May 2011 - galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: greg: Fix for importing library datasets into a new named history. Library datasets will no longer be imported into both the current history and the new named history ( only the latter ) in this scenario.

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/10c1c31c03bc/ changeset: 10c1c31c03bc branches: user: greg date: 2011-05-31 18:03:52 summary: Fix for importing library datasets into a new named history. Library datasets will no longer be imported into both the current history and the new named history ( only the latter ) in this scenario. affected #: 1 file (53 bytes) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 11 months

1
0
0 / 0

commit/galaxy-central: jgoecks: Fix bugs in reading and visualizing GFF3 datasets.

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/217a5c1f12bc/ changeset: 217a5c1f12bc branches: user: jgoecks date: 2011-05-28 01:07:06 summary: Fix bugs in reading and visualizing GFF3 datasets. affected #: 1 file (496 bytes) --- a/lib/galaxy/datatypes/util/gff_util.py Fri May 27 09:22:27 2011 -0400 +++ b/lib/galaxy/datatypes/util/gff_util.py Sat May 28 01:07:06 2011 +0200 @@ -67,11 +67,18 @@ def name( self ): """ Returns feature's name. """ - name = self.attributes.get( 'transcript_id', None ) - if not name: - name = self.attributes.get( 'id', None ) - if not name: - name = self.attributes.get( 'group', None ) + name = None + # Preference for name: GTF, GFF3, GFF. + for attr_name in [ + # GTF: + 'transcript_id', 'gene_id', + # GFF3: + 'ID', 'id', + # GFF (TODO): + 'group' ]: + name = self.attributes.get( attr_name, None ) + if name is not None: + break return name def copy( self ): @@ -172,11 +179,14 @@ self.seed_interval = None return return_val - # Initialize feature name from seed. + # Initialize feature identifier from seed. feature_group = self.seed_interval.attributes.get( 'group', None ) # For GFF - feature_id = self.seed_interval.attributes.get( 'ID', None ) # For GFF3 - feature_gene_id = self.seed_interval.attributes.get( 'gene_id', None ) # For GTF - feature_transcript_id = self.seed_interval.attributes.get( 'transcript_id', None ) # For GTF + # For GFF3 + feature_id = self.seed_interval.attributes.get( 'ID', None ) + feature_parent_id = self.seed_interval.attributes.get( 'Parent', None ) + # For GTF. + feature_gene_id = self.seed_interval.attributes.get( 'gene_id', None ) + feature_transcript_id = self.seed_interval.attributes.get( 'transcript_id', None ) # Read all intervals associated with seed. feature_intervals = [] @@ -205,8 +215,9 @@ if group and feature_group != group: break # GFF3 test: - parent = interval.attributes.get( 'Parent', None ) - if feature_id and feature_id != parent: + parent_id = interval.attributes.get( 'Parent', None ) + cur_id = interval.attributes.get( 'ID', None ) + if feature_id and parent_id != feature_parent_id and feature_id != cur_id: break # GTF test: gene_id = interval.attributes.get( 'gene_id', None ) @@ -230,7 +241,7 @@ # Convert to BED coords? if self.convert_to_bed_coord: convert_gff_coords_to_bed( feature ) - + return feature @@ -280,10 +291,11 @@ attributes_list = attr_str.split(";") attributes = {} for name_value_pair in attributes_list: - # Try splitting by space and, if necessary, by '=' sign. - pair = name_value_pair.strip().split(" ") + # Try splitting by '=' (GFF3) first because spaces are allowed in GFF3 + # attribute; next, try double quotes for GTF. + pair = name_value_pair.strip().split("=") if len( pair ) == 1: - pair = name_value_pair.strip().split("=") + pair = name_value_pair.strip().split("\"") if len( pair ) == 1: # Could not split for some reason -- raise exception? continue Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: richard_burhans: Updated help text for genome diversity tools

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/3e7f7c40b4fe/ changeset: 3e7f7c40b4fe branches: user: richard_burhans date: 2011-05-27 15:22:27 summary: Updated help text for genome diversity tools affected #: 3 files (501 bytes) --- a/tools/genome_diversity/extract_flanking_dna.xml Fri May 27 11:19:16 2011 +0200 +++ b/tools/genome_diversity/extract_flanking_dna.xml Fri May 27 09:22:27 2011 -0400 @@ -54,7 +54,9 @@ <help> **What it does** - If extracts flanking dna for the SNPs in the dataset. + It reports a DNA segment containing each SNP, with up to 200 nucleotides on + either side of the SNP position, which is indicated by "n". Fewer nucleotides + are reported if the SNP is near an end of the assembled genome fragment. ----- --- a/tools/genome_diversity/select_restriction_enzymes.xml Fri May 27 11:19:16 2011 +0200 +++ b/tools/genome_diversity/select_restriction_enzymes.xml Fri May 27 09:22:27 2011 -0400 @@ -57,7 +57,9 @@ <help> **What it does** - It selects SNPs in the dataset by restriction enzyme. + It selects the SNPs that are differentially cut by at least one of the + specified restriction enzymes. The enzymes are required to cut the amplified + segment (for the specified PCR primers) only at the SNP. ----- --- a/tools/genome_diversity/select_snps.xml Fri May 27 11:19:16 2011 +0200 +++ b/tools/genome_diversity/select_snps.xml Fri May 27 09:22:27 2011 -0400 @@ -51,7 +51,9 @@ <help> **What it does** - If selects a specified number of SNPs from the dataset. + It attempts to select a specified number of SNPs from the dataset, making them + approximately uniformly spaced relative to the reference genome. The number + actually selected may be slightly more than the specified number. ----- Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: Fix brand not being clickable

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/9dcd437dfc98/ changeset: 9dcd437dfc98 branches: user: kanwei date: 2011-05-27 11:19:16 summary: Fix brand not being clickable affected #: 1 file (15 bytes) --- a/templates/webapps/galaxy/base_panels.mako Fri May 27 11:01:46 2011 +0200 +++ b/templates/webapps/galaxy/base_panels.mako Fri May 27 11:19:16 2011 +0200 @@ -7,9 +7,9 @@ <%def name="masthead()"> ## Tab area, fills entire width - <div style="position: absolute; top: 0; left: 0; width: 100%; text-align: center"> + <div style="position: relative; right: -50%; float: left; text-align: center;"> - <table class="tab-group" border="0" cellspacing="0" style="margin: auto;"> + <table class="tab-group" border="0" cellspacing="0" style="position: relative; right: 50%;"><tr><%def name="tab( id, display, href, target='_parent', visible=True, extra_class='', menu_options=None )"> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: Velvet wrapper: fix typos, tabs -> spaces, spacing

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/68c34a8bd236/ changeset: 68c34a8bd236 branches: user: kanwei date: 2011-05-27 11:01:46 summary: Velvet wrapper: fix typos, tabs -> spaces, spacing affected #: 2 files (1.2 KB) --- a/tools/sr_assembly/velvetg.xml Fri May 27 10:47:17 2011 +0200 +++ b/tools/sr_assembly/velvetg.xml Fri May 27 11:01:46 2011 +0200 @@ -1,7 +1,7 @@ <tool id="velvetg" name="velvetg" version="1.0.0"> - <description>Velvet sequence assembler for very short reads</description> - <command interpreter="python"> - velvetg_wrapper.py + <description>Velvet sequence assembler for very short reads</description> + <command interpreter="python"> + velvetg_wrapper.py '$input.extra_files_path' '$contigs' '$stats' '$LastGraph' '$velvet_asm' '$unused_reads_fasta' #if $generate_amos.afg == "yes": @@ -65,159 +65,159 @@ $reads.options.scaffolding #end if #end if - </command> - <inputs> - <param name="input" type="data" format="velvet" label="Velvet Dataset" help="Prepared by velveth."/> - <conditional name="generate_amos"> - <param name="afg" type="select" label="Generate a AMOS.afg file"> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="no"/> - <when value="yes"/> - </conditional> + </command> + <inputs> + <param name="input" type="data" format="velvet" label="Velvet Dataset" help="Prepared by velveth."/> + <conditional name="generate_amos"> + <param name="afg" type="select" label="Generate a AMOS.afg file"> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"/> + </conditional> - <conditional name="unused_reads"> - <param name="generate_unused" type="select" label="Generate a UnusedReads fasta file"> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="no"/> - <when value="yes"/> - </conditional> + <conditional name="unused_reads"> + <param name="generate_unused" type="select" label="Generate a UnusedReads fasta file"> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"/> + </conditional> - <conditional name="last_graph"> - <param name="generate_graph" type="select" label="Generate velvet LastGraph file"> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="no"/> - <when value="yes"/> - </conditional> + <conditional name="last_graph"> + <param name="generate_graph" type="select" label="Generate velvet LastGraph file"> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"/> + </conditional> - <param name="read_trkg" type="boolean" checked="false" truevalue="-read_trkg yes" falsevalue="-read_trkg no" label="track short read positions" help=" tracking of short read positions in assembly"/> + <param name="read_trkg" type="boolean" checked="false" truevalue="-read_trkg yes" falsevalue="-read_trkg no" label="track short read positions" help=" tracking of short read positions in assembly"/> - <conditional name="coverage"> - <param name="cutoff" type="select" label="Coverage cutoff" help=""> - <option value="none">None</option> - <option value="auto">Automatically Determined</option> - <option value="value">Specify Cutoff Value</option> - </param> - <when value="none"/> - <when value="auto"/> - <when value="value"> - <param name="cov_cutoff" value = "10.0" label="Remove nodes with coverage below" type="float" /> - </when> - </conditional> + <conditional name="coverage"> + <param name="cutoff" type="select" label="Coverage cutoff" help=""> + <option value="none">None</option> + <option value="auto">Automatically Determined</option> + <option value="value">Specify Cutoff Value</option> + </param> + <when value="none"/> + <when value="auto"/> + <when value="value"> + <param name="cov_cutoff" value = "10.0" label="Remove nodes with coverage below" type="float" /> + </when> + </conditional> - <conditional name="expected"> - <param name="coverage" type="select" label="Expected Coverage of Unique Regions" help=""> - <option value="none">None</option> - <option value="auto">Automatically Determined</option> - <option value="value">Specify Expected Value</option> - </param> - <when value="none"/> - <when value="auto"/> - <when value="value"> - <param name="exp_cov" value = "10.0" label="Remove nodes with coverage below" type="float" /> - </when> - </conditional> + <conditional name="expected"> + <param name="coverage" type="select" label="Expected Coverage of Unique Regions" help=""> + <option value="none">None</option> + <option value="auto">Automatically Determined</option> + <option value="value">Specify Expected Value</option> + </param> + <when value="none"/> + <when value="auto"/> + <when value="value"> + <param name="exp_cov" value = "10.0" label="Remove nodes with coverage below" type="float" /> + </when> + </conditional> - <conditional name="contig_lgth"> - <param name="use_contig_lgth" type="select" label=" Set minimum contig length" help="minimum contig length exported to contigs.fa file (default: hash length * 2)."> - <option value="no">No</option> - <option value="yes">Yes</option> + <conditional name="contig_lgth"> + <param name="use_contig_lgth" type="select" label=" Set minimum contig length" help="minimum contig length exported to contigs.fa file (default: hash length * 2)."> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"> + <param name="min_contig_lgth" value = "42" label="minimum contig length" type="integer" help="minimum contig length exported to contigs.fa file (default: hash length * 2)"/> + </when> + </conditional> + + <conditional name="reads"> + <param name="paired" type="select" label="Using Paired Reads"> + <option value="no">No</option> + <option value="yes" selected="${input.metadata.paired_end_reads}">Yes</option> + </param> + <when value="no"/> + <when value="yes"> + <param name="ins_length" value = "-1" label="Insert Length in Paired-End Read dataset (ignored when -1)" type="integer" help="Expected distance between two paired end reads"/> + <conditional name="options"> + <param name="advanced" type="select" label="Velvet Advanced Options"> + <option value="no">Use Defaults</option> + <option value="yes">Set Advanced Option Values</option></param><when value="no"/><when value="yes"> - <param name="min_contig_lgth" value = "42" label="minimum contig length" type="integer" help="minimum contig length exported to contigs.fa file (default: hash length * 2)"/> - </when> - </conditional> - - <conditional name="reads"> - <param name="paired" type="select" label="Using Paired Reads"> - <option value="no">No</option> - <option value="yes" selected="${input.metadata.paired_end_reads}">Yes</option> - </param> - <when value="no"/> - <when value="yes"> - <param name="ins_length" value = "-1" label="Insert Length in Paired-End Read dataset (ignored when -1)" type="integer" help="Expected distance between two paired end reads"/> - <conditional name="options"> - <param name="advanced" type="select" label="Velvet Advanced Options"> - <option value="no">Use Defaults</option> - <option value="yes">Set Advanced Option Values</option> - </param> - <when value="no"/> - <when value="yes"> - <param name="ins_length_sd" value = "-1" label="Estimate of Standard Deviation of Paired-End Read dataset(ignored when -1)" type="integer" help="Estimate of standard deviation of Paired-End Read dataset (default: 10% of corresponding length)"/> - <param name="ins_length2" value = "-1" label="Insert Length in 2nd Paired-End Short Read dataset (ignored when -1)" type="integer" help="Expected distance between two paired end reads in the second short-read dataset"/> - <param name="ins_length2_sd" value = "-1" label="Estimate of Standard Deviation of 2nd Paired-End Read dataset (ignored when -1)" type="integer" help="Estimate of standard deviation of 2nd Paired-End Read dataset (default: 10% of corresponding length)"/> - <param name="ins_length_long" value = "-1" label="Insert Length in Long Paired-End Read dataset (ignored when -1)" type="integer" help="Expected distance between two long paired-end reads"/> - <param name="ins_length_long_sd" value = "-1" label="Estimate of Standard Deviation of 2nd Paired-End Read dataset (ignored when -1)" type="integer" help="Estimate of standard deviation of Long Paired-End Read dataset (default: 10% of corresponding length)"/> - <param name="max_branch_length" value = "-1" label="Maximum branch length (ignored when -1)" type="integer" help="maximum length in base pair of bubble (default: 100)"/> - <param name="max_divergence" value = "-1." label="Maximum max_divergence (between .0 and 1., ignored when -1.)" type="float" help="maximum divergence rate between two branches in a bubble (default: .2)"/> - <param name="max_gap_count" value = "-1" label="Maximum gap count (ignored when -1)" type="integer" help="maximum number of gaps allowed in the alignment of the two branches of a bubble (default: 3)"/> - <param name="min_pair_count" value = "-1" label="Minimum read-pair count (ignored when -1)" type="integer" help="minimum number of paired end connections to justify the scaffolding of two long contigs (default: 10)"/> - <param name="max_coverage" value = "-1." label="Maximum coverage exclusion(ignored when -1.)" type="float" help="Exclude data that has coverage more than this maximum coverage value"/> - <param name="long_mult_cutoff" value = "-1" label="Minimum number of long reads required to merge contigs (ignored when -1)" type="integer" help="minimum number of long reads required to merge contigs (default: 2)"/> - <param name="scaffolding" type="boolean" checked="true" truevalue="-scaffolding yes" falsevalue="-scaffolding no" label="Use Scaffolding" help="Scaffold contigs that it cannot quite be connected (This results in sequences of Ns in the contigs)"/> + <param name="ins_length_sd" value = "-1" label="Estimate of Standard Deviation of Paired-End Read dataset(ignored when -1)" type="integer" help="Estimate of standard deviation of Paired-End Read dataset (default: 10% of corresponding length)"/> + <param name="ins_length2" value = "-1" label="Insert Length in 2nd Paired-End Short Read dataset (ignored when -1)" type="integer" help="Expected distance between two paired end reads in the second short-read dataset"/> + <param name="ins_length2_sd" value = "-1" label="Estimate of Standard Deviation of 2nd Paired-End Read dataset (ignored when -1)" type="integer" help="Estimate of standard deviation of 2nd Paired-End Read dataset (default: 10% of corresponding length)"/> + <param name="ins_length_long" value = "-1" label="Insert Length in Long Paired-End Read dataset (ignored when -1)" type="integer" help="Expected distance between two long paired-end reads"/> + <param name="ins_length_long_sd" value = "-1" label="Estimate of Standard Deviation of 2nd Paired-End Read dataset (ignored when -1)" type="integer" help="Estimate of standard deviation of Long Paired-End Read dataset (default: 10% of corresponding length)"/> + <param name="max_branch_length" value = "-1" label="Maximum branch length (ignored when -1)" type="integer" help="maximum length in base pair of bubble (default: 100)"/> + <param name="max_divergence" value = "-1." label="Maximum max_divergence (between .0 and 1., ignored when -1.)" type="float" help="maximum divergence rate between two branches in a bubble (default: .2)"/> + <param name="max_gap_count" value = "-1" label="Maximum gap count (ignored when -1)" type="integer" help="maximum number of gaps allowed in the alignment of the two branches of a bubble (default: 3)"/> + <param name="min_pair_count" value = "-1" label="Minimum read-pair count (ignored when -1)" type="integer" help="minimum number of paired end connections to justify the scaffolding of two long contigs (default: 10)"/> + <param name="max_coverage" value = "-1." label="Maximum coverage exclusion(ignored when -1.)" type="float" help="Exclude data that has coverage more than this maximum coverage value"/> + <param name="long_mult_cutoff" value = "-1" label="Minimum number of long reads required to merge contigs (ignored when -1)" type="integer" help="minimum number of long reads required to merge contigs (default: 2)"/> + <param name="scaffolding" type="boolean" checked="true" truevalue="-scaffolding yes" falsevalue="-scaffolding no" label="Use Scaffolding" help="Scaffold contigs that it cannot quite be connected (This results in sequences of Ns in the contigs)"/></when> - </conditional> - </when> - </conditional> - </inputs> - <outputs> -  - <data format="txt" name="LastGraph" label="${tool.name} on ${on_string}: LastGraph"> - <filter>last_graph['generate_graph'] == "yes"</filter> - </data> - <data format="afg" name="velvet_asm" label="${tool.name} on ${on_string}: AMOS.afg"> - <filter>generate_amos['afg'] == "yes"</filter> - </data> - <data format="fasta" name="unused_reads_fasta" label="${tool.name} on ${on_string}: Unused Reads"> - <filter>unused_reads['generate_unused'] == "yes"</filter> - </data> - <data format="tabular" name="stats" label="${tool.name} on ${on_string}: Stats"/> - <data format="fasta" name="contigs" label="${tool.name} on ${on_string}: Contigs"/> - </outputs> - <requirements> - <requirement type="package">velvet</requirement> - </requirements> - <tests> - <test> - <param name="input" value="velveth_test1/output.html" ftype="velvet" > - <composite_data value='velveth_test1/Sequences' ftype="Sequences"/> - <composite_data value='velveth_test1/Roadmaps' ftype="Roadmaps"/> - <composite_data value='velveth_test1/Log'/> - </param> - <param name="afg" value="yes" /> - <param name="generate_unused" value="yes" /> - <param name="generate_graph" value="no" /> - <param name="read_trkg" value="-read_trkg no" /> - <param name="cutoff" value="auto" /> - <param name="coverage" value="auto" /> - <param name="use_contig_lgth" value="no" /> - <param name="paired" value="no" /> -  - <output name="velvet_asm" file="velvetg_test1/amos.afg" compare="diff"/> - <output name="unused_reads_fasta" file="velvetg_test1/unusedreads.fa" compare="diff"/> - <output name="stats" file="velvetg_test1/stats.csv" compare="diff"/> - <output name="contigs" file="velvetg_test1/contigs.fa" compare="diff"/> - </test> - </tests> - <help> + </conditional> + </when> + </conditional> + </inputs> + <outputs> +  + <data format="txt" name="LastGraph" label="${tool.name} on ${on_string}: LastGraph"> + <filter>last_graph['generate_graph'] == "yes"</filter> + </data> + <data format="afg" name="velvet_asm" label="${tool.name} on ${on_string}: AMOS.afg"> + <filter>generate_amos['afg'] == "yes"</filter> + </data> + <data format="fasta" name="unused_reads_fasta" label="${tool.name} on ${on_string}: Unused Reads"> + <filter>unused_reads['generate_unused'] == "yes"</filter> + </data> + <data format="tabular" name="stats" label="${tool.name} on ${on_string}: Stats"/> + <data format="fasta" name="contigs" label="${tool.name} on ${on_string}: Contigs"/> + </outputs> + <requirements> + <requirement type="package">velvet</requirement> + </requirements> + <tests> + <test> + <param name="input" value="velveth_test1/output.html" ftype="velvet" > + <composite_data value='velveth_test1/Sequences' ftype="Sequences"/> + <composite_data value='velveth_test1/Roadmaps' ftype="Roadmaps"/> + <composite_data value='velveth_test1/Log'/> + </param> + <param name="afg" value="yes" /> + <param name="generate_unused" value="yes" /> + <param name="generate_graph" value="no" /> + <param name="read_trkg" value="-read_trkg no" /> + <param name="cutoff" value="auto" /> + <param name="coverage" value="auto" /> + <param name="use_contig_lgth" value="no" /> + <param name="paired" value="no" /> +  + <output name="velvet_asm" file="velvetg_test1/amos.afg" compare="diff"/> + <output name="unused_reads_fasta" file="velvetg_test1/unusedreads.fa" compare="diff"/> + <output name="stats" file="velvetg_test1/stats.csv" compare="diff"/> + <output name="contigs" file="velvetg_test1/contigs.fa" compare="diff"/> + </test> + </tests> + <help> **Velvet Overview** Velvet_ is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454, developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI), near Cambridge, in the United Kingdom. Velvet currently takes in short read sequences, removes errors then produces high quality unique contigs. It then uses paired-end read and long read information, when available, to retrieve the repeated areas between contigs. -Read the Velvet `documentation`__ for details on using the Vevlet Assembler. +Read the Velvet `documentation`__ for details on using the Velvet Assembler. .. _Velvet: http://www.ebi.ac.uk/~zerbino/velvet/ @@ -238,7 +238,7 @@ **Contigs** The *contigs.fa* file. -This fasta file contains the sequences of the contigs longer than 2k, where k is the word-length used in velveth. If you have specified a min contig lgth threshold, then the contigs shorter than that value are omitted. +This fasta file contains the sequences of the contigs longer than 2k, where k is the word-length used in velveth. If you have specified a min contig length threshold, then the contigs shorter than that value are omitted. Note that the length and coverage information provided in the header of each contig should therefore be understood in k-mers and in k-mer coverage (cf. 5.1) respectively. The N's in the sequence correspond to gaps between scaffolded contigs. The number of N's corresponds to the estimated length of the gap. For reasons of compatibility with the archives, any gap shorter than 10bp is represented by a sequence of 10 N's. @@ -297,5 +297,5 @@ directory/LastGraph : special formatted file with all the information on the final graph directory/velvet_asm.afg : (if requested) AMOS compatible assembly file - </help> + </help></tool> --- a/tools/sr_assembly/velveth.xml Fri May 27 10:47:17 2011 +0200 +++ b/tools/sr_assembly/velveth.xml Fri May 27 11:01:46 2011 +0200 @@ -1,79 +1,79 @@ <tool id="velveth" name="velveth" version="1.0.0"> - <description>Prepare a dataset for the Velvet velvetg Assembler</description> - <command interpreter="python"> - velveth_wrapper.py + <description>Prepare a dataset for the Velvet velvetg Assembler</description> + <command interpreter="python"> + velveth_wrapper.py '$out_file1' '$out_file1.extra_files_path' $hash_length $strand_specific #for $i in $inputs - ${i.file_format} - ${i.read_type} - ${i.input} + ${i.file_format} + ${i.read_type} + ${i.input} #end for - </command> - <inputs> - <param label="Hash Length" name="hash_length" type="select" help="k-mer length in base pairs of the words being hashed."> - <option value="11">11</option> - <option value="13">13</option> - <option value="15">15</option> - <option value="17">17</option> - <option value="19">19</option> - <option value="21" selected="yes">21</option> - <option value="23">23</option> - <option value="25">25</option> - <option value="27">27</option> - <option value="29">29</option> - </param> - <param name="strand_specific" type="boolean" checked="false" truevalue="-strand_specific" falsevalue="" label="Use strand specific transcriptome sequencing" help="If you are using a strand specific transcriptome sequencing protocol, you may wish to use this option for better results."/> - <repeat name="inputs" title="Input Files"> - <param label="file format" name="file_format" type="select"> - <option value="-fasta" selected="yes">fasta</option> - <option value="-fastq">fastq</option> - <option value="-eland">eland</option> - <option value="-gerald">gerald</option> - </param> - <param label="read type" name="read_type" type="select"> - <option value="-short" selected="yes">short reads</option> - <option value="-shortPaired">shortPaired reads</option> - <option value="-short2">short2 reads</option> - <option value="-shortPaired2">shortPaired2 reads</option> - <option value="-long">long reads</option> - <option value="-longPaired">longPaired reads</option> - </param> + </command> + <inputs> + <param label="Hash Length" name="hash_length" type="select" help="k-mer length in base pairs of the words being hashed."> + <option value="11">11</option> + <option value="13">13</option> + <option value="15">15</option> + <option value="17">17</option> + <option value="19">19</option> + <option value="21" selected="yes">21</option> + <option value="23">23</option> + <option value="25">25</option> + <option value="27">27</option> + <option value="29">29</option> + </param> + <param name="strand_specific" type="boolean" checked="false" truevalue="-strand_specific" falsevalue="" label="Use strand specific transcriptome sequencing" help="If you are using a strand specific transcriptome sequencing protocol, you may wish to use this option for better results."/> + <repeat name="inputs" title="Input Files"> + <param label="file format" name="file_format" type="select"> + <option value="-fasta" selected="yes">fasta</option> + <option value="-fastq">fastq</option> + <option value="-eland">eland</option> + <option value="-gerald">gerald</option> + </param> + <param label="read type" name="read_type" type="select"> + <option value="-short" selected="yes">short reads</option> + <option value="-shortPaired">shortPaired reads</option> + <option value="-short2">short2 reads</option> + <option value="-shortPaired2">shortPaired2 reads</option> + <option value="-long">long reads</option> + <option value="-longPaired">longPaired reads</option> + </param> - <param name="input" type="data" format="fasta,fastq,eland,gerald" label="Dataset"/> - </repeat> - </inputs> - <outputs> - <data format="velvet" name="out_file1" /> - </outputs> - <requirements> - <requirement type="package">velvet</requirement> - </requirements> - <tests> - <test> - <param name="hash_length" value="21" /> - <param name="read_type" value="-shortPaired" /> -  - <param name="file_format" value="fasta" /> - <param name="read_type" value="shortPaired reads" /> - <param name="input" value="velvet_test_reads.fa" ftype="fasta" /> -  - <param name="strand_specific" value="" /> - <output name="out_file1" file="velveth_test1/output.html" lines_diff="4"> - <extra_files type="file" name='Sequences' value="velveth_test1/Sequences" compare="diff" /> - <extra_files type="file" name='Roadmaps' value="velveth_test1/Roadmaps" compare="diff" /> - </output> - </test> - </tests> - <help> + <param name="input" type="data" format="fasta,fastq,eland,gerald" label="Dataset"/> + </repeat> + </inputs> + <outputs> + <data format="velvet" name="out_file1" /> + </outputs> + <requirements> + <requirement type="package">velvet</requirement> + </requirements> + <tests> + <test> + <param name="hash_length" value="21" /> + <param name="read_type" value="-shortPaired" /> +  + <param name="file_format" value="fasta" /> + <param name="read_type" value="shortPaired reads" /> + <param name="input" value="velvet_test_reads.fa" ftype="fasta" /> +  + <param name="strand_specific" value="" /> + <output name="out_file1" file="velveth_test1/output.html" lines_diff="4"> + <extra_files type="file" name='Sequences' value="velveth_test1/Sequences" compare="diff" /> + <extra_files type="file" name='Roadmaps' value="velveth_test1/Roadmaps" compare="diff" /> + </output> + </test> + </tests> + <help> **Velvet Overview** Velvet_ is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454, developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI), near Cambridge, in the United Kingdom. Velvet currently takes in short read sequences, removes errors then produces high quality unique contigs. It then uses paired-end read and long read information, when available, to retrieve the repeated areas between contigs. -Read the Velvet `documentation`__ for details on using the Vevlet Assembler. +Read the Velvet `documentation`__ for details on using the Velvet Assembler. .. _Velvet: http://www.ebi.ac.uk/~zerbino/velvet/ @@ -124,5 +124,5 @@ long (for Sanger, 454 or even reference sequences) longPaired - </help> + </help></tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: [Peter Cock] Filtering tool: Only cast used columns. Fix valid lines and skipped info lines. [Kanwei] Add new testcases to test this behavior. Fixes #537. Fixes #535

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/cc686fadddbc/ changeset: cc686fadddbc branches: user: kanwei date: 2011-05-27 10:47:17 summary: [Peter Cock] Filtering tool: Only cast used columns. Fix valid lines and skipped info lines. [Kanwei] Add new testcases to test this behavior. Fixes #537. Fixes #535 affected #: 4 files (364 bytes) --- a/tools/stats/filtering.py Thu May 26 13:29:00 2011 -0400 +++ b/tools/stats/filtering.py Fri May 27 10:47:17 2011 +0200 @@ -32,7 +32,7 @@ cond_text = sys.argv[3] try: in_columns = int( sys.argv[4] ) - assert sys.argv[5] #check to see that the column types varaible isn't null + assert sys.argv[5] #check to see that the column types variable isn't null in_column_types = sys.argv[5].split( ',' ) except: stop_err( "Data does not appear to be tabular. This tool can only be used with tab-delimited data." ) @@ -60,22 +60,25 @@ except: if operand in secured: stop_err( "Illegal value '%s' in condition '%s'" % ( operand, cond_text ) ) - -# Find the largest column used in the filter. -largest_col_index = -1 -for match in re.finditer( 'c(\d)+', cond_text ): - col_index = int( match.group()[1:] ) - if col_index > largest_col_index: - largest_col_index = col_index + +# Work out which columns are used in the filter (save using 1 based counting) +used_cols = sorted(set(int(match.group()[1:]) \ + for match in re.finditer('c(\d)+', cond_text))) +largest_col_index = max(used_cols) # Prepare the column variable names and wrappers for column data types. Only -# prepare columns up to largest column in condition. +# cast columns used in the filter. cols, type_casts = [], [] for col in range( 1, largest_col_index + 1 ): col_name = "c%d" % col cols.append( col_name ) col_type = in_column_types[ col - 1 ] - type_cast = "%s(%s)" % ( col_type, col_name ) + if col in used_cols: + type_cast = "%s(%s)" % ( col_type, col_name ) + else: + #If we don't use this column, don't cast it. + #Otherwise we get errors on things like optional integer columns. + type_cast = col_name type_casts.append( type_cast ) col_str = ', '.join( cols ) # 'c1, c2, c3, c4' @@ -83,6 +86,7 @@ assign = "%s, = line.split( '\\t' )[:%i]" % ( col_str, largest_col_index ) wrap = "%s = %s" % ( col_str, type_cast_str ) skipped_lines = 0 +invalid_lines = 0 first_invalid_line = 0 invalid_line = None lines_kept = 0 @@ -96,9 +100,6 @@ line = line.rstrip( '\\r\\n' ) if not line or line.startswith( '#' ): skipped_lines += 1 - if not invalid_line: - first_invalid_line = i + 1 - invalid_line = line continue try: %s @@ -107,7 +108,7 @@ lines_kept += 1 print >> out, line except: - skipped_lines += 1 + invalid_lines += 1 if not invalid_line: first_invalid_line = i + 1 invalid_line = line @@ -132,5 +133,7 @@ print 'kept %4.2f%% of %d lines.' % ( 100.0*lines_kept/valid_lines, total_lines ) else: print 'Possible invalid filter condition "%s" or non-existent column referenced. See tool tips, syntax and examples.' % cond_text - if skipped_lines > 0: - print 'Skipped %d invalid lines starting at line #%d: "%s"' % ( skipped_lines, first_invalid_line, invalid_line ) + if invalid_lines: + print 'Skipped %d invalid line(s) starting at line #%d: "%s"' % ( invalid_lines, first_invalid_line, invalid_line ) + if skipped_lines: + print 'Skipped %i comment (starting with #) or blank line(s)' % skipped_lines --- a/tools/stats/filtering.xml Thu May 26 13:29:00 2011 -0400 +++ b/tools/stats/filtering.xml Fri May 27 10:47:17 2011 +0200 @@ -1,4 +1,4 @@ -<tool id="Filter1" name="Filter" version="1.0.1"> +<tool id="Filter1" name="Filter" version="1.1.0"><description>data on any column using simple expressions</description><command interpreter="python"> filtering.py $input $out_file1 "$cond" ${input.metadata.columns} "${input.metadata.column_types}" @@ -29,7 +29,11 @@ <param name="cond" value="c3=='chr1' and c5>5"/><output name="out_file1" file="filter1_test3.sam"/></test> - + <test> + <param name="input" value="filter1_inbad.bed"/> + <param name="cond" value="c1=='chr22'"/> + <output name="out_file1" file="filter1_test4.bed"/> + </test></tests><help> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: richard_burhans: updated help section for the genome diversity extract primers tool

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/bae2efef9ac7/ changeset: r5602:bae2efef9ac7 user: richard_burhans date: 2011-05-26 19:29:00 summary: updated help section for the genome diversity extract primers tool affected #: 1 file (153 bytes) --- a/tools/genome_diversity/extract_primers.xml Thu May 26 08:27:52 2011 -0400 +++ b/tools/genome_diversity/extract_primers.xml Thu May 26 13:29:00 2011 -0400 @@ -49,7 +49,16 @@ <help> **What it does** - It extracts primers for the SNPs in the dataset. + This tool extracts primers for SNPs in the argument dataset using the + Primer3 program. The first line of output for a given SNP reports the + name of the assembled contig, the SNP's position in the contig, the + two variant nucleotides, and Primer3's "pair penalty". The next line, + if not blank, names restriction enzymes (from the user-adjustable list) + that differentially cut at that site, but do not cut at any other position + between and including the primer positions. The next lines show the SNP's + flanking regions, with the SNP position indicated by "n", including the + primer positions and an additional 3 nucleotides. + ----- @@ -57,30 +66,26 @@ - input file:: - chr2_75111355_75112576 314 A C L F chr2 75111676 C F 15 4 53 2 9 48 Y 96 0.369 0.355 0.396 0 - chr8_93901796_93905612 2471 A C A A chr8 93904264 A A 8 0 51 10 2 14 Y 961 0.016 0.534 0.114 2 - chr10_7434473_7435447 524 T C S S chr10 7435005 T S 11 5 90 14 0 69 Y 626 0.066 0.406 0.727 0 - chr14_80021455_80022064 138 G A H H chr14 80021593 G H 14 0 69 9 6 124 Y 377 0.118 0.997 0.195 1 - chr15_64470252_64471048 89 G A Y Y chr15 64470341 G Y 5 6 109 14 0 69 Y 312 0.247 0.998 0.393 0 - chr18_48070585_48071386 514 C T E K chr18 48071100 T K 7 7 46 14 0 69 Y 2 0.200 0.032 0.163 0 - chr18_50154905_50155664 304 A G Y C chr18 50155208 A Y 4 2 17 5 1 22 Y 8 0.022 0.996 0.128 0 - chr18_57379354_57380496 315 C T V V chr18 57379669 G V 11 0 60 9 6 62 Y 726 0.118 0.048 0.014 1 - chr19_14240610_14242055 232 C T A V chr19 14240840 C A 18 8 56 15 5 42 Y 73 0.003 0.153 0.835 0 - chr19_39866997_39874915 3117 C T P P chr19 39870110 C P 3 7 65 14 2 32 Y 6 0.321 0.911 0.462 4 - etc. + chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 + chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 + chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 + chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 - output file:: - > chr2_75111355_75112576 314 A C 0.613831 + chr5_30800874_30802049 734 G A 0.352964 + BglII,MboI,Sau3AI,Tru9I,XhoII + 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA + >>>>>>>>>>>>>>>>>>>> - 1 TTTGCCCTGAGGCAGACTTTTTAAAGTACTGTGTAATGTATGAAGTCCTTCTGCTCAAGC - >>>>>>>>>>>>>>>>>>>> - - 61 AAATCATTGGCATGAAAACAGTTGCAAACTTATTGTGAGAGAAGAGTCCAAGAGTTTTAA - - - 121 CAGTCTGTAAGTATATAGCCTGTGAGTTTGATTTCCTTCTTGTTTTTnTTCCAGAAACAT - + 61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT + + + 21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT + <<<<<<< + + 181 TGAACCTTGGCTCTGA + <<<<<<<<<<<<< etc. </help></tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: Remove debug

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/cfda1bc74468/ changeset: r5601:cfda1bc74468 user: kanwei date: 2011-05-26 14:27:52 summary: Remove debug affected #: 1 file (23 bytes) --- a/lib/galaxy/web/controllers/user.py Thu May 26 08:20:37 2011 -0400 +++ b/lib/galaxy/web/controllers/user.py Thu May 26 08:27:52 2011 -0400 @@ -437,7 +437,6 @@ active_view="user" ) @web.expose def create( self, trans, cntrller='user', redirect_url='', refresh_frames=[], **kwd ): - print cntrller params = util.Params( kwd ) message = util.restore_text( params.get( 'message', '' ) ) status = params.get( 'status', 'done' ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: Fix user/create from direct URL access

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/242a479242cd/ changeset: r5600:242a479242cd user: kanwei date: 2011-05-26 14:20:37 summary: Fix user/create from direct URL access affected #: 1 file (30 bytes) --- a/lib/galaxy/web/controllers/user.py Thu May 26 09:50:07 2011 +0200 +++ b/lib/galaxy/web/controllers/user.py Thu May 26 08:20:37 2011 -0400 @@ -436,7 +436,8 @@ status='done', active_view="user" ) @web.expose - def create( self, trans, cntrller, redirect_url='', refresh_frames=[], **kwd ): + def create( self, trans, cntrller='user', redirect_url='', refresh_frames=[], **kwd ): + print cntrller params = util.Params( kwd ) message = util.restore_text( params.get( 'message', '' ) ) status = params.get( 'status', 'done' ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

commit/galaxy-central: kanwei: Make branding not cover header links

by Bitbucket

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/bfa4ff026215/ changeset: r5599:bfa4ff026215 user: kanwei date: 2011-05-26 09:50:07 summary: Make branding not cover header links affected #: 2 files (32 bytes) --- a/static/june_2007_style/blue/panel_layout.css Wed May 25 17:12:21 2011 +0200 +++ b/static/june_2007_style/blue/panel_layout.css Thu May 26 09:50:07 2011 +0200 @@ -35,7 +35,7 @@ .panel-info-message{background-image:url(info_small.png);background-color:#CCCCFF;} #masthead{position:absolute;top:0;left:0;width:100%;min-width:900px;height:32px;background:#2C3143;color:#fff;border-bottom:solid #444 1px;z-index:15000;padding:0;} #masthead a{color:#eeeeee;text-decoration:none;} -#masthead .title{font-family:verdana;padding:3px 10px;font-size:175%;font-weight:bold;} +#masthead .title{font-family:verdana;padding:3px 10px;font-size:175%;font-weight:bold;z-index:-1;} #masthead a:hover{text-decoration:underline;} .tab-group{margin:0;padding:0 10px;height:100%;white-space:nowrap;cursor:default;background:transparent;} .tab-group .tab{background:#2C3143;position:relative;float:left;margin:0;padding:0 1em;height:32px;line-height:32px;text-align:left;} --- a/static/june_2007_style/panel_layout.css.tmpl Wed May 25 17:12:21 2011 +0200 +++ b/static/june_2007_style/panel_layout.css.tmpl Thu May 26 09:50:07 2011 +0200 @@ -259,6 +259,7 @@ padding: 3px 10px; font-size: 175%; font-weight: bold; + z-index: -1; } } Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

10 years, 12 months

1
0
0 / 0

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

galaxy-commits May 2011