galaxy-commits July 2013

galaxy-commits@lists.galaxyproject.org

1 participants
83 discussions

commit/galaxy-central: carlfeberhard: library upload: sort dbkeys, default to unspecified, remove unneeded call to replace_big_select_inputs
by commits-noreply＠bitbucket.org 22 Jul '13

22 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/3a2753976434/ Changeset: 3a2753976434 User: carlfeberhard Date: 2013-07-22 21:48:50 Summary: library upload: sort dbkeys, default to unspecified, remove unneeded call to replace_big_select_inputs Affected #: 2 files diff -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 -r 3a27539764348d4099669bc7fe94c9432e62aff0 lib/galaxy/webapps/galaxy/controllers/library_common.py --- a/lib/galaxy/webapps/galaxy/controllers/library_common.py +++ b/lib/galaxy/webapps/galaxy/controllers/library_common.py @@ -949,7 +949,10 @@ # Send list of data formats to the upload form so the "extension" select list can be populated dynamically file_formats = trans.app.datatypes_registry.upload_file_formats + dbkeys = trans.app.genomes.get_dbkeys( trans ) + dbkeys.sort( key=lambda dbkey: dbkey[0].lower() ) + # Send the current history to the form to enable importing datasets from history to library history = trans.get_history() if history is not None: diff -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 -r 3a27539764348d4099669bc7fe94c9432e62aff0 templates/webapps/galaxy/library/common/common.mako --- a/templates/webapps/galaxy/library/common/common.mako +++ b/templates/webapps/galaxy/library/common/common.mako @@ -271,8 +271,16 @@ <label>Genome:</label><div class="form-row-input"><select name="dbkey" last_selected_value="?"> + <% + # move unspecified to the first option and set as default if not last_used_build + #TODO: remove when we decide on a common dbkey selector widget + unspecified = ('unspecified (?)', '?') + dbkeys.remove( unspecified ) + dbkeys.insert( 0, unspecified ) + default_selected = last_used_build or '?' + %> %for dbkey in dbkeys: - %if dbkey[1] == last_used_build: + %if dbkey[1] == default_selected: <option value="${dbkey[1]}" selected>${dbkey[0]}</option> %else: <option value="${dbkey[1]}">${dbkey[0]}</option> @@ -331,13 +339,6 @@ </form></div></div> - ## Script to replace dbkey select with select+search. - <script type="text/javascript"> - // Replace dbkey select with search+select. - jQuery(document).ready( function() { - replace_big_select_inputs(); - }); - </script> %elif upload_option == 'import_from_history': <div class="toolForm"><div class="toolFormTitle">Active datasets in your current history (${ util.unicodify( history.name )})</div> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: Dave Bouvier: Wrap the repository type select in form tags so that Twill will correctly parse the HTML on the browse repository files page. This resolves failing functional tests in the test_0440_deleting_dependency_definitions script.
by commits-noreply＠bitbucket.org 22 Jul '13

22 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/b72d967e0cf4/ Changeset: b72d967e0cf4 User: Dave Bouvier Date: 2013-07-22 19:14:58 Summary: Wrap the repository type select in form tags so that Twill will correctly parse the HTML on the browse repository files page. This resolves failing functional tests in the test_0440_deleting_dependency_definitions script. Affected #: 2 files diff -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 templates/webapps/tool_shed/repository/browse_repository.mako --- a/templates/webapps/tool_shed/repository/browse_repository.mako +++ b/templates/webapps/tool_shed/repository/browse_repository.mako @@ -46,7 +46,9 @@ ${render_clone_str( repository )} </div> %endif - ${render_repository_type_select_field( repository_type_select_field, render_help=False )} + <form name="repository_type"> + ${render_repository_type_select_field( repository_type_select_field, render_help=False )} + </form> %if can_push: <form name="select_files_to_delete" id="select_files_to_delete" action="${h.url_for( controller='repository', action='select_files_to_delete', id=trans.security.encode_id( repository.id ))}" method="post" ><div class="form-row" > diff -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 test/tool_shed/base/twilltestcase.py --- a/test/tool_shed/base/twilltestcase.py +++ b/test/tool_shed/base/twilltestcase.py @@ -348,7 +348,7 @@ # Twill sets hidden form fields to read-only by default. We need to write to this field. form = tc.browser.get_form( 'select_files_to_delete' ) form.find_control( "selected_files_to_delete" ).readonly = False - tc.fv( "1", "selected_files_to_delete", ','.join( files_to_delete ) ) + tc.fv( "2", "selected_files_to_delete", ','.join( files_to_delete ) ) tc.submit( 'select_files_to_delete_button' ) self.check_for_strings( strings_displayed, strings_not_displayed ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/ca99a6970101/ Changeset: ca99a6970101 Branch: mepcotterell/allow-pip-to-run-when-venv_directory-con-1373715782557 User: mepcotterell Date: 2013-07-13 13:44:05 Summary: allow pip to run when venv_directory contains spaces Affected #: 1 file diff -r a0ea8ac5583cd295266eac38a12da4d9fd7613ac -r ca99a6970101125e19328e72216c120a3a8027aa lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -277,7 +277,7 @@ # POSIXLY_CORRECT forces shell commands . and source to have the same # and well defined behavior in bash/zsh. activate_command = "POSIXLY_CORRECT=1; . %s" % os.path.join( venv_directory, "bin", "activate" ) - install_command = "pip install -r '%s'" % requirements_path + install_command = "python '%s' install -r '%s'" % ( os.path.join( venv_directory, "bin", "pip" ), requirements_path ) full_setup_command = "%s; %s; %s" % ( setup_command, activate_command, install_command ) return_code = handle_command( app, tool_dependency, install_dir, full_setup_command ) if return_code: https://bitbucket.org/galaxy/galaxy-central/commits/559effee9eb7/ Changeset: 559effee9eb7 User: natefoo Date: 2013-07-19 22:52:50 Summary: Merged in mepcotterell/galaxy-central/mepcotterell/allow-pip-to-run-when-venv_directory-con-1373715782557 (pull request #195) allow pip to run when venv_directory contains spaces Affected #: 1 file diff -r 2ba6bd8a9d25e26ce6668c2a0219199b49e255d7 -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -277,7 +277,7 @@ # POSIXLY_CORRECT forces shell commands . and source to have the same # and well defined behavior in bash/zsh. activate_command = "POSIXLY_CORRECT=1; . %s" % os.path.join( venv_directory, "bin", "activate" ) - install_command = "pip install -r '%s'" % requirements_path + install_command = "python '%s' install -r '%s'" % ( os.path.join( venv_directory, "bin", "pip" ), requirements_path ) full_setup_command = "%s; %s; %s" % ( setup_command, activate_command, install_command ) return_code = handle_command( app, tool_dependency, install_dir, full_setup_command ) if return_code: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Enhance the change_directory action for installing tool dependencies via fabric to allow for changing the current directory to a location above the current working directory as long as the location is still within the defined working_directory.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/2ba6bd8a9d25/ Changeset: 2ba6bd8a9d25 User: greg Date: 2013-07-19 21:19:04 Summary: Enhance the change_directory action for installing tool dependencies via fabric to allow for changing the current directory to a location above the current working directory as long as the location is still within the defined working_directory. Affected #: 1 file diff -r 5d0cfe53740b554f2643a3518ea23807dfdb26a5 -r 2ba6bd8a9d25e26ce6668c2a0219199b49e255d7 lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -339,9 +339,13 @@ extract = action_dict.get( 'extract', False ) common_util.url_download( current_dir, filename, url, extract=extract ) elif action_type == 'change_directory': - target_directory = os.path.realpath( os.path.join( current_dir, action_dict[ 'directory' ] ) ) + target_directory = os.path.realpath( os.path.normpath( os.path.join( current_dir, action_dict[ 'directory' ] ) ) ) if target_directory.startswith( os.path.realpath( current_dir ) ) and os.path.exists( target_directory ): + # Change directory to a directory within the current working directory. dir = target_directory + elif target_directory.startswith( os.path.realpath( work_dir ) ) and os.path.exists( target_directory ): + # Change directory to a directory above the current working directory, but within the defined work_dir. + dir = target_directory.replace( os.path.realpath( work_dir ), '' ).lstrip( '/' ) else: log.error( 'Invalid or nonexistent directory %s specified, ignoring change_directory action.', target_directory ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: guerler: bowtie2 wrapper update
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/5d0cfe53740b/ Changeset: 5d0cfe53740b User: guerler Date: 2013-07-19 20:56:39 Summary: bowtie2 wrapper update Affected #: 1 file diff -r 883d7c4b387c0e701539b49e593144b7c027a64c -r 5d0cfe53740b554f2643a3518ea23807dfdb26a5 tools/sr_mapping/bowtie2_wrapper.xml --- a/tools/sr_mapping/bowtie2_wrapper.xml +++ b/tools/sr_mapping/bowtie2_wrapper.xml @@ -99,7 +99,7 @@ ## rename unaligned sequence files #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: - #set left = str(str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )) + #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' ) #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) mv $left $output_unaligned_reads_l; @@ -317,6 +317,7 @@ Trim n-bases from 5' (left) end of each read before alignment. *-3/--trim3 (default: 0)* + Trim n-bases from 3' (right) end of each read before alignment. *--nofw/--norc (default: both strands enabled)* Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: guerler: bowtie2 tool wrapper update
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/883d7c4b387c/ Changeset: 883d7c4b387c User: guerler Date: 2013-07-19 20:30:38 Summary: bowtie2 tool wrapper update Affected #: 2 files diff -r cd7fe5ef532822f778dda054ec434aec6ce17eee -r 883d7c4b387c0e701539b49e593144b7c027a64c tools/sr_mapping/bowtie2_wrapper.py --- a/tools/sr_mapping/bowtie2_wrapper.py +++ /dev/null @@ -1,172 +0,0 @@ -#!/usr/bin/env python - -import optparse, os, shutil, subprocess, sys, tempfile, fileinput - -def stop_err( msg ): - sys.stderr.write( "%s\n" % msg ) - sys.exit() - -def __main__(): - #Parse Command Line - parser = optparse.OptionParser() - parser.add_option( '-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.' ) - parser.add_option( '', '--own-file', dest='own_file', help='' ) - parser.add_option( '-D', '--indexes-path', dest='index_path', help='Indexes directory; location of .ebwt and .fa files.' ) - - # Wrapper options. - parser.add_option( '-O', '--output', dest='output' ) - parser.add_option( '-1', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) - parser.add_option( '-2', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) - parser.add_option( '', '--single-paired', dest='single_paired', help='' ) - parser.add_option( '-I', '--minins', dest='min_insert' ) - parser.add_option( '-X', '--maxins', dest='max_insert' ) - parser.add_option( '', '--settings', dest='settings', help='' ) - parser.add_option( '', '--end-to-end', dest='end_to_end', action="store_true" ) - parser.add_option( '', '--local', dest='local', action="store_true" ) - parser.add_option( '', '--preset-alignment', dest='preset_alignment') - - # Read group options. - parser.add_option( '', '--rgid', dest='rgid', help='Read group identifier' ) - parser.add_option( '', '--rglb', dest='rglb', help='Library name' ) - parser.add_option( '', '--rgpl', dest='rgpl', help='Platform/technology used to produce the reads' ) - parser.add_option( '', '--rgsm', dest='rgsm', help='Sample' ) - - parser.add_option( '', '--output_unaligned_reads', dest='output_unaligned_reads', help='File name for unaligned reads (single-end)' ) - parser.add_option( '', '--output_unaligned_reads_l', dest='output_unaligned_reads_l', help='File name for unaligned reads (left, paired-end)' ) - parser.add_option( '', '--output_unaligned_reads_r', dest='output_unaligned_reads_r', help='File name for unaligned reads (right, paired-end)' ) - - (options, args) = parser.parse_args() - - tmp_unaligned_file_name = None - # Creat bowtie index if necessary. - tmp_index_dir = tempfile.mkdtemp() - - if options.single_paired == 'paired': - if options.output_unaligned_reads_l and options.output_unaligned_reads_r: - tmp_unaligned_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) - tmp_unaligned_file_name = tmp_unaligned_file.name - tmp_unaligned_file.close() - output_unaligned_reads = '--un-conc %s' % tmp_unaligned_file_name - else: - output_unaligned_reads = '' - elif options.output_unaligned_reads: - output_unaligned_reads = '--un %s' % options.output_unaligned_reads - else: - output_unaligned_reads = '' - - if options.own_file: - index_path = os.path.join( tmp_index_dir, '.'.join( os.path.split( options.own_file )[1].split( '.' )[:-1] ) ) - try: - os.link( options.own_file, index_path + '.fa' ) - except: - # Bowtie prefers (but doesn't require) fasta file to be in same directory, with .fa extension - pass - cmd_index = 'bowtie2-build -f %s %s' % ( options.own_file, index_path ) - try: - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name - tmp_stderr = open( tmp, 'wb' ) - proc = subprocess.Popen( args=cmd_index, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - except Exception, e: - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( 'Error indexing reference sequence\n' + str( e ) ) - else: - index_path = options.index_path - - # Build bowtie command; use view and sort to create sorted bam. - cmd = 'bowtie2 %s -x %s %s %s | samtools view -Su - | samtools sort -o - - > %s' - - # Set up reads. - if options.single_paired == 'paired': - reads = " -1 %s -2 %s" % ( options.input1, options.input2 ) - else: - reads = " -U %s" % ( options.input1 ) - - # Set up options. - opts = '-p %s' % ( options.num_threads ) - if options.single_paired == 'paired': - if options.min_insert: - opts += ' -I %s' % options.min_insert - if options.max_insert: - opts += ' -X %s' % options.max_insert - if options.settings == 'preSet': - pass - else: - if options.local: - opts += ' --local' - if options.preset_alignment: - opts += ' --' + options.preset_alignment - - # Read group options. - if options.rgid: - if not options.rglb or not options.rgpl or not options.rgsm: - stop_err( 'If you want to specify read groups, you must include the ID, LB, PL, and SM tags.' ) - opts += ' --rg-id %s' % options.rgid - opts += ' --rg %s:%s' % ( 'LB', options.rglb ) - opts += ' --rg %s:%s' % ( 'PL', options.rgpl ) - opts += ' --rg %s:%s' % ( 'SM', options.rgsm ) - - # Final command: - cmd = cmd % ( opts, index_path, reads, output_unaligned_reads, options.output ) - print cmd - - # Run - try: - tmp_out = tempfile.NamedTemporaryFile().name - tmp_stdout = open( tmp_out, 'wb' ) - tmp_err = tempfile.NamedTemporaryFile().name - tmp_stderr = open( tmp_err, 'wb' ) - proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stdout=tmp_stdout, stderr=tmp_stderr ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp_err, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stdout.close() - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - - # TODO: look for errors in program output. - except Exception, e: - stop_err( 'Error in bowtie2:\n' + str( e ) ) - - # get unaligned reads output files in place if appropriate - if options.single_paired == 'paired' and tmp_unaligned_file_name and options.output_unaligned_reads_l and options.output_unaligned_reads_r: - try: - left = tmp_unaligned_file_name.replace( '.fastq', '.1.fastq' ) - right = tmp_unaligned_file_name.replace( '.fastq', '.2.fastq' ) - shutil.move( left, options.output_unaligned_reads_l ) - shutil.move( right, options.output_unaligned_reads_r ) - except Exception, e: - sys.stdout.write( 'Error producing the unaligned output files.\n' ) - - # Clean up temp dirs - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - -if __name__=="__main__": __main__() diff -r cd7fe5ef532822f778dda054ec434aec6ce17eee -r 883d7c4b387c0e701539b49e593144b7c027a64c tools/sr_mapping/bowtie2_wrapper.xml --- a/tools/sr_mapping/bowtie2_wrapper.xml +++ b/tools/sr_mapping/bowtie2_wrapper.xml @@ -1,4 +1,4 @@ -<tool id="bowtie2" name="Bowtie2" version="0.1"> +<tool id="bowtie2" name="Bowtie2" version="0.2"><description>is a short-read aligner</description><version_command>bowtie2 --version</version_command> @@ -6,85 +6,136 @@ <requirement type="package">bowtie2</requirement><requirement type="package">samtools</requirement></requirements> - <command interpreter="python"> - bowtie2_wrapper.py + + <command> + ## prepare bowtie2 index + #set index_path = '' + #if str($reference_genome.source) == "history": + bowtie2-build "$reference_genome.own_file" genome; ln -s "$reference_genome.own_file" genome.fa; + #set index_path = 'genome' + #else: + #set index_path = $reference_genome.index.fields.path + #end if - ## Change this to accommodate the number of threads you have available. - --num-threads="4" + ## execute bowtie2 + bowtie2 + + ## number of threads + -p 4 - ## Outputs. - --output=$output - - #if str( $singlePaired.sPaired ) == "single" + ## index file path + -x $index_path + + ## check for single/pair-end + #if str( $library.type ) == "single" + ## prepare inputs + -U $library.input_1 + #if $output_unaligned_reads_l - --output_unaligned_reads=$output_unaligned_reads_l + --un $output_unaligned_reads_l #end if #else - #if $output_unaligned_reads_l and $output_unaligned_reads_r - --output_unaligned_reads_l=$output_unaligned_reads_l - --output_unaligned_reads_r=$output_unaligned_reads_r + ## prepare inputs + -1 $library.input_1 + -2 $library.input_2 + -I $library.min_insert + -X $library.max_insert + + #if $output_unaligned_reads_l + --un-conc $output_unaligned_reads_l #end if #end if - ## Handle reference file. - #if $refGenomeSource.genomeSource == "history": - --own-file=$refGenomeSource.ownFile - #else: - --indexes-path="${refGenomeSource.index.fields.path}" - #end if + ## configure settings + #if str($params.full) == "yes": + ## add alignment type + $params.align_type - ## Are reads single-end or paired? - --single-paired=$singlePaired.sPaired + ## add performance + $params.performance + + ## add time flag + $params.time + + ## add nofw/norc + $params.nofw_norc - ## First input file always required. - --input1=$input1 + ## set gbar + --gbar $params.gbar - ## Second input only if input is paired-end. - #if $singlePaired.sPaired == "paired" - --input2=$singlePaired.input2 - -I $singlePaired.minInsert - -X $singlePaired.maxInsert - #end if + ## check skip + #if str($params.skip) != "0": + -s $params.skip + #end if - ## Set params. - --settings=$params.settingsType + ## check upto + #if str($params.upto) != "0": + -u $params.upto + #end if - #if $params.settingsType == "full": - #if str($params.align_type) == "end_to_end": - --end-to-end --preset-alignment=$params.preset.align_preset_select - #else: - --local --preset-alignment=$params.preset.align_preset_select-local + ## check trim5 + #if str($params.trim5) != "0": + -5 $params.trim5 + #end if + + ## check trim3 + #if str($params.trim3) != "0": + -3 $params.trim3 #end if #end if - - ## Read group information. - #if $readGroup.specReadGroup == "yes" - --rgid="$readGroup.rgid" - --rglb="$readGroup.rglb" - --rgpl="$readGroup.rgpl" - --rgsm="$readGroup.rgsm" + + ## read group information + #if str($read_group.selection) == "yes": + #if $read_group.rgid and $read_group.rglb and $read_group.rgpl and $read_group.rgsm: + --rg-id $read_group.rgid + --rg LB:$read_group.rglb + --rg PL:$read_group.rgpl + --rg SM:$read_group.rgsm + #end if + #end if + + ## view/sort and output file + | samtools view -Su - | samtools sort -o - - > $output; + + ## rename unaligned sequence files + #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: + #set left = str(str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )) + #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) + + mv $left $output_unaligned_reads_l; + mv $right $output_unaligned_reads_r; #end if </command> + +  + <stdio> + <regex match="Exception" source="stderr" level="fatal" description="Tool exception"/> + </stdio> + <inputs> - <conditional name="singlePaired"> - <param name="sPaired" type="select" label="Is this library mate-paired?"> +  + <conditional name="library"> + <param name="type" type="select" label="Is this library mate-paired?"><option value="single">Single-end</option><option value="paired">Paired-end</option></param><when value="single"> - <param format="fastqsanger" name="input1" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/></when><when value="paired"> - <param format="fastqsanger" name="input1" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> - <param format="fastqsanger" name="input2" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> -  - <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments" /> - <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments" /> + <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <param name="input_2" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <param name="min_insert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments" /> + <param name="max_insert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments" /></when></conditional> - <param name="unalignedFile" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write all reads that could not be aligned to a file (uses --un for single-end and --un-conc for paired-ends)" /> - <conditional name="refGenomeSource"> - <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + +  + <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads to separate file(s)" /> + +  + <conditional name="reference_genome"> + <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"><option value="indexed">Use a built-in index</option><option value="history">Use one from the history</option></param> @@ -97,40 +148,13 @@ </param></when><when value="history"> - <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> - </when> - </conditional> - <conditional name="params"> - <param name="settingsType" type="select" label="Parameter Settings" help="You can use the default settings or set custom values for any of Bowtie's parameters."> - <option value="preSet">Use Defaults</option> - <option value="full">Full parameter list</option> - </param> - <when value="preSet" /> -  - <when value="full"> - <param name="align_type" type="select" label="Type of alignment"> - <option selected="true" value="end_to_end">End to end</option> - <option value="local">Local</option> - </param> - <conditional name="preset"> - <param name="b2_preset" type="select" label="Use Preset options"> - <option selected="true" value="Yes">Yes</option> - <option value="No">No</option> - </param> - <when value="Yes"> - <param name="align_preset_select" type="select" label="Preset option"> - <option value="very-fast">Very fast</option> - <option value="fast">Fast</option> - <option selected="true" value="sensitive">Sensitive</option> - <option value="very-sensitive">Very sensitive</option> - </param> - </when> - <when value="No" /> - </conditional> - </when> - </conditional> - <conditional name="readGroup"> - <param name="specReadGroup" type="select" label="Specify the read group for this file?"> + <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> + </when> + </conditional> + +  + <conditional name="read_group"> + <param name="selection" type="select" label="Specify the read group for this file?"><option value="yes">Yes</option><option value="no" selected="True">No</option></param> @@ -141,40 +165,87 @@ <param name="rgsm" type="text" size="25" label="Sample (SM)" help="Required if RG specified. Use pool name where a pool is being sequenced" /></when><when value="no" /> - </conditional> + </conditional> + +  + <conditional name="params"> + <param name="full" type="select" label="Parameter Settings" help="You can use the default settings or set custom values for any of Bowtie's parameters."> + <option value="no">Use defaults</option> + <option value="yes">Full parameter list</option> + </param> + <when value="yes"> + <param name="align_type" type="select" label="Type of alignment"> + <option value="" selected="true">End to end</option> + <option value="--local">Local</option> + </param> + + <param name="performance" type="select" label="Preset option"> + <option value="">Default</option> + <option value="--very-fast">Very fast</option> + <option value="--fast">Fast</option> + <option value="--sensitive" selected="true">Sensitive</option> + <option value="--very-sensitive">Very sensitive</option> + </param> + + <param name="gbar" type="integer" value="4" label="Disallow gaps within n-positions of read" /> + + <param name="trim5" type="integer" value="0" label="Trim n-bases from 5' of each read" /> + + <param name="trim3" type="integer" value="0" label="Trim n-bases from 3' of each read" /> + + <param name="skip" type="integer" value="0" label="Skip the first n-reads" /> + + <param name="upto" type="integer" value="0" label="Number of reads to be aligned (0 = unlimited)" /> + + <param name="nofw_norc" type="select" label="Strand directions"> + <option value="">Both</option> + <option value="--nofw">Disable forward</option> + <option value="--norc">Disable reverse</option> + </param> + + <param name="time" type="select" label="Log mapping time"> + <option value="">No</option> + <option value="--time">Yes</option> + </param> + + </when> + <when value="no" /> + </conditional> + </inputs> + <outputs><data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > - <filter>unalignedFile is True</filter> + <filter>unaligned_file is True</filter><actions><action type="format"> - <option type="from_param" name="singlePaired.input1" param_attribute="ext" /> + <option type="from_param" name="library.input_1" param_attribute="ext" /></action></actions></data><data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)"> - <filter>singlePaired['sPaired'] == "paired" and unalignedFile is True</filter> + <filter>library['type'] == "paired" and unaligned_file is True</filter><actions><action type="format"> - <option type="from_param" name="singlePaired.input1" param_attribute="ext" /> + <option type="from_param" name="library.input_1" param_attribute="ext" /></action></actions></data><data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads"><actions> - <conditional name="refGenomeSource.genomeSource"> + <conditional name="reference_genome.source"><when value="indexed"><action type="metadata" name="dbkey"><option type="from_data_table" name="bowtie2_indexes" column="1" offset="0"><filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> - <filter type="param_value" ref="refGenomeSource.index" column="0"/> + <filter type="param_value" ref="reference_genome.index" column="0"/></option></action></when><when value="history"><action type="metadata" name="dbkey"> - <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" /></action></when></conditional> @@ -186,5 +257,115 @@ </tests><help> +**Bowtie2 Overview** + +Bowtie_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools. + +*Please cite:* Langmead, B., Trapnell, C., Pop, M. and Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25 (2009) + +.. _Bowtie: http://bowtie-bio.sourceforge.net/bowtie2/ + +------ + +**Inputs** + +Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. + +------ + +**Outputs** + +The mapped sequence reads are provided as BAM file, while unmapped reads are optionally available as SAM records. When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:: + + 20000 reads; of these: + 20000 (100.00%) were unpaired; of these: + 1247 (6.24%) aligned 0 times + 18739 (93.69%) aligned exactly 1 time + 14 (0.07%) aligned >1 times + 93.77% overall alignment rate + +------ + +**Alignment options** + +*--end-to-end/--local* + +By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment. When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score. + +End-to-end alignment example:: + + Read GACTGGGCGATCTCGACTTCG + ||||| |||||||||||||| + Reference GACTG--CGATCTCGACATCG + +Local alignment example:: + + Read ACGGTTGCGTTAA-TCCGCCACG + ||||||||| |||||| + Reference TAACTTGCGTTAAATCCGCCTGG + +*-s/--skip (default: 0)* + +Skip (i.e. do not align) the first n-reads or pairs in the input. + +*-u/--qupto (default: no limit)* + +Align the first n-reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop. + +*-5/--trim5 (default: 0)* + +Trim n-bases from 5' (left) end of each read before alignment. + +*-3/--trim3 (default: 0)* +Trim n-bases from 3' (right) end of each read before alignment. + +*--nofw/--norc (default: both strands enabled)* + +If --nofw is specified, Bowtie 2 will not attempt to align unpaired reads to the forward (Watson) reference strand. If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes Bowtie 2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled. + +*--gbar (default: 4)* + +Disallow gaps within n-positions of the beginning or end of the read. + +------ + +**Paired-end options** + +*-I/--minins (default: 0)* + +The minimum fragment length for valid paired-end alignments. E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. + +The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. + +*-X/--maxins (default: 0)* + +The maximum fragment length for valid paired-end alignments. E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. + +The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. + +------ + +**SAM options** + +*--rg-id [text]* + +Set the read group ID to [text]. This causes the SAM @RG header line to be printed, with [text] as the value associated with the ID: tag. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to [text]. + +*--rg [text]* + +Add [text] as a field on the @RG header line. Note: in order for the @RG line to appear, --rg-id must also be specified. This is because the ID tag is required by the SAM Spec. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal. + +------ + +**Output options** + +*--un/--un-conc* + +Write reads that fail to align concordantly to file(s). These reads correspond to the SAM records. + +*-t/--time (default: off)* + +Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. + </help></tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: More fixes for managing tool dependencies for installed tool shed repositories.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/cd7fe5ef5328/ Changeset: cd7fe5ef5328 User: greg Date: 2013-07-19 20:14:59 Summary: More fixes for managing tool dependencies for installed tool shed repositories. Affected #: 1 file diff -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 -r cd7fe5ef532822f778dda054ec434aec6ce17eee lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -731,9 +731,15 @@ message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) tool_dependency_ids = tool_dependency_util.get_tool_dependency_ids( as_string=False, **kwd ) - # We need a tool_shed_repository, so get it from one of the tool_dependencies. - tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) - tool_shed_repository = tool_dependency.tool_shed_repository + repository_id = kwd.get( 'repository_id', None ) + if tool_dependency_ids: + # We need a tool_shed_repository, so get it from one of the tool_dependencies. + tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) + tool_shed_repository = tool_dependency.tool_shed_repository + else: + # The user must be on the manage_repository_tool_dependencies page and clicked the button to either install or uninstall a + # tool dependency, but they didn't check any of the available tool dependencies on which to perform the action. + tool_shed_repository = suc.get_tool_shed_repository_by_id( trans, repository_id ) self.tool_dependency_grid.title = "Tool shed repository '%s' tool dependencies" % tool_shed_repository.name if 'operation' in kwd: operation = kwd[ 'operation' ].lower() @@ -773,6 +779,7 @@ return trans.response.send_redirect( web.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids, + repository_id=repository_id, message=message, status=status ) ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fixes for managing the tool dependencies of an installed tool shed repository.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/2c257f0cbeb8/ Changeset: 2c257f0cbeb8 User: greg Date: 2013-07-19 19:57:31 Summary: Fixes for managing the tool dependencies of an installed tool shed repository. Affected #: 3 files diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -653,9 +653,15 @@ message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) tool_dependency_ids = tool_dependency_util.get_tool_dependency_ids( as_string=False, **kwd ) - # We need a tool_shed_repository, so get it from one of the tool_dependencies. - tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) - tool_shed_repository = tool_dependency.tool_shed_repository + if tool_dependency_ids: + # We need a tool_shed_repository, so get it from one of the tool_dependencies. + tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) + tool_shed_repository = tool_dependency.tool_shed_repository + else: + # The user must be on the manage_repository_tool_dependencies page and clicked the button to either install or uninstall a + # tool dependency, but they didn't check any of the available tool dependencies on which to perform the action. + repository_id = kwd.get( 'repository_id', None ) + tool_shed_repository = suc.get_tool_shed_repository_by_id( trans, repository_id ) if 'operation' in kwd: operation = kwd[ 'operation' ].lower() if not tool_dependency_ids: @@ -664,7 +670,7 @@ kwd[ 'status' ] = 'error' del kwd[ 'operation' ] return trans.response.send_redirect( web.url_for( controller='admin_toolshed', - action='manage_installed_tool_dependencies', + action='manage_repository_tool_dependencies', **kwd ) ) if operation == 'browse': return trans.response.send_redirect( web.url_for( controller='admin_toolshed', @@ -720,7 +726,7 @@ @web.expose @web.require_admin def manage_tool_dependencies( self, trans, **kwd ): - # This method is called when tool dependencies are being installed. See the related manage_repository_tool-dependencies + # This method is called when tool dependencies are being installed. See the related manage_repository_tool_dependencies # method for managing the tool dependencies for a specified installed tool shed repository. message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako --- a/templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako +++ b/templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako @@ -44,7 +44,7 @@ <tr><td> %if tool_dependency.status not in [ trans.model.ToolDependency.installation_status.UNINSTALLED ]: - <a target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='browse', tool_dependency_ids=trans.security.encode_id( tool_dependency.id ) )}"> + <a target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='browse', tool_dependency_ids=trans.security.encode_id( tool_dependency.id ), repository_id=trans.security.encode_id( repository.id ) )}"> ${tool_dependency.name} </a> %else: @@ -60,7 +60,7 @@ </table> %if can_install: <br/> - <form name="install_tool_dependencies" id="install_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_tool_dependencies', operation='install' )}" method="post" > + <form name="install_tool_dependencies" id="install_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_tool_dependencies', operation='install', repository_id=trans.security.encode_id( repository.id ) )}" method="post" ><div class="form-row"> Check each tool dependency that you want to install and click <b>Install</b>. </div> @@ -81,7 +81,7 @@ %endif %if can_uninstall: <br/> - <form name="uninstall_tool_dependencies" id="uninstall_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='uninstall' )}" method="post" > + <form name="uninstall_tool_dependencies" id="uninstall_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='uninstall', repository_id=trans.security.encode_id( repository.id ) )}" method="post" ><div class="form-row"> Check each tool dependency that you want to uninstall and click <b>Uninstall</b>. </div> diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 templates/admin/tool_shed_repository/repository_actions_menu.mako --- a/templates/admin/tool_shed_repository/repository_actions_menu.mako +++ b/templates/admin/tool_shed_repository/repository_actions_menu.mako @@ -32,7 +32,7 @@ <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='set_tool_versions', id=trans.security.encode_id( repository.id ) )}">Set tool versions</a> %endif %if tool_dependency_ids: - <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids )}">Manage tool dependencies</a> + <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids, repository_id=trans.security.encode_id( repository.id ) )}">Manage tool dependencies</a> %endif <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='deactivate_or_uninstall_repository', id=trans.security.encode_id( repository.id ) )}">Deactivate or uninstall repository</a> %endif Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/25a0393e9112/ Changeset: 25a0393e9112 User: dan Date: 2013-07-19 19:40:39 Summary: Fix server error when an invalid locale is provided by a clients browser. Better handling of locales provided with surrounding whitespace. Affected #: 1 file diff -r a498340fed83e012e23f83f00d63b6ddaa5687cb -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py +++ b/lib/galaxy/web/framework/__init__.py @@ -367,9 +367,9 @@ client_locales = self.environ['HTTP_ACCEPT_LANGUAGE'].split( ',' ) for locale in client_locales: try: - locales.append( Locale.parse( locale.split( ';' )[0], sep='-' ).language ) - except UnknownLocaleError: - pass + locales.append( Locale.parse( locale.split( ';' )[0].strip(), sep='-' ).language ) + except Exception, e: + log.debug( "Error parsing locale '%s'. %s: %s", locale, type( e ), e ) if not locales: # Default to English locales = 'en' https://bitbucket.org/galaxy/galaxy-central/commits/cd6fec2f5cba/ Changeset: cd6fec2f5cba Branch: stable User: dan Date: 2013-07-19 19:40:39 Summary: Fix server error when an invalid locale is provided by a clients browser. Better handling of locales provided with surrounding whitespace. Affected #: 1 file diff -r 9ebd7732e616492f4570587496f1b9074cb2eac7 -r cd6fec2f5cba878de9943dd00abe816a65dc96db lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py +++ b/lib/galaxy/web/framework/__init__.py @@ -367,9 +367,9 @@ client_locales = self.environ['HTTP_ACCEPT_LANGUAGE'].split( ',' ) for locale in client_locales: try: - locales.append( Locale.parse( locale.split( ';' )[0], sep='-' ).language ) - except UnknownLocaleError: - pass + locales.append( Locale.parse( locale.split( ';' )[0].strip(), sep='-' ).language ) + except Exception, e: + log.debug( "Error parsing locale '%s'. %s: %s", locale, type( e ), e ) if not locales: # Default to English locales = 'en' Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Filter out repository dependencies that have been deleted from the repository grids in the tool shed.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/a498340fed83/ Changeset: a498340fed83 User: greg Date: 2013-07-19 15:47:41 Summary: Filter out repository dependencies that have been deleted from the repository grids in the tool shed. Affected #: 1 file diff -r d9fe5bea5a43c4c4645408a9035ad818d89d012c -r a498340fed83e012e23f83f00d63b6ddaa5687cb lib/tool_shed/grids/repository_grids.py --- a/lib/tool_shed/grids/repository_grids.py +++ b/lib/tool_shed/grids/repository_grids.py @@ -1270,7 +1270,7 @@ owner = rd_tup[ 2 ] changeset_revision = rd_tup[ 3 ] required_repository = suc.get_repository_by_name_and_owner( trans.app, name, owner ) - if required_repository: + if required_repository and not required_repository.deleted: required_repository_id = trans.security.encode_id( required_repository.id ) required_repository_metadata = metadata_util.get_repository_metadata_by_repository_id_changeset_revision( trans, required_repository_id, Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

← Newer
1
2
3
4
5
6
7
8
9
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

galaxy-commits July 2013