""
+ if not dataset.dataset.purged:
+ dataset.peek = data.get_file_peek( dataset.file_name, is_multi_byte=is_multi_byte )
+ if line_count is None:
+ # See if line_count is stored in the metadata
+ if dataset.metadata.data_lines:
+ dataset.blurb = "%s genomic coordinates" % util.commaify( str( dataset.metadata.data_lines ) )
+ else:
+ # Number of lines is not known ( this should not happen ), and auto-detect is
+ # needed to set metadata
+ dataset.blurb = "? genomic coordinates"
+ else:
+ dataset.blurb = "%s genomic coordinates" % util.commaify( str( line_count ) )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+
+ def make_html_table( self, dataset, skipchars=[] ):
+ """Create HTML table, used for displaying peek"""
+ out = ['<table cellspacing="0" cellpadding="3">']
+ comments = []
+ try:
+ # Generate column header
+ out.append('<tr>')
+ for i in range( 1, dataset.metadata.columns+1 ):
+ if i == dataset.metadata.chromCol:
+ out.append( '<th>%s.Chrom</th>' % i )
+ elif i == dataset.metadata.startCol:
+ out.append( '<th>%s.Start</th>' % i )
+ elif i == dataset.metadata.baseCol:
+ out.append( '<th>%s.Base</th>' % i )
+ else:
+ out.append( '<th>%s</th>' % i )
+ out.append('</tr>')
+ out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) )
+ out.append( '</table>' )
+ out = "".join( out )
+ except Exception, exc:
+ out = "Can't create peek %s" % str( exc )
+ return out
+
+ def repair_methods( self, dataset ):
+ """Return options for removing errors along with a description"""
+ return [ ("lines", "Remove erroneous lines") ]
+
+ def sniff( self, filename ):
+ """
+ Checks for 'pileup-ness'
+
+ There are two main types of pileup: 6-column and 10-column. For both,
+ the first three and last two columns are the same. We only check the
+ first three to allow for some personalization of the format.
+
+ >>> fname = get_test_fname( 'interval.interval' )
+ >>> Pileup().sniff( fname )
+ False
+ >>> fname = get_test_fname( '6col.pileup' )
+ >>> Pileup().sniff( fname )
+ True
+ >>> fname = get_test_fname( '10col.pileup' )
+ >>> Pileup().sniff( fname )
+ True
+ """
+ headers = get_headers( filename, '\t' )
+ try:
+ for hdr in headers:
+ if hdr and not hdr[0].startswith( '#' ):
+ if len( hdr ) < 3:
+ return False
+ try:
+ # chrom start in column 1 (with 0-based columns)
+ # and reference base is in column 2
+ check = int( hdr[1] )
+ assert hdr[2] in [ 'A', 'C', 'G', 'T', 'N', 'a', 'c', 'g', 't', 'n' ]
+ except:
+ return False
+ return True
+ except:
+ return False
diff -r 5f927f52191c -r 3ac95cd927d7 lib/galaxy/datatypes/test/10col.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/10col.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,30 @@
+chrM 1 G G 25 0 25 1 ^:. I
+chrM 2 T T 25 0 25 1 . I
+chrM 3 T T 25 0 25 1 . I
+chrM 4 A A 36 0 25 3 .^:.^:. II+
+chrM 5 A A 36 0 25 3 ... III
+chrM 6 T T 36 0 25 3 ... III
+chrM 7 G G 42 0 25 5 ...^:.^:. IIIII
+chrM 8 T T 45 0 25 6 .....^:. IIIIII
+chrM 9 A A 51 0 25 8 ......^:.^:. IIIIIIII
+chrM 10 G G 54 0 25 9 ........^:. IIIIIIIII
+chrM 11 C C 57 0 25 10 .........^:. IIIIIIIIII
+chrM 12 T T 60 0 25 11 ..........^:. IIIIIIIIIII
+chrM 13 T T 78 0 25 17 ...........^:.^:.^:.^:.^:.^:. IIIIIIIIIIIIIIIII
+chrM 14 A A 56 0 25 18 .......G.........^:. BIIIIIII+IIIIIIIII
+chrM 15 A A 87 0 25 20 ..................^:.^:. DIIIIIII(IIIIIIIIIII
+chrM 16 T T 87 0 25 20 .................... IIIIIIIIIIIIIIIIIIII
+chrM 17 A A 87 0 25 20 .................... 9IIIIIIIIIIIIIIIIIII
+chrM 18 A A 87 0 25 20 .................... @IIIIIIIIIIIIIIIIIII
+chrM 19 T T 55 0 25 20 ..................GG IIIIIIIIIIIIIIIIII'A
+chrM 20 A A 54 0 25 20 ..................C. IIIIIIIIIIIIIII2II#$
+chrM 21 T T 87 0 25 20 .................... IIIIIIIIIIIIIIIIIIII
+chrM 22 A A 87 0 25 20 .................... IIIIIIIIIIIIIIAIIIII
+chrM 23 A A 87 0 25 20 .................... 9IIIIIIIIII0IIIIIIII
+chrM 24 A A 87 0 25 20 ........N........... IIIIIIII"IIIIICIIIII
+chrM 25 G G 57 0 25 21 ...A................^:. A@.$IIIIIIIFIIIIIIIII
+chrM 26 C C 57 0 25 21 .......A............. IIHIDII&IIIIIIIIIIIII
+chrM 27 A A 99 0 25 24 .....................^:.^:.^:. IE8IFIII9IIIIIIIIIIIIIII
+chrM 28 A A 99 0 25 24 ........................ 1FIIIIIIIIIIIIIIIIDEIIII
+chrM 29 G G 55 0 25 24 ..................NN.... ;IIIIII+HII=IIIIII""IIII
+chrM 30 G G 68 0 25 25 ...C....................^:. ;I?&IAI0IIIIIIIIIIIIIIIII
diff -r 5f927f52191c -r 3ac95cd927d7 lib/galaxy/datatypes/test/6col.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/6col.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,30 @@
+chrM 42 C 1 ^:. I
+chrM 43 C 2 .^:. II
+chrM 44 T 2 .. II
+chrM 45 A 3 ..^:. III
+chrM 46 G 4 ...^:. IIII
+chrM 47 A 5 ....^:, IIIII
+chrM 48 T 5 ...., IIIII
+chrM 49 G 5 ...., IIIII
+chrM 50 A 5 ...., IIIII
+chrM 51 G 5 ...., IIIII
+chrM 52 T 5 ...., IIIII
+chrM 53 A 5 ...., IIIII
+chrM 54 T 5 ...., IIIII
+chrM 55 T 5 ...., IIIII
+chrM 56 C 5 ...., IIIII
+chrM 57 T 5 ...., IIIII
+chrM 58 T 5 ...., IIIII
+chrM 59 A 5 ...., IIIII
+chrM 60 C 5 ...., IIIII
+chrM 61 T 5 ...., IIIII
+chrM 62 C 5 ...., IIIII
+chrM 63 C 5 ...., IIIII
+chrM 64 A 5 ...., IIIII
+chrM 65 T 5 ...., IIIII
+chrM 66 A 5 ...., IIIII
+chrM 67 A 5 ...., IIIII
+chrM 68 A 5 ...., IIICI
+chrM 69 C 5 ...., IIIII
+chrM 70 A 5 ...., IIIII
+chrM 71 C 5 ...., IIIII
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/1.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,1000 @@
+chrM 42 C 1 ^:. I
+chrM 43 C 2 .^:. II
+chrM 44 T 2 .. II
+chrM 45 A 3 ..^:. III
+chrM 46 G 4 ...^:. IIII
+chrM 47 A 5 ....^:, IIIII
+chrM 48 T 5 ...., IIIII
+chrM 49 G 5 ...., IIIII
+chrM 50 A 5 ...., IIIII
+chrM 51 G 5 ...., IIIII
+chrM 52 T 5 ...., IIIII
+chrM 53 A 5 ...., IIIII
+chrM 54 T 5 ...., IIIII
+chrM 55 T 5 ...., IIIII
+chrM 56 C 5 ...., IIIII
+chrM 57 T 5 ...., IIIII
+chrM 58 T 5 ...., IIIII
+chrM 59 A 5 ...., IIIII
+chrM 60 C 5 ...., IIIII
+chrM 61 T 5 ...., IIIII
+chrM 62 C 5 ...., IIIII
+chrM 63 C 5 ...., IIIII
+chrM 64 A 5 ...., IIIII
+chrM 65 T 5 ...., IIIII
+chrM 66 A 5 ...., IIIII
+chrM 67 A 5 ...., IIIII
+chrM 68 A 5 ...., IIICI
+chrM 69 C 5 ...., IIIII
+chrM 70 A 5 ...., IIIII
+chrM 71 C 5 ...., IIIII
+chrM 72 A 5 ...., IAIII
+chrM 73 T 5 ...., IIIII
+chrM 74 A 5 ...., IIIII
+chrM 75 G 5 ...., %IIII
+chrM 76 G 5 T..., *IIII
+chrM 77 C 5 .$..., GIIII
+chrM 78 T 4 .$.., IIII
+chrM 79 T 3 .., III
+chrM 80 G 3 .$., I1I
+chrM 81 G 2 .$, II
+chrM 82 T 1 ,$ I
+chrM 83 C 2 ^:.^:. II
+chrM 84 C 2 .. II
+chrM 85 T 2 .. II
+chrM 86 A 2 .. II
+chrM 87 G 2 .. II
+chrM 88 C 2 .. II
+chrM 89 C 2 .. II
+chrM 90 T 2 .. II
+chrM 91 T 2 .. II
+chrM 92 T 2 .. II
+chrM 93 T 2 .. II
+chrM 94 T 2 .. II
+chrM 95 A 2 .. II
+chrM 96 T 2 .. II
+chrM 97 T 2 .. II
+chrM 98 A 2 .. II
+chrM 99 G 2 .. II
+chrM 100 T 2 .. II
+chrM 101 T 2 .. II
+chrM 102 A 2 .. II
+chrM 103 T 2 .. II
+chrM 104 T 2 .. II
+chrM 105 A 2 .. IE
+chrM 106 A 2 .. II
+chrM 107 T 2 .. II
+chrM 108 A 2 .. II
+chrM 109 G 2 .. II
+chrM 110 A 2 .. II
+chrM 111 A 2 .. I2
+chrM 112 T 2 .. II
+chrM 113 T 2 .. II
+chrM 114 A 2 .. H7
+chrM 115 C 2 .. II
+chrM 116 A 2 .. II
+chrM 117 C 2 .. II
+chrM 118 A 2 .$.$ F8
+chrM 156 T 1 ^:, &
+chrM 157 C 1 , I
+chrM 158 A 2 g^:g I>
+chrM 159 C 2 ,, /F
+chrM 160 G 2 ,, II
+chrM 161 T 2 ,, I>
+chrM 162 C 2 ,, .-
+chrM 163 T 2 ,, I8
+chrM 164 C 2 ,, 4F
+chrM 165 T 2 ,, II
+chrM 166 A 2 ,, II
+chrM 167 C 2 ,, ;6
+chrM 168 G 2 ,, II
+chrM 169 A 2 ,, II
+chrM 170 T 2 ,, II
+chrM 171 T 2 ,, IB
+chrM 172 A 2 ,, II
+chrM 173 A 2 ,, II
+chrM 174 A 2 ,, II
+chrM 175 A 2 ,, II
+chrM 176 G 2 ,, II
+chrM 177 G 2 ,, II
+chrM 178 A 2 ,, II
+chrM 179 G 2 ,, II
+chrM 180 C 2 ,, II
+chrM 181 A 3 ,,^:, III
+chrM 182 G 3 ,,, III
+chrM 183 G 3 ,,, III
+chrM 184 T 3 ,,, III
+chrM 185 A 3 ,,, III
+chrM 186 T 3 ,,, III
+chrM 187 C 3 ,,, III
+chrM 188 A 3 ,,, III
+chrM 189 A 3 ,,, III
+chrM 190 G 3 ,,, III
+chrM 191 C 3 ,$,, III
+chrM 192 A 2 ,, II
+chrM 193 C 2 ,$, II
+chrM 194 A 1 , I
+chrM 195 C 1 , I
+chrM 196 T 1 , F
+chrM 197 A 1 , I
+chrM 198 G 1 , I
+chrM 199 A 1 , I
+chrM 200 A 1 , I
+chrM 201 A 2 ,^:. I-
+chrM 202 G 2 ,. II
+chrM 203 T 2 ,. II
+chrM 204 A 2 ,. II
+chrM 205 G 2 ,. I6
+chrM 206 C 2 ,. II
+chrM 207 T 2 ,. I,
+chrM 208 C 2 ,. II
+chrM 209 A 2 ,. II
+chrM 210 T 2 ,. II
+chrM 211 A 2 ,. II
+chrM 212 A 2 ,. IE
+chrM 213 C 2 ,. IC
+chrM 214 A 2 ,. I;
+chrM 215 C 2 ,. II
+chrM 216 C 2 ,$. II
+chrM 217 T 1 . I
+chrM 218 T 1 . I
+chrM 219 G 1 T I
+chrM 220 C 1 . I
+chrM 221 T 1 . I
+chrM 222 C 1 . E
+chrM 223 A 1 . 4
+chrM 224 G 1 T 9
+chrM 225 C 1 . :
+chrM 226 C 1 . ?
+chrM 227 A 1 . .
+chrM 228 C 1 . C
+chrM 229 A 3 .^:,^:, %II
+chrM 230 C 3 .,, 8II
+chrM 231 C 3 .,, 9II
+chrM 232 C 3 .,, III
+chrM 233 C 3 .,, AI'
+chrM 234 C 3 .,, DI+
+chrM 235 A 3 .,, &I@
+chrM 236 C 3 .$,a +I$
+chrM 237 G 2 ,, II
+chrM 238 G 2 ,, II
+chrM 239 G 2 ,, II
+chrM 240 A 2 ,, II
+chrM 241 C 2 ,, I+
+chrM 242 A 2 ,, II
+chrM 243 C 2 ,, II
+chrM 244 A 3 ,,^:, II;
+chrM 245 G 3 ,,, II*
+chrM 246 C 3 ,,n II"
+chrM 247 A 3 ,,, III
+chrM 248 G 4 ,,,^:. IIII
+chrM 249 T 4 ,,,. II)I
+chrM 250 G 4 ,,,. II2I
+chrM 251 A 4 ,,,. II(I
+chrM 252 T 4 ,,,. II*I
+chrM 253 A 4 ,,,. II7I
+chrM 254 A 4 ,,,. II1I
+chrM 255 A 4 ,,,. II?I
+chrM 256 A 4 ,,,. II9I
+chrM 257 A 4 ,,,. II?I
+chrM 258 T 4 ,,,. II$I
+chrM 259 T 5 ,,,.^:. II&II
+chrM 260 A 5 ,,,.. II,II
+chrM 261 A 5 ,,,.. II/II
+chrM 262 G 5 ,,,.. II5II
+chrM 263 C 5 ,,a.. II%II
+chrM 264 T 5 ,$,$,.. II%II
+chrM 265 A 3 ,.. )II
+chrM 266 T 3 ,.. +II
+chrM 267 G 4 ,..^:. *III
+chrM 268 A 4 ,... EIII
+chrM 269 A 4 ,... =III
+chrM 270 C 4 a... ;III
+chrM 271 G 4 ,... ;III
+chrM 272 A 4 ,... 8@II
+chrM 273 A 4 ,... 1III
+chrM 274 A 4 ,... ICII
+chrM 275 G 4 ,... IIII
+chrM 276 T 4 ,... IIII
+chrM 277 T 4 ,... IIII
+chrM 278 C 4 ,... IIII
+chrM 279 G 4 ,$... IIII
+chrM 280 A 3 ... III
+chrM 281 C 3 ... GII
+chrM 282 T 3 ... III
+chrM 283 A 3 .$.. IFI
+chrM 284 A 3 ..^:, IAI
+chrM 285 G 3 .., ;II
+chrM 286 T 4 ..,^:. IIII
+chrM 287 C 4 ..,. II4I
+chrM 288 A 4 ..,. @III
+chrM 289 T 4 ..,. IIII
+chrM 290 A 4 ..,. @:II
+chrM 291 T 4 ..,. IIAI
+chrM 292 T 4 ..,. IIII
+chrM 293 A 4 ..,. 8;II
+chrM 294 A 4 .$.,. I<II
+chrM 295 A 3 .,. 4II
+chrM 296 T 3 .,. III
+chrM 297 A 3 .,. BII
+chrM 298 A 3 .,. CII
+chrM 299 G 3 .,. III
+chrM 300 G 3 .,. ;II
+chrM 301 G 3 .,. III
+chrM 302 T 3 .$,. III
+chrM 303 T 2 ,. II
+chrM 304 G 2 ,. II
+chrM 305 G 2 ,. II
+chrM 306 T 2 ,. II
+chrM 307 A 2 ,. II
+chrM 308 A 2 ,. II
+chrM 309 A 2 ,. II
+chrM 310 T 2 ,. II
+chrM 311 T 2 ,. II
+chrM 312 T 3 ,.^:. III
+chrM 313 C 3 ,.. III
+chrM 314 G 3 ,.. III
+chrM 315 T 3 ,.. III
+chrM 316 G 3 ,.. III
+chrM 317 C 3 ,.. III
+chrM 318 C 3 ,.. III
+chrM 319 A 3 ,$.. III
+chrM 320 G 2 .. II
+chrM 321 C 2 .$. II
+chrM 322 C 1 . I
+chrM 323 A 1 . I
+chrM 324 C 1 . I
+chrM 325 C 1 . I
+chrM 326 G 1 . I
+chrM 327 C 1 . I
+chrM 328 G 1 . I
+chrM 329 G 1 . I
+chrM 330 T 1 . I
+chrM 331 C 1 . I
+chrM 332 A 1 . I
+chrM 333 T 1 . I
+chrM 334 A 1 . I
+chrM 335 C 1 . I
+chrM 336 G 1 . I
+chrM 337 A 1 . I
+chrM 338 T 1 . I
+chrM 339 T 1 . I
+chrM 340 A 1 . I
+chrM 341 A 1 . D
+chrM 342 C 1 . I
+chrM 343 C 1 . I
+chrM 344 C 1 . I
+chrM 345 A 1 . I
+chrM 346 A 1 . ;
+chrM 347 A 1 .$ 7
+chrM 360 C 1 ^:. I
+chrM 361 G 1 . I
+chrM 362 G 1 . I
+chrM 363 C 1 . I
+chrM 364 G 1 . I
+chrM 365 T 1 . I
+chrM 366 A 1 . I
+chrM 367 A 1 . I
+chrM 368 A 1 . I
+chrM 369 G 1 . I
+chrM 370 C 1 . I
+chrM 371 G 1 . I
+chrM 372 T 1 . I
+chrM 373 G 1 . I
+chrM 374 T 1 . I
+chrM 375 C 1 . I
+chrM 376 A 1 . I
+chrM 377 A 1 . I
+chrM 378 A 1 . I
+chrM 379 G 1 . I
+chrM 380 A 1 . I
+chrM 381 C 1 T I
+chrM 382 T 1 . I
+chrM 383 A 1 . I
+chrM 384 A 1 . I
+chrM 385 T 1 . I
+chrM 386 A 1 G I
+chrM 387 C 1 . I
+chrM 388 C 1 . I
+chrM 389 A 2 .^:. II
+chrM 390 A 3 ..^:. III
+chrM 391 A 3 ... >II
+chrM 392 A 3 ... III
+chrM 393 T 3 ... III
+chrM 394 A 3 ... III
+chrM 395 A 3 .$.. III
+chrM 396 A 2 .. II
+chrM 397 G 2 .. II
+chrM 398 T 2 .. EI
+chrM 399 T 2 .. II
+chrM 400 A 3 ..^:. III
+chrM 401 A 3 ... III
+chrM 402 A 3 ... III
+chrM 403 A 3 ... III
+chrM 404 C 3 ... III
+chrM 405 C 3 ... III
+chrM 406 C 3 ... EII
+chrM 407 A 3 ... III
+chrM 408 G 3 ... III
+chrM 409 T 3 ... 0II
+chrM 410 T 3 ... III
+chrM 411 A 4 ...^:, IIII
+chrM 412 A 4 ..., FIII
+chrM 413 G 4 ..., IIIH
+chrM 414 C 4 ...a III2
+chrM 415 C 4 TTTt III7
+chrM 416 G 5 ...,^:, II?7:
+chrM 417 T 5 ...,, ;IIE@
+chrM 418 A 5 ...,, IIIII
+chrM 419 A 5 ...,, IIIII
+chrM 420 A 5 ...,, FIIII
+chrM 421 A 5 ...,, IIIII
+chrM 422 A 5 ...,, >IIII
+chrM 423 G 6 ...,,^:, HII/I,
+chrM 424 C 6 .$..a,, ;II-I:
+chrM 425 T 5 .$.,,, IIIIF
+chrM 426 A 5 .,,,^:, III@I
+chrM 427 C 5 .,,,, III$I
+chrM 428 A 5 .,,,, IIIII
+chrM 429 A 5 .,,,, IIII.
+chrM 430 C 5 .,,,a I%I5'
+chrM 431 C 5 .,,,, I(I5<
+chrM 432 A 5 .,,,, IIIII
+chrM 433 A 5 .,,,, 0IIII
+chrM 434 A 5 .,,,, =IIII
+chrM 435 G 5 .$,,,, EIIII
+chrM 436 T 4 ,,,, III5
+chrM 437 A 4 ,,,, IIII
+chrM 438 A 4 ,,,, IIII
+chrM 439 A 4 ,,,, IIII
+chrM 440 A 4 ,,,, IIIF
+chrM 441 T 6 ,,,,^:.^:. III;II
+chrM 442 A 6 ,,,,.. IIIIII
+chrM 443 G 6 ,,,,.. IIIIII
+chrM 444 A 6 ,,,,.. IIIIII
+chrM 445 C 6 ,,,,.. IIIIII
+chrM 446 T 6 ,$,,,.. IIIIII
+chrM 447 A 5 ,,,.. IIIII
+chrM 448 C 5 ,,,.. IIIII
+chrM 449 G 6 ,,,..^:, IIIII6
+chrM 450 A 6 ,,,.., IIIIII
+chrM 451 A 6 ,$,,.., IIIIII
+chrM 452 A 5 ,,.., IIIII
+chrM 453 G 5 ,,.., IIIII
+chrM 454 T 6 ,,..,^:, IIIIII
+chrM 455 G 6 ,,..,, IIIIII
+chrM 456 A 6 ,,..,, IIIIII
+chrM 457 C 6 ,,..,, IIIII=
+chrM 458 T 6 ,$,..,, IIIIII
+chrM 459 T 5 ,..,, IIIII
+chrM 460 T 5 ,..,, IIIII
+chrM 461 A 5 ,$..,, IIIII
+chrM 462 A 4 ..,, IIII
+chrM 463 T 4 ..,, IIIC
+chrM 464 A 4 ..,, IIII
+chrM 465 C 4 ..,, IIII
+chrM 466 C 4 ..,, IIII
+chrM 467 T 4 ..,, II>?
+chrM 468 C 4 ..,, IIII
+chrM 469 T 4 ..,, IIIG
+chrM 470 G 4 ..,, %III
+chrM 471 A 4 ..,, 4;II
+chrM 472 C 4 ..,, II3I
+chrM 473 T 4 ..,, IIII
+chrM 474 A 4 ..,, ;III
+chrM 475 C 4 ..,, IIII
+chrM 476 A 4 .$.$,, 32II
+chrM 477 C 2 ,, II
+chrM 478 G 2 ,, II
+chrM 479 A 2 ,, II
+chrM 480 T 3 ,,^:. III
+chrM 481 A 3 ,,. III
+chrM 482 G 3 ,,. III
+chrM 483 C 4 ,,.^:, IIIE
+chrM 484 T 4 ,$,., III9
+chrM 485 A 3 ,., III
+chrM 486 A 3 ,., III
+chrM 487 G 3 ,., III
+chrM 488 A 3 ,., III
+chrM 489 C 3 ,$., III
+chrM 490 C 2 ., II
+chrM 491 C 2 ., II
+chrM 492 A 2 ., II
+chrM 493 A 2 ., II
+chrM 494 A 2 ., II
+chrM 495 C 2 ., II
+chrM 496 T 2 ., I2
+chrM 497 G 2 ., II
+chrM 498 G 2 ., II
+chrM 499 G 2 ., II
+chrM 500 A 2 ., II
+chrM 501 T 2 ., II
+chrM 502 T 2 ., II
+chrM 503 A 2 ., II
+chrM 504 G 2 ., II
+chrM 505 A 2 ., GI
+chrM 506 T 2 ., II
+chrM 507 A 2 ., II
+chrM 508 C 2 ., II
+chrM 509 C 2 ., II
+chrM 510 C 3 .,^:. III
+chrM 511 C 3 .,. III
+chrM 512 A 3 .,. 6II
+chrM 513 C 3 .,. III
+chrM 514 T 3 .,. III
+chrM 515 A 3 .$,. III
+chrM 516 T 2 ,. II
+chrM 517 G 2 ,. II
+chrM 518 C 3 ,$.^:. III
+chrM 519 T 2 .. II
+chrM 520 T 3 ..^:, III
+chrM 521 A 3 .., III
+chrM 522 G 3 .., II,
+chrM 523 C 3 .., III
+chrM 524 C 3 .., II7
+chrM 525 C 3 .., III
+chrM 526 T 3 .., II?
+chrM 527 A 3 .., III
+chrM 528 A 3 .., III
+chrM 529 A 3 .., FII
+chrM 530 C 3 .., II+
+chrM 531 T 3 .., III
+chrM 532 A 3 .., :II
+chrM 533 A 3 .., DGI
+chrM 534 A 3 .., III
+chrM 535 A 3 .., ?CI
+chrM 536 T 3 .., III
+chrM 537 A 3 .., 9II
+chrM 538 G 3 .., III
+chrM 539 C 3 .., III
+chrM 540 T 3 .., III
+chrM 541 T 3 .., III
+chrM 542 A 4 ..,^:. IIII
+chrM 543 C 4 ..,. IIII
+chrM 544 C 4 ..,. IIII
+chrM 545 A 4 N$.,. "III
+chrM 546 C 3 .,. III
+chrM 547 A 3 .,. DII
+chrM 548 A 3 .,. EII
+chrM 549 C 3 .,. III
+chrM 550 A 3 .,. III
+chrM 551 A 3 .,. 6II
+chrM 552 A 3 .,. GII
+chrM 553 G 3 .$,. ?II
+chrM 554 C 2 ,. I<
+chrM 555 T 2 ,$. II
+chrM 556 A 2 .^:. II
+chrM 557 T 2 .. II
+chrM 558 T 2 .. II
+chrM 559 C 2 .. II
+chrM 560 G 2 .. II
+chrM 561 C 2 .. II
+chrM 562 C 2 .. II
+chrM 563 A 2 .. CI
+chrM 564 G 2 .. II
+chrM 565 A 2 .. GI
+chrM 566 G 2 .. II
+chrM 567 T 2 .. /I
+chrM 568 A 2 .. DI
+chrM 569 C 2 .. II
+chrM 570 T 2 .. II
+chrM 571 A 2 .. II
+chrM 572 C 2 .. FI
+chrM 573 T 2 .. 9I
+chrM 574 A 2 .. II
+chrM 575 G 2 .. II
+chrM 576 C 2 .. II
+chrM 577 A 3 .$.^:. III
+chrM 578 A 2 .. II
+chrM 579 C 2 .. II
+chrM 580 A 3 ..^:, III
+chrM 581 G 3 .., III
+chrM 582 C 3 .., II?
+chrM 583 C 3 ..a II-
+chrM 584 T 3 .., IIH
+chrM 585 A 3 .., III
+chrM 586 A 3 .., III
+chrM 587 A 4 ..,^:, IIII
+chrM 588 A 4 ..,, IIII
+chrM 589 C 4 ..,, IIII
+chrM 590 T 4 ..,, II.5
+chrM 591 C 4 .$.,, II<I
+chrM 592 A 3 .,, III
+chrM 593 A 3 .,, III
+chrM 594 A 3 .,, III
+chrM 595 G 3 .,, III
+chrM 596 G 3 .,, III
+chrM 597 A 3 .,, :EI
+chrM 598 C 3 .,, III
+chrM 599 T 4 .,,^:. II@I
+chrM 600 T 4 .,,. IIII
+chrM 601 G 4 .,,. IIII
+chrM 602 G 4 .,,. IIII
+chrM 603 C 4 .,,. IIII
+chrM 604 G 4 .,,. IIII
+chrM 605 G 4 .,,. IIII
+chrM 606 T 4 .,,. 5III
+chrM 607 G 4 .,,. IIII
+chrM 608 C 4 .,,. *III
+chrM 609 T 5 .,,.^:, ?IIII
+chrM 610 T 5 .,,., IIII8
+chrM 611 T 5 .,,., IIIII
+chrM 612 A 5 T$,,., 3IIII
+chrM 613 C 4 ,,., III)
+chrM 614 A 4 ,,., IIII
+chrM 615 T 4 ,$,., IIII
+chrM 616 C 3 ,., III
+chrM 617 C 3 ,., III
+chrM 618 C 3 ,., III
+chrM 619 T 3 ,., IF9
+chrM 620 C 3 ,., II7
+chrM 621 T 3 ,., III
+chrM 622 A 3 ,$., I7I
+chrM 623 G 2 ., II
+chrM 624 A 2 ., 9I
+chrM 625 G 2 ., II
+chrM 626 G 2 ., II
+chrM 627 A 2 ., 2I
+chrM 628 G 2 ., II
+chrM 629 C 2 ., II
+chrM 630 C 2 ., II
+chrM 631 T 2 ., II
+chrM 632 G 2 ., II
+chrM 633 T 2 ., II
+chrM 634 T 2 .$, II
+chrM 635 C 1 , I
+chrM 636 C 1 , I
+chrM 637 A 1 , I
+chrM 638 T 1 , I
+chrM 639 A 1 , I
+chrM 640 A 1 , I
+chrM 641 T 1 , I
+chrM 642 C 1 , I
+chrM 643 G 1 , I
+chrM 644 A 1 ,$ I
+chrM 646 A 1 ^:. I
+chrM 647 A 1 . I
+chrM 648 A 1 . I
+chrM 649 C 2 .^:, II
+chrM 650 C 2 ., II
+chrM 651 C 2 ., II
+chrM 652 C 3 .,^:, II)
+chrM 653 G 3 .,, II2
+chrM 654 A 3 .,, III
+chrM 655 T 4 .,,^:. II*I
+chrM 656 A 4 .,,. IIII
+chrM 657 A 4 .,,. IIII
+chrM 658 A 4 .,,. IIII
+chrM 659 C 4 .,,. IIII
+chrM 660 C 4 .,,. IIII
+chrM 661 C 4 .,,. IIII
+chrM 662 C 4 .,,. IIFI
+chrM 663 A 4 .,,. =IDI
+chrM 664 C 4 .,,. II6I
+chrM 665 C 5 .,,.^:, IIIII
+chrM 666 A 5 .,,., BIIII
+chrM 667 T 5 .,,., II5I+
+chrM 668 C 5 .,,., IIIII
+chrM 669 C 5 .,,., IIIII
+chrM 670 C 5 .,a., II.II
+chrM 671 T 5 .,,., IIIIA
+chrM 672 T 6 .,,.,^:. FI9I.I
+chrM 673 G 6 .,,.,. IIIIII
+chrM 674 C 6 .,,.,. IIIIII
+chrM 675 T 6 .,,.,. IIIIII
+chrM 676 A 6 .,,.,. ,IIEII
+chrM 677 A 7 .,,.,.^:. 3II;III
+chrM 678 T 7 .,,.,.. IIIIDII
+chrM 679 T 7 .,,.,.. CIIIIII
+chrM 680 C 7 .,,.,.. IIIIIII
+chrM 681 A 7 .$,,.,.. 9IIIIII
+chrM 682 G 6 ,,.,.. II$III
+chrM 683 C 6 ,,.,.. IIIIII
+chrM 684 C 6 ,$,.,.. IIIIII
+chrM 685 T 5 ,.,.. IIIII
+chrM 686 A 5 ,.,.. IIIII
+chrM 687 T 5 ,$.,.. IIIII
+chrM 688 A 4 .,.. IIII
+chrM 689 T 4 .,.. IIII
+chrM 690 A 4 .$,.. IIII
+chrM 691 C 3 ,.. III
+chrM 692 C 3 ,.. III
+chrM 693 G 4 ,..^:, IIII
+chrM 694 C 4 ,.., IIII
+chrM 695 C 4 ,.., IIII
+chrM 696 A 4 ,.., IIII
+chrM 697 T 4 ,.., IIII
+chrM 698 C 4 ,.., IIII
+chrM 699 T 4 ,.., IIII
+chrM 700 T 4 ,$.., IIII
+chrM 701 C 3 .., III
+chrM 702 A 3 .., III
+chrM 703 G 3 .., 2II
+chrM 704 C 3 .., III
+chrM 705 A 3 N., "II
+chrM 706 A 3 .., I5I
+chrM 707 A 3 .$., GII
+chrM 708 C 2 ., II
+chrM 709 C 2 ., II
+chrM 710 C 2 ., II
+chrM 711 T 2 ., II
+chrM 712 A 2 .$, II
+chrM 713 A 1 , I
+chrM 714 A 1 , I
+chrM 715 C 1 , I
+chrM 716 A 1 , I
+chrM 717 A 1 , I
+chrM 718 G 1 , I
+chrM 719 G 2 ,^:, I&
+chrM 720 T 2 ,g I$
+chrM 721 A 2 ,, I3
+chrM 722 C 2 ,, I$
+chrM 723 C 2 ,t I&
+chrM 724 G 2 ,, I)
+chrM 725 A 2 ,, II
+chrM 726 A 3 ,,^:. III
+chrM 727 G 3 ,,. III
+chrM 728 T 3 ,$,. III
+chrM 729 A 2 ,. II
+chrM 730 A 2 n. "I
+chrM 731 G 2 ,. II
+chrM 732 C 3 a.^:. $II
+chrM 733 A 3 ,.. III
+chrM 734 C 3 ,.. %II
+chrM 735 A 3 ,.. III
+chrM 736 A 3 ,.. *II
+chrM 737 A 3 ,.. III
+chrM 738 T 3 ,.. III
+chrM 739 A 3 ,.. III
+chrM 740 T 3 ,.. III
+chrM 741 C 3 ,.. III
+chrM 742 C 3 ,.. III
+chrM 743 A 3 ,.. III
+chrM 744 A 3 ,.. III
+chrM 745 C 3 ,.. III
+chrM 746 A 3 ,.. IIE
+chrM 747 T 3 ,.. III
+chrM 748 A 3 ,.. III
+chrM 749 A 3 ,.. III
+chrM 750 A 3 ,.. III
+chrM 751 A 3 ,.. IAI
+chrM 752 A 3 ,.. III
+chrM 753 C 3 ,.. III
+chrM 754 G 3 ,$.. III
+chrM 755 T 2 .. II
+chrM 756 T 3 ..^:, III
+chrM 757 A 3 .., III
+chrM 758 G 3 .., III
+chrM 759 G 3 .., III
+chrM 760 T 3 .., =II
+chrM 761 C 3 .$., IID
+chrM 762 A 2 ., =I
+chrM 763 A 2 ., EI
+chrM 764 G 2 ., II
+chrM 765 G 2 ., II
+chrM 766 T 2 ., :I
+chrM 767 G 3 .$,^:, III
+chrM 768 T 2 ,, I>
+chrM 769 A 3 ,,^:, III
+chrM 770 G 3 ,,, III
+chrM 771 C 3 ,,, IHI
+chrM 772 C 3 ,a, I)/
+chrM 773 C 3 ,,, I7I
+chrM 774 A 4 ,,,^:. II:I
+chrM 775 T 4 ,,,. IH.I
+chrM 776 G 4 ,,,. IIII
+chrM 777 G 4 ,,,. IIII
+chrM 778 G 4 ,,,. IIII
+chrM 779 A 4 ,,,. IIAI
+chrM 780 T 4 ,,,. IIGI
+chrM 781 G 4 ,,,. IIII
+chrM 782 G 4 ,,,. IIII
+chrM 783 A 4 ,,,. IIII
+chrM 784 G 4 ,,,. IIII
+chrM 785 A 4 ,,,. IIII
+chrM 786 G 4 ,,,. IIII
+chrM 787 A 4 ,,,. IIII
+chrM 788 A 4 ,,,. IIII
+chrM 789 A 4 ,,,. IIII
+chrM 790 T 5 ,,,.^:. IIIII
+chrM 791 G 5 ,$,,.. IIIII
+chrM 792 G 4 ,,.. IIII
+chrM 793 G 4 ,,.. IIII
+chrM 794 C 4 ,,.. IIII
+chrM 795 T 4 ,,.. IIII
+chrM 796 A 4 ,,.. IIII
+chrM 797 C 4 ,,.. IIII
+chrM 798 A 4 ,,.. IIII
+chrM 799 T 4 ,,.. IIII
+chrM 800 T 4 ,,.. IIII
+chrM 801 T 4 ,,.. IIII
+chrM 802 T 4 ,$,.. IIII
+chrM 803 C 3 ,.. III
+chrM 804 T 3 ,$.. III
+chrM 805 A 2 .. II
+chrM 806 C 3 ..^:. III
+chrM 807 C 3 ... III
+chrM 808 C 3 ... III
+chrM 809 T 3 .$.. III
+chrM 810 A 3 ..^:, III
+chrM 811 A 3 .., III
+chrM 812 G 3 .., II7
+chrM 813 A 3 .., III
+chrM 814 A 3 .., III
+chrM 815 C 3 .., III
+chrM 816 A 3 .., III
+chrM 817 A 3 .., III
+chrM 818 G 3 .., III
+chrM 819 A 3 .., III
+chrM 820 A 3 .., &II
+chrM 821 C 3 .., III
+chrM 822 T 3 .., III
+chrM 823 T 3 ..n II"
+chrM 824 T 3 .., III
+chrM 825 A 3 .$., III
+chrM 826 A 3 .,^:. III
+chrM 827 C 3 .,. III
+chrM 828 C 3 .,. III
+chrM 829 C 4 .,.^:, IIII
+chrM 830 G 4 .,., IIII
+chrM 831 G 4 .,., IIII
+chrM 832 A 4 .,., IIII
+chrM 833 C 4 .,., IIII
+chrM 834 G 4 .,., IIII
+chrM 835 A 4 .,., IIII
+chrM 836 A 4 .,., 8III
+chrM 837 A 4 .,., IIII
+chrM 838 G 4 .,., IIII
+chrM 839 T 5 .,.,^:, 4:IIG
+chrM 840 C 5 .,.,, IIIII
+chrM 841 T 5 .$,.,, IIIII
+chrM 842 C 4 ,.,, IIII
+chrM 843 C 4 ,.,, IIII
+chrM 844 A 4 ,.,, IIII
+chrM 845 T 4 ,$.,, IIII
+chrM 846 G 3 .,, @II
+chrM 847 A 3 .,, III
+chrM 848 A 3 .,, III
+chrM 849 A 3 .,, III
+chrM 850 C 3 .,, III
+chrM 851 T 3 .,, III
+chrM 852 G 3 .,, III
+chrM 853 G 3 .,, III
+chrM 854 A 3 .,, EII
+chrM 855 G 3 .,, DII
+chrM 856 A 3 .,, III
+chrM 857 C 3 .,, III
+chrM 858 T 4 .,,^:, IIIA
+chrM 859 A 4 .,,, @III
+chrM 860 A 4 .,,, IIII
+chrM 861 A 4 .$,,, EIII
+chrM 862 G 3 ,,, III
+chrM 863 G 3 ,,, III
+chrM 864 A 3 ,$,, III
+chrM 865 G 2 ,, II
+chrM 866 G 2 ,, II
+chrM 867 A 2 ,, II
+chrM 868 T 2 ,, II
+chrM 869 T 2 ,, II
+chrM 870 T 2 ,, II
+chrM 871 A 2 ,, II
+chrM 872 G 2 ,, II
+chrM 873 C 2 ,, II
+chrM 874 A 2 ,$, II
+chrM 875 G 1 , I
+chrM 876 T 1 , I
+chrM 877 A 1 , I
+chrM 878 A 1 , I
+chrM 879 A 1 , I
+chrM 880 T 1 , I
+chrM 881 T 1 , I
+chrM 882 A 1 , I
+chrM 883 A 1 , I
+chrM 884 G 1 , I
+chrM 885 A 1 , I
+chrM 886 A 1 , I
+chrM 887 T 1 , (
+chrM 888 A 1 , I
+chrM 889 G 1 , I
+chrM 890 A 1 , I
+chrM 891 G 1 , I
+chrM 892 A 1 , I
+chrM 893 G 1 ,$ I
+chrM 898 A 1 ^:, I
+chrM 899 T 2 ,^:. /I
+chrM 900 T 2 ,. 7I
+chrM 901 G 2 ,. CI
+chrM 902 A 2 ,. II
+chrM 903 A 2 ,. II
+chrM 904 T 2 ,. II
+chrM 905 C 3 ,.^:, III
+chrM 906 A 3 ,., III
+chrM 907 G 3 ,., III
+chrM 908 G 3 ,., III
+chrM 909 C 3 ,., III
+chrM 910 C 3 ,., III
+chrM 911 A 4 ,.,^:, IIII
+chrM 912 T 4 ,.,, IIEG
+chrM 913 G 4 ,.,, III:
+chrM 914 A 4 ,.,, IIII
+chrM 915 A 4 ,.,, IIII
+chrM 916 G 4 ,.,, III5
+chrM 917 C 4 ,.,, III5
+chrM 918 G 4 ,.,, IIII
+chrM 919 C 4 ,.,, III<
+chrM 920 G 4 ,.,, IIII
+chrM 921 C 4 ,.,, IIII
+chrM 922 A 4 ,.,, IIII
+chrM 923 C 4 ,.,, III8
+chrM 924 A 4 ,.,, IFII
+chrM 925 C 4 ,.,, IIII
+chrM 926 A 4 ,.,, IIII
+chrM 927 C 4 ,.,, IIII
+chrM 928 C 5 ,.,,^:, IIII:
+chrM 929 G 5 ,.,,, IIIE:
+chrM 930 C 5 ,.,,, IIIII
+chrM 931 C 5 ,.,,, IIIIF
+chrM 932 C 5 ,.,,, IIIIC
+chrM 933 G 5 ,$.,,, I?II:
+chrM 934 T 4 .$,,, 4II>
+chrM 935 C 3 ,,, III
+chrM 936 A 3 ,,, III
+chrM 937 C 3 ,,, II1
+chrM 938 C 3 ,,, III
+chrM 939 C 3 ,,, III
+chrM 940 T 3 ,$,, III
+chrM 941 C 2 ,, II
+chrM 942 C 2 ,, I'
+chrM 943 T 2 ,, II
+chrM 944 T 2 ,, II
+chrM 945 A 2 ,, II
+chrM 946 A 2 ,$, II
+chrM 947 A 1 , I
+chrM 948 T 1 , I
+chrM 949 A 1 , I
+chrM 950 T 1 , I
+chrM 951 C 1 , I
+chrM 952 A 1 , I
+chrM 953 C 1 , I
+chrM 954 A 1 , I
+chrM 955 A 2 ,^:. II
+chrM 956 A 2 ,. II
+chrM 957 T 2 ,. II
+chrM 958 C 3 ,.^:. III
+chrM 959 A 3 ,.. III
+chrM 960 T 3 ,.. III
+chrM 961 A 3 ,.. III
+chrM 962 A 3 ,.. III
+chrM 963 C 4 ,$..^:. IIII
+chrM 964 A 3 ... I(;
+chrM 965 T 3 ... III
+chrM 966 A 4 ...^:. IIII
+chrM 967 A 4 .... IIII
+chrM 968 C 4 .... IEII
+chrM 969 A 4 .... IIII
+chrM 970 T 4 .... IIII
+chrM 971 A 4 .... IIII
+chrM 972 A 4 .... IIII
+chrM 973 A 4 .... II0I
+chrM 974 A 5 ....^:. IIIII
+chrM 975 C 5 ..... IIIII
+chrM 976 C 5 ..... IIIII
+chrM 977 G 5 ..... IIIII
+chrM 978 T 5 ..... IIIII
+chrM 979 G 5 ..... I0III
+chrM 980 A 5 ..... IIII4
+chrM 981 C 5 ..... IIIII
+chrM 982 C 5 ..... IIIII
+chrM 983 C 5 ..... IIIII
+chrM 984 A 5 ..... -IGII
+chrM 985 A 5 ..... 4GIII
+chrM 986 A 5 ..... BDGII
+chrM 987 C 5 ..... IDIII
+chrM 988 A 5 ..... @<III
+chrM 989 T 5 ..... IIIII
+chrM 990 A 5 .$.... I@III
+chrM 991 T 4 .... IICI
+chrM 992 G 4 T... )III
+chrM 993 A 4 .$... ?ICI
+chrM 994 A 3 ... III
+chrM 995 A 3 ... III
+chrM 996 G 3 ... III
+chrM 997 G 3 ... III
+chrM 998 A 3 .$.. 4II
+chrM 999 G 3 ..^:. III
+chrM 1000 A 3 ... III
+chrM 1001 C 3 .$.. III
+chrM 1002 A 2 .. II
+chrM 1003 A 2 .. II
+chrM 1004 G 2 .. II
+chrM 1005 T 2 .. II
+chrM 1006 C 2 .. II
+chrM 1007 G 2 .. CI
+chrM 1008 T 2 .. II
+chrM 1009 A 2 .$. II
+chrM 1010 A 1 . I
+chrM 1011 C 1 . I
+chrM 1012 A 1 . I
+chrM 1013 A 1 . I
+chrM 1014 G 1 . I
+chrM 1015 G 1 . I
+chrM 1016 T 1 . I
+chrM 1017 A 1 . I
+chrM 1018 A 1 . I
+chrM 1019 G 1 . I
+chrM 1020 T 1 . I
+chrM 1021 A 1 . I
+chrM 1022 T 1 . I
+chrM 1023 A 1 . I
+chrM 1024 C 1 . I
+chrM 1025 C 1 . I
+chrM 1026 G 1 . I
+chrM 1027 G 1 . I
+chrM 1028 A 1 . I
+chrM 1029 A 1 . I
+chrM 1030 G 1 . I
+chrM 1031 G 2 .^:. II
+chrM 1032 T 2 .. EI
+chrM 1033 G 2 .. II
+chrM 1034 T 2 .$. II
+chrM 1035 A 2 .^:. II
+chrM 1036 C 2 .. II
+chrM 1037 T 2 .. II
+chrM 1038 T 2 .. II
+chrM 1039 G 2 .. II
+chrM 1040 G 2 .. II
+chrM 1041 A 2 .. II
+chrM 1042 T 2 .. II
+chrM 1043 A 3 ..^:, III
+chrM 1044 A 3 .., III
+chrM 1045 C 3 .., II7
+chrM 1046 C 3 .., II-
+chrM 1047 A 3 .., III
+chrM 1048 A 3 .., III
+chrM 1049 A 3 .., III
+chrM 1050 G 3 .., III
+chrM 1051 T 3 .., III
+chrM 1052 G 3 .., III
+chrM 1053 T 3 .., GII
+chrM 1054 A 3 .., III
+chrM 1055 G 3 .., :II
+chrM 1056 C 3 ..a HI%
+chrM 1057 T 3 .., III
+chrM 1058 T 3 .., III
+chrM 1059 A 3 .., BII
+chrM 1060 A 3 .., GII
+chrM 1061 A 3 .., HII
+chrM 1062 C 3 .., III
+chrM 1063 A 3 .., DII
+chrM 1064 A 3 .., BII
+chrM 1065 A 3 .., 1II
+chrM 1066 G 3 .$., &II
+chrM 1067 C 2 ., II
+chrM 1068 A 2 ., II
+chrM 1069 T 2 ., II
+chrM 1070 C 2 .$, II
+chrM 1071 C 1 , I
+chrM 1072 A 1 , I
+chrM 1073 G 1 , I
+chrM 1074 C 1 , I
+chrM 1075 T 1 , I
+chrM 1076 T 1 , I
+chrM 1077 A 1 , I
+chrM 1078 C 1 ,$ I
+chrM 1090 T 1 ^:, I
+chrM 1091 T 1 , I
+chrM 1092 C 1 n "
+chrM 1093 A 1 , I
+chrM 1094 C 1 , I
+chrM 1095 T 1 , 7
+chrM 1096 C 1 a B
+chrM 1097 A 1 , I
+chrM 1098 A 1 , I
+chrM 1099 A 1 , I
+chrM 1100 A 1 , I
+chrM 1101 T 1 , I
+chrM 1102 G 2 ,^:, (I
+chrM 1103 A 2 ,, II
+chrM 1104 A 2 ,, I+
+chrM 1105 C 2 ,, .I
+chrM 1106 A 2 ,, 8I
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in1.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in1.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,30 @@
+chrM 1 A G 25 0 25 1 ^:. I
+chrM 2 C T 25 0 25 2 .N I$
+chrM 3 T G 27 0 25 2 .. II
+chrM 4 G C 36 0 25 3 .^:.^:. II+
+chrM 5 T A 38 0 25 3 ... III
+chrM 6 T A 39 0 25 4 .N.. I$II
+chrM 7 G C 43 0 25 5 ...^:.^:. IIIII
+chrM 8 A C 46 0 25 6 .....^:. IIIIII
+chrM 9 T G 53 0 25 8 ..G...^:.^:. IIIII$II
+chrM 10 T G 56 0 25 9 ........^:. IIIIIIIII
+chrM 11 C G 57 0 25 10 .........^:. IIIIIIIIII
+chrM 12 T C 61 0 25 11 ..........^:. IIIIIIIIIII
+chrM 13 T G 79 0 25 15 .........^:.^:.^:.^:.^:.^:. IIIIIIIIIIII#II
+chrM 14 A C 58 0 25 18 .......G.........^:. BIIIIIII+IIIIIIIII
+chrM 15 G A 87 0 25 19 ..N...............^:.^:. DIIIIII$(IIIIIIIIIII
+chrM 16 G C 88 0 25 20 .........N.......... IIIIIIIIIIIIIIIIIIII
+chrM 17 A C 88 0 25 20 .........G.......... 9IIIIIIIIIIIIIIIIIII
+chrM 18 G A 89 0 25 20 ...A................ @IIIIIIIIIIIIIIIIIII
+chrM 19 G T 58 0 25 20 ....T.............GG IIIIIIIIIIIIIIIIII'A
+chrM 20 T C 55 0 25 20 .........C........C. IIIIIIIIIIIIIII2II#$
+chrM 21 C T 87 0 25 20 ..........G......... IIIIIIIIIIIIIIIIIIII
+chrM 22 C A 87 0 25 20 ..........N......... IIIIIIIIIIIIIIAIIIII
+chrM 23 A G 87 0 25 20 .....T.............. 9IIIIIIIIII0IIIIIIII
+chrM 24 A T 89 0 25 20 .....N..N........... III$IIII"IIIIICII#II
+chrM 25 G A 57 0 25 21 ...A................^:. A@.$IIIIIIIFIIIIIIIII
+chrM 26 C G 58 0 25 22 ...N....A............. IIHIDII&IIIIII@IIIIII
+chrM 27 T A 99 0 25 23 ....................^:.^:.^:. IE8IFIII9IIIIIIIIIIIIII
+chrM 28 A C 99 0 25 24 ..G..................... 1FIIIIIIIIIIIIIIIIDEIIII
+chrM 29 G C 58 0 25 25 ........C.........NN.... ;IIIIII+HII=III$III""IIII
+chrM 30 T T 65 0 25 25 ...C....................^:. ;I?&IAI0IIIIIIIIIIIIIIIII
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in2.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in2.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,30 @@
+chrM 1 T G 25 0 25 1 ^:. I
+chrM 2 C A 25 0 25 1 . I
+chrM 3 C A 25 0 25 2 .. I+
+chrM 4 G A 36 0 25 3 .^:.^:. II+
+chrM 5 A T 36 0 25 3 ... IDI
+chrM 6 A G 36 0 25 4 ..T. IIBI
+chrM 7 C G 42 0 25 5 ...^:.^:. ID@II
+chrM 8 T T 45 0 25 6 .....^:. III$BI
+chrM 9 C A 51 0 25 8 ......^:.^:. $#III+III
+chrM 10 G G 54 0 25 9 ........^:. III$III#I
+chrM 11 T C 57 0 25 10 .........^:. IIIDBIIIII
+chrM 12 A T 60 0 25 11 ..........^:. IIIIIIIII$I
+chrM 13 A T 78 0 25 18 ..A.........^:.^:.^:.^:.^:.^:. III#$IIIIII+IIDIIB
+chrM 14 G A 56 0 25 19 ........T.........^:. BIIIIIII+IIII$IBIII
+chrM 15 G A 87 0 25 20 ..................^:.^:. DIIIIIII(IIIIIIIIIII
+chr1 1 T T 87 0 25 20 .............T...... IIIIIIIIIIII$DIIIIII
+chr1 2 A T 87 0 25 20 ......G............. 9IIIIIIIIIIIIICBIIII
+chr1 3 A G 87 0 25 20 ....A............... @IIIIIIIII#IIII#IIII
+chr1 4 A T 55 0 25 20 ..................GG IIIII@II$IIIIIIIII'A
+chr1 5 C A 54 0 25 20 .......A..........C. IIIIIIIIIDIIIII2II#$
+chr1 6 G T 87 0 25 20 .............A...... IIIIIIIBIIIIII#IIIII
+chr1 7 A C 87 0 25 20 ..........C......... IIIII+IIIIIIIIAIIIII
+chr1 8 G A 87 0 25 20 ....G.........T..... 9IIIIIIIIII0IIIIIIII
+chr1 9 A T 87 0 25 20 ........N........... IIII$III"IIIIICIIIII
+chr1 10 G A 57 0 25 21 ...A................^:. A@.$IIIIIIIFIIIIIIIII
+chr1 11 C A 57 0 25 22 ....G...A............. IIHIDII&IIIIII#III$II
+chr1 12 T A 99 0 25 24 .....................^:.^:.^:. IE8IFIII9IIIIIIIIIIIIIII
+chr1 13 A C 99 0 25 25 ...N..................... 1FIIIIIIIIIIIIIIIIDEII$II
+chr1 14 G C 55 0 25 25 ....G..............NN.... ;IIIBIII+HII=IIIIII""IIII
+chr1 15 T G 68 0 25 28 ...C.......N............^:. ;I?&IAI0IIIIIII@II#$II@II
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in3.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in3.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,30 @@
+chr1 1 G G 25 0 25 1 ^:. I
+chr1 2 T T 25 0 25 1 . I
+chr1 3 T T 27 0 25 1 . I
+chr1 4 A A 36 0 25 2 .^:. I+
+chr1 5 A A 36 0 25 3 ... III
+chr1 6 T T 36 0 25 4 .N.. II#I
+chr1 7 G G 42 0 25 5 ...^:.^:. IIIII
+chr1 8 T T 45 0 25 6 .....^:. IIIIII
+chr1 9 A A 51 0 25 7 .....^:.^:. IBIIIII
+chr1 10 G G 54 0 25 9 ........^:. IIIIIIIII
+chr1 11 C C 57 0 25 10 .........^:. IIIIIIII"I
+chr1 12 T T 60 0 25 11 ..........^:. IIIIIIDIIII
+chr1 13 T T 78 0 25 17 ...........^:.^:.^:.^:.^:.^:. IIII"$IIIIIIIIIII
+chr1 14 A A 56 0 25 18 .......G.........^:. BIIIIIII+IIIIIIIII
+chr1 15 A A 87 0 25 20 ....N.............^:.^:. DIII$III(IIIIIIIIIII
+chr4 1 T T 90 0 25 20 ..........N......... IIIIIIIII$IIIIIIIIII
+chr4 2 A A 87 0 25 20 .......C............ 9IIIIIIIII"IIIIIIIII
+chr4 3 A A 34 0 25 20 ......G............. @IIIIIIIIIIII#IIIIII
+chr4 4 T T 55 0 25 21 ...........N.......GG IIIII@IIIIIIIIIIIII'A
+chr4 5 A A 54 0 25 21 ...N...............C. IIII"IIIIIIIIIII2II#$
+chr4 6 T T 87 0 25 21 ................N.... IIIIIIII$IIIIIIIIIIII
+chr4 7 A A 80 0 25 21 .....G............... III$IIIIIIIIIIIAIIIII
+chr4 8 A A 87 0 25 22 ..N................... 9IIIIIIIIII0IIIII"$III
+chr4 9 A A 87 0 25 22 .GG.......N........... IIII$IIIII"IIIIICIIIII
+chr4 10 G G 57 0 25 23 .....A................^:. A@.$IIIIIIIIIFIIIIIIIII
+chr4 11 C C 57 0 25 25 .......A.....GN.......... IIHIDII&III#IIIIIIIIIIIII
+chr4 12 A A 99 0 25 26 .......................^:.^:.^:. IE8IFIII9IIIIIII$IIIIIIIII
+chr4 13 A A 99 0 25 27 ........N.................. 1FIIIIII$IIIIIIIIIIIIDEIIII
+chr4 14 G G 55 0 25 28 ..N...................NN.... ;III$I#IIII+HII=IIIIII""IIII
+chr4 15 G G 68 0 25 30 ...C....N..G.................^:. ;I?&IAI0IIIIIII$#I$@IIIIIIIIII
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in4.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in4.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,25 @@
+chr2 1 T 6 .C..., I$$III
+chr2 2 G 6 ..N.., III@II
+chr2 3 C 7 ..C..., I$IIIII
+chr2 4 G 7 .G...., I#IIIII
+chr2 5 G 7 ...N.., IIII#BI
+chr2 6 A 7 ..T..., I$IDIII
+chr2 7 T 8 ...C..., IIIBD$II
+chr2 8 A 8 ..A...., IBI#IIII
+chr2 9 C 9 .GA..N.., I$IBIII#I
+chr2 10 T 9 ........, I$II#IIII
+chr2 11 C 10 .>>..T..., IIII@I$I$I
+chr2 12 G 10 .N..G...., III$IIIIII
+chr2 13 A 11 ....A..T.., IIIIII#I@II
+chr1 1 C 1 ^:. I
+chr1 2 G 2 .^:. $I
+chr1 3 A 2 .. I%
+chr1 4 C 2 .. I$
+chr1 5 T 3 ..^:. I#I
+chr1 6 G 3 ..^:, I#I
+chr1 7 C 4 .N., IIII
+chr1 8 A 4 ..., I$II
+chr1 9 T 5 ..C., I#IDI
+chr1 10 G 5 N..., IBII@
+chr1 11 A 5 .C.., I$II#
+chr1 12 C 5 ..N., I$III
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in5.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in5.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,25 @@
+chr1 42 T 1 ^:. I
+chr1 43 G 2 .^:. $I
+chr1 44 T 2 .. I%
+chr1 45 C 3 ..^:. III
+chr1 46 G 3 ..^:. I#I
+chr1 47 T 4 ...^:, I#II
+chr1 48 A 4 .N., IIII
+chr1 49 C 5 ...., IIIII
+chr1 50 A 5 ..G., IIIDI
+chr1 51 A 5 A..., IBIII
+chr1 52 A 5 ...., IIII#
+chr1 53 G 5 ..N., I$III
+chr2 77 C 6 .G..., I$$III
+chr2 78 G 6 ..N.., III@II
+chr2 79 T 7 ..N..., I$IIIII
+chr2 80 C 7 .G...., I#IIIII
+chr2 81 G 7 ...A.., IIII#BI
+chr2 82 A 8 ...G..., I$IDIIII
+chr2 83 A 8 ...T..., IIIBD$II
+chr2 84 T 8 ..A...., IBI#IIII
+chr2 85 G 8 .GA...., IIBIII#I
+chr2 86 C 9 ........, I$II#IIII
+chr2 87 G 9 ....T..., IIIII$I$I
+chr2 88 G 10 .N..G...., III$IIIIII
+chr2 89 G 10 ...A..T.., IIIII#I@II
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in6.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in6.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,25 @@
+chr1 42 C 1 ^:. I
+chr1 43 C 2 .^:. II
+chr1 44 T 2 .. II
+chr1 45 A 3 ..^:. III
+chr1 46 G 4 ...^:. IIII
+chr1 47 A 5 ....^:, IIIII
+chr1 48 T 5 ...N, I#III
+chr1 49 G 5 ...., IIIII
+chr1 50 A 5 .G.., IIIII
+chr1 51 G 5 ...., IIIII
+chr2 52 T 5 .N.., II$II
+chr2 53 A 5 ...., IIIII
+chr2 54 T 5 ...., IIIII
+chr2 55 T 5 ...., IIIII
+chr2 56 C 5 ...., IIIBI
+chr2 57 T 5 ...., IDIII
+chr2 58 T 6 .N..., IIIIII
+chr2 59 A 6 ....., IIII$I
+chr3 60 C 6 ...G., I#IIII
+chr3 61 T 6 ..N.., IIIIII
+chr3 62 C 6 ...A., IIIIII
+chr3 63 C 7 .N...., IIIIIII
+chr3 64 A 7 ...G.., IIIII$I
+chr3 65 T 7 ...AA., IIIII@@
+chr3 66 A 7 ....N., IIIIIII
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in7.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in7.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,32 @@
+chr2 1 T 6 .C..., I$$III
+chr2 2 G 6 ..N.., III@II
+chr2 3 C 7 ..C..., I$IIIII
+chr2 4 G 7 .G...., I#IIIII
+chr2 5 G 7 ...N.., IIII#BI
+chr2 6 A 7 ..T..., I$IDIII
+chr2 7 T 8 ...C..., IIIBD$II
+chr2 8 A 8 ..A...., IBI#IIII
+chr2 9 C 9 .GA..N.., I$IBIII#I
+chr2 10 T 9 ........, I$II#IIII
+chr2 11 C 10 .>>..T..., IIII@I$I$I
+chr2 12 G 10 .N..G...., III$IIIIII
+chr2 13 A 11 ....A..T.., IIIIII#I@II
+chr2 14 G 11 ..N....... IICIBII@AII
+chr2 15 C 11 A.....NG.. IIIIIDIIIII
+chr2 16 T 11 ...C.....G I$IIIB@IIIC
+chr2 17 C 12 G......TN.. IIAII@IIII$I
+chr2 18 A 12 N......G..A IIIBIII$IIII
+chr2 19 A 13 .......NN... IIIIIIBIII$$@
+chr2 20 C 13 ..GT.......N IIIIABIIC$III
+chr1 1 C 1 ^:. I
+chr1 2 G 2 .^:. $I
+chr1 3 A 2 .. I%
+chr1 4 C 2 .. I$
+chr1 5 T 3 ..^:. I#I
+chr1 6 G 3 ..^:, I#I
+chr1 7 C 4 .N., IIII
+chr1 8 A 4 ..., I$II
+chr1 9 T 5 ..C., I#IDI
+chr1 10 G 5 N..., IBII@
+chr1 11 A 5 .C.., I$II#
+chr1 12 C 5 ..N., I$III
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in8.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in8.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,23 @@
+chr1 42 T 1 ^:. I
+chr1 43 G 2 .^:. $I
+chr1 44 T 2 .. I%
+chr1 45 C 3 ..^:. III
+chr1 46 G 3 ..^:. I#I
+chr1 47 T 4 ...^:, I#II
+chr1 48 A 4 .N., IIII
+chr1 49 C 5 ...., IIIII
+chr1 50 A 5 ..G., IIIDI
+chr1 51 A 5 A..., IBIII
+chr1 52 A 5 ...., IIII#
+chr1 53 G 5 ..N., I$III
+chr2 77 C 6 .G..., I$$III
+chr2 78 G 6 ..N.., III@II
+chr2 79 T 7 ..N..., I$IIIII
+chr2 80 C 7 .G...., I#IIIII
+chr2 81 G 7 ...A.., IIII#BI
+chr2 82 A 8 ...G..., I$IDIIII
+chr2 83 A 8 ...T..., IIIBD$II
+chr2 84 T 8 ..A...., IBI#IIII
+chr2 85 G 8 .GA...., IIBIII#I
+chr2 86 C 9 ........, I$II#IIII
+chr2 87 G 9 ....T..., IIIII$I$I
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_in9.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_in9.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,25 @@
+chr1 43 C 2 .^:. II
+chr3 65 T 7 ...AA., IIIII@@
+chr1 44 T 2 .. II
+chr2 54 T 5 ...., IIIII
+chr1 45 A 3 ..^:. III
+chr1 47 A 5 ....^:, IIIII
+chr1 50 A 5 .G.., IIIII
+chr1 51 G 5 ...., IIIII
+chr2 52 T 5 .N.., II$II
+chr2 53 A 5 ...., IIIII
+chr3 60 C 6 ...G., I#IIII
+chr3 61 T 6 ..N.., IIIIII
+chr1 49 G 5 ...., IIIII
+chr2 55 T 5 ...., IIIII
+chr2 56 C 5 ...., IIIBI
+chr2 58 T 6 .N..., IIIIII
+chr2 59 A 6 ....., IIII$I
+chr3 62 C 6 ...A., IIIIII
+chr1 42 C 1 ^:. I
+chr3 63 C 7 .N...., IIIIIII
+chr1 48 T 5 ...N, I#III
+chr1 46 G 4 ...^:. IIII
+chr3 64 A 7 ...G.., IIIII$I
+chr3 66 A 7 ....N., IIIIIII
+chr2 57 T 5 ...., IDIII
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_out1.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_out1.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,60 @@
+chr1 1 T T 87 25 G G 25 25
+chr1 2 A T 87 25 T T 25 25
+chr1 3 A G 87 25 T T 27 25
+chr1 4 A T 55 25 A A 36 25
+chr1 5 C A 54 25 A A 36 25
+chr1 6 G T 87 25 T T 36 25
+chr1 7 A C 87 25 G G 42 25
+chr1 8 G A 87 25 T T 45 25
+chr1 9 A T 87 25 A A 51 25
+chr1 10 G A 57 25 G G 54 25
+chr1 11 C A 57 25 C C 57 25
+chr1 12 T A 99 25 T T 60 25
+chr1 13 A C 99 25 T T 78 25
+chr1 14 G C 55 25 A A 56 25
+chr1 15 T G 68 25 A A 87 25
+chr4 1 T T 90 25
+chr4 2 A A 87 25
+chr4 3 A A 34 25
+chr4 4 T T 55 25
+chr4 5 A A 54 25
+chr4 6 T T 87 25
+chr4 7 A A 80 25
+chr4 8 A A 87 25
+chr4 9 A A 87 25
+chr4 10 G G 57 25
+chr4 11 C C 57 25
+chr4 12 A A 99 25
+chr4 13 A A 99 25
+chr4 14 G G 55 25
+chr4 15 G G 68 25
+chrM 1 A G 25 25 T G 25 25
+chrM 2 C T 25 25 C A 25 25
+chrM 3 T G 27 25 C A 25 25
+chrM 4 G C 36 25 G A 36 25
+chrM 5 T A 38 25 A T 36 25
+chrM 6 T A 39 25 A G 36 25
+chrM 7 G C 43 25 C G 42 25
+chrM 8 A C 46 25 T T 45 25
+chrM 9 T G 53 25 C A 51 25
+chrM 10 T G 56 25 G G 54 25
+chrM 11 C G 57 25 T C 57 25
+chrM 12 T C 61 25 A T 60 25
+chrM 13 T G 79 25 A T 78 25
+chrM 14 A C 58 25 G A 56 25
+chrM 15 G A 87 25 G A 87 25
+chrM 16 G C 88 25
+chrM 17 A C 88 25
+chrM 18 G A 89 25
+chrM 19 G T 58 25
+chrM 20 T C 55 25
+chrM 21 C T 87 25
+chrM 22 C A 87 25
+chrM 23 A G 87 25
+chrM 24 A T 89 25
+chrM 25 G A 57 25
+chrM 26 C G 58 25
+chrM 27 T A 99 25
+chrM 28 A C 99 25
+chrM 29 G C 58 25
+chrM 30 T T 65 25
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_out2.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_out2.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,65 @@
+chr1 1 C 1
+chr1 2 G 2
+chr1 3 A 2
+chr1 4 C 2
+chr1 5 T 3
+chr1 6 G 3
+chr1 7 C 4
+chr1 8 A 4
+chr1 9 T 5
+chr1 10 G 5
+chr1 11 A 5
+chr1 12 C 5
+chr1 42 T 1 C 1
+chr1 43 G 2 C 2
+chr1 44 T 2 T 2
+chr1 45 C 3 A 3
+chr1 46 G 3 G 4
+chr1 47 T 4 A 5
+chr1 48 A 4 T 5
+chr1 49 C 5 G 5
+chr1 50 A 5 A 5
+chr1 51 A 5 G 5
+chr1 52 A 5
+chr1 53 G 5
+chr2 1 T 6
+chr2 2 G 6
+chr2 3 C 7
+chr2 4 G 7
+chr2 5 G 7
+chr2 6 A 7
+chr2 7 T 8
+chr2 8 A 8
+chr2 9 C 9
+chr2 10 T 9
+chr2 11 C 10
+chr2 12 G 10
+chr2 13 A 11
+chr2 52 T 5
+chr2 53 A 5
+chr2 54 T 5
+chr2 55 T 5
+chr2 56 C 5
+chr2 57 T 5
+chr2 58 T 6
+chr2 59 A 6
+chr2 77 C 6
+chr2 78 G 6
+chr2 79 T 7
+chr2 80 C 7
+chr2 81 G 7
+chr2 82 A 8
+chr2 83 A 8
+chr2 84 T 8
+chr2 85 G 8
+chr2 86 C 9
+chr2 87 G 9
+chr2 88 G 10
+chr2 89 G 10
+chr3 60 C 6
+chr3 61 T 6
+chr3 62 C 6
+chr3 63 C 7
+chr3 64 A 7
+chr3 65 T 7
+chr3 66 A 7
diff -r 5f927f52191c -r 3ac95cd927d7 test-data/column_join_out3.pileup
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/column_join_out3.pileup Fri Mar 26 12:00:55 2010 -0400
@@ -0,0 +1,70 @@
+chr1 1 C 1 ^:.
+chr1 2 G 2 .^:.
+chr1 3 A 2 ..
+chr1 4 C 2 ..
+chr1 5 T 3 ..^:.
+chr1 6 G 3 ..^:,
+chr1 7 C 4 .N.,
+chr1 8 A 4 ...,
+chr1 9 T 5 ..C.,
+chr1 10 G 5 N...,
+chr1 11 A 5 .C..,
+chr1 12 C 5 ..N.,
+chr1 42 T 1 ^:. C 1 ^:.
+chr1 43 G 2 .^:. C 2 .^:.
+chr1 44 T 2 .. T 2 ..
+chr1 45 C 3 ..^:. A 3 ..^:.
+chr1 46 G 3 ..^:. G 4 ...^:.
+chr1 47 T 4 ...^:, A 5 ....^:,
+chr1 48 A 4 .N., T 5 ...N,
+chr1 49 C 5 ...., G 5 ....,
+chr1 50 A 5 ..G., A 5 .G..,
+chr1 51 A 5 A..., G 5 ....,
+chr1 52 A 5 ....,
+chr1 53 G 5 ..N.,
+chr2 1 T 6 .C...,
+chr2 2 G 6 ..N..,
+chr2 3 C 7 ..C...,
+chr2 4 G 7 .G....,
+chr2 5 G 7 ...N..,
+chr2 6 A 7 ..T...,
+chr2 7 T 8 ...C...,
+chr2 8 A 8 ..A....,
+chr2 9 C 9 .GA..N..,
+chr2 10 T 9 ........,
+chr2 11 C 10 .>>..T...,
+chr2 12 G 10 .N..G....,
+chr2 13 A 11 ....A..T..,
+chr2 14 G 11 ..N.......
+chr2 15 C 11 A.....NG..
+chr2 16 T 11 ...C.....G
+chr2 17 C 12 G......TN..
+chr2 18 A 12 N......G..A
+chr2 19 A 13 .......NN...
+chr2 20 C 13 ..GT.......N
+chr2 52 T 5 .N..,
+chr2 53 A 5 ....,
+chr2 54 T 5 ....,
+chr2 55 T 5 ....,
+chr2 56 C 5 ....,
+chr2 57 T 5 ....,
+chr2 58 T 6 .N...,
+chr2 59 A 6 .....,
+chr2 77 C 6 .G...,
+chr2 78 G 6 ..N..,
+chr2 79 T 7 ..N...,
+chr2 80 C 7 .G....,
+chr2 81 G 7 ...A..,
+chr2 82 A 8 ...G...,
+chr2 83 A 8 ...T...,
+chr2 84 T 8 ..A....,
+chr2 85 G 8 .GA....,
+chr2 86 C 9 ........,
+chr2 87 G 9 ....T...,
+chr3 60 C 6 ...G.,
+chr3 61 T 6 ..N..,
+chr3 62 C 6 ...A.,
+chr3 63 C 7 .N....,
+chr3 64 A 7 ...G..,
+chr3 65 T 7 ...AA.,
+chr3 66 A 7 ....N.,
diff -r 5f927f52191c -r 3ac95cd927d7 test/functional/test_get_data.py
--- a/test/functional/test_get_data.py Fri Mar 26 09:51:03 2010 -0400
+++ b/test/functional/test_get_data.py Fri Mar 26 12:00:55 2010 -0400
@@ -575,5 +575,22 @@
self.check_history_for_string( 'Pasted Entry' )
self.check_history_for_string( 'hello world' )
self.delete_history( id=self.security.encode_id( history.id ) )
+ def test_0165_upload_file( self ):
+ """Test uploading 1.pileup, NOT setting the file format"""
+ self.check_history_for_string( 'Your history is empty' )
+ history = sa_session.query( galaxy.model.History ) \
+ .filter( and_( galaxy.model.History.table.c.deleted==False,
+ galaxy.model.History.table.c.user_id==admin_user.id ) ) \
+ .order_by( desc( galaxy.model.History.table.c.create_time ) ) \
+ .first()
+ self.upload_file( '1.pileup' )
+ hda = sa_session.query( galaxy.model.HistoryDatasetAssociation ) \
+ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ) \
+ .first()
+ assert hda is not None, "Problem retrieving hda from database"
+ self.verify_dataset_correctness( '1.pileup', hid=str( hda.hid ) )
+ self.check_history_for_string( '1.pileup format: <span class="pileup">pileup</span>, database: \? Info: uploaded file' )
+ self.check_metadata_for_string( 'value="1.pileup" value="\?" Change data type selected value="pileup" selected="yes"' )
+ self.delete_history( id=self.security.encode_id( history.id ) )
def test_9999_clean_up( self ):
self.logout()
diff -r 5f927f52191c -r 3ac95cd927d7 tool_conf.xml.sample
--- a/tool_conf.xml.sample Fri Mar 26 09:51:03 2010 -0400
+++ b/tool_conf.xml.sample Fri Mar 26 12:00:55 2010 -0400
@@ -61,6 +61,7 @@
<tool file="filters/compare.xml"/>
<tool file="new_operations/subtract_query.xml"/>
<tool file="stats/grouping.xml" />
+ <tool file="new_operations/column_join.xml" />
</section>
<section name="Convert Formats" id="convert">
<tool file="filters/axt_to_concat_fasta.xml" />
1
0
16 Apr '10
details: http://www.bx.psu.edu/hg/galaxy/rev/5f927f52191c
changeset: 3564:5f927f52191c
user: James Taylor <james(a)jamestaylor.org>
date: Fri Mar 26 09:51:03 2010 -0400
description:
Add template for structured history display
diffstat:
templates/history/display_structured.mako | 124 ++++++++++++++++++++++++++++++
1 files changed, 124 insertions(+), 0 deletions(-)
diffs (129 lines):
diff -r 9ed4a26508ea -r 5f927f52191c templates/history/display_structured.mako
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/templates/history/display_structured.mako Fri Mar 26 09:51:03 2010 -0400
@@ -0,0 +1,124 @@
+<%inherit file="/base.mako"/>
+<%namespace file="/root/history_common.mako" import="render_dataset" />
+
+<%def name="stylesheets()">
+ ${parent.stylesheets()}
+ ${h.css( "history" )}
+ <style type="text/css">
+ body {
+ background: white;
+ padding: 5px;
+ }
+
+ .clickable {
+ cursor: pointer;
+ }
+
+ .workflow {
+ border: solid gray 1px;
+ border-left-width: 5px;
+ }
+
+ .workflow > .header {
+ background: lightgray;
+ padding: 5px 10px;
+
+ font-weight: bold;
+ }
+
+ .workflow > .body {
+ border-top: solid gray 1px;
+ padding: 5px;
+ }
+
+ div.toolForm {
+ margin: 5px 0;
+ border-left-width: 5px;
+ }
+ div.toolFormBody {
+ padding: 5px 5px;
+ }
+ </style>
+</%def>
+
+<%def name="javascripts()">
+ ${parent.javascripts()}
+ <script type="text/javascript">
+ $(function(){
+
+ $(".workflow, .tool").each( function() {
+ var body = $(this).children( ".body" );
+ $(this).children( ".header" ).click( function() {
+ body.toggle();
+ }).addClass( "clickable" );
+ // body.hide();
+ });
+
+ $(".historyItem").each( function() {
+ var id = this.id;
+ var body = $(this).children( "div.historyItemBody" );
+ var peek = body.find( "pre.peek" )
+ $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() {
+ if ( body.is(":visible") ) {
+ // Hiding stuff here
+ if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) }
+ body.slideUp( "fast" );
+ } else {
+ // Showing stuff here
+ body.slideDown( "fast", function() {
+ if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); }
+ });
+ }
+ return false;
+ });
+ body.hide();
+ });
+ });
+ </script>
+</%def>
+
+<%def name="render_item( entity, children )">
+<%
+entity_name = entity.__class__.__name__
+if entity_name == "HistoryDatasetAssociation":
+ render_item_hda( entity, children )
+elif entity_name == "Job":
+ render_item_job( entity, children )
+elif entity_name == "WorkflowInvocation":
+ render_item_wf( entity, children )
+%>
+</%def>
+
+<%def name="render_item_hda( hda, children )">
+ ${render_dataset( hda, hda.hid )}
+</%def>
+
+<%def name="render_item_job( job, children )">
+
+ <div class="tool toolForm">
+ <div class="header toolFormTitle">Tool: ${trans.app.toolbox.tools_by_id[job.tool_id].name}</div>
+ <div class="body toolFormBody">
+ %for e, c in children:
+ ${render_item( e, c )}
+ %endfor
+ </div>
+ </div>
+
+</%def>
+
+<%def name="render_item_wf( wf, children )">
+
+ <div class="workflow">
+ <div class="header">Workflow: ${wf.workflow.name}</div>
+ <div class="body">
+ %for e, c in children:
+ ${render_item( e, c )}
+ %endfor
+ </div>
+ </div>
+
+</%def>
+
+%for entity, children in items:
+ ${render_item( entity, children )}
+%endfor
\ No newline at end of file
1
0
16 Apr '10
details: http://www.bx.psu.edu/hg/galaxy/rev/9ed4a26508ea
changeset: 3563:9ed4a26508ea
user: fubar: ross Lazarus at gmail period com
date: Thu Mar 25 23:07:14 2010 -0400
description:
added sim_size as a way of comparing (eg) .png outputs
diffstat:
test/base/twilltestcase.py | 6 ++++++
1 files changed, 6 insertions(+), 0 deletions(-)
diffs (16 lines):
diff -r 0890f7bf9d49 -r 9ed4a26508ea test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Thu Mar 25 15:21:57 2010 -0400
+++ b/test/base/twilltestcase.py Thu Mar 25 23:07:14 2010 -0400
@@ -749,6 +749,12 @@
self.files_re_match( local_name, temp_name, attributes=attributes )
elif compare == 're_match_multiline':
self.files_re_match_multiline( local_name, temp_name, attributes=attributes )
+ elif compare == 'sim_size':
+ delta = attributes.get('delta','100')
+ s1 = len(data)
+ s2 = os.path.getsize(local_name)
+ if abs(s1-s2) > int(delta):
+ raise Exception, 'Files %s=%db but %s=%db - compare (delta=%s) failed' % (temp_name,s1,local_name,s2,delta)
else:
raise Exception, 'Unimplemented Compare type: %s' % compare
except AssertionError, err:
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/0890f7bf9d49
changeset: 3562:0890f7bf9d49
user: Kanwei Li <kanwei(a)gmail.com>
date: Thu Mar 25 15:21:57 2010 -0400
description:
trackster:
- New summary tree data structure that specializes in aggregation at defined levels
- BED converter for summary_tree
- Feature tracks now have a summary display when there are a lot of things to be rendered on screen, but will display simple lines and full detailed view as you zoom in and can fit more on screen
- Added option to display number of features in a region of summary view
- Line tracks can now be displayed as intensity
- Pack scripts
diffstat:
datatypes_conf.xml.sample | 5 +-
lib/galaxy/datatypes/binary.py | 2 +-
lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py | 45 --
lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml | 15 -
lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.py | 45 ++
lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.xml | 15 +
lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py | 29 -
lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml | 14 -
lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.py | 25 +
lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.xml | 14 +
lib/galaxy/datatypes/interval.py | 2 +-
lib/galaxy/visualization/tracks/data/array_tree.py | 74 +--
lib/galaxy/visualization/tracks/data/interval_index.py | 32 +-
lib/galaxy/visualization/tracks/data/summary_tree.py | 37 +
lib/galaxy/visualization/tracks/summary.py | 88 ++++
lib/galaxy/web/controllers/tracks.py | 19 +-
lib/galaxy/web/controllers/visualization.py | 4 +-
static/scripts/packed/galaxy.workflow_editor.canvas.js | 2 +-
static/scripts/packed/trackster.js | 2 +-
static/scripts/trackster.js | 210 +++++----
templates/tracks/browser.mako | 2 +-
21 files changed, 397 insertions(+), 284 deletions(-)
diffs (1067 lines):
diff -r 44f2713a7279 -r 0890f7bf9d49 datatypes_conf.xml.sample
--- a/datatypes_conf.xml.sample Wed Mar 24 15:13:57 2010 -0400
+++ b/datatypes_conf.xml.sample Thu Mar 25 15:21:57 2010 -0400
@@ -5,14 +5,14 @@
<datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/>
<datatype extension="bam" type="galaxy.datatypes.binary:Bam" mimetype="application/octet-stream" display_in_upload="true">
<converter file="bam_to_bai.xml" target_datatype="bai"/>
- <converter file="bam_to_array_tree_converter.xml" target_datatype="array_tree"/>
+ <converter file="bam_to_summary_tree_converter.xml" target_datatype="summary_tree"/>
<display file="ucsc/bam.xml" />
</datatype>
<datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true">
<converter file="bed_to_gff_converter.xml" target_datatype="gff"/>
<converter file="interval_to_coverage.xml" target_datatype="coverage"/>
<converter file="bed_to_interval_index_converter.xml" target_datatype="interval_index"/>
- <converter file="bed_to_array_tree_converter.xml" target_datatype="array_tree"/>
+ <converter file="bed_to_summary_tree_converter.xml" target_datatype="summary_tree"/>
<converter file="bed_to_genetrack_converter.xml" target_datatype="genetrack"/>
<!-- <display file="ucsc/interval_as_bed.xml" /> -->
<display file="genetrack.xml" />
@@ -80,6 +80,7 @@
<converter file="wiggle_to_simple_converter.xml" target_datatype="interval"/>
</datatype>
<datatype extension="array_tree" type="galaxy.datatypes.data:Data" />
+ <datatype extension="summary_tree" type="galaxy.datatypes.data:Data" />
<datatype extension="interval_index" type="galaxy.datatypes.data:Data" />
<!-- Start EMBOSS tools -->
<datatype extension="acedb" type="galaxy.datatypes.data:Text"/>
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/binary.py
--- a/lib/galaxy/datatypes/binary.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/datatypes/binary.py Thu Mar 25 15:21:57 2010 -0400
@@ -139,7 +139,7 @@
except:
return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) )
def get_track_type( self ):
- return "ReadTrack", ["bai", "array_tree"]
+ return "ReadTrack", ["bai", "summary_tree"]
class Binseq( Binary ):
"""Class describing a zip archive of binary sequence files"""
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py
--- a/lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py Wed Mar 24 15:13:57 2010 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,45 +0,0 @@
-#!/usr/bin/env python
-
-from __future__ import division
-
-import sys
-from galaxy import eggs
-import pkg_resources; pkg_resources.require( "bx-python" ); pkg_resources.require( "pysam" )
-
-from pysam import csamtools
-from bx.arrays.array_tree import *
-
-BLOCK_SIZE = 1000
-
-class BamReader:
- def __init__( self, input_fname, index_fname ):
- self.bamfile = csamtools.Samfile( filename=input_fname, mode='rb', index_filename=index_fname )
- self.iterator = self.bamfile.fetch()
-
- def __iter__( self ):
- return self
-
- def __next__( self ):
- while True:
- read = self.iterator.next()
- return read.rname, read.mpos, read.pos + read.rlen, None, mapq
-
-
-def main():
-
- input_fname = sys.argv[1]
- index_fname = sys.argv[2]
- out_fname = sys.argv[3]
-
- reader = BamReader( input_fname, index_fname )
-
- # Fill array from reader
- d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE )
-
- for array_tree in d.itervalues():
- array_tree.root.build_summary()
-
- FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ), no_leaves=True )
-
-if __name__ == "__main__":
- main()
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml
--- a/lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml Wed Mar 24 15:13:57 2010 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,15 +0,0 @@
-<tool id="CONVERTER_bam_to_array_tree_0" name="Convert BAM to Array Tree" version="1.0.0">
-<!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
- <command interpreter="python">bam_to_array_tree_converter.py $input1 $output1</command>
- <inputs>
- <page>
- <param format="bam" name="input1" type="data" label="Choose BAM file"/>
- <param format="bai" name="index" type="data" label="BAM index file"/>
- </page>
- </inputs>
- <outputs>
- <data format="array_tree" name="output1"/>
- </outputs>
- <help>
- </help>
-</tool>
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.py Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,45 @@
+#!/usr/bin/env python
+
+from __future__ import division
+
+import sys
+from galaxy import eggs
+import pkg_resources; pkg_resources.require( "bx-python" ); pkg_resources.require( "pysam" )
+
+from pysam import csamtools
+from bx.arrays.array_tree import *
+
+BLOCK_SIZE = 1000
+
+class BamReader:
+ def __init__( self, input_fname, index_fname ):
+ self.bamfile = csamtools.Samfile( filename=input_fname, mode='rb', index_filename=index_fname )
+ self.iterator = self.bamfile.fetch()
+
+ def __iter__( self ):
+ return self
+
+ def __next__( self ):
+ while True:
+ read = self.iterator.next()
+ return read.rname, read.mpos, read.pos + read.rlen, None, mapq
+
+
+def main():
+
+ input_fname = sys.argv[1]
+ index_fname = sys.argv[2]
+ out_fname = sys.argv[3]
+
+ reader = BamReader( input_fname, index_fname )
+
+ # Fill array from reader
+ d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE )
+
+ for array_tree in d.itervalues():
+ array_tree.root.build_summary()
+
+ FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ), no_leaves=True )
+
+if __name__ == "__main__":
+ main()
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/converters/bam_to_summary_tree_converter.xml Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,15 @@
+<tool id="CONVERTER_bam_to_summary_tree_0" name="Convert BAM to Summary Tree" version="1.0.0">
+<!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
+ <command interpreter="python">bam_to_summary_tree_converter.py $input1 $output1</command>
+ <inputs>
+ <page>
+ <param format="bam" name="input1" type="data" label="Choose BAM file"/>
+ <param format="bai" name="index" type="data" label="BAM index file"/>
+ </page>
+ </inputs>
+ <outputs>
+ <data format="summary_tree" name="output1"/>
+ </outputs>
+ <help>
+ </help>
+</tool>
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py
--- a/lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py Wed Mar 24 15:13:57 2010 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,29 +0,0 @@
-#!/usr/bin/env python
-
-from __future__ import division
-
-import sys
-from galaxy import eggs
-import pkg_resources; pkg_resources.require( "bx-python" )
-from bx.arrays.array_tree import *
-from bx.arrays.bed import BedReader
-
-BLOCK_SIZE = 1000
-
-def main():
-
- input_fname = sys.argv[1]
- out_fname = sys.argv[2]
-
- reader = BedReader( open( input_fname ) )
-
- # Fill array from reader
- d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE )
-
- for array_tree in d.itervalues():
- array_tree.root.build_summary()
-
- FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ), no_leaves=True )
-
-if __name__ == "__main__":
- main()
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml
--- a/lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml Wed Mar 24 15:13:57 2010 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,14 +0,0 @@
-<tool id="CONVERTER_bed_to_array_tree_0" name="Convert BED to Array Tree" version="1.0.0">
-<!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
- <command interpreter="python">bed_to_array_tree_converter.py $input1 $output1</command>
- <inputs>
- <page>
- <param format="bed" name="input1" type="data" label="Choose BED file"/>
- </page>
- </inputs>
- <outputs>
- <data format="array_tree" name="output1"/>
- </outputs>
- <help>
- </help>
-</tool>
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.py Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,25 @@
+#!/usr/bin/env python
+
+from __future__ import division
+
+import sys
+from galaxy import eggs
+import pkg_resources; pkg_resources.require( "bx-python" )
+from galaxy.visualization.tracks.summary import *
+from bx.arrays.bed import BedReader
+
+def main():
+
+ input_fname = sys.argv[1]
+ out_fname = sys.argv[2]
+
+ reader = BedReader( open( input_fname ) )
+
+ st = SummaryTree(block_size=100, levels=4, draw_cutoff=100, detail_cutoff=20)
+ for chrom, chrom_start, chrom_end, name, score in reader:
+ st.insert_range(chrom, chrom_start, chrom_end)
+
+ st.write(out_fname)
+
+if __name__ == "__main__":
+ main()
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/converters/bed_to_summary_tree_converter.xml Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,14 @@
+<tool id="CONVERTER_bed_to_summary_tree_0" name="Convert BED to Summary Tree" version="1.0.0">
+<!-- <description>__NOT_USED_CURRENTLY_FOR_CONVERTERS__</description> -->
+ <command interpreter="python">bed_to_summary_tree_converter.py $input1 $output1</command>
+ <inputs>
+ <page>
+ <param format="bed" name="input1" type="data" label="Choose BED file"/>
+ </page>
+ </inputs>
+ <outputs>
+ <data format="summary_tree" name="output1"/>
+ </outputs>
+ <help>
+ </help>
+</tool>
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/datatypes/interval.py
--- a/lib/galaxy/datatypes/interval.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/datatypes/interval.py Thu Mar 25 15:21:57 2010 -0400
@@ -508,7 +508,7 @@
except: return False
def get_track_type( self ):
- return "FeatureTrack", ["interval_index", "array_tree"]
+ return "FeatureTrack", ["interval_index", "summary_tree"]
class BedStrict( Bed ):
"""Tab delimited data in strict BED format - no non-standard columns allowed"""
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/visualization/tracks/data/array_tree.py
--- a/lib/galaxy/visualization/tracks/data/array_tree.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/visualization/tracks/data/array_tree.py Thu Mar 25 15:21:57 2010 -0400
@@ -3,26 +3,13 @@
"""
import pkg_resources; pkg_resources.require( "bx-python" )
-try:
- from bx.arrays.array_tree import FileArrayTreeDict
-except:
- pass
+from bx.arrays.array_tree import FileArrayTreeDict
from math import floor, ceil, log, pow
-import logging
-logger = logging.getLogger(__name__)
-
-# Maybe this should be included in the datatype itself, so users can add their
-# own types to the browser as long as they return the right format of data?
-
-SUMMARIZE_N = 200
class ArrayTreeDataProvider( object ):
def __init__( self, dataset, original_dataset ):
self.dataset = dataset
- # def calc_resolution(self, start, end, density):
- # return pow( 10, ceil( log( (end - start) / density , 10 ) ) )
-
def get_stats( self, chrom ):
f = open( self.dataset.file_name )
d = FileArrayTreeDict( f )
@@ -52,8 +39,8 @@
if n != n: # NaN != NaN
return None
else:
- return float(n)
-
+ return float(n)
+
def get_data( self, chrom, start, end, **kwargs ):
f = open( self.dataset.file_name )
d = FileArrayTreeDict( f )
@@ -61,7 +48,7 @@
# Get the right chromosome
try:
chrom_array_tree = d[chrom]
- except KeyError:
+ except:
f.close()
return None
@@ -70,53 +57,26 @@
end = int( end )
resolution = max(1, ceil(float(kwargs['resolution'])))
- level = int( ceil( log( resolution, block_size ) ) )
+ level = int( floor( log( resolution, block_size ) ) )
level = max( level, 0 )
stepsize = block_size ** level
# Is the requested level valid?
assert 0 <= level <= chrom_array_tree.levels
- if "frequencies" in kwargs:
- if level <= 0:
- # Low level enough to always display features
- f.close()
- return None
+ results = []
+ for block_start in range( start, end, stepsize * block_size ):
+ # print block_start
+ # Return either data point or a summary depending on the level
+ indexes = range( block_start, block_start + stepsize * block_size, stepsize )
+ if level > 0:
+ s = chrom_array_tree.get_summary( block_start, level )
+ if s is not None:
+ results.extend( zip( indexes, map( self.float_nan, s.sums / s.counts ) ) )
else:
- # Round to nearest bin
- bin_start = start // (stepsize * block_size) * (stepsize * block_size)
-
- indexes = range( bin_start, (bin_start + stepsize * block_size), stepsize )
- summary = chrom_array_tree.get_summary( bin_start, level )
- if summary:
- results = zip( indexes, map( int, summary.frequencies ) )
- filtered = filter(lambda tup: tup[0] >= start and tup[0] <= end, results)
- sums = 0
- max_f = 0
- for tup in filtered:
- sums += tup[1]
- max_f = max(max_f, tup[1])
-
- if max_f > 10000:
- f.close()
- return filtered, int(sums), float(sums)/len(filtered)
- f.close()
- return None
-
- else:
- results = []
- for block_start in range( start, end, stepsize * block_size ):
- # print block_start
- # Return either data point or a summary depending on the level
- indexes = range( block_start, block_start + stepsize * block_size, stepsize )
- if level > 0:
- s = chrom_array_tree.get_summary( block_start, level )
- if s:
- results.extend( zip( indexes, map( self.float_nan, s.sums / s.counts ) ) )
- else:
- l = chrom_array_tree.get_leaf( block_start )
- if l:
- results.extend( zip( indexes, map( self.float_nan, l ) ) )
+ l = chrom_array_tree.get_leaf( block_start )
+ if l is not None:
+ results.extend( zip( indexes, map( self.float_nan, l ) ) )
f.close()
return results
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/visualization/tracks/data/interval_index.py
--- a/lib/galaxy/visualization/tracks/data/interval_index.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/visualization/tracks/data/interval_index.py Thu Mar 25 15:21:57 2010 -0400
@@ -1,6 +1,8 @@
"""
Interval index data provider for the Galaxy track browser.
Kanwei Li, 2009
+
+Payload format: [ uid (offset), start, end, name, strand, thick_start, thick_end, blocks ]
"""
import pkg_resources; pkg_resources.require( "bx-python" )
@@ -21,26 +23,22 @@
for start, end, offset in index.find(chrom, start, end):
source.seek(offset)
feature = source.readline().split()
- payload = { 'uid': offset, 'start': start, 'end': end, 'name': feature[3] }
- try:
- payload['strand'] = feature[5]
- except IndexError:
- pass
-
- if 'include_blocks' in kwargs:
- try:
+ payload = [ offset, start, end ]
+ if "no_detail" not in kwargs:
+ length = len(feature)
+ payload.append(feature[3]) # name
+ if length >= 6: # strand
+ payload.append(feature[5])
+
+ if length >= 8:
+ payload.append(int(feature[6]))
+ payload.append(int(feature[7]))
+
+ if length >= 12:
block_sizes = [ int(n) for n in feature[10].split(',') if n != '']
block_starts = [ int(n) for n in feature[11].split(',') if n != '' ]
blocks = zip(block_sizes, block_starts)
- payload['blocks'] = [ (start + block[1], start + block[1] + block[0]) for block in blocks]
- except IndexError:
- pass
-
- try:
- payload['thick_start'] = int(feature[6])
- payload['thick_end'] = int(feature[7])
- except IndexError:
- pass
+ payload.append( [ (start + block[1], start + block[1] + block[0]) for block in blocks] )
results.append(payload)
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/visualization/tracks/data/summary_tree.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/visualization/tracks/data/summary_tree.py Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,37 @@
+"""
+Summary tree data provider for the Galaxy track browser.
+"""
+
+import pkg_resources; pkg_resources.require( "bx-python" )
+from galaxy.visualization.tracks.summary import *
+from math import ceil, log
+from galaxy.util.lrucache import LRUCache
+
+CACHE = LRUCache(20) # Store 20 recently accessed indices for performance
+
+class SummaryTreeDataProvider( object ):
+ def __init__( self, dataset, original_dataset ):
+ self.dataset = dataset
+
+ def get_summary( self, chrom, start, end, **kwargs):
+ filename = self.dataset.file_name
+ st = CACHE[filename]
+ if st is None:
+ st = summary_tree_from_file( self.dataset.file_name )
+ CACHE[filename] = st
+ if chrom not in st.chrom_blocks:
+ return None
+
+ resolution = max(1, ceil(float(kwargs['resolution'])))
+
+ level = ceil( log( resolution, st.block_size ) )
+ level = int(max( level, 0 ))
+
+ stats = st.chrom_stats[chrom]
+ results = st.query(chrom, int(start), int(end), level)
+ if results == "detail" or level <= 0:
+ return None
+ elif results == "draw":
+ return "no_detail", None, None
+ else:
+ return results, stats["max"], stats["avg"]
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/visualization/tracks/summary.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/visualization/tracks/summary.py Thu Mar 25 15:21:57 2010 -0400
@@ -0,0 +1,88 @@
+'''
+2010, Kanwei Li
+Summary tree data structure for aggregation
+'''
+
+import sys, os
+import cPickle
+
+VERSION = 1
+
+class SummaryTree:
+ def __init__(self, block_size, levels, draw_cutoff, detail_cutoff):
+ self.version = VERSION
+ self.chrom_blocks = {}
+ self.levels = levels
+ self.draw_cutoff = draw_cutoff
+ self.detail_cutoff = detail_cutoff
+ self.block_size = block_size
+ self.chrom_stats = {}
+
+ def find_block(self, num, level):
+ return (num / self.block_size ** level)
+
+ def insert_range(self, chrom, start, end):
+ if chrom in self.chrom_blocks:
+ blocks = self.chrom_blocks[chrom]
+ else:
+ blocks = self.chrom_blocks[chrom] = {}
+ self.chrom_stats[chrom] = {}
+ for level in range(1, self.levels+1):
+ blocks[level] = {}
+
+
+ for level in range(1, self.levels+1):
+ block_level = blocks[level]
+ starting_block = self.find_block(start, level)
+ ending_block = self.find_block(end, level)
+ for block in range(starting_block, ending_block+1):
+ if block in block_level:
+ block_level[block] += 1
+ else:
+ block_level[block] = 1
+
+ def finish(self):
+ ''' Checks for cutoff and only stores levels above it '''
+ for chrom, blocks in self.chrom_blocks.iteritems():
+ cur_best = 999
+ for level in range(self.levels, 0, -1):
+ max_val = max(blocks[level].values())
+ if max_val < self.draw_cutoff:
+ if "draw_level" not in self.chrom_stats[chrom]:
+ self.chrom_stats[chrom]["draw_level"] = level
+ elif max_val < self.detail_cutoff:
+ self.chrom_stats[chrom]["detail_level"] = level
+ break
+ else:
+ self.chrom_stats[chrom]["max"] = max_val
+ self.chrom_stats[chrom]["avg"] = float(max_val) / len(blocks[level])
+ cur_best = level
+
+ self.chrom_blocks[chrom] = dict([ (key, value) for key, value in blocks.iteritems() if key >= cur_best ])
+
+ def query(self, chrom, start, end, level):
+ if chrom in self.chrom_blocks:
+ stats = self.chrom_stats[chrom]
+ if "detail_level" in stats and level <= stats["detail_level"]:
+ return "detail"
+ elif "draw_level" in stats and level <= stats["draw_level"]:
+ return "draw"
+ blocks = self.chrom_blocks[chrom]
+ results = []
+ multiplier = self.block_size ** level
+ starting_block = self.find_block(start, level)
+ ending_block = self.find_block(end, level)
+ for block in range(starting_block, ending_block+1):
+ if block in blocks[level]:
+ results.append( (block * multiplier, blocks[level][block]) )
+ return results
+
+ return None
+
+ def write(self, filename):
+ self.finish()
+ cPickle.dump(self, open(filename, 'wb'), 2)
+
+def summary_tree_from_file(filename):
+ return cPickle.load(open(filename, "r"))
+
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/web/controllers/tracks.py
--- a/lib/galaxy/web/controllers/tracks.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/web/controllers/tracks.py Thu Mar 25 15:21:57 2010 -0400
@@ -25,6 +25,7 @@
from galaxy.visualization.tracks.data.array_tree import ArrayTreeDataProvider
from galaxy.visualization.tracks.data.interval_index import IntervalIndexDataProvider
from galaxy.visualization.tracks.data.bam import BamDataProvider
+from galaxy.visualization.tracks.data.summary_tree import SummaryTreeDataProvider
# Message strings returned to browser
messages = Bunch(
@@ -41,7 +42,8 @@
dataset_type_to_data_provider = {
"array_tree": ArrayTreeDataProvider,
"interval_index": IntervalIndexDataProvider,
- "bai": BamDataProvider
+ "bai": BamDataProvider,
+ "summary_tree": SummaryTreeDataProvider
}
class DatasetSelectionGrid( grids.Grid ):
@@ -199,6 +201,7 @@
track_type, indexes = dataset.datatype.get_track_type()
converted = dict([ (index, self.__dataset_as_type( trans, dataset, index )) for index in indexes ])
+ extra_info = None
for index, converted_dataset in converted.iteritems():
if not converted_dataset:
@@ -212,11 +215,15 @@
if len(converted) > 1:
# Have to choose between array_tree and other provider
- array_tree = ArrayTreeDataProvider( converted['array_tree'], dataset )
- freqs = array_tree.get_data( chrom, low, high, frequencies=True, **kwargs )
+ summary_tree = SummaryTreeDataProvider( converted['summary_tree'], dataset )
+ freqs = summary_tree.get_summary( chrom, low, high, **kwargs )
if freqs is not None:
- frequencies, sums, avg_f = freqs
- return { "dataset_type": "array_tree", "data": frequencies, "sums": sums, "avg_f": avg_f }
+ frequencies, max_v, avg_v = freqs
+ if frequencies != "no_detail":
+ return { "dataset_type": "summary_tree", "data": frequencies, "max": max_v, "avg": avg_v }
+ else:
+ kwargs["no_detail"] = True # meh
+ extra_info = "no_detail"
dataset_type = "interval_index"
else:
dataset_type = converted.keys()[0]
@@ -228,7 +235,7 @@
else:
data = data_provider.get_data( chrom, low, high, **kwargs )
- return { "dataset_type": dataset_type, "data": data }
+ return { "dataset_type": dataset_type, "extra_info": extra_info, "data": data }
def __dataset_as_type( self, trans, dataset, type ):
"""
diff -r 44f2713a7279 -r 0890f7bf9d49 lib/galaxy/web/controllers/visualization.py
--- a/lib/galaxy/web/controllers/visualization.py Wed Mar 24 15:13:57 2010 -0400
+++ b/lib/galaxy/web/controllers/visualization.py Thu Mar 25 15:21:57 2010 -0400
@@ -25,8 +25,8 @@
key="free-text-search", visible=False, filterable="standard" )
)
operations = [
- grids.GridOperation( "Edit content", allow_multiple=False, url_args=dict( controller='tracks', action='browser' ) ),
- grids.GridOperation( "Edit attributes", allow_multiple=False, url_args=dict( action='edit') ),
+ grids.GridOperation( "View", allow_multiple=False, url_args=dict( controller='tracks', action='browser' ) ),
+ grids.GridOperation( "Edit Attributes", allow_multiple=False, url_args=dict( action='edit') ),
grids.GridOperation( "Share or Publish", allow_multiple=False, condition=( lambda item: not item.deleted ), async_compatible=False ),
grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ), async_compatible=True, confirm="Are you sure you want to delete this visualization?" ),
]
diff -r 44f2713a7279 -r 0890f7bf9d49 static/scripts/packed/galaxy.workflow_editor.canvas.js
--- a/static/scripts/packed/galaxy.workflow_editor.canvas.js Wed Mar 24 15:13:57 2010 -0400
+++ b/static/scripts/packed/galaxy.workflow_editor.canvas.js Thu Mar 25 15:21:57 2010 -0400
@@ -1,1 +1,1 @@
-function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a!
){this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*!
f;this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canv
as.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hover",function(){if(f.connectors.length>0){var g=$("<div class='callou!
t'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");return i}).bind("drag",function(i){var h=function(){var k=$(i.dragProx!
y).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dr
agProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b.appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=!
g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;this.tooltip=g.tooltip?g.tooltip:"";this.annotation=g.annotation;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extension+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j)!
)});workflow.node_changed(this)},update_field_data:function(f){var c=$
(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destroy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='!
color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false;this.active_form_has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connectors,function(j,k){f[h.name]={id:k.handle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.t!
ool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.e
lement).position(),annotation:d.annotation};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},check_changes_in_active_form:function(){if(this.active_form_has_changes){this.has_changes=true;$("#right-content").find("form").submit();this.active_form_has_changes=false}},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.check_cha!
nges_in_active_form();this.clear_active_node();parent.show_form_for_tool(a.form_html+a.tooltip,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html+a.tooltip,a)}},layout:function(){this.check_changes_in_active_form();this.has_changes=true;var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){level_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[b[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(f!
unction(p,o){return $(d[p].element).position().top-$(d[o].element).pos
ition().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this.canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(functio!
n(){var k=$(this).position();$(this).css("left",k.left+d);$(this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></div>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../ima!
ges/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#can
vas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this).offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prototype,{te!
st:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.css("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this;var a=fu!
nction(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.
cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({width:f,height:f});b.draw_overview()});$("#overview-border div").bind("drag",fun!
ction(f){})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewport_overlay()}});
\ No newline at end of file
+function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a!
){this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*!
f;this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canv
as.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hover",function(){if(f.connectors.length>0){var g=$("<div class='callou!
t'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");return i}).bind("drag",function(i){var h=function(){var k=$(i.dragProx!
y).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dr
agProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b.appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=!
g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;this.tooltip=g.tooltip?g.tooltip:"";this.annotation=g.annotation;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extension+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j)!
)});workflow.node_changed(this)},update_field_data:function(f){var c=$
(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;this.annotation=f.annotation;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destroy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div")!
.remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false;this.active_form_has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connectors,function(j,k){f[h.name]={id:k.handle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,too!
l_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input
_connections:f,position:$(d.element).position(),annotation:d.annotation};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},check_changes_in_active_form:function(){if(this.active_form_has_changes){this.has_changes=true;$("#right-content").find("form").submit();this.active_form_has_changes=false}},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.a!
ctive_node!=a){this.check_changes_in_active_form();this.clear_active_node();parent.show_form_for_tool(a.form_html+a.tooltip,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html+a.tooltip,a)}},layout:function(){this.check_changes_in_active_form();this.has_changes=true;var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){level_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[b[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by!
_level,function(k,l){l.sort(function(p,o){return $(d[p].element).posit
ion().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this.canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_cont!
ainer.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$(this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></div>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function!
(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#can
vas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this).offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.ext!
end(ScrollPanel.prototype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.css("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:f!
unction(){var b=this;var a=function(f,g){f=Math.min(f,b.cv.width()/2);
f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({width:f,height:f});b.draw_overview()});$("#overview!
-border div").bind("drag",function(f){})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_!
viewport_overlay()}});
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 static/scripts/packed/trackster.js
--- a/static/scripts/packed/trackster.js Wed Mar 24 15:13:57 2010 -0400
+++ b/static/scripts/packed/trackster.js Thu Mar 25 15:21:57 2010 -0400
@@ -1,1 +1,1 @@
-var DEBUG=false;var DENSITY=1000,FEATURE_LEVELS=10,DATA_ERROR="There was an error in indexing this dataset.",DATA_NONE="No data for this chrom/contig.",DATA_PENDING="Currently indexing... please wait",DATA_LOADING="Loading data...",CACHED_TILES_FEATURE=10,CACHED_TILES_LINE=30,CACHED_DATA=20,CONTEXT=$("<canvas></canvas>").get(0).getContext("2d"),RIGHT_STRAND,LEFT_STRAND;var right_img=new Image();right_img.src="../images/visualization/strand_right.png";right_img.onload=function(){RIGHT_STRAND=CONTEXT.createPattern(right_img,"repeat")};var left_img=new Image();left_img.src="../images/visualization/strand_left.png";left_img.onload=function(){LEFT_STRAND=CONTEXT.createPattern(left_img,"repeat")};var right_img_inv=new Image();right_img_inv.src="../images/visualization/strand_right_inv.png";right_img_inv.onload=function(){RIGHT_STRAND_INV=CONTEXT.createPattern(right_img_inv,"repeat")};var left_img_inv=new Image();left_img_inv.src="../images/visualization/strand_left_inv.png";left_!
img_inv.onload=function(){LEFT_STRAND_INV=CONTEXT.createPattern(left_img_inv,"repeat")};function commatize(b){b+="";var a=/(\d+)(\d{3})/;while(a.test(b)){b=b.replace(a,"$1,$2")}return b}var Cache=function(a){this.num_elements=a;this.clear()};$.extend(Cache.prototype,{get:function(b){var a=this.key_ary.indexOf(b);if(a!=-1){this.key_ary.splice(a,1);this.key_ary.push(b)}return this.obj_cache[b]},set:function(b,c){if(!this.obj_cache[b]){if(this.key_ary.length>=this.num_elements){var a=this.key_ary.shift();delete this.obj_cache[a]}this.key_ary.push(b)}this.obj_cache[b]=c;return c},clear:function(){this.obj_cache={};this.key_ary=[]}});var View=function(b,d,c,a){this.vis_id=c;this.dbkey=a;this.title=d;this.chrom=b;this.tracks=[];this.label_tracks=[];this.max_low=0;this.max_high=0;this.center=(this.max_high-this.max_low)/2;this.zoom_factor=3;this.zoom_level=0;this.track_id_counter=0};$.extend(View.prototype,{add_track:function(a){a.view=this;a.track_id=this.track_id_counter;this.tr!
acks.push(a);if(a.init){a.init()}a.container_div.attr("id","track_"+a.
track_id);this.track_id_counter+=1},add_label_track:function(a){a.view=this;this.label_tracks.push(a)},remove_track:function(a){a.container_div.fadeOut("slow",function(){$(this).remove()});delete this.tracks[a]},update_options:function(){var b=$("ul#sortable-ul").sortable("toArray");var d=[];var c=$("#viewport > div").sort(function(g,f){return b.indexOf($(g).attr("id"))>b.indexOf($(f).attr("id"))});$("#viewport > div").remove();$("#viewport").html(c);for(var e in view.tracks){var a=view.tracks[e];if(a.update_options){a.update_options(e)}}},redraw:function(f){this.span=this.max_high-this.max_low;var d=this.span/Math.pow(this.zoom_factor,this.zoom_level),b=this.center-(d/2),e=b+d;if(b<0){b=0;e=b+d}else{if(e>this.max_high){e=this.max_high;b=e-d}}this.low=Math.floor(b);this.high=Math.ceil(e);this.center=Math.round(this.low+(this.high-this.low)/2);this.resolution=Math.pow(10,Math.ceil(Math.log((this.high-this.low)/DENSITY)/Math.LN10));this.zoom_res=Math.pow(FEATURE_LEVELS,Math.ma!
x(0,Math.ceil(Math.log(this.resolution,FEATURE_LEVELS)/Math.log(FEATURE_LEVELS))));$("#overview-box").css({left:(this.low/this.span)*$("#overview-viewport").width(),width:Math.max(12,((this.high-this.low)/this.span)*$("#overview-viewport").width())}).show();$("#low").val(commatize(this.low));$("#high").val(commatize(this.high));if(!f){for(var c=0,a=this.tracks.length;c<a;c++){this.tracks[c].draw()}for(var c=0,a=this.label_tracks.length;c<a;c++){this.label_tracks[c].draw()}}},zoom_in:function(a){if(this.max_high===0||this.high-this.low<30){return}if(a){this.center=a/$(document).width()*(this.high-this.low)+this.low}this.zoom_level+=1;this.redraw()},zoom_out:function(){if(this.max_high===0){return}if(this.zoom_level<=0){this.zoom_level=0;return}this.zoom_level-=1;this.redraw()}});var Track=function(a,b){this.name=a;this.parent_element=b;this.init_global()};$.extend(Track.prototype,{init_global:function(){this.header_div=$("<div class='track-header'>").text(this.name);this.con!
tent_div=$("<div class='track-content'>");this.container_div=$("<div><
/div>").addClass("track").append(this.header_div).append(this.content_div);this.parent_element.append(this.container_div)},init_each:function(c,b){var a=this;a.data_queue={};a.tile_cache.clear();a.data_cache.clear();a.content_div.css("height","30px");a.content_div.text(DATA_LOADING);a.container_div.removeClass("nodata error pending");if(a.view.chrom){$.getJSON(data_url,c,function(d){if(!d||d=="error"){a.container_div.addClass("error");a.content_div.text(DATA_ERROR)}else{if(d.length===0||d=="no data"){a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}else{if(d=="pending"){a.container_div.addClass("pending");a.content_div.text(DATA_PENDING);setTimeout(function(){a.init()},5000)}else{a.content_div.text("");a.content_div.css("height",a.height_px+"px");b(d);a.draw()}}}})}else{a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}}});var TiledTrack=function(){};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(){var i=this.view.low,e=this.view.!
high,f=e-i,d=this.view.resolution;if(DEBUG){$("#debug").text(d+" "+this.view.zoom_res)}var k=$("<div style='position: relative;'></div>");this.content_div.children(":first").remove();this.content_div.append(k);var l=this.content_div.width()/f;var h;var a=Math.floor(i/d/DENSITY);while((a*DENSITY*d)<e){var j=this.content_div.width()+"_"+this.view.zoom_level+"_"+a;var c=this.tile_cache.get(j);if(c){var g=a*DENSITY*d;var b=(g-i)*l;if(this.left_offset){b-=this.left_offset}c.css({left:b});k.append(c);this.max_height=Math.max(this.max_height,c.height())}else{this.delayed_draw(this,j,i,e,a,d,k,l)}a+=1}},delayed_draw:function(c,e,a,f,b,d,g,h){setTimeout(function(){if(!(a>c.view.high||f<c.view.low)){tile_element=c.draw_tile(d,b,g,h);if(tile_element){c.tile_cache.set(e,tile_element);c.max_height=Math.max(c.max_height,tile_element.height());c.content_div.css("height",c.max_height+"px")}}},50)}});var LabelTrack=function(a){Track.call(this,null,a);this.track_type="LabelTrack";this.hidden!
=true;this.container_div.addClass("label-track")};$.extend(LabelTrack.
prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div style='position: relative; height: 1.3em;'></div>");while(a<c.high){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+commatize(a)+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.append(b)}});var LineTrack=function(c,a,d,b){this.track_type="LineTrack";Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.indexer=d;this.height_px=100;this.container_div.addClass("line-track");this.dataset_id=a;this.data_cache=new Cache(CACHED_DATA);this.tile_cache=new Cache(CACHED_TILES_LINE);this.prefs={min_value:undefined,max_value:undefined};if(b.min_value!==undefined){this.prefs.min_value=b.min_value}if(b.max_value!==undefined){this.prefs.max_value=b.max_value}};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:fu!
nction(){var a=this,b=a.view.tracks.indexOf(a);a.vertical_range=undefined;this.init_each({stats:true,indexer:a.indexer,chrom:a.view.chrom,low:null,high:null,dataset_id:a.dataset_id},function(d){if(isNaN(parseFloat(a.prefs.min_value))||isNaN(parseFloat(a.prefs.max_value))){a.prefs.min_value=d.min;a.prefs.max_value=d.max;$("#track_"+b+"_minval").val(a.prefs.min_value);$("#track_"+b+"_maxval").val(a.prefs.max_value)}a.vertical_range=a.prefs.max_value-a.prefs.min_value;$("#linetrack_"+b+"_minval").remove();$("#linetrack_"+b+"_maxval").remove();var e=$("<div></div>").addClass("yaxislabel").attr("id","linetrack_"+b+"_minval").text(a.prefs.min_value);var c=$("<div></div>").addClass("yaxislabel").attr("id","linetrack_"+b+"_maxval").text(a.prefs.max_value);c.css({position:"relative",top:"25px"});c.prependTo(a.container_div);e.css({position:"relative",top:a.height_px+55+"px"});e.prependTo(a.container_div)})},get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;!
if(!c.data_queue[e]){c.data_queue[e]=true;$.getJSON(data_url,{indexer:
this.indexer,chrom:this.view.chrom,low:a,high:f,dataset_id:this.dataset_id,resolution:this.view.resolution,},function(g){c.data_cache.set(e,g);delete c.data_queue[e];c.draw()})}},draw_tile:function(n,p,c,e){if(this.vertical_range===undefined){return}var q=p*DENSITY*n,a=DENSITY*n,b=$("<canvas class='tile'></canvas>"),s=n+"_"+p;if(!this.data_cache.get(s)){this.get_data(n,p);return}var r=this.data_cache.get(s);b.css({position:"absolute",top:0,left:(q-this.view.low)*e});b.get(0).width=Math.ceil(a*e);b.get(0).height=this.height_px;var m=b.get(0).getContext("2d"),j=false,k=this.prefs.min_value,f=this.prefs.max_value,l=this.vertical_range,d=this.height_px;m.beginPath();for(var o=0;o<r.length-1;o++){var h=r[o][0]-q;var g=r[o][1];if(isNaN(g)){j=false}else{h=h*e;if(g<=k){g=k}else{if(g>=f){g=f}}g=Math.round(d-(g-k)/l*d);if(j){m.lineTo(h,g)}else{m.moveTo(h,g);j=true}}}m.stroke();c.append(b);return b},gen_options:function(j){var a=$("<div></div>").addClass("form-row");var e="track_"+j+"_!
minval",g="track_"+j+"_maxval",h=$("<label></label>").attr("for",e).text("Min value:"),b=(this.prefs.min_value===undefined?"":this.prefs.min_value),i=$("<input></input>").attr("id",e).val(b),d=$("<label></label>").attr("for",g).text("Max value:"),f=(this.prefs.max_value===undefined?"":this.prefs.max_value),c=$("<input></input>").attr("id",g).val(f);return a.append(h).append(i).append(d).append(c)},update_options:function(c){var a=$("#track_"+c+"_minval").val(),b=$("#track_"+c+"_maxval").val();if(a!==this.prefs.min_value||b!==this.prefs.max_value){this.prefs.min_value=parseFloat(a);this.prefs.max_value=parseFloat(b);this.vertical_range=this.prefs.max_value-this.prefs.min_value;$("#linetrack_"+c+"_minval").text(this.prefs.min_value);$("#linetrack_"+c+"_maxval").text(this.prefs.max_value);this.tile_cache.clear();this.draw()}}});var FeatureTrack=function(c,a,d,b){this.track_type="FeatureTrack";Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.indexer=d;this.height_px!
=100;this.container_div.addClass("feature-track");this.dataset_id=a;th
is.zo_slots={};this.show_labels_scale=0.001;this.showing_details=false;this.vertical_detail_px=10;this.vertical_nodetail_px=3;this.default_font="9px Monaco, Lucida Console, monospace";this.left_offset=200;this.inc_slots={};this.data_queue={};this.s_e_by_tile={};this.tile_cache=new Cache(CACHED_TILES_FEATURE);this.data_cache=new Cache(20);this.prefs={block_color:"black",label_color:"black"};if(b.block_color!==undefined){this.prefs.block_color=b.block_color}if(b.label_color!==undefined){this.prefs.label_color=b.label_color}};$.extend(FeatureTrack.prototype,TiledTrack.prototype,{init:function(){var a=this;this.init_each({indexer:a.indexer,low:a.view.max_low,high:a.view.max_high,dataset_id:a.dataset_id,chrom:a.view.chrom},function(b){a.values=b;a.calc_slots();a.slots=a.zo_slots})},get_data:function(a,d){var b=this,c=a+"_"+d;if(!b.data_queue[c]){b.data_queue[c]=true;$.getJSON(data_url,{indexer:b.indexer,chrom:b.view.chrom,low:a,high:d,dataset_id:b.dataset_id,include_blocks:true},!
function(e){b.data_cache.set(c,e);delete b.data_queue[c];b.draw()})}},calc_slots:function(){var b=[],a=this.content_div.width()/(this.view.high-this.view.low),d=this.view.max_low;for(var e=0,f=this.values.length;e<f;e++){var g,h,k=this.values[e];g=Math.floor((k.start-d)*a);h=Math.ceil((k.end-d)*a);var c=0;while(true){if(b[c]===undefined||b[c]<g){b[c]=h;this.zo_slots[k.uid]=c;break}c++}}this.height_px=b.length*this.vertical_nodetail_px+15;this.content_div.css("height",this.height_px+"px")},incremental_slots:function(a,f){if(!this.inc_slots[a]){this.inc_slots[a]={};this.inc_slots[a].w_scale=1/a;this.s_e_by_tile[a]={}}var h=this.inc_slots[a].w_scale,s=[],g=0,b=$("<canvas></canvas>").get(0).getContext("2d"),l=this.view.max_low;var c,e,u=[];for(var p=0,q=f.length;p<q;p++){var d=f[p];if(this.inc_slots[a][d.uid]!==undefined){g=Math.max(g,this.inc_slots[a][d.uid]);u.push(this.inc_slots[a][d.uid])}else{s.push(p)}}for(var p=0,q=s.length;p<q;p++){var d=f[s[p]];c=Math.floor((d.start-l)!
*h);c-=b.measureText(d.name).width;e=Math.ceil((d.end-l)*h);var o=0;wh
ile(true){var m=true;if(this.s_e_by_tile[a][o]!==undefined){for(var n=0,t=this.s_e_by_tile[a][o].length;n<t;n++){var r=this.s_e_by_tile[a][o][n];if(e>r[0]&&c<r[1]){m=false;break}}}if(m){if(this.s_e_by_tile[a][o]===undefined){this.s_e_by_tile[a][o]=[]}this.s_e_by_tile[a][o].push([c,e]);this.inc_slots[a][d.uid]=o;g=Math.max(g,o);break}o++}}return g},draw_tile:function(B,f,g,M){if(!this.values){return}var s=f*DENSITY*B,G=(f+1)*DENSITY*B,r=DENSITY*B;var K,L,m;if(M>this.show_labels_scale){if(!this.showing_details){this.showing_details=true}for(var H in this.data_cache.obj_cache){var C=H.split("_"),z=C[0],c=C[1];if(z<=s&&c>=G){K=this.data_cache.get(H);break}}if(!K){this.data_queue[[s,G]]=true;this.get_data(s,G);return}m=this.incremental_slots(this.view.zoom_res,K)*this.vertical_detail_px+15;L=this.inc_slots[this.view.zoom_res]}else{if(this.showing_details){this.showing_details=false}m=this.height_px;L=this.zo_slots;K=this.values}var a=Math.ceil(r*M),u=$("<canvas class='tile'></can!
vas>"),D=this.prefs.label_color,e=this.prefs.block_color,x=this.left_offset,N=this.showing_details,O=(this.showing_details?this.vertical_detail_px:this.vertical_nodetail_px);u.css({position:"absolute",top:0,left:(s-this.view.low)*M-x});u.get(0).width=a+x;u.get(0).height=m;var p=u.get(0).getContext("2d");p.fillStyle=this.prefs.block_color;p.font=this.default_font;p.textAlign="right";var I=0;for(var J=0,o=K.length;J<o;J++){var v=K[J];if(v.start<=G&&v.end>=s){var A=Math.floor(Math.max(0,(v.start-s)*M)),q=Math.ceil(Math.min(a,(v.end-s)*M)),y=L[v.uid]*O;var n,E,t=null,P=null;if(v.thick_start&&v.thick_end){t=Math.floor(Math.max(0,(v.thick_start-s)*M));P=Math.ceil(Math.min(a,(v.thick_end-s)*M))}if(!N){p.fillRect(A+x,y+5,q-A,1)}else{if(v.start>s){p.fillStyle=D;p.fillText(v.name,A-1+x,y+8);p.fillStyle=e}var Q=v.blocks;if(Q){if(v.strand){if(v.strand=="+"){p.fillStyle=RIGHT_STRAND}else{if(v.strand=="-"){p.fillStyle=LEFT_STRAND}}p.fillRect(A+x,y,q-A,10);p.fillStyle=e}for(var H=0,d=Q.le!
ngth;H<d;H++){var h=Q[H],b=Math.floor(Math.max(0,(h[0]-s)*M)),w=Math.c
eil(Math.min(a,(h[1]-s)*M));if(b>w){continue}n=5;E=3;p.fillRect(b+x,y+E,w-b,n);if(t!==undefined&&!(b>P||w<t)){n=9;E=1;var F=Math.max(b,t),l=Math.min(w,P);p.fillRect(F+x,y+E,l-F,n)}}}else{n=9;E=1;p.fillRect(A+x,y+E,q-A,n);if(v.strand){if(v.strand=="+"){p.fillStyle=RIGHT_STRAND_INV}else{if(v.strand=="-"){p.fillStyle=LEFT_STRAND_INV}}p.fillRect(A+x,y,q-A,10);p.fillStyle=prefs.block_color}}}I++}}g.append(u);return u},gen_options:function(g){var a=$("<div></div>").addClass("form-row");var d="track_"+g+"_block_color",c=$("<label></label>").attr("for",d).text("Block color:"),b=$("<input></input>").attr("id",d).attr("name",d).val(this.prefs.block_color),f="track_"+g+"_label_color",h=$("<label></label>").attr("for",f).text("Label color:"),e=$("<input></input>").attr("id",f).attr("name",f).val(this.prefs.label_color);return a.append(c).append(b).append(h).append(e)},update_options:function(c){var a=$("#track_"+c+"_block_color").val(),b=$("#track_"+c+"_label_color").val();if(a!==this.p!
refs.block_color||b!==this.prefs.label_color){this.prefs.block_color=a;this.prefs.label_color=b;this.tile_cache.clear();this.draw()}}});var ReadTrack=function(c,a,d,b){this.track_type="ReadTrack";this.tile_cache=new Cache(CACHED_TILES_FEATURE);Track.call(this,c,$("#viewport"));TiledTrack.call(this);FeatureTrack.call(this,c,a,d,b)};$.extend(ReadTrack.prototype,TiledTrack.prototype,FeatureTrack.prototype,{draw_tile:function(v,z,m,n){if(!this.values){return}var A=z*DENSITY*v,e=(z+1)*DENSITY*v,q=DENSITY*v;var D,p,h;h=this.height_px;p=this.zo_slots;D=this.values;var t=Math.ceil(q*n),r=$("<canvas class='tile'></canvas>");r.css({position:"absolute",top:0,left:(A-this.view.low)*n-this.left_offset});r.get(0).width=t+this.left_offset;r.get(0).height=h;var u=r.get(0).getContext("2d");u.fillStyle=this.prefs.block_color;u.font=this.default_font;u.textAlign="right";var s=u.measureText("A").width;var w=0;for(var x=0,y=D.length;x<y;x++){var l=D[x];if(l.start<=e&&l.end>=A){var g=Math.floor(!
Math.max(0,(l.start-A)*n)),k=Math.ceil(Math.min(t,(l.end-A)*n)),f=p[l.
uid]*this.vertical_detail_px;var a,E,d=null,o=null;if(n>s){for(var B=0,b=l.name.length;B<b;B++){var C=Math.floor(Math.max(0,(l.start+B-A)*n));u.fillText(l.name[B],C+this.left_offset,f+8)}}else{u.fillRect(g+this.left_offset,f+4,k-g,3)}}}m.append(r);return r}});
\ No newline at end of file
+var DEBUG=false;var DENSITY=1000,FEATURE_LEVELS=10,DATA_ERROR="There was an error in indexing this dataset.",DATA_NOCONVERTER="A converter for this dataset is not installed. Please check your datatypes_conf.xml file.",DATA_NONE="No data for this chrom/contig.",DATA_PENDING="Currently indexing... please wait",DATA_LOADING="Loading data...",CACHED_TILES_FEATURE=10,CACHED_TILES_LINE=30,CACHED_DATA=20,CONTEXT=$("<canvas></canvas>").get(0).getContext("2d"),RIGHT_STRAND,LEFT_STRAND;var right_img=new Image();right_img.src="../images/visualization/strand_right.png";right_img.onload=function(){RIGHT_STRAND=CONTEXT.createPattern(right_img,"repeat")};var left_img=new Image();left_img.src="../images/visualization/strand_left.png";left_img.onload=function(){LEFT_STRAND=CONTEXT.createPattern(left_img,"repeat")};var right_img_inv=new Image();right_img_inv.src="../images/visualization/strand_right_inv.png";right_img_inv.onload=function(){RIGHT_STRAND_INV=CONTEXT.createPattern(right_img_inv!
,"repeat")};var left_img_inv=new Image();left_img_inv.src="../images/visualization/strand_left_inv.png";left_img_inv.onload=function(){LEFT_STRAND_INV=CONTEXT.createPattern(left_img_inv,"repeat")};function commatize(b){b+="";var a=/(\d+)(\d{3})/;while(a.test(b)){b=b.replace(a,"$1,$2")}return b}var Cache=function(a){this.num_elements=a;this.clear()};$.extend(Cache.prototype,{get:function(b){var a=this.key_ary.indexOf(b);if(a!=-1){this.key_ary.splice(a,1);this.key_ary.push(b)}return this.obj_cache[b]},set:function(b,c){if(!this.obj_cache[b]){if(this.key_ary.length>=this.num_elements){var a=this.key_ary.shift();delete this.obj_cache[a]}this.key_ary.push(b)}this.obj_cache[b]=c;return c},clear:function(){this.obj_cache={};this.key_ary=[]}});var Drawer=function(){};$.extend(Drawer.prototype,{intensity:function(b,a,c){},});drawer=new Drawer();var View=function(b,d,c,a){this.vis_id=c;this.dbkey=a;this.title=d;this.chrom=b;this.tracks=[];this.label_tracks=[];this.max_low=0;this.max_!
high=0;this.center=(this.max_high-this.max_low)/2;this.zoom_factor=3;t
his.zoom_level=0;this.track_id_counter=0};$.extend(View.prototype,{add_track:function(a){a.view=this;a.track_id=this.track_id_counter;this.tracks.push(a);if(a.init){a.init()}a.container_div.attr("id","track_"+a.track_id);this.track_id_counter+=1},add_label_track:function(a){a.view=this;this.label_tracks.push(a)},remove_track:function(a){a.container_div.fadeOut("slow",function(){$(this).remove()});delete this.tracks[a]},update_options:function(){var b=$("ul#sortable-ul").sortable("toArray");var d=[];var c=$("#viewport > div").sort(function(g,f){return b.indexOf($(g).attr("id"))>b.indexOf($(f).attr("id"))});$("#viewport > div").remove();$("#viewport").html(c);for(var e in view.tracks){var a=view.tracks[e];if(a.update_options){a.update_options(e)}}},reset:function(){this.low=this.max_low;this.high=this.max_high;this.center=this.center=(this.max_high-this.max_low)/2;this.zoom_level=0;$(".yaxislabel").remove()},redraw:function(f){this.span=this.max_high-this.max_low;var d=this.sp!
an/Math.pow(this.zoom_factor,this.zoom_level),b=this.center-(d/2),e=b+d;if(b<0){b=0;e=b+d}else{if(e>this.max_high){e=this.max_high;b=e-d}}this.low=Math.floor(b);this.high=Math.ceil(e);this.center=Math.round(this.low+(this.high-this.low)/2);this.resolution=Math.pow(10,Math.ceil(Math.log((this.high-this.low)/200)/Math.LN10));this.zoom_res=Math.pow(FEATURE_LEVELS,Math.max(0,Math.ceil(Math.log(this.resolution,FEATURE_LEVELS)/Math.log(FEATURE_LEVELS))));$("#overview-box").css({left:(this.low/this.span)*$("#overview-viewport").width(),width:Math.max(12,((this.high-this.low)/this.span)*$("#overview-viewport").width())}).show();$("#low").val(commatize(this.low));$("#high").val(commatize(this.high));if(!f){for(var c=0,a=this.tracks.length;c<a;c++){if(this.tracks[c].enabled){this.tracks[c].draw()}}for(var c=0,a=this.label_tracks.length;c<a;c++){this.label_tracks[c].draw()}}},zoom_in:function(a,b){if(this.max_high===0||this.high-this.low<30){return}if(a){this.center=a/b.width()*(this.!
high-this.low)+this.low}this.zoom_level+=1;this.redraw()},zoom_out:fun
ction(){if(this.max_high===0){return}if(this.zoom_level<=0){this.zoom_level=0;return}this.zoom_level-=1;this.redraw()}});var Track=function(a,b){this.name=a;this.parent_element=b;this.init_global()};$.extend(Track.prototype,{init_global:function(){this.header_div=$("<div class='track-header'>").text(this.name);this.content_div=$("<div class='track-content'>");this.container_div=$("<div></div>").addClass("track").append(this.header_div).append(this.content_div);this.parent_element.append(this.container_div)},init_each:function(c,b){var a=this;a.enabled=false;a.data_queue={};a.tile_cache.clear();a.data_cache.clear();a.content_div.css("height","30px");a.content_div.text(DATA_LOADING);a.container_div.removeClass("nodata error pending");if(a.view.chrom){$.getJSON(data_url,c,function(d){if(!d||d==="error"){a.container_div.addClass("error");a.content_div.text(DATA_ERROR)}else{if(d==="no converter"){a.container_div.addClass("error");a.content_div.text(DATA_NOCONVERTER)}else{if((d.da!
ta&&d.data.length===0)||d==="no data"){a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}else{if(d==="pending"){a.container_div.addClass("pending");a.content_div.text(DATA_PENDING);setTimeout(function(){a.init()},5000)}else{a.content_div.text("");a.content_div.css("height",a.height_px+"px");a.enabled=true;b(d);a.draw()}}}}})}else{a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}}});var TiledTrack=function(){};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(){var i=this.view.low,e=this.view.high,f=e-i,d=this.view.resolution;if(DEBUG){$("#debug").text(d+" "+this.view.zoom_res)}var k=$("<div style='position: relative;'></div>");this.content_div.children(":first").remove();this.content_div.append(k);var l=this.content_div.width()/f;var h;var a=Math.floor(i/d/DENSITY);while((a*DENSITY*d)<e){var j=this.content_div.width()+"_"+this.view.zoom_level+"_"+a;var c=this.tile_cache.get(j);if(c){var g=a*DENSITY*d;var b=(g-i)*l;if(this.left_offse!
t){b-=this.left_offset}c.css({left:b});k.append(c);this.max_height=Mat
h.max(this.max_height,c.height())}else{this.delayed_draw(this,j,i,e,a,d,k,l)}a+=1}},delayed_draw:function(c,e,a,f,b,d,g,h){setTimeout(function(){if(!(a>c.view.high||f<c.view.low)){tile_element=c.draw_tile(d,b,g,h);if(tile_element){c.tile_cache.set(e,tile_element);c.max_height=Math.max(c.max_height,tile_element.height());c.content_div.css("height",c.max_height+"px")}}},50)}});var LabelTrack=function(a){Track.call(this,null,a);this.track_type="LabelTrack";this.hidden=true;this.container_div.addClass("label-track")};$.extend(LabelTrack.prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div style='position: relative; height: 1.3em;'></div>");while(a<c.high){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+commatize(a)+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.app!
end(b)}});var LineTrack=function(c,a,b){this.track_type="LineTrack";Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.height_px=100;this.container_div.addClass("line-track");this.dataset_id=a;this.data_cache=new Cache(CACHED_DATA);this.tile_cache=new Cache(CACHED_TILES_LINE);this.prefs={min_value:undefined,max_value:undefined,mode:"line"};if(b.min_value!==undefined){this.prefs.min_value=b.min_value}if(b.max_value!==undefined){this.prefs.max_value=b.max_value}if(b.max_value!==undefined){this.prefs.mode=b.mode}};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:function(){var a=this,b=a.view.tracks.indexOf(a);a.vertical_range=undefined;this.init_each({stats:true,chrom:a.view.chrom,low:null,high:null,dataset_id:a.dataset_id},function(c){data=c.data;if(isNaN(parseFloat(a.prefs.min_value))||isNaN(parseFloat(a.prefs.max_value))){a.prefs.min_value=data.min;a.prefs.max_value=data.max;$("#track_"+b+"_minval").val(a.prefs.min_value);$("#track_"+b+"_maxval").val(a.pre!
fs.max_value)}a.vertical_range=a.prefs.max_value-a.prefs.min_value;a.t
otal_frequency=data.total_frequency;$("#linetrack_"+b+"_minval").remove();$("#linetrack_"+b+"_maxval").remove();var e=$("<div></div>").addClass("yaxislabel").attr("id","linetrack_"+b+"_minval").text(a.prefs.min_value);var d=$("<div></div>").addClass("yaxislabel").attr("id","linetrack_"+b+"_maxval").text(a.prefs.max_value);d.css({position:"relative",top:"25px"});d.prependTo(a.container_div);e.css({position:"relative",top:a.height_px+55+"px"});e.prependTo(a.container_div)})},get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;if(!c.data_queue[e]){c.data_queue[e]=true;$.ajax({url:data_url,dataType:"json",data:{chrom:this.view.chrom,low:a,high:f,dataset_id:this.dataset_id,resolution:this.view.resolution},success:function(g){data=g.data;c.data_cache.set(e,data);delete c.data_queue[e];c.draw()},error:function(h,g,i){console.log(h,g,i)}})}},draw_tile:function(o,q,c,e){if(this.vertical_range===undefined){return}var r=q*DENSITY*o,a=DENSITY*o,b=$("<canvas class!
='tile'></canvas>"),u=o+"_"+q;if(!this.data_cache.get(u)){this.get_data(o,q);return}var t=this.data_cache.get(u);b.css({position:"absolute",top:0,left:(r-this.view.low)*e});b.get(0).width=Math.ceil(a*e);b.get(0).height=this.height_px;var n=b.get(0).getContext("2d"),k=false,l=this.prefs.min_value,g=this.prefs.max_value,m=this.vertical_range,s=this.total_frequency,d=this.height_px;n.beginPath();if(t.length>1){var f=Math.ceil((t[1][0]-t[0][0])*e)}else{var f=10}for(var p=0;p<t.length;p++){var j=t[p][0]-r;var h=t[p][1];if(this.prefs.mode=="intensity"){if(h===null){continue}j=j*e;if(h<=l){h=l}else{if(h>=g){h=g}}h=255-Math.floor((h-l)/m*255);n.fillStyle="rgb("+h+","+h+","+h+")";n.fillRect(j,0,f,30)}else{if(h===null){k=false;continue}else{j=j*e;if(h<=l){h=l}else{if(h>=g){h=g}}h=Math.round(d-(h-l)/m*d);if(k){n.lineTo(j,h)}else{n.moveTo(j,h);k=true}}}}n.stroke();c.append(b);return b},gen_options:function(n){var a=$("<div></div>").addClass("form-row");var h="track_"+n+"_minval",k="tra!
ck_"+n+"_maxval",e="track_"+n+"_mode",l=$("<label></label>").attr("for
",h).text("Min value:"),b=(this.prefs.min_value===undefined?"":this.prefs.min_value),m=$("<input></input>").attr("id",h).val(b),g=$("<label></label>").attr("for",k).text("Max value:"),j=(this.prefs.max_value===undefined?"":this.prefs.max_value),f=$("<input></input>").attr("id",k).val(j),d=$("<label></label>").attr("for",e).text("Display mode:"),i=(this.prefs.mode===undefined?"line":this.prefs.mode),c=$('<select id="'+e+'"><option value="line" id="mode_line">Line</option><option value="intensity" id="mode_intensity">Intensity</option></select>');$("#"+e+" #mode_"+i).attr("selected","selected");return a.append(l).append(m).append(g).append(f).append(d).append(c)},update_options:function(d){var a=$("#track_"+d+"_minval").val(),c=$("#track_"+d+"_maxval").val(),b=$("#track_"+d+"_mode option:selected").val();if(a!==this.prefs.min_value||c!==this.prefs.max_value||b!=this.prefs.mode){this.prefs.min_value=parseFloat(a);this.prefs.max_value=parseFloat(c);this.prefs.mode=b;this.vertica!
l_range=this.prefs.max_value-this.prefs.min_value;$("#linetrack_"+d+"_minval").text(this.prefs.min_value);$("#linetrack_"+d+"_maxval").text(this.prefs.max_value);this.tile_cache.clear();this.draw()}}});var FeatureTrack=function(c,a,b){this.track_type="FeatureTrack";Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.height_px=100;this.container_div.addClass("feature-track");this.dataset_id=a;this.zo_slots={};this.show_labels_scale=0.001;this.showing_details=false;this.vertical_detail_px=10;this.vertical_nodetail_px=3;this.default_font="9px Monaco, Lucida Console, monospace";this.left_offset=200;this.inc_slots={};this.data_queue={};this.s_e_by_tile={};this.tile_cache=new Cache(CACHED_TILES_FEATURE);this.data_cache=new Cache(20);this.prefs={block_color:"black",label_color:"black",show_counts:true};if(b.block_color!==undefined){this.prefs.block_color=b.block_color}if(b.label_color!==undefined){this.prefs.label_color=b.label_color}if(b.show_counts!==undefined){this.pre!
fs.show_counts=b.show_counts}};$.extend(FeatureTrack.prototype,TiledTr
ack.prototype,{init:function(){var a=this,b=a.view.max_low+"_"+a.view.max_high;this.init_each({low:a.view.max_low,high:a.view.max_high,dataset_id:a.dataset_id,chrom:a.view.chrom,resolution:this.view.resolution},function(c){a.data_cache.set(b,c);a.draw()})},get_data:function(a,d){var b=this,c=a+"_"+d;if(!b.data_queue[c]){b.data_queue[c]=true;$.getJSON(data_url,{chrom:b.view.chrom,low:a,high:d,dataset_id:b.dataset_id,resolution:this.view.resolution},function(e){b.data_cache.set(c,e);delete b.data_queue[c];b.draw()})}},incremental_slots:function(a,g,c){if(!this.inc_slots[a]){this.inc_slots[a]={};this.inc_slots[a].w_scale=1/a;this.s_e_by_tile[a]={}}var m=this.inc_slots[a].w_scale,u=[],h=0,b=$("<canvas></canvas>").get(0).getContext("2d"),n=this.view.max_low;var d,f,w=[];for(var r=0,s=g.length;r<s;r++){var e=g[r],l=e[0];if(this.inc_slots[a][l]!==undefined){h=Math.max(h,this.inc_slots[a][l]);w.push(this.inc_slots[a][l])}else{u.push(r)}}for(var r=0,s=u.length;r<s;r++){var e=g[u[r]];!
l=e[0],feature_start=e[1],feature_end=e[2],feature_name=e[3];d=Math.floor((feature_start-n)*m);if(!c){d-=b.measureText(feature_name).width}f=Math.ceil((feature_end-n)*m);var q=0;while(true){var o=true;if(this.s_e_by_tile[a][q]!==undefined){for(var p=0,v=this.s_e_by_tile[a][q].length;p<v;p++){var t=this.s_e_by_tile[a][q][p];if(f>t[0]&&d<t[1]){o=false;break}}}if(o){if(this.s_e_by_tile[a][q]===undefined){this.s_e_by_tile[a][q]=[]}this.s_e_by_tile[a][q].push([d,f]);this.inc_slots[a][l]=q;h=Math.max(h,q);break}q++}}return h},draw_tile:function(R,h,m,ae){var z=h*DENSITY*R,X=(h+1)*DENSITY*R,w=DENSITY*R;var ac,ad,p;var Y=z+"_"+X;var ac=this.data_cache.get(Y);if(!ac){this.data_queue[[z,X]]=true;this.get_data(z,X);return}if(ac.dataset_type=="array_tree"){p=30}else{var P=(ac.extra_info==="no_detail");var af=(P?this.vertical_nodetail_px:this.vertical_detail_px);p=this.incremental_slots(this.view.zoom_res,ac.data,P)*af+15;m.parent().css("height",Math.max(this.height_px,p)+"px");ad=this.!
inc_slots[this.view.zoom_res]}var a=Math.ceil(w*ae),F=$("<canvas class
='tile'></canvas>"),T=this.prefs.label_color,f=this.prefs.block_color,J=this.left_offset;F.css({position:"absolute",top:0,left:(z-this.view.low)*ae-J});F.get(0).width=a+J;F.get(0).height=p;var t=F.get(0).getContext("2d");t.fillStyle=this.prefs.block_color;t.font=this.default_font;t.textAlign="right";var C=55,W=255-C,g=W*2/3;if(ac.dataset_type=="summary_tree"){var L=ac.data;var v=ac.max;var l=ac.avg;if(ac.data.length>2){var b=Math.ceil((L[1][0]-L[0][0])*ae)}else{var b=50}for(var aa=0,s=L.length;aa<s;aa++){var N=Math.ceil((L[aa][0]-z)*ae);var M=L[aa][1];if(!M){continue}var E=Math.floor(W-(M/v)*W);t.fillStyle="rgb("+E+","+E+","+E+")";t.fillRect(N+J,0,b,20);if(this.prefs.show_counts){if(E>g){t.fillStyle="black"}else{t.fillStyle="#ddd"}t.textAlign="center";t.fillText(L[aa][1],N+J+(b/2),12)}}m.append(F);return F}var ac=ac.data;var Z=0;for(var aa=0,s=ac.length;aa<s;aa++){var G=ac[aa],D=G[0],ab=G[1],O=G[2],A=G[3];if(ab<=X&&O>=z){var Q=Math.floor(Math.max(0,(ab-z)*ae)),u=Math.ceil(Ma!
th.min(a,(O-z)*ae)),K=ad[D]*af;if(P){t.fillRect(Q+J,K+5,u-Q,1)}else{var r=G[4],I=G[5],S=G[6],e=G[7];var q,U,B=null,ag=null;if(I&&S){B=Math.floor(Math.max(0,(I-z)*ae));ag=Math.ceil(Math.min(a,(S-z)*ae))}if(ab>z){t.fillStyle=T;t.fillText(A,Q-1+J,K+8);t.fillStyle=f}if(e){if(r){if(r=="+"){t.fillStyle=RIGHT_STRAND}else{if(r=="-"){t.fillStyle=LEFT_STRAND}}t.fillRect(Q+J,K,u-Q,10);t.fillStyle=f}for(var Y=0,d=e.length;Y<d;Y++){var n=e[Y],c=Math.floor(Math.max(0,(n[0]-z)*ae)),H=Math.ceil(Math.min(a,(n[1]-z)*ae));if(c>H){continue}q=5;U=3;t.fillRect(c+J,K+U,H-c,q);if(B!==undefined&&!(c>ag||H<B)){q=9;U=1;var V=Math.max(c,B),o=Math.min(H,ag);t.fillRect(V+J,K+U,o-V,q)}}}else{q=9;U=1;t.fillRect(Q+J,K+U,u-Q,q);if(G.strand){if(G.strand=="+"){t.fillStyle=RIGHT_STRAND_INV}else{if(G.strand=="-"){t.fillStyle=LEFT_STRAND_INV}}t.fillRect(Q+J,K,u-Q,10);t.fillStyle=prefs.block_color}}}Z++}}m.append(F);return F},gen_options:function(h){var a=$("<div></div>").addClass("form-row");var d="track_"+h+"_b!
lock_color",j=$("<label></label>").attr("for",d).text("Block color:"),
k=$("<input></input>").attr("id",d).attr("name",d).val(this.prefs.block_color),i="track_"+h+"_label_color",f=$("<label></label>").attr("for",i).text("Text color:"),g=$("<input></input>").attr("id",i).attr("name",i).val(this.prefs.label_color),e="track_"+h+"_show_count",c=$("<label></label>").attr("for",e).text("Show summary counts"),b=$('<input type="checkbox" style="float:left;"></input>').attr("id",e).attr("name",e).attr("checked",this.prefs.show_counts);return a.append(j).append(k).append(f).append(g).append(b).append(c)},update_options:function(d){var b=$("#track_"+d+"_block_color").val(),c=$("#track_"+d+"_label_color").val(),a=$("#track_"+d+"_show_count").attr("checked");if(b!==this.prefs.block_color||c!==this.prefs.label_color||a!=this.prefs.show_counts){this.prefs.block_color=b;this.prefs.label_color=c;this.prefs.show_counts=a;this.tile_cache.clear();this.draw()}}});var ReadTrack=function(c,a,b){this.track_type="ReadTrack";this.tile_cache=new Cache(CACHED_TILES_FEATUR!
E);Track.call(this,c,$("#viewport"));TiledTrack.call(this);FeatureTrack.call(this,c,a,b)};$.extend(ReadTrack.prototype,TiledTrack.prototype,FeatureTrack.prototype,{draw_tile:function(v,z,m,n){if(!this.values){return}var A=z*DENSITY*v,e=(z+1)*DENSITY*v,q=DENSITY*v;var D,p,h;h=this.height_px;p=this.zo_slots;D=this.values;var t=Math.ceil(q*n),r=$("<canvas class='tile'></canvas>");r.css({position:"absolute",top:0,left:(A-this.view.low)*n-this.left_offset});r.get(0).width=t+this.left_offset;r.get(0).height=h;var u=r.get(0).getContext("2d");u.fillStyle=this.prefs.block_color;u.font=this.default_font;u.textAlign="right";var s=u.measureText("A").width;var w=0;for(var x=0,y=D.length;x<y;x++){var l=D[x];if(l.start<=e&&l.end>=A){var g=Math.floor(Math.max(0,(l.start-A)*n)),k=Math.ceil(Math.min(t,(l.end-A)*n)),f=p[l.uid]*this.vertical_detail_px;var a,E,d=null,o=null;if(n>s){for(var B=0,b=l.name.length;B<b;B++){var C=Math.floor(Math.max(0,(l.start+B-A)*n));u.fillText(l.name[B],C+this.lef!
t_offset,f+8)}}else{u.fillRect(g+this.left_offset,f+4,k-g,3)}}}m.appen
d(r);return r}});
\ No newline at end of file
diff -r 44f2713a7279 -r 0890f7bf9d49 static/scripts/trackster.js
--- a/static/scripts/trackster.js Wed Mar 24 15:13:57 2010 -0400
+++ b/static/scripts/trackster.js Thu Mar 25 15:21:57 2010 -0400
@@ -163,7 +163,7 @@
this.center = Math.round( this.low + (this.high - this.low) / 2 );
// 10^log10(range / DENSITY) Close approximation for browser window, assuming DENSITY = window width
- this.resolution = Math.pow( 10, Math.ceil( Math.log( (this.high - this.low) / DENSITY ) / Math.LN10 ) );
+ this.resolution = Math.pow( 10, Math.ceil( Math.log( (this.high - this.low) / 200 ) / Math.LN10 ) );
this.zoom_res = Math.pow( FEATURE_LEVELS, Math.max(0,Math.ceil( Math.log( this.resolution, FEATURE_LEVELS ) / Math.log(FEATURE_LEVELS) )));
// Overview
@@ -355,9 +355,10 @@
this.dataset_id = dataset_id;
this.data_cache = new Cache(CACHED_DATA);
this.tile_cache = new Cache(CACHED_TILES_LINE);
- this.prefs = { 'min_value': undefined, 'max_value': undefined };
+ this.prefs = { 'min_value': undefined, 'max_value': undefined, 'mode': 'line' };
if (prefs.min_value !== undefined) { this.prefs.min_value = prefs.min_value; }
if (prefs.max_value !== undefined) { this.prefs.max_value = prefs.max_value; }
+ if (prefs.max_value !== undefined) { this.prefs.mode = prefs.mode; }
};
$.extend( LineTrack.prototype, TiledTrack.prototype, {
init: function() {
@@ -457,14 +458,17 @@
ctx.beginPath();
// for intensity, calculate delta x in pixels to for width of box
- var delta_x_px = Math.ceil((data[1][0] - data[0][0]) * w_scale);
- var mode = "line";
+ if (data.length > 1) {
+ var delta_x_px = Math.ceil((data[1][0] - data[0][0]) * w_scale);
+ } else {
+ var delta_x_px = 10;
+ }
for ( var i = 0; i < data.length; i++ ) {
var x = data[i][0] - tile_low;
var y = data[i][1];
- if ( mode == "intensity" ) {
+ if ( this.prefs.mode == "intensity" ) {
// DRAW INTENSITY
if (y === null) {
continue;
@@ -475,7 +479,7 @@
} else if (y >= max_value) {
y = max_value;
}
- y = Math.floor( (y - min_value) / vertical_range * 255 );
+ y = 255 - Math.floor( (y - min_value) / vertical_range * 255 );
ctx.fillStyle = "rgb(" +y+ "," +y+ "," +y+ ")";
ctx.fillRect(x, 0, delta_x_px, 30);
}
@@ -512,20 +516,27 @@
var minval = 'track_' + track_id + '_minval',
maxval = 'track_' + track_id + '_maxval',
+ mode = 'track_' + track_id + '_mode',
min_label = $('<label></label>').attr("for", minval).text("Min value:"),
min_val = (this.prefs.min_value === undefined ? "" : this.prefs.min_value),
min_input = $('<input></input>').attr("id", minval).val(min_val),
max_label = $('<label></label>').attr("for", maxval).text("Max value:"),
max_val = (this.prefs.max_value === undefined ? "" : this.prefs.max_value),
- max_input = $('<input></input>').attr("id", maxval).val(max_val);
+ max_input = $('<input></input>').attr("id", maxval).val(max_val),
+ mode_label = $('<label></label>').attr("for", mode).text("Display mode:"),
+ mode_val = (this.prefs.mode === undefined ? "line" : this.prefs.mode),
+ mode_input = $('<select id="' +mode+ '"><option value="line" id="mode_line">Line</option><option value="intensity" id="mode_intensity">Intensity</option></select>');
+ $("#" + mode + " #mode_"+mode_val).attr('selected', 'selected');
- return container.append(min_label).append(min_input).append(max_label).append(max_input);
+ return container.append(min_label).append(min_input).append(max_label).append(max_input).append(mode_label).append(mode_input);
}, update_options: function(track_id) {
var min_value = $('#track_' + track_id + '_minval').val(),
- max_value = $('#track_' + track_id + '_maxval').val();
- if ( min_value !== this.prefs.min_value || max_value !== this.prefs.max_value) {
+ max_value = $('#track_' + track_id + '_maxval').val(),
+ mode = $('#track_' + track_id + '_mode option:selected').val();
+ if ( min_value !== this.prefs.min_value || max_value !== this.prefs.max_value || mode != this.prefs.mode ) {
this.prefs.min_value = parseFloat(min_value);
this.prefs.max_value = parseFloat(max_value);
+ this.prefs.mode = mode;
this.vertical_range = this.prefs.max_value - this.prefs.min_value;
// Update the y-axis
$('#linetrack_' + track_id + '_minval').text(this.prefs.min_value);
@@ -557,9 +568,10 @@
this.tile_cache = new Cache(CACHED_TILES_FEATURE);
this.data_cache = new Cache(20);
- this.prefs = { 'block_color': 'black', 'label_color': 'black' };
+ this.prefs = { 'block_color': 'black', 'label_color': 'black', 'show_counts': true };
if (prefs.block_color !== undefined) { this.prefs.block_color = prefs.block_color; }
if (prefs.label_color !== undefined) { this.prefs.label_color = prefs.label_color; }
+ if (prefs.show_counts !== undefined) { this.prefs.show_counts = prefs.show_counts; }
};
$.extend( FeatureTrack.prototype, TiledTrack.prototype, {
@@ -584,7 +596,7 @@
track.data_queue[key] = true;
$.getJSON( data_url, { chrom: track.view.chrom,
low: low, high: high, dataset_id: track.dataset_id,
- include_blocks: true, resolution: this.view.resolution }, function (result) {
+ resolution: this.view.resolution }, function (result) {
track.data_cache.set(key, result);
// console.log("datacache", track.data_cache.get(key));
delete track.data_queue[key];
@@ -592,31 +604,7 @@
});
}
},
- calc_slots: function() {
- var end_ary = [],
- scale = this.content_div.width() / (this.view.high - this.view.low),
- max_low = this.view.max_low;
- // console.log(scale, this.view.high, this.view.low);
- for (var i = 0, len = this.values.length; i < len; i++) {
- var f_start, f_end, feature = this.values[i];
- f_start = Math.floor( (feature.start - max_low) * scale );
- f_end = Math.ceil( (feature.end - max_low) * scale );
-
- // if (include_labels) { console.log(f_start, f_end); }
- var j = 0;
- while (true) {
- if (end_ary[j] === undefined || end_ary[j] < f_start) {
- end_ary[j] = f_end;
- this.zo_slots[feature.uid] = j;
- break;
- }
- j++;
- }
- }
- this.height_px = end_ary.length * this.vertical_nodetail_px + 15;
- this.content_div.css( "height", this.height_px + "px" );
- },
- incremental_slots: function( level, features ) {
+ incremental_slots: function( level, features, no_detail ) {
if (!this.inc_slots[level]) {
this.inc_slots[level] = {};
this.inc_slots[level].w_scale = 1 / level;
@@ -636,10 +624,11 @@
// If feature already exists in slots (from previously seen tiles), use the same slot,
// otherwise if not seen, add to "undone" list for slot calculation
for (var i = 0, len = features.length; i < len; i++) {
- var feature = features[i];
- if (this.inc_slots[level][feature.uid] !== undefined) {
- highest_slot = Math.max(highest_slot, this.inc_slots[level][feature.uid]);
- slotted.push(this.inc_slots[level][feature.uid]);
+ var feature = features[i],
+ feature_uid = feature[0];
+ if (this.inc_slots[level][feature_uid] !== undefined) {
+ highest_slot = Math.max(highest_slot, this.inc_slots[level][feature_uid]);
+ slotted.push(this.inc_slots[level][feature_uid]);
} else {
undone.push(i);
}
@@ -648,9 +637,15 @@
// console.log("Slotted: ", features.length - undone.length, "/", features.length, slotted);
for (var i = 0, len = undone.length; i < len; i++) {
var feature = features[undone[i]];
- f_start = Math.floor( (feature.start - max_low) * w_scale );
- f_start -= dummy_canvas.measureText(feature.name).width;
- f_end = Math.ceil( (feature.end - max_low) * w_scale );
+ feature_uid = feature[0],
+ feature_start = feature[1],
+ feature_end = feature[2],
+ feature_name = feature[3];
+ f_start = Math.floor( (feature_start - max_low) * w_scale );
+ if (!no_detail) {
+ f_start -= dummy_canvas.measureText(feature_name).width;
+ }
+ f_end = Math.ceil( (feature_end - max_low) * w_scale );
var j = 0;
// Try to fit the feature to the first slot that doesn't overlap any other features in that slot
@@ -668,7 +663,7 @@
if (found) {
if (this.s_e_by_tile[level][j] === undefined) { this.s_e_by_tile[level][j] = []; }
this.s_e_by_tile[level][j].push([f_start, f_end]);
- this.inc_slots[level][feature.uid] = j;
+ this.inc_slots[level][feature_uid] = j;
highest_slot = Math.max(highest_slot, j);
break;
}
@@ -707,9 +702,12 @@
required_height = 30;
// Blah
} else {
- // Calculate new slots incrementally for this new chunk of data and update height if necessary
- required_height = this.incremental_slots( this.view.zoom_res, data.data ) * this.vertical_detail_px + 15;
- // console.log(required_height);
+ // Calculate new slots incrementally for this new chunk of data and update height if necessary
+ var no_detail = (data.extra_info === "no_detail");
+
+ var y_scale = ( no_detail ? this.vertical_nodetail_px : this.vertical_detail_px );
+ required_height = this.incremental_slots( this.view.zoom_res, data.data, no_detail ) * y_scale + 15;
+ parent_element.parent().css("height", Math.max(this.height_px, required_height) + "px");
slots = this.inc_slots[this.view.zoom_res];
}
@@ -718,9 +716,7 @@
new_canvas = $("<canvas class='tile'></canvas>"),
label_color = this.prefs.label_color,
block_color = this.prefs.block_color,
- left_offset = this.left_offset,
- // showing_details = this.showing_details,
- y_scale = this.vertical_detail_px;
+ left_offset = this.left_offset;
new_canvas.css({
position: "absolute",
@@ -734,24 +730,39 @@
ctx.fillStyle = this.prefs.block_color;
ctx.font = this.default_font;
ctx.textAlign = "right";
- var min_color = 150;
+ var min_color = 55,
+ color_span = 255 - min_color,
+ color_cutoff = color_span*2/3; // Where text switches from black to white
+
- if (data.dataset_type == "array_tree") {
+ if (data.dataset_type == "summary_tree") {
var points = data.data;
- var sums = data.sums;
- var avg_f = data.avg_f;
- var delta_x_px = Math.ceil((points[1][0] - points[0][0]) * w_scale);
-
+ var max = data.max;
+ var avg = data.avg;
+ if (data.data.length > 2) {
+ var delta_x_px = Math.ceil((points[1][0] - points[0][0]) * w_scale);
+ } else {
+ var delta_x_px = 50; // Arbitrary, fix
+ }
+
for ( var i = 0, len = points.length; i < len; i++ ) {
var x = Math.ceil( (points[i][0] - tile_low) * w_scale );
var y = points[i][1];
-
- if (!y) {
- continue;
+
+ if (!y) { continue; }
+ var color = Math.floor( color_span - (y / max) * color_span );
+ ctx.fillStyle = "rgb(" +color+ "," +color+ "," +color+ ")";
+ ctx.fillRect(x + left_offset, 0, delta_x_px, 20);
+
+ if (this.prefs.show_counts) {
+ if (color > color_cutoff) {
+ ctx.fillStyle = "black";
+ } else {
+ ctx.fillStyle = "#ddd";
+ }
+ ctx.textAlign = "center";
+ ctx.fillText(points[i][1], x + left_offset + (delta_x_px/2), 12);
}
- y = Math.floor( min_color + (y - avg_f)/sums * min_color );
- ctx.fillStyle = "rgb(" +y+ "," +y+ "," +y+ ")";
- ctx.fillRect(x + left_offset, 0, delta_x_px, 20);
}
parent_element.append( new_canvas );
return new_canvas;
@@ -760,42 +771,51 @@
var data = data.data;
var j = 0;
for (var i = 0, len = data.length; i < len; i++) {
- var feature = data[i];
- if (feature.start <= tile_high && feature.end >= tile_low) {
- var f_start = Math.floor( Math.max(0, (feature.start - tile_low) * w_scale) ),
- f_end = Math.ceil( Math.min(width, (feature.end - tile_low) * w_scale) ),
- y_center = slots[feature.uid] * y_scale;
+ var feature = data[i],
+ feature_uid = feature[0],
+ feature_start = feature[1],
+ feature_end = feature[2],
+ feature_name = feature[3];
- var thickness, y_start, thick_start = null, thick_end = null;
- if (feature.thick_start && feature.thick_end) {
- thick_start = Math.floor( Math.max(0, (feature.thick_start - tile_low) * w_scale) );
- thick_end = Math.ceil( Math.min(width, (feature.thick_end - tile_low) * w_scale) );
- }
- // if (!showing_details) {
- // Non-detail levels
- // ctx.fillRect(f_start + left_offset, y_center + 5, f_end - f_start, 1);
- // } else {
+ if (feature_start <= tile_high && feature_end >= tile_low) {
+ var f_start = Math.floor( Math.max(0, (feature_start - tile_low) * w_scale) ),
+ f_end = Math.ceil( Math.min(width, (feature_end - tile_low) * w_scale) ),
+ y_center = slots[feature_uid] * y_scale;
+
+ // console.log(feature_uid, feature_start, feature_end, f_start, f_end, y_center);
+ if (no_detail) {
+ ctx.fillRect(f_start + left_offset, y_center + 5, f_end - f_start, 1);
+ } else {
// Showing labels, blocks, details
- if (feature.start > tile_low) {
+ var feature_strand = feature[4],
+ feature_ts = feature[5],
+ feature_te = feature[6],
+ feature_blocks = feature[7];
+
+ var thickness, y_start, thick_start = null, thick_end = null;
+ if (feature_ts && feature_te) {
+ thick_start = Math.floor( Math.max(0, (feature_ts - tile_low) * w_scale) );
+ thick_end = Math.ceil( Math.min(width, (feature_te - tile_low) * w_scale) );
+ }
+ if (feature_start > tile_low) {
ctx.fillStyle = label_color;
- ctx.fillText(feature.name, f_start - 1 + left_offset, y_center + 8);
+ ctx.fillText(feature_name, f_start - 1 + left_offset, y_center + 8);
ctx.fillStyle = block_color;
}
- var blocks = feature.blocks;
- if (blocks) {
+ if (feature_blocks) {
// Draw introns
- if (feature.strand) {
- if (feature.strand == "+") {
+ if (feature_strand) {
+ if (feature_strand == "+") {
ctx.fillStyle = RIGHT_STRAND;
- } else if (feature.strand == "-") {
+ } else if (feature_strand == "-") {
ctx.fillStyle = LEFT_STRAND;
}
ctx.fillRect(f_start + left_offset, y_center, f_end - f_start, 10);
ctx.fillStyle = block_color;
}
- for (var k = 0, k_len = blocks.length; k < k_len; k++) {
- var block = blocks[k],
+ for (var k = 0, k_len = feature_blocks.length; k < k_len; k++) {
+ var block = feature_blocks[k],
block_start = Math.floor( Math.max(0, (block[0] - tile_low) * w_scale) ),
block_end = Math.ceil( Math.min(width, (block[1] - tile_low) * w_scale) );
if (block_start > block_end) { continue; }
@@ -829,7 +849,7 @@
ctx.fillStyle = prefs.block_color;
}
}
- // }
+ }
j++;
}
}
@@ -843,15 +863,21 @@
block_color_label = $('<label></label>').attr("for", block_color).text("Block color:"),
block_color_input = $('<input></input>').attr("id", block_color).attr("name", block_color).val(this.prefs.block_color),
label_color = 'track_' + track_id + '_label_color',
- label_color_label = $('<label></label>').attr("for", label_color).text("Label color:"),
- label_color_input = $('<input></input>').attr("id", label_color).attr("name", label_color).val(this.prefs.label_color);
- return container.append(block_color_label).append(block_color_input).append(label_color_label).append(label_color_input);
+ label_color_label = $('<label></label>').attr("for", label_color).text("Text color:"),
+ label_color_input = $('<input></input>').attr("id", label_color).attr("name", label_color).val(this.prefs.label_color),
+ show_count = 'track_' + track_id + '_show_count',
+ show_count_label = $('<label></label>').attr("for", show_count).text("Show summary counts"),
+ show_count_input = $('<input type="checkbox" style="float:left;"></input>').attr("id", show_count).attr("name", show_count).attr("checked", this.prefs.show_counts);
+
+ return container.append(block_color_label).append(block_color_input).append(label_color_label).append(label_color_input).append(show_count_input).append(show_count_label);
}, update_options: function(track_id) {
var block_color = $('#track_' + track_id + '_block_color').val(),
- label_color = $('#track_' + track_id + '_label_color').val();
- if (block_color !== this.prefs.block_color || label_color !== this.prefs.label_color) {
+ label_color = $('#track_' + track_id + '_label_color').val(),
+ show_counts = $('#track_' + track_id + '_show_count').attr("checked");
+ if (block_color !== this.prefs.block_color || label_color !== this.prefs.label_color || show_counts != this.prefs.show_counts) {
this.prefs.block_color = block_color;
this.prefs.label_color = label_color;
+ this.prefs.show_counts = show_counts;
this.tile_cache.clear();
this.draw();
}
diff -r 44f2713a7279 -r 0890f7bf9d49 templates/tracks/browser.mako
--- a/templates/tracks/browser.mako Wed Mar 24 15:13:57 2010 -0400
+++ b/templates/tracks/browser.mako Thu Mar 25 15:21:57 2010 -0400
@@ -170,7 +170,7 @@
$("#right-border").bind( "dragend", function(e) { refresh(e); } );
$(window).trigger( "resize" );
- $("#viewport").bind( "dragstart", function( e ) {
+ $("#viewport-container").bind( "dragstart", function( e ) {
this.original_low = view.low;
this.current_height = e.clientY;
this.current_x = e.offsetX;
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/44f2713a7279
changeset: 3561:44f2713a7279
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Wed Mar 24 15:13:57 2010 -0400
description:
Add FASTQ <--> Tabular converter tools.
diffstat:
test-data/fastq_to_tabular_out_1.tabular | 2 +
test-data/fastq_to_tabular_out_2.tabular | 2 +
tool_conf.xml.main | 2 +
tool_conf.xml.sample | 2 +
tools/fastq/fastq_to_tabular.py | 21 ++++++++++++++++++
tools/fastq/fastq_to_tabular.xml | 30 +++++++++++++++++++++++++
tools/fastq/tabular_to_fastq.py | 29 +++++++++++++++++++++++++
tools/fastq/tabular_to_fastq.xml | 37 ++++++++++++++++++++++++++++++++
8 files changed, 125 insertions(+), 0 deletions(-)
diffs (169 lines):
diff -r 4c95f1a101f1 -r 44f2713a7279 test-data/fastq_to_tabular_out_1.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_1.tabular Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 4c95f1a101f1 -r 44f2713a7279 test-data/fastq_to_tabular_out_2.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_2.tabular Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 4c95f1a101f1 -r 44f2713a7279 tool_conf.xml.main
--- a/tool_conf.xml.main Wed Mar 24 14:14:58 2010 -0400
+++ b/tool_conf.xml.main Wed Mar 24 15:13:57 2010 -0400
@@ -297,6 +297,8 @@
<tool file="fastq/fastq_trimmer.xml" />
<tool file="fastq/fastq_manipulation.xml" />
<tool file="fastq/fastq_to_fasta.xml" />
+ <tool file="fastq/fastq_to_tabular.xml" />
+ <tool file="fastq/tabular_to_fastq.xml" />
</section>
<section name="NGS: Mapping" id="ngs_mapping">
<label text="Illumina" id="illumina"/>
diff -r 4c95f1a101f1 -r 44f2713a7279 tool_conf.xml.sample
--- a/tool_conf.xml.sample Wed Mar 24 14:14:58 2010 -0400
+++ b/tool_conf.xml.sample Wed Mar 24 15:13:57 2010 -0400
@@ -208,6 +208,8 @@
<tool file="fastq/fastq_trimmer.xml" />
<tool file="fastq/fastq_manipulation.xml" />
<tool file="fastq/fastq_to_fasta.xml" />
+ <tool file="fastq/fastq_to_tabular.xml" />
+ <tool file="fastq/tabular_to_fastq.xml" />
</section>
<section name="NGS: Mapping" id="solexa_tools">
<tool file="sr_mapping/lastz_wrapper.xml" />
diff -r 4c95f1a101f1 -r 44f2713a7279 tools/fastq/fastq_to_tabular.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/fastq/fastq_to_tabular.py Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,21 @@
+#Dan Blankenberg
+import sys
+from galaxy_utils.sequence.fastq import fastqReader
+
+def main():
+ input_filename = sys.argv[1]
+ output_filename = sys.argv[2]
+ input_type = sys.argv[3] or 'sanger' #input type should ordinarily be unnecessary
+
+ num_reads = None
+ fastq_read = None
+ out = open( output_filename, 'wb' )
+ for num_reads, fastq_read in enumerate( fastqReader( open( input_filename ), format = input_type ) ):
+ out.write( "%s\t%s\t%s\n" % ( fastq_read.identifier[1:].replace( '\t', ' ' ), fastq_read.sequence.replace( '\t', ' ' ), fastq_read.quality.replace( '\t', ' ' ) ) )
+ out.close()
+ if num_reads is None:
+ print "No valid FASTQ reads could be processed."
+ else:
+ print "%i FASTQ reads were converted to Tabular." % ( num_reads + 1 )
+
+if __name__ == "__main__": main()
diff -r 4c95f1a101f1 -r 44f2713a7279 tools/fastq/fastq_to_tabular.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/fastq/fastq_to_tabular.xml Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,30 @@
+<tool id="fastq_to_tabular" name="FASTQ to Tabular" version="1.0.0">
+ <description>converter</description>
+ <command interpreter="python">fastq_to_tabular.py '$input_file' '$output_file' '${input_file.extension[len( 'fastq' ):]}'</command>
+ <inputs>
+ <param name="input_file" type="data" format="fastqsanger,fastqcssanger,fastqillumina,fastqsolexa" label="FASTQ file to convert" />
+ </inputs>
+ <outputs>
+ <data name="output_file" format="tabular" />
+ </outputs>
+ <tests>
+ <!-- basic test -->
+ <test>
+ <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />
+ <output name="output_file" file="fastq_to_tabular_out_1.tabular" />
+ </test>
+ <!-- color space test -->
+ <test>
+ <param name="input_file" value="sanger_full_range_as_cssanger.fastqcssanger" ftype="fastqcssanger" />
+ <output name="output_file" file="fastq_to_tabular_out_2.tabular" />
+ </test>
+ </tests>
+ <help>
+**What it does**
+
+This tool converts FASTQ sequencing reads to a Tabular file.
+
+Tab characters, if present in the source FASTQ file, will be converted to spaces.
+
+ </help>
+</tool>
diff -r 4c95f1a101f1 -r 44f2713a7279 tools/fastq/tabular_to_fastq.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/fastq/tabular_to_fastq.py Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,29 @@
+#Dan Blankenberg
+import sys
+
+def main():
+ input_filename = sys.argv[1]
+ output_filename = sys.argv[2]
+ identifier_col = int( sys.argv[3] ) - 1
+ sequence_col = int( sys.argv[4] ) - 1
+ quality_col = int( sys.argv[5] ) - 1
+
+ max_col = max( identifier_col, sequence_col, quality_col )
+ num_reads = None
+ fastq_read = None
+ skipped_lines = 0
+ out = open( output_filename, 'wb' )
+ for num_reads, line in enumerate( open( input_filename ) ):
+ fields = line.rstrip( '\n\r' ).split( '\t' )
+ if len( fields ) > max_col:
+ out.write( "@%s\n%s\n+\n%s\n" % ( fields[identifier_col], fields[sequence_col], fields[quality_col] ) )
+ else:
+ skipped_lines += 1
+
+ out.close()
+ if num_reads is None:
+ print "Input was empty."
+ else:
+ print "%i tabular lines were written as FASTQ reads. Be sure to use the FASTQ Groomer tool on this output before further analysis." % ( num_reads + 1 - skipped_lines )
+
+if __name__ == "__main__": main()
diff -r 4c95f1a101f1 -r 44f2713a7279 tools/fastq/tabular_to_fastq.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/fastq/tabular_to_fastq.xml Wed Mar 24 15:13:57 2010 -0400
@@ -0,0 +1,37 @@
+<tool id="tabular_to_fastq" name="Tabular to FASTQ" version="1.0.0">
+ <description>converter</description>
+ <command interpreter="python">tabular_to_fastq.py '$input_file' '$output_file' '$identifier' '$sequence' '$quality'</command>
+ <inputs>
+ <param name="input_file" type="data" format="tabular" label="Tabular file to convert" />
+ <param name="identifier" label="Identifier column" type="data_column" data_ref="input_file" />
+ <param name="sequence" label="Sequence column" type="data_column" data_ref="input_file" />
+ <param name="quality" label="Quality column" type="data_column" data_ref="input_file" />
+ </inputs>
+ <outputs>
+ <data name="output_file" format="fastq" />
+ </outputs>
+ <tests>
+ <!-- basic test -->
+ <test>
+ <param name="input_file" value="fastq_to_tabular_out_1.tabular" ftype="tabular" />
+ <param name="identifier" value="1" />
+ <param name="sequence" value="2" />
+ <param name="quality" value="3" />
+ <output name="output_file" file="sanger_full_range_original_sanger.fastqsanger" />
+ </test>
+ <!-- color space test -->
+ <test>
+ <param name="input_file" value="fastq_to_tabular_out_2.tabular" ftype="tabular" />
+ <param name="identifier" value="1" />
+ <param name="sequence" value="2" />
+ <param name="quality" value="3" />
+ <output name="output_file" file="sanger_full_range_as_cssanger.fastqcssanger" />
+ </test>
+ </tests>
+ <help>
+**What it does**
+
+This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool.
+
+ </help>
+</tool>
1
0
Hello
I have installed Galaxy in a production environment and a UCSC local mirror.
When I click on "display at UCSC main", I have an error on UCSC :
"redirected to non-http(s): /galaxy/root"
Have you an idea to resolve this problem ?
Thanks
Emeric
--
Ce message a été vérifié par MailScanner
pour des virus ou des polluriels et rien de
suspect n'a été trouvé.
3
5
Hi,
I recently discovered an issue that prevents me from easily deleting
multiple histories at once.
This is the method I use:
Click ³Options² on the right side menu -> Go to ³Saved Histories² -> Click
on the check box of the history to be deleted -> Click ³Delete² button at
the bottom (next to ³For selected histories:²).
When I do this, nothing happens, and the history remains.
However, if I click on the the downward triangle and click on ³Delete² from
the pull down menu, the history is correctly deleted.
Deleting using the check-boxes and the Delete button works in changeset
3446:143c920af25c
But fails in changeset 3447:f5d383525d68.
Please let me know if you cannot reproduce the problem.
Cheers,
Oliver
2
1
Hi
I have a problem that I've not been able to track down. I've tried
searching the mailing list archive and googling.
When I enable paste in universe_wsgi.ini and then run run.sh I get this
error. The same occurs for both the stable and development branches.
Traceback (most recent call last):
File "./scripts/paster.py", line 34, in <module>
command.run()
File
"/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py",
line 84, in run
invoke(command, command_name, options, args[1:])
File
"/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py",
line 123, in invoke
exit_code = runner.run(args)
File
"/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py",
line 218, in run
result = self.command()
File
"/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/serve.py",
line 274, in command
relative_to=base, global_conf=vars)
File
"/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/serve.py",
line 308, in loadserver
relative_to=relative_to, **kw)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 210, in loadserver
return loadobj(SERVER, uri, name=name, **kw)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 224, in loadobj
global_conf=global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 248, in loadcontext
global_conf=global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 278, in _loadconfig
return loader.get_context(object_type, name, global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 409, in get_context
section)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 431, in _context_from_use
object_type, name=use, global_conf=global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 361, in get_context
global_conf=global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 248, in loadcontext
global_conf=global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 285, in _loadegg
return loader.get_context(object_type, name, global_conf)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 561, in get_context
object_type, name=name)
File
"/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py",
line 600, in find_egg_entry_point
for prot in protocol_options] or '(no entry points)'))))
LookupError: Entry point 'gzip' not found in egg 'Paste' (dir:
/home/nat/work/software/galaxy-central/eggs/Paste-1.6-py2.6.egg;
protocols: paste.server_factory, paste.server_runner; entry_points: )
The strange thing is on another machine I don't get the error but I
can't find out what the missing dependency is on the machine the
generates the error despite comparing installed packages etc.
I'm running Ubunutu 9.1 64bit on both machines.
Can anyone tell me what I'm missing that leads to the above error?
Many thanks
Nathaniel
--
Nathaniel Street
Umeå Plant Science Centre
Department of Plant Physiology
University of Umeå
SE-901 87 Umeå
SWEDEN
email: nathaniel.street(a)plantphys.umu.se
tel: +46-90-786 5473
fax: +46-90-786 6676
www.popgenie.org
2
1
In universe_wsgi.ini there is a parameter log_level which is set to
DEBUG. I want to decrease the size of the log being output. What are
the other options for log_level?
Thanks,
Natalie
2
1