1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/d57affe81874/
changeset: d57affe81874
user: dan
date: 2011-08-25 16:00:09
summary: Minor tool help updates.
affected #: 28 files (7.7 KB)
--- a/tools/fastq/fastq_combiner.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_combiner.xml Thu Aug 25 10:00:09 2011 -0400
@@ -66,5 +66,12 @@
Specifying a set of quality scores is optional; when not provided, the output will be fastqsanger or fastqcssanger (when a csfasta is provided) with each quality score being the maximal allowed value (93).
Use this tool, for example, to convert 454-type output to FASTQ.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
</help></tool>
--- a/tools/fastq/fastq_filter.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_filter.xml Thu Aug 25 10:00:09 2011 -0400
@@ -307,5 +307,12 @@
Adapter bases in color space reads are excluded from filtering.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_groomer.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_groomer.xml Thu Aug 25 10:00:09 2011 -0400
@@ -358,6 +358,12 @@
Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
.. _Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2009 Dec 16.: http://www.ncbi.nlm.nih.gov/pubmed/20015970
--- a/tools/fastq/fastq_manipulation.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_manipulation.xml Thu Aug 25 10:00:09 2011 -0400
@@ -417,5 +417,13 @@
2. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "Change Adapter Base" and set **New Adapter** to "" (an empty text field).
3. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "String Translate" and set **From** to "0123." and **To** to "ACGTN".
4. Click Execute. The new history item will contained double-encoded psuedo-nucleotide space reads.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_masker_by_quality.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_masker_by_quality.xml Thu Aug 25 10:00:09 2011 -0400
@@ -49,5 +49,12 @@
This tool is not available for use on color space (csSanger) formats.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_paired_end_joiner.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_paired_end_joiner.xml Thu Aug 25 10:00:09 2011 -0400
@@ -51,5 +51,12 @@
+HWI-EAS91_1_30788AAXX:7:21:1542:1758
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_paired_end_splitter.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_paired_end_splitter.xml Thu Aug 25 10:00:09 2011 -0400
@@ -52,5 +52,12 @@
+HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_stats.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_stats.xml Thu Aug 25 10:00:09 2011 -0400
@@ -60,5 +60,12 @@
Adapter bases in color space reads are excluded from statistics.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_to_fasta.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_to_fasta.xml Thu Aug 25 10:00:09 2011 -0400
@@ -29,5 +29,12 @@
This tool converts FASTQ sequencing reads to FASTA sequences.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_to_tabular.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_to_tabular.xml Thu Aug 25 10:00:09 2011 -0400
@@ -90,5 +90,12 @@
Note the sequences and quality strings have been truncated for display purposes in the above tables.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_trimmer.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_trimmer.xml Thu Aug 25 10:00:09 2011 -0400
@@ -109,5 +109,12 @@
Trimming a color space read will cause any adapter base to be lost.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/fastq_trimmer_by_quality.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/fastq_trimmer_by_quality.xml Thu Aug 25 10:00:09 2011 -0400
@@ -134,5 +134,12 @@
Trimming a color space read will cause any adapter base to be lost.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/fastq/tabular_to_fastq.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/fastq/tabular_to_fastq.xml Thu Aug 25 10:00:09 2011 -0400
@@ -33,5 +33,12 @@
This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
</help></tool>
--- a/tools/maf/genebed_maf_to_fasta.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/genebed_maf_to_fasta.xml Thu Aug 25 10:00:09 2011 -0400
@@ -87,6 +87,12 @@
* stitches blocks together and resolves overlaps based on alignment score;
* outputs alignments in FASTA format.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
</help></tool>
--- a/tools/maf/interval2maf.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/interval2maf.xml Thu Aug 25 10:00:09 2011 -0400
@@ -283,5 +283,12 @@
s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG
s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/interval2maf_pairwise.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/interval2maf_pairwise.xml Thu Aug 25 10:00:09 2011 -0400
@@ -39,5 +39,12 @@
.. image:: ./static/images/maf_icons/interval2maf.png
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/interval_maf_to_merged_fasta.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/interval_maf_to_merged_fasta.xml Thu Aug 25 10:00:09 2011 -0400
@@ -103,5 +103,12 @@
.. image:: ./static/images/maf_icons/stitchMaf.png
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_by_block_number.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_by_block_number.xml Thu Aug 25 10:00:09 2011 -0400
@@ -28,5 +28,13 @@
**What it does**
This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_filter.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_filter.xml Thu Aug 25 10:00:09 2011 -0400
@@ -191,5 +191,12 @@
You can also provide a size range and limit your output to the MAF blocks which fall within the specified range.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_limit_size.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_limit_size.xml Thu Aug 25 10:00:09 2011 -0400
@@ -24,5 +24,13 @@
**What it does**
This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_limit_to_species.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_limit_to_species.xml Thu Aug 25 10:00:09 2011 -0400
@@ -39,6 +39,13 @@
* **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_reverse_complement.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_reverse_complement.xml Thu Aug 25 10:00:09 2011 -0400
@@ -41,5 +41,13 @@
s hg17.chr7 31156555 58 - 158628139 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAATGAATAAACCACAAATT
s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT
s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_split_by_species.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_split_by_species.xml Thu Aug 25 10:00:09 2011 -0400
@@ -211,6 +211,13 @@
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_stats.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_stats.xml Thu Aug 25 10:00:09 2011 -0400
@@ -108,5 +108,13 @@
======== =========== ========
where **coverage** is the number of nucleotides divided by the total length of the provided intervals.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
</help></tool>
--- a/tools/maf/maf_thread_for_species.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_thread_for_species.xml Thu Aug 25 10:00:09 2011 -0400
@@ -48,6 +48,11 @@
s hg17.chr7 127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
</help>
--- a/tools/maf/maf_to_bed.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_to_bed.xml Thu Aug 25 10:00:09 2011 -0400
@@ -123,6 +123,12 @@
5. score - A score between 0 and 1000.
6. strand - Defines the strand - either '+' or '-'.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
</help><code file="maf_to_bed_code.py"/>
--- a/tools/maf/maf_to_fasta.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_to_fasta.xml Thu Aug 25 10:00:09 2011 -0400
@@ -188,6 +188,12 @@
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
</help></tool>
--- a/tools/maf/maf_to_interval.xml Wed Aug 24 17:15:34 2011 -0400
+++ b/tools/maf/maf_to_interval.xml Thu Aug 25 10:00:09 2011 -0400
@@ -121,6 +121,12 @@
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
</help></tool>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/9986212ed733/
changeset: 9986212ed733
user: jgoecks
date: 2011-08-24 23:15:34
summary: Cleanup display of shared visualizations.
affected #: 1 file (7 bytes)
--- a/templates/visualization/display.mako Wed Aug 24 16:43:02 2011 -0400
+++ b/templates/visualization/display.mako Wed Aug 24 17:15:34 2011 -0400
@@ -58,7 +58,7 @@
</%def><%def name="render_item( visualization, config )">
- <div id="${visualization.id}" class="unified-panel-body" style="overflow:none;top:0px;"></div>
+ <div id="${trans.security.encode_id( visualization.id )}" class="unified-panel-body" style="overflow:none;top:0px;"></div><script type="text/javascript">
// TODO: much of this code is copied from browser.mako -- create shared base and use in both places.
@@ -76,15 +76,14 @@
converted_datasets_state_url = "${h.url_for( controller='/tracks', action='converted_datasets_state' )}",
addable_track_types = { "LineTrack": LineTrack, "FeatureTrack": FeatureTrack, "ReadTrack": ReadTrack },
view,
- container_element = $("#${visualization.id}");
+ container_element = $("#${trans.security.encode_id( visualization.id )}");
$(function() {
if (container_element.parents(".item-content").length > 0) { // Embedded viz
container_element.parents(".item-content").css( { "max-height": "none", "overflow": "visible" } );
} else { // Viewing just one shared viz
- // TODO: need live or just bind click?
- $("#right-border").live("click", function() { view.resize_window(); });
+ $("#right-border").click(function() { view.resize_window(); });
}
// Create view and add tracks.
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/d0c9c238ddbf/
changeset: d0c9c238ddbf
user: natefoo
date: 2011-08-24 21:33:07
summary: Fix sending mail when the receipient is a list (as in sample tracking mail routines).
affected #: 1 file (93 bytes)
--- a/lib/galaxy/util/__init__.py Wed Aug 24 14:42:56 2011 -0400
+++ b/lib/galaxy/util/__init__.py Wed Aug 24 15:33:07 2011 -0400
@@ -572,8 +572,11 @@
"""
Sends an email.
"""
+ header_to = to
+ if isinstance( to, list ):
+ header_to = ', '.join( to )
msg = MIMEText( body )
- msg[ 'To' ] = to
+ msg[ 'To' ] = header_to
msg[ 'From' ] = frm
msg[ 'Subject' ] = subject
if config.smtp_server is None:
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/08859d106924/
changeset: 08859d106924
user: natefoo
date: 2011-08-24 20:38:29
summary: Remove unspecified build validator from aggregate_scores_in_intervals2 tool because it can work with a custom fasta.
affected #: 1 file (415 bytes)
--- a/tools/stats/aggregate_binned_scores_in_intervals.xml Wed Aug 24 13:58:48 2011 -0400
+++ b/tools/stats/aggregate_binned_scores_in_intervals.xml Wed Aug 24 14:38:29 2011 -0400
@@ -1,4 +1,4 @@
-<tool id="aggregate_scores_in_intervals2" description="such as phastCons, GERP, binCons, and others for a set of genomic intervals" name="Aggregate datapoints" version="1.1.2">
+<tool id="aggregate_scores_in_intervals2" description="such as phastCons, GERP, binCons, and others for a set of genomic intervals" name="Aggregate datapoints" version="1.1.3"><description>Appends the average, min, max of datapoints per interval</description><command interpreter="python">
#if $score_source_type.score_source == "user" #aggregate_scores_in_intervals.py $score_source_type.input2 $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 --chrom_buffer=3
@@ -6,11 +6,7 @@
#end if#
</command><inputs>
- <param format="interval" name="input1" type="data" label="Interval file">
- <validator type="unspecified_build" message="Unspecified build, this tool works with data from genome builds hg16, hg17 or hg18. Click the pencil icon in your history item to set the genome build."/>
- <validator type="dataset_metadata_in_file" filename="binned_scores.loc" metadata_name="dbkey" metadata_column="0" message="Data is currently not available for the specified build." />
-
- </param>
+ <param format="interval" name="input1" type="data" label="Interval file"/><conditional name="score_source_type"><param name="score_source" type="select" label="Score Source"><option value="cached" selected="true">Locally Cached Scores</option>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/a609a7af3fb6/
changeset: a609a7af3fb6
user: kanwei
date: 2011-08-24 19:58:48
summary: Grouping tool: use system numpy if provided, otherwise use bundled numpy egg
affected #: 1 file (35 bytes)
--- a/tools/stats/grouping.py Wed Aug 24 13:14:49 2011 -0400
+++ b/tools/stats/grouping.py Wed Aug 24 13:58:48 2011 -0400
@@ -6,9 +6,12 @@
This tool provides the SQL "group by" functionality.
"""
import sys, commands, tempfile, random
-import pkg_resources
-pkg_resources.require( "numpy" )
-import numpy
+try:
+ import numpy
+except:
+ from galaxy import eggs
+ eggs.require( "numpy" )
+ import numpy
from itertools import groupby
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.