galaxy-commits
Threads by month
- ----- 2026 -----
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- 15302 discussions
2 new changesets in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/d6559b2d69fc/
changeset: r4967:d6559b2d69fc
user: jgoecks
date: 2011-02-01 17:19:40
summary: Use classes instead of ids in tool menu URLs so that search works correctly when recently used menu is visible.
affected #: 1 file (6 bytes)
--- a/templates/root/tool_menu.mako Mon Jan 31 18:25:33 2011 -0500
+++ b/templates/root/tool_menu.mako Tue Feb 01 11:19:40 2011 -0500
@@ -21,9 +21,9 @@
## ${tool.description.replace( '[[', '<a href="link" target="galaxy_main">' % $tool.id ).replace( "]]", "</a>" )
<% tool_id = re.sub( '[^a-z0-9_]', '_', tool.id.lower() ) %>
%if tool.name:
- <a id="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${_(tool.name)}</a> ${tool.description}
+ <a class="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${_(tool.name)}</a> ${tool.description}
%else:
- <a id="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${tool.description}</a>
+ <a class="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${tool.description}</a>
%endif
</div>
%endif
@@ -140,7 +140,7 @@
$(".toolSectionWrapper").find(".toolTitle").hide();
if ( data.length != 0 ) {
// Map tool ids to element ids and join them.
- var s = $.map( data, function( n, i ) { return "#link-" + n.toLowerCase().replace(/[^a-z0-9_]/g,'_'); } ).join( ", " );
+ var s = $.map( data, function( n, i ) { return ".link-" + n.toLowerCase().replace(/[^a-z0-9_]/g,'_'); } ).join( ", " );
// First pass to show matching tools and their parents.
$(s).each( function() {
http://bitbucket.org/galaxy/galaxy-central/changeset/f9770f73f784/
changeset: r4968:f9770f73f784
user: jgoecks
date: 2011-02-01 17:20:02
summary: Merge.
affected #: 0 files (0 bytes)
--- a/datatypes_conf.xml.sample Tue Feb 01 11:19:40 2011 -0500
+++ b/datatypes_conf.xml.sample Tue Feb 01 11:20:02 2011 -0500
@@ -114,6 +114,7 @@
<datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/><datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/><datatype extension="txt" type="galaxy.datatypes.data:Text" display_in_upload="true"/>
+ <datatype extension="memexml" type="galaxy.datatypes.xml:MEMEXml" display_in_upload="true"/><datatype extension="blastxml" type="galaxy.datatypes.xml:BlastXml" display_in_upload="true"/><datatype extension="vcf" type="galaxy.datatypes.tabular:Vcf" display_in_upload="true"><converter file="vcf_to_interval_index_converter.xml" target_datatype="interval_index"/>
--- a/lib/galaxy/datatypes/xml.py Tue Feb 01 11:19:40 2011 -0500
+++ b/lib/galaxy/datatypes/xml.py Tue Feb 01 11:20:02 2011 -0500
@@ -39,3 +39,18 @@
line = line.rstrip( '\n\r' )
if line != blastxml_header[ i ]:
return False
+
+class MEMEXml( data.Text ):
+ """MEME XML Output data"""
+ file_ext = "memexml"
+
+ def set_peek( self, dataset, is_multi_byte=False ):
+ """Set the peek and blurb text"""
+ if not dataset.dataset.purged:
+ dataset.peek = data.get_file_peek( dataset.file_name, is_multi_byte=is_multi_byte )
+ dataset.blurb = 'MEME XML data'
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+ def sniff( self, filename ):
+ return False
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme/meme/meme_output_html_1.html Tue Feb 01 11:20:02 2011 -0500
@@ -0,0 +1,2819 @@
+<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd">
+<html>
+<head>
+<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
+<title>MEME</title>
+<style type="text/css">
+ /* The following is the content of meme.css */
+ body { background-color:white; font-size: 12px; font-family: Verdana, Arial, Helvetica, sans-serif;}
+
+ div.help {
+ display: inline-block;
+ margin: 0px;
+ padding: 0px;
+ width: 12px;
+ height: 13px;
+ background-image: url("help.gif");
+ background-image: url("data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAAwAAAANAQMAAACn5x0BAAAAAXNSR0IArs4c6QAAAAZQTFRFAAAAnp6eqp814gAAAAF0Uk5TAEDm2GYAAAABYktHRACIBR1IAAAACXBIWXMAAAsTAAALEwEAmpwYAAAAB3RJTUUH2gMJBQgGYqhNZQAAACZJREFUCNdj+P+BoUGAoV+AYeYEEGoWYGgTYGgRAAm2gRGQ8f8DAOnhC2lYnqs6AAAAAElFTkSuQmCC");
+ }
+
+ p.spaced { line-height: 1.8em;}
+
+ p.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;}
+
+ td.jump { font-size: 13px; color: #ffffff; background-color: #00666a;
+ font-family: Georgia, "Times New Roman", Times, serif;}
+
+ a.jump { margin: 15px 0 0; font-style: normal; font-variant: small-caps;
+ font-weight: bolder; font-family: Georgia, "Times New Roman", Times, serif;}
+
+ h2.mainh {font-size: 1.5em; font-style: normal; margin: 15px 0 0;
+ font-variant: small-caps; font-family: Georgia, "Times New Roman", Times, serif;}
+
+ h2.line {border-bottom: 1px solid #CCCCCC; font-size: 1.5em; font-style: normal;
+ margin: 15px 0 0; padding-bottom: 3px; font-variant: small-caps;
+ font-family: Georgia, "Times New Roman", Times, serif;}
+
+ h4 {border-bottom: 1px solid #CCCCCC; font-size: 1.2em; font-style: normal;
+ margin: 10px 0 0; padding-bottom: 3px; font-family: Georgia, "Times New Roman", Times, serif;}
+
+ h5 {margin: 0px}
+
+ a.help { font-size: 9px; font-style: normal; text-transform: uppercase;
+ font-family: Georgia, "Times New Roman", Times, serif;}
+
+ div.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;}
+
+ div.pad1 { margin: 10px 5px;}
+
+ div.pad2 { margin: 25px 5px 5px;}
+ h2.pad2 { padding: 25px 5px 5px;}
+
+ div.pad3 { padding: 5px 0px 10px 30px;}
+
+ div.box { border: 2px solid #CCCCCC; padding:10px;}
+
+ div.bar { border-left: 7px solid #00666a; padding:5px; margin-top:25px; }
+
+ div.subsection {margin:25px 0px;}
+
+ img {border:0px none;}
+
+ th.majorth {text-align:left;}
+ th.minorth {font-weight:normal; text-align:left; width:8em; padding: 3px 0px;}
+ th.actionth {font-weight:normal; text-align:left;}
+
+ .strand_name {text-align:left;}
+ .strand_side {padding:0px 10px;}
+ .strand_start {padding:0px 10px;}
+ .strand_pvalue {text-align:center; padding:0px 10px;}
+ .strand_lflank {text-align:right; padding-right:5px; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace; color:gray;}
+ .strand_seq {text-align:center; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace;}
+ .strand_rflank {text-align:left; padding-left:5px; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace; color:gray;}
+
+ .block_td {height:25px;}
+ .block_container {position:relative; width:99%; height:25px; padding:0px; margin:0px;}
+ .block_motif {position:absolute; z-index:3; height:12px; top:0px; text-align:center; vertical-align:middle; background-color:cyan;}
+ .block_rule {position:absolute; z-index:2; width:100%; height:1px; top:12px; left:0px; background-color:gray;}
+ .block_plus_sym {position:absolute; z-index:4; width:12px; height:12px; top:0px; left:0px; color:gray;}
+ .block_minus_sym {position:absolute; z-index:4; width:12px; height:12px; top:13px; left:0px; color:gray;}
+
+ .tic_major {position:absolute; border-left:2px solid blue; height:0.5em; top:0em;}
+ .tic_minor {position:absolute; border-left:1px solid blue; height:0.2em; top:0em;}
+ .tic_label {position:absolute; top:0.5em; height: 1em; text-align:center; vertical-align:middle}
+
+ .explain h5 {font-size:1em; margin-left: 1em;}
+
+ div.doc {margin-left: 2em; margin-bottom: 3em;}
+
+ div.tabArea {
+ font-size: 80%;
+ font-weight: bold;
+ }
+
+ a.tab {
+ background-color: #ddddff;
+ border: 1px solid #000000;
+ border-top-width: 0px;
+ padding: 2px 1em 2px 1em;
+ text-decoration: none;
+ }
+
+ a.tab, a.tab:visited {
+ color: #808080;
+ }
+
+ a.tab:hover {
+ background-color: #d0d0d0;
+ color: #606060;
+ }
+ a.tab.activeTab, a.tab.activeTab:hover, a.tab.activeTab:visited {
+ background-color: #f0f0f0;
+ color: #000000;
+ }
+ div.tabMain {
+ border: 1px solid #000000;
+ background-color: #ffffff;
+ padding: 5px;
+ margin-right: 5px;
+ }
+ th.trainingset {
+ border-bottom: thin dashed black;
+ font-weight:normal;
+ padding:0px 10px;
+ }
+
+ </style>
+<script type="text/javascript">
+ //======================================================================
+ // start Alphabet object
+ //======================================================================
+ function Alphabet(alphabet, bg) {
+ //variable prototype
+ this.freqs = new Array();
+ this.alphabet = new Array();
+ this.letter_count = 0;
+ //method prototype
+ this.get_ic = Alphabet_get_ic;
+ this.get_size = Alphabet_get_size;
+ this.get_index = Alphabet_get_index;
+ this.get_letter = Alphabet_get_letter;
+ this.get_colour = Alphabet_get_colour;
+ this.get_bg_freq = Alphabet_get_bg_freq;
+ this.is_nucleotide = Alphabet_is_nucleotide;
+ this.is_ambig = Alphabet_is_ambig;
+ this.toString = Alphabet_to_string;
+ //construct
+ var is_letter = /^\w$/;
+ var is_prob = /^((1(\.0+)?)|(0(\.\d+)?))$/;
+ for (var pos = 0; pos < alphabet.length; pos++) {
+ var letter = alphabet.charAt(pos);
+ if (is_letter.test(letter)) {
+ this.alphabet[this.letter_count] = letter.toUpperCase();
+ this.freqs[this.letter_count] = -1;
+ this.letter_count++;
+ }
+ }
+ if (!(bg === undefined)) {
+ var parts = bg.split(/\s+/);
+ for (var i = 0, pos = 0; (i + 1) < parts.length; i += 2) {
+ var letter = parts[i];
+ var freq = parts[i+1];
+ if (is_letter.test(letter) && is_prob.test(freq)) {
+ letter = letter.toUpperCase(); //find the letter it matches
+ for (;pos < this.letter_count; pos++) {
+ if (this.alphabet[pos] == letter) break;
+ }
+ if (pos >= this.letter_count) throw "NOT_IN_ALPHABET";
+ this.freqs[pos] = (+freq);
+ }
+ }
+ }
+ }
+
+
+ function Alphabet_get_ic() {
+ if (this.is_nucleotide()) {
+ return 2;
+ } else {
+ return Math.log(20) / Math.LN2;
+ }
+ }
+
+ function Alphabet_get_size() {
+ return this.letter_count;
+ }
+
+ function Alphabet_get_letter(alph_index) {
+ if (alph_index < 0 || alph_index >= this.letter_count) {
+ throw "BAD_ALPHABET_INDEX";
+ }
+ return this.alphabet[alph_index];
+ }
+
+ function Alphabet_get_bg_freq(alph_index) {
+ if (alph_index < 0 || alph_index >= this.letter_count) {
+ throw "BAD_ALPHABET_INDEX";
+ }
+ if (this.freqs[alph_index] == -1) throw "BG_FREQ_NOT_SET";
+ return this.freqs[alph_index];
+ }
+
+ function Alphabet_get_colour(alph_index) {
+ var red = "rgb(204,0,0)";
+ var blue = "rgb(0,0,204)";
+ var orange = "rgb(255,179,0)";
+ var green = "rgb(0,128,0)";
+ var yellow = "rgb(255,255,0)";
+ var purple = "rgb(204,0,204)";
+ var magenta = "rgb(255,0,255)";
+ var pink = "rgb(255,204,204)";
+ var turquoise = "rgb(51,230,204)";
+ if (alph_index < 0 || alph_index >= this.letter_count) {
+ throw "BAD_ALPHABET_INDEX";
+ }
+ if (this.is_nucleotide()) {
+ switch (this.alphabet[alph_index]) {
+ case "A":
+ return red;
+ case "C":
+ return blue;
+ case "G":
+ return orange;
+ case "T":
+ return green;
+ }
+ } else {
+ switch (this.alphabet[alph_index]) {
+ case "A":
+ case "C":
+ case "F":
+ case "I":
+ case "L":
+ case "V":
+ case "W":
+ case "M":
+ return blue;
+ case "N":
+ case "Q":
+ case "S":
+ case "T":
+ return green;
+ case "D":
+ case "E":
+ return magenta;
+ case "K":
+ case "R":
+ return red;
+ case "H":
+ return pink;
+ case "G":
+ return orange;
+ case "P":
+ return yellow;
+ case "Y":
+ return turquoise;
+ }
+ }
+ return "black";
+ }
+
+ function Alphabet_is_ambig(alph_index) {
+ if (alph_index < 0 || alph_index >= this.letter_count) {
+ throw "BAD_ALPHABET_INDEX";
+ }
+ if (this.is_nucleotide()) {
+ return ("ACGT".indexOf(this.alphabet[alph_index]) == -1);
+ } else {
+ return ("ACDEFGHIKLMNPQRSTVWY".indexOf(this.alphabet[alph_index]) == -1);
+ }
+ }
+
+ function Alphabet_get_index(letter) {
+ for (i = 0; i < this.letter_count; i++) {
+ if (this.alphabet[i] == letter.toUpperCase()) return i;
+ }
+ throw "UNKNOWN_LETTER";
+ }
+
+ function Alphabet_is_nucleotide() {
+ //TODO basic method, make better
+ if (this.letter_count < 20) return true;
+ return false;
+ }
+
+ function Alphabet_to_string() {
+ return (this.is_nucleotide() ? "Nucleotide" : "Protein") + " Alphabet " + (this.alphabet.join(""));
+ }
+
+ //======================================================================
+ // end Alphabet object
+ //======================================================================
+
+ //======================================================================
+ // start Symbol object
+ //======================================================================
+ function Symbol(alph_index, scale, alphabet) {
+ //variable prototype
+ this.symbol = alphabet.get_letter(alph_index);
+ this.scale = scale;
+ this.colour = alphabet.get_colour(alph_index);
+ //function prototype
+ this.get_symbol = Symbol_get_symbol;
+ this.get_scale = Symbol_get_scale;
+ this.get_colour = Symbol_get_colour;
+ this.toString = Symbol_to_string;
+ }
+
+ function Symbol_get_symbol() {
+ return this.symbol;
+ }
+
+ function Symbol_get_scale() {
+ return this.scale;
+ }
+
+ function Symbol_get_colour() {
+ return this.colour;
+ }
+
+ function Symbol_to_string() {
+ return this.symbol + " " + (Math.round(this.scale*1000)/10) + "%";
+ }
+
+ function compare_symbol(sym1, sym2) {
+ if (sym1.get_scale() < sym2.get_scale()) {
+ return -1;
+ } else if (sym1.get_scale() > sym2.get_scale()) {
+ return 1;
+ } else {
+ return 0;
+ }
+ }
+ //======================================================================
+ // end Symbol object
+ //======================================================================
+
+ //======================================================================
+ // start Pspm object
+ //======================================================================
+ function Pspm(pssm, name) {
+ //variable prototype
+ this.alph_length = 0;
+ this.motif_length = 0;
+ this.pspm = new Array();
+ this.name = (typeof name == "string" ? name : "");
+ this.nsites = 0;
+ this.evalue = 0;
+ //function prototype
+ this.copy = Pspm_copy;
+ this.reverse_complement = Pspm_reverse_complement;
+ this.get_stack = Pspm_get_stack;
+ this.get_stack_ic = Pspm_get_stack_ic;
+ this.get_motif_length = Pspm_get_motif_length;
+ this.get_alph_length = Pspm_get_alph_length;
+ this.toString = Pspm_to_string;
+ //construct
+ var pspm_header = /letter-probability matrix:\s+alength=\s+(\d+)\s+w=\s+(\d+)(\s+nsites=\s+(\S+))?(\s+E=\s+(\S+))?\s*/;
+ var is_prob = /^((1(\.0+)?)|(0(\.\d+)?))$/;
+ var is_empty = /^\s*$/;
+ var lines = pssm.split(/\s*\n\s*/);
+ var read_pssm = false;
+ var line_num = 0;
+ var col_num = 0;
+ for (line_index in lines) {
+ //exclude inherited properties and undefined properties
+ if (!lines.hasOwnProperty(line_index) || lines[line_index] === undefined) continue;
+
+ var line = lines[line_index];
+ if (is_empty.test(line)) {
+ continue;
+ }
+ if (!read_pssm) {
+ var header_match = pspm_header.exec(line);
+ if (header_match != null) {
+ read_pssm = true;
+ this.alph_length = (+header_match[1]);
+ this.motif_length = (+header_match[2]);
+ if (header_match[4]) this.nsites = parseFloat(header_match[4]);//not always an integer
+ if (header_match[6]) this.evalue = parseFloat(header_match[6]);
+ this.pspm = new Array(this.motif_length);
+ }
+ continue;
+ }
+ if (line_num >= this.motif_length) {
+ throw "TOO_MANY_ROWS";
+ }
+ this.pspm[line_num] = new Array(this.alph_length);
+ col_num = 0;
+ var parts = line.split(/\s+/);
+ for (part_index in parts) {
+ //exclude inherited properties and undefined properties
+ if (!parts.hasOwnProperty(part_index) || parts[part_index] === undefined) continue;
+
+ var prob = parts[part_index];
+ if (!is_prob.test(prob)) continue;
+ if (col_num >= this.alph_length) {
+ throw "TOO_MANY_COLS";
+ }
+ this.pspm[line_num][col_num] = (+prob);
+ col_num++;
+ }
+ if (col_num != this.alph_length) {
+ throw "TOO_FEW_COLS";
+ }
+ line_num++;
+ }
+ if (line_num != this.motif_length) {
+ throw "TOO_FEW_ROWS";
+ }
+ }
+
+ function Clone() {}
+
+ function Pspm_copy() {
+ Clone.prototype = this;
+ var clone = new Clone();
+ //so far only a shallow copy, need to copy everything
+ clone.alph_length = (0+this.alph_length);
+ clone.motif_length = (0+this.motif_length);
+ clone.pspm = new Array(this.motif_length);
+ for (row = 0; row < this.motif_length; row++) {
+ clone.pspm[row] = new Array(this.alph_length);
+ for (col = 0; col < this.alph_length; col++) {
+ clone.pspm[row][col] = (0+this.pspm[row][col]);
+ }
+ }
+ return clone;
+ }
+
+ function Pspm_reverse_complement(alphabet) {
+ if (this.alph_length != alphabet.get_size()) {
+ throw "ALPHABET_MISMATCH";
+ }
+ if (!alphabet.is_nucleotide()) {
+ throw "NO_PROTEIN_RC";
+ }
+ //reverse
+ var x = 0;
+ var y = this.motif_length-1;
+ while (x < y) {
+ var temp = this.pspm[x];
+ this.pspm[x] = this.pspm[y];
+ this.pspm[y] = temp;
+ x++;
+ y--;
+ }
+ //complement
+ var a_index = alphabet.get_index("A");
+ var c_index = alphabet.get_index("C");
+ var g_index = alphabet.get_index("G");
+ var t_index = alphabet.get_index("T");
+ for (i = 0; i < this.motif_length; i++) {
+ var row = this.pspm[i];
+ //swap A and T
+ var temp = row[a_index];
+ row[a_index] = row[t_index];
+ row[t_index] = temp;
+ //swap C and G
+ temp = row[c_index];
+ row[c_index] = row[g_index];
+ row[g_index] = temp;
+ }
+ //note that ambigs are ignored because they don't effect motifs
+ return this; //allow function chaining...
+ }
+
+ function Pspm_get_stack(position, alphabet) {
+ if (this.alph_length != alphabet.get_size()) {
+ throw "ALPHABET_MISMATCH";
+ }
+ var row = this.pspm[position];
+ var stack_ic = this.get_stack_ic(position, alphabet);
+ var alphabet_ic = alphabet.get_ic();
+ var stack = new Array();
+ for (i = 0; i < this.alph_length; i++) {
+ if (alphabet.is_ambig(i)) continue;
+ var sym = new Symbol(i, row[i]*stack_ic/alphabet_ic, alphabet);
+ if (sym.get_scale() <= 0) continue;
+ stack.push(sym);
+ }
+ stack.sort(compare_symbol);
+ return stack;
+ }
+
+ function Pspm_get_stack_ic(position, alphabet) {
+ if (this.alph_length != alphabet.get_size()) {
+ throw "ALPHABET_MISMATCH";
+ }
+ var row = this.pspm[position];
+ var H = 0;
+ for (var i = 0; i < this.alph_length; i++) {
+ if (alphabet.is_ambig(i)) continue;
+ if (row[i] == 0) continue;
+ H -= (row[i] * (Math.log(row[i]) / Math.LN2));
+ }
+ return alphabet.get_ic() - H;
+ }
+
+ function Pspm_get_error(alphabet) {
+ var asize;
+ if (this.nsites == 0) return 0;
+ if (alphabet.is_nucleotide()) {
+ asize = 4;
+ } else {
+ asize = 20;
+ }
+ return (asize-1) / (2 * Math.log(2)*this.nsites);
+ }
+
+ function Pspm_get_motif_length() {
+ return this.motif_length;
+ }
+
+ function Pspm_get_alph_length() {
+ return this.alph_length;
+ }
+
+ function Pspm_to_string() {
+ var str = "";
+ for (row_index in this.pspm) {
+ //exclude inherited properties and undefined properties
+ if (!this.pspm.hasOwnProperty(row_index) || this.pspm[row_index] === undefined) continue;
+
+ var row = this.pspm[row_index];
+ str += row.join("\t") + "\n";
+ }
+ return str;
+ }
+ //======================================================================
+ // end Pspm object
+ //======================================================================
+
+ //======================================================================
+ // start Logo object
+ //======================================================================
+ function Logo(alphabet, fine_text) {
+ this.alphabet = alphabet;
+ this.fine_text = fine_text;
+ this.pspm_list = [];
+ this.pspm_column = [];
+ this.rows = 0;
+ this.columns = 0;
+
+ //functions
+ this.add_pspm = Logo_add_pspm;
+ this.get_columns = Logo_get_columns;
+ this.get_rows = Logo_get_rows;
+ this.get_pspm = Logo_get_pspm;
+ this.get_offset = Logo_get_offset;
+ }
+
+ function Logo_add_pspm(pspm, column) {
+ if (column === undefined) column = 0;
+ else if (column < 0) throw "COLUMN_OUT_OF_BOUNDS";
+ this.pspm_list[this.rows] = pspm;
+ this.pspm_column[this.rows] = column;
+ this.rows++;
+ var col = column + pspm.get_motif_length();
+ if (col > this.columns) this.columns = col;
+ }
+
+ function Logo_get_columns() {
+ return this.columns;
+ }
+
+ function Logo_get_rows() {
+ return this.rows;
+ }
+
+ function Logo_get_pspm(row_index) {
+ if (row_index < 0 || row_index >= this.rows) throw "INDEX_OUT_OF_BOUNDS";
+ return this.pspm_list[row_index];
+ }
+
+ function Logo_get_offset(row_index) {
+ if (row_index < 0 || row_index >= this.rows) throw "INDEX_OUT_OF_BOUNDS";
+ return this.pspm_column[row_index];
+ }
+
+ //======================================================================
+ // end Logo object
+ //======================================================================
+
+ //======================================================================
+ // start RasterizedAlphabet
+ //======================================================================
+
+ // Rasterize Alphabet
+ // 1) Measure width of text at default font for all symbols in alphabet
+ // 2) sort in width ascending
+ // 3) Drop the top and bottom 10% (designed to ignore outliers like 'W' and 'I')
+ // 4) Calculate the average as the maximum scaling factor (designed to stop I becoming a rectangular blob).
+ // 5) Assume scale of zero would result in width of zero, interpolate scale required to make perfect width font
+ // 6) Draw text onto temp canvas at calculated scale
+ // 7) Find bounds of drawn text
+ // 8) Paint on to another canvas at the desired height (but only scaling width to fit if larger).
+ function RasterizedAlphabet(alphabet, font, target_width) {
+ //variable prototypes
+ this.lookup = []; //a map of letter to index
+ this.rasters = []; //a list of rasters
+ this.dimensions = []; //a list of dimensions
+
+ //function prototypes
+ this.draw = RasterizedAlphabet_draw;
+
+ //construct
+ var default_size = 60; // size of square to assume as the default width
+ var safety_pad = 20; // pixels to pad around so we don't miss the edges
+ // create a canvas to do our rasterizing on
+ var canvas = document.createElement("canvas");
+ // assume the default font would fit in a canvas of 100 by 100
+ canvas.width = default_size + 2 * safety_pad;
+ canvas.height = default_size + 2 * safety_pad;
+ // check for canvas support before attempting anything
+ if (!canvas.getContext) throw "NO_CANVAS_SUPPORT";
+ var ctx = canvas.getContext('2d');
+ // check for html5 text drawing support
+ if (!supports_text(ctx)) throw "NO_CANVAS_TEXT_SUPPORT";
+ // calculate the middle
+ var middle = Math.round(canvas.width / 2);
+ // calculate the baseline
+ var baseline = Math.round(canvas.height - safety_pad);
+ // list of widths
+ var widths = [];
+ var count = 0;
+ var letters = [];
+ //now measure each letter in the alphabet
+ for (var i = 0; i < alphabet.get_size(); ++i) {
+ if (alphabet.is_ambig(i)) continue; //skip ambigs as they're never rendered
+ var letter = alphabet.get_letter(i);
+ letters.push(letter);
+ var pos = count++;
+ this.lookup[letter] = pos;
+ //clear the canvas
+ canvas.width = canvas.width;
+ // get the context and prepare to draw our width test
+ var ctx = canvas.getContext('2d');
+ ctx.font = font;
+ ctx.fillStyle = alphabet.get_colour(i);
+ ctx.textAlign = "center";
+ ctx.translate(middle, baseline);
+ // draw the test text
+ ctx.fillText(letter, 0, 0);
+ //measure
+ var size = RasterizedAlphabet_measure(ctx, canvas.width, canvas.height);
+ if (size.width == 0) throw "INVISIBLE_LETTER"; //maybe the fill was white on white?
+ widths.push(size.width);
+ this.dimensions[pos] = size;
+ }
+ //sort the widths
+ widths.sort(function(a,b) {return a - b;});
+ //drop 10% of the items off each end
+ var tenpercent = Math.floor(widths.length / 10);
+ for (var i = 0; i < tenpercent; ++i) {
+ widths.pop();
+ widths.shift();
+ }
+ //calculate average width
+ var avg_width = 0;
+ for (var i = 0; i < widths.length; ++i) avg_width += widths[i];
+ avg_width /= widths.length;
+ // calculate scales
+ for (var i = 0; i < this.dimensions.length; ++i) {
+ var size = this.dimensions[i];
+ // calculate scale
+ var scale = target_width / Math.max(avg_width, size.width);
+ // estimate scaled height
+ var target_height = size.height * scale;
+ // create an approprately sized canvas
+ var raster = document.createElement("canvas");
+ raster.width = target_width; // if it goes over the edge too bad...
+ raster.height = target_height + safety_pad * 2;
+ // calculate the middle
+ middle = Math.round(raster.width / 2);
+ // calculate the baseline
+ baseline = Math.round(raster.height - safety_pad);
+ // get the context and prepare to draw the rasterized text
+ ctx = raster.getContext('2d');
+ ctx.font = font;
+ ctx.fillStyle = alphabet.get_colour(i);
+ ctx.textAlign = "center";
+ ctx.translate(middle, baseline);
+ ctx.save();
+ ctx.scale(scale, scale);
+ // draw the rasterized text
+ ctx.fillText(letters[i], 0, 0);
+ ctx.restore();
+ this.rasters[i] = raster;
+ this.dimensions[i] = RasterizedAlphabet_measure(ctx, raster.width, raster.height);
+ }
+ }
+
+ function RasterizedAlphabet_measure(ctx, cwidth, cheight) {
+ var data = ctx.getImageData(0, 0, cwidth, cheight).data;
+ var r = 0, c = 0;// r: row, c: column
+ var top_line = -1, bottom_line = -1, left_line = -1, right_line = -1;
+ var txt_width = 0, txt_height = 0;
+ // Find the top-most line with a non-white pixel
+ for (r = 0; r < cheight; r++) {
+ for (c = 0; c < cwidth; c++) {
+ if (data[r * cwidth * 4 + c * 4 + 3]) {
+ top_line = r;
+ break;
+ }
+ }
+ if (top_line != -1) break;
+ }
+
+ //find the last line with a non-white pixel
+ if (top_line != -1) {
+ for (r = cheight-1; r >= top_line; r--) {
+ for(c = 0; c < cwidth; c++) {
+ if(data[r * cwidth * 4 + c * 4 + 3]) {
+ bottom_line = r;
+ break;
+ }
+ }
+ if (bottom_line != -1) break;
+ }
+ txt_height = bottom_line - top_line + 1;
+ }
+
+ // Find the left-most line with a non-white pixel
+ for (c = 0; c < cwidth; c++) {
+ for (r = 0; r < cheight; r++) {
+ if (data[r * cwidth * 4 + c * 4 + 3]) {
+ left_line = c;
+ break;
+ }
+ }
+ if (left_line != -1) break;
+ }
+
+ //find the right most line with a non-white pixel
+ if (left_line != -1) {
+ for (c = cwidth-1; c >= left_line; c--) {
+ for(r = 0; r < cheight; r++) {
+ if(data[r * cwidth * 4 + c * 4 + 3]) {
+ right_line = c;
+ break;
+ }
+ }
+ if (right_line != -1) break;
+ }
+ txt_width = right_line - left_line + 1;
+ }
+
+ //return the bounds
+ return {bound_top: top_line, bound_bottom: bottom_line, bound_left: left_line, bound_right: right_line, width: txt_width, height: txt_height};
+ }
+
+ function RasterizedAlphabet_draw(ctx, letter, dx, dy, dWidth, dHeight) {
+ var index = this.lookup[letter];
+ var raster = this.rasters[index];
+ var size = this.dimensions[index];
+ ctx.drawImage(raster, 0, size.bound_top -1, raster.width, size.height+1, dx, dy, dWidth, dHeight);
+ }
+
+ //======================================================================
+ // end RasterizedAlphabet
+ //======================================================================
+
+ //======================================================================
+ // start LogoMetrics object
+ //======================================================================
+
+ function LogoMetrics(ctx, canvas_width, canvas_height, logo_columns, logo_rows, allow_space_for_names) {
+ if (allow_space_for_names === undefined) allow_space_for_names = false;
+ //variable prototypes
+ this.canvas_width = canvas_width;
+ this.canvas_height = canvas_height;
+ this.scale_x = 1;
+ this.scale_y = 1;
+ this.pad_top = 5;
+ this.pad_left = 10;
+ this.pad_right = 5;
+ this.pad_bottom = 0;
+ this.pad_middle = 20;
+ this.name_height = 14;
+ this.name_font = "bold " + this.name_height + "px Times, sans-serif";
+ this.name_spacer = 0;
+ this.y_label = "bits"
+ this.y_label_height = 12;
+ this.y_label_font = "bold " + this.y_label_height + "px Helvetica, sans-serif";
+ this.y_label_spacer = 3;
+ this.y_num_height = 12;
+ this.y_num_width = 0;
+ this.y_num_font = "bold " + this.y_num_height + "px Helvetica, sans-serif";
+ this.y_tic_width = 5;
+ this.stack_pad_left = 0;
+ this.stack_font = "bold 25px Helvetica, sans-serif";
+ this.stack_height = 90;
+ this.stack_width = 26;
+ this.stacks_pad_right = 5;
+ this.x_num_above = 2;
+ this.x_num_height = 12;
+ this.x_num_width = 0;
+ this.x_num_font = "bold " + this.x_num_height + "px Helvetica, sans-serif";
+ this.fine_txt_height = 6;
+ this.fine_txt_above = 2;
+ this.fine_txt_font = "normal " + this.fine_txt_height + "px Helvetica, sans-serif";
+ this.letter_metrics = new Array();
+ this.summed_width = 0;
+ this.summed_height = 0;
+ //function prototypes
+ //none
+ //calculate the width of the y axis numbers
+ ctx.font = this.y_num_font;
+ for (var i = 0; i <= 2; i++) {
+ this.y_num_width = Math.max(this.y_num_width, ctx.measureText("" + i).width);
+ }
+ //calculate the width of the x axis numbers (but they are rotated so it becomes height)
+ ctx.font = this.x_num_font;
+ for (var i = 1; i <= logo_columns; i++) {
+ this.x_num_width = Math.max(this.x_num_width, ctx.measureText("" + i).width);
+ }
+
+ //calculate how much vertical space we want to draw this
+ //first we add the padding at the top and bottom since that's always there
+ this.summed_height += this.pad_top + this.pad_bottom;
+ //all except the last row have the same amount of space allocated to them
+ if (logo_rows > 1) {
+ var row_height = this.stack_height + this.pad_middle;
+ if (allow_space_for_names) {
+ row_height += this.name_height;
+ //the label is allowed to overlap into the spacer
+ row_height += Math.max(this.y_num_height/2, this.name_spacer);
+ //the label is allowed to overlap the space used by the other label
+ row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above);
+ } else {
+ row_height += this.y_num_height/2;
+ //the label is allowed to overlap the space used by the other label
+ row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above);
+ }
+ this.summed_height += row_height * (logo_rows - 1);
+ }
+ //the last row has the name and fine text below it but no padding
+ this.summed_height += this.stack_height + this.y_num_height/2;
+ if (allow_space_for_names) {
+ this.summed_height += this.fine_txt_height + this.fine_txt_above + this.name_height;
+ this.summed_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above + this.name_spacer);
+ } else {
+ this.summed_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above + this.fine_txt_height + this.fine_txt_above);
+ }
+
+ //calculate how much horizontal space we want to draw this
+ //first add the padding at the left and right since that's always there
+ this.summed_width += this.pad_left + this.pad_right;
+ //add on the space for the y-axis label
+ this.summed_width += this.y_label_height + this.y_label_spacer;
+ //add on the space for the y-axis
+ this.summed_width += this.y_num_width + this.y_tic_width;
+ //add on the space for the stacks
+ this.summed_width += (this.stack_pad_left + this.stack_width) * logo_columns;
+ //add on the padding after the stacks (an offset from the fine text)
+ this.summed_width += this.stacks_pad_right;
+
+ //calculate scaling factors
+ this.scale_y = this.canvas_height / this.summed_height;
+ this.scale_x = this.canvas_width / this.summed_width;
+
+ //maintain aspect ratio
+ if (this.scale_y > this.scale_x) {
+ this.scale_y = this.scale_x;
+ } else {
+ this.scale_x = this.scale_y;
+ }
+
+
+ }
+
+ //======================================================================
+ // end LogoMetrics object
+ //======================================================================
+
+
+ //found this trick at http://talideon.com/weblog/2005/02/detecting-broken-images-js.cfm
+ function image_ok(img) {
+ // During the onload event, IE correctly identifies any images that
+ // weren't downloaded as not complete. Others should too. Gecko-based
+ // browsers act like NS4 in that they report this incorrectly.
+ if (!img.complete) {
+ return false;
+ }
+ // However, they do have two very useful properties: naturalWidth and
+ // naturalHeight. These give the true size of the image. If it failed
+ // to load, either of these should be zero.
+ if (typeof img.naturalWidth != "undefined" && img.naturalWidth == 0) {
+ return false;
+ }
+ // No other way of checking: assume it's ok.
+ return true;
+ }
+
+ function supports_text(ctx) {
+ if (!ctx.fillText) return false;
+ if (!ctx.measureText) return false;
+ return true;
+ }
+
+ //draws the scale, returns the width
+ function draw_scale(ctx, metrics, alphabet_ic) {
+ var tic_height = metrics.stack_height / alphabet_ic;
+ ctx.save();
+ ctx.lineWidth = 1.5;
+ ctx.translate(metrics.y_label_height, metrics.y_num_height/2);
+ //draw the axis label
+ ctx.save();
+ ctx.font = metrics.y_label_font;
+ ctx.translate(0, metrics.stack_height/2);
+ ctx.save();
+ ctx.rotate(-(Math.PI / 2));
+ ctx.textAlign = "center";
+ ctx.fillText("bits", 0, 0);
+ ctx.restore();
+ ctx.restore();
+
+ ctx.translate(metrics.y_label_spacer + metrics.y_num_width, 0);
+
+ //draw the axis tics
+ ctx.save();
+ ctx.translate(0, metrics.stack_height);
+ ctx.font = metrics.y_num_font;
+ ctx.textAlign = "right";
+ ctx.textBaseline = "middle";
+ for (var i = 0; i <= alphabet_ic; i++) {
+ //draw the number
+ ctx.fillText("" + i, 0, 0);
+ //draw the tic
+ ctx.beginPath();
+ ctx.moveTo(0, 0);
+ ctx.lineTo(metrics.y_tic_width, 0);
+ ctx.stroke();
+ //prepare for next tic
+ ctx.translate(0, -tic_height);
+ }
+ ctx.restore();
+
+ ctx.translate(metrics.y_tic_width, 0);
+
+ ctx.beginPath();
+ ctx.moveTo(0, 0);
+ ctx.lineTo(0, metrics.stack_height);
+ ctx.stroke();
+
+ ctx.restore();
+ }
+
+ function draw_stack_num(ctx, metrics, row_index) {
+ ctx.save();
+ ctx.font = metrics.x_num_font;
+ ctx.translate(metrics.stack_width / 2, metrics.stack_height + metrics.x_num_above);
+ ctx.save();
+ ctx.rotate(-(Math.PI / 2));
+ ctx.textBaseline = "middle"
+ ctx.textAlign = "right"
+ ctx.fillText("" + (row_index + 1), 0, 0);
+ ctx.restore();
+ ctx.restore();
+ }
+
+ function draw_stack(ctx, metrics, symbols, raster) {
+ var preferred_pad = 0;
+ var sym_min = 5;
+
+ ctx.save();//1
+ ctx.translate(0, metrics.stack_height);
+ for (var i in symbols) {
+ //exclude inherited properties and undefined properties
+ if (!symbols.hasOwnProperty(i) || symbols[i] === undefined) continue;
+
+ var sym = symbols[i];
+ var sym_height = metrics.stack_height * sym.get_scale();
+
+ var pad = preferred_pad;
+ if (sym_height - pad < sym_min) {
+ pad = Math.min(pad, Math.max(0, sym_height - sym_min));
+ }
+ sym_height -= pad;
+
+ //translate to the correct position
+ ctx.translate(0, -(pad/2 + sym_height));
+ //draw
+ raster.draw(ctx, sym.get_symbol(), 0, 0, metrics.stack_width, sym_height);
+ //translate past the padding
+ ctx.translate(0, -(pad/2));
+ }
+ ctx.restore();//1
+ }
+
+ //draws a stack of symbols
+ function draw_stack_old(ctx, metrics, symbols) {
+ var lpad = 2;
+ var sym_min = 5;
+ var pos = metrics.stack_height;
+ for (var i in symbols) {
+ //exclude inherited properties and undefined properties
+ if (!symbols.hasOwnProperty(i) || symbols[i] === undefined) continue;
+
+ var sym = symbols[i];
+ var sym_height = metrics.stack_height*sym.get_scale();
+ var letter = metrics.get_letter_metrics(sym.get_symbol());
+ //attempting to draw something smaller than a pixel causes display corruption
+ if (sym_height >= 1) {
+ //it's better to see the letter than to pad it
+ var pad = lpad;
+ if (sym_height - pad < sym_min) {
+ pad = Math.min(pad, Math.max(0, sym_height - sym_min));
+ }
+ //move to the correct drawing position
+ ctx.save();//s1
+ ctx.translate(0, pos);
+ //create a clipping rectangle to ensure the letter doesn't overlap when it's distorted
+ ctx.save();//s2
+ //ctx.beginPath(); //disabled clipping because after the improvements in the text metrics it looks better without
+ //ctx.moveTo(-metrics.stack_width/2,0);
+ //ctx.lineTo(metrics.stack_width/2, 0);
+ //ctx.lineTo(metrics.stack_width/2, -sym_height);
+ //ctx.lineTo(-metrics.stack_width/2, -sym_height);
+ //ctx.lineTo(-metrics.stack_width/2,0);
+ //ctx.clip();
+ //now draw
+ ctx.translate(0, -(pad/2));
+ ctx.translate(0, -letter.get_descent(sym_height - pad));
+ ctx.fillStyle = sym.get_colour();
+ ctx.textAlign = "center";
+ ctx.save();//s3
+ ctx.scale(letter.wscale, letter.get_hscale(sym_height - pad));
+ ctx.fillText(sym.get_symbol(), 0, 0);
+ ctx.restore();//s3
+
+ ctx.restore();//s2
+ ctx.restore();//s1
+ }
+
+ pos = pos - sym_height;
+ }
+ }
+
+ function draw_logo_on_canvas(logo, canvas, show_names, scale) {
+ var draw_name = (typeof show_names == "boolean" ? show_names : (logo.get_rows() > 1));
+ var cwidth = canvas.width;
+ var cheight = canvas.height;
+ //need a minimum 46 x 120 canvas to draw the font size checks on
+ if (canvas.width < 46) canvas.width = 46;
+ if (canvas.height < 120) canvas.height = 120;
+ var ctx = canvas.getContext('2d');
+ //assume that the user wants the canvas scaled equally so calculate what the best width for this image should be
+ var metrics = new LogoMetrics(ctx, canvas.width, canvas.height, logo.get_columns(), logo.get_rows(), draw_name);
+ ctx.save();//s1
+ if (typeof scale == "number") {
+ //resize the canvas to fit the scaled logo
+ cwidth = metrics.summed_width * scale;
+ cheight = metrics.summed_height * scale;
+ } else {
+ if (cwidth == 0 || cheight == 0 || scale == 0) {
+ throw "CANVAS_MUST_HAVE_DIMENSIONS";
+ }
+ scale = Math.min(cwidth / metrics.summed_width, cheight / metrics.summed_height);
+ }
+ var raster = new RasterizedAlphabet(logo.alphabet, metrics.stack_font, metrics.stack_width * scale * 2);
+ if (cwidth != canvas.width || cheight != canvas.height) {
+ canvas.width = cwidth;
+ canvas.height = cheight;
+ //as the canvas has been resized the context is now out of date
+ ctx = canvas.getContext('2d');
+ }
+ ctx.scale(scale, scale);
+ ctx.save();//s2
+ ctx.save();//s7
+ //create margin
+ ctx.translate(metrics.pad_left, metrics.pad_top);
+ for (var pspm_i = 0; pspm_i < logo.get_rows(); ++pspm_i) {
+ var pspm = logo.get_pspm(pspm_i);
+ var offset = logo.get_offset(pspm_i);
+ //optionally draw name if this isn't the last row or is the only row
+ if (draw_name && (logo.get_rows() == 1 || pspm_i != (logo.get_rows()-1))) {
+ ctx.save();//s4
+ ctx.translate(metrics.summed_width/2, metrics.name_height);
+ ctx.font = metrics.name_font;
+ ctx.textAlign = "center";
+ ctx.fillText(pspm.name, 0, 0);
+ ctx.restore();//s4
+ ctx.translate(0, metrics.name_height + Math.min(0, metrics.name_spacer - metrics.y_num_height/2));
+ }
+ //draw scale
+ draw_scale(ctx, metrics, logo.alphabet.get_ic());
+ ctx.save();//s5
+ //translate across past the scale
+ ctx.translate(metrics.y_label_height + metrics.y_label_spacer +
+ metrics.y_num_width + metrics.y_tic_width, 0);
+ //draw letters
+ ctx.translate(0, metrics.y_num_height / 2);
+ for (var col_index = 0; col_index < logo.get_columns(); col_index++) {
+ ctx.translate(metrics.stack_pad_left,0);
+ if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) {
+ var motif_position = col_index - offset;
+ draw_stack_num(ctx, metrics, motif_position);
+ draw_stack(ctx, metrics, pspm.get_stack(motif_position, logo.alphabet), raster);
+ }
+ ctx.translate(metrics.stack_width, 0);
+ }
+ ctx.restore();//s5
+ ////optionally draw name if this is the last row but isn't the only row
+ if (draw_name && (logo.get_rows() != 1 && pspm_i == (logo.get_rows()-1))) {
+ //translate vertically past the stack and axis's
+ ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height +
+ Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width + metrics.name_spacer));
+
+ ctx.save();//s6
+ ctx.translate(metrics.summed_width/2, metrics.name_height);
+ ctx.font = metrics.name_font;
+ ctx.textAlign = "center";
+ ctx.fillText(pspm.name, 0, 0);
+ ctx.restore();//s6
+ ctx.translate(0, metrics.name_height);
+ } else {
+ //translate vertically past the stack and axis's
+ ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width));
+ }
+ //if not the last row then add middle padding
+ if (pspm_i != (logo.get_rows() -1)) {
+ ctx.translate(0, metrics.pad_middle);
+ }
+ }
+ ctx.restore();//s7
+ ctx.translate(metrics.summed_width - metrics.pad_right, metrics.summed_height - metrics.pad_bottom);
+ ctx.font = metrics.fine_txt_font;
+ ctx.textAlign = "right";
+ ctx.fillText(logo.fine_text, 0,0);
+ ctx.restore();//s2
+ ctx.restore();//s1
+ }
+
+ function create_canvas(c_width, c_height, c_id, c_title, c_display) {
+ var canvas = document.createElement("canvas");
+ //check for canvas support before attempting anything
+ if (!canvas.getContext) return null;
+ var ctx = canvas.getContext('2d');
+ //check for html5 text drawing support
+ if (!supports_text(ctx)) return null;
+ //size the canvas
+ canvas.width = c_width;
+ canvas.height = c_height;
+ canvas.id = c_id;
+ canvas.title = c_title;
+ canvas.style.display = c_display;
+ return canvas;
+ }
+
+ function logo_1(alphabet, fine_text, pspm) {
+ var logo = new Logo(alphabet, fine_text);
+ logo.add_pspm(pspm);
+ return logo;
+ }
+
+ function logo_2(alphabet, fine_text, target, query, query_offset) {
+ var logo = new Logo(alphabet, fine_text);
+ if (query_offset < 0) {
+ logo.add_pspm(target, -query_offset);
+ logo.add_pspm(query);
+ } else {
+ logo.add_pspm(target);
+ logo.add_pspm(query, query_offset);
+ }
+ return logo;
+ }
+
+ /*
+ * Specifies an alternate source for an image.
+ * If the image with the image_id specified has
+ * not loaded then a generated logo will be used
+ * to replace it.
+ *
+ * Note that the image must either have dimensions
+ * or a scale must be set.
+ */
+ function alternate_logo(logo, image_id, scale) {
+ var image = document.getElementById(image_id);
+ if (!image) {
+ alert("Can't find specified image id (" + image_id + ")");
+ return;
+ }
+ //if the image has loaded then there is no reason to use the canvas
+ if (image_ok(image)) return;
+ //the image has failed to load so replace it with a canvas if we can.
+ var canvas = create_canvas(image.width, image.height, image_id, image.title, image.style.display);
+ if (canvas == null) return;
+ //draw the logo on the canvas
+ draw_logo_on_canvas(logo, canvas, undefined, scale);
+ //replace the image with the canvas
+ image.parentNode.replaceChild(canvas, image);
+ }
+
+ /*
+ * Specifes that the element with the specified id
+ * should be replaced with a generated logo.
+ */
+ function replace_logo(logo, replace_id, scale, title_txt, display_style) {
+ var element = document.getElementById(replace_id);
+ if (!replace_id) {
+ alert("Can't find specified id (" + replace_id + ")");
+ return;
+ }
+ //found the element!
+ var canvas = create_canvas(50, 120, replace_id, title_txt, display_style);
+ if (canvas == null) return;
+ //draw the logo on the canvas
+ draw_logo_on_canvas(logo, canvas, undefined, scale);
+ //replace the element with the canvas
+ element.parentNode.replaceChild(canvas, element);
+ }
+
+ //example code for creating a logo
+ //function do_load() {
+ // var alphabet = new Alphabet(document.getElementById("alphabet").value, document.getElementById("bgfreq").value);
+ // var pspm = new Pspm(document.getElementById("pspm1").value);
+ // var pspm_rc = pspm.copy().reverse_complement(alphabet);
+ // draw_logo(pspm, alphabet, "Motif 1", "logo1");
+ // draw_logo(pspm_rc, alphabet, "Motif 1 Reverse Complement", "logo_rc1");
+ //}
+
+
+ function setup() {
+ var motif_count = 1;
+ //create canvas logos
+ var alphabet = new Alphabet(document.getElementById("alphabet").value, document.getElementById("bgfreq").value);
+ for (var i = 1; i <= motif_count; i++) {
+ var pspm = new Pspm(document.getElementById("pspm" + i).value);
+ var logo = logo_1(alphabet, "MEME", pspm);
+ alternate_logo(logo, "thumbnail_logo_" + i, 0.5);
+ alternate_logo(logo, "logo_img_" + i, 1);
+
+ }
+
+ //ensure radio buttons have data generated for them by fireing events
+ var allInputs = document.getElementsByTagName("input");
+ for (var i = 0; i < allInputs.length; i++) {
+ var input = allInputs[i];
+ if (input.type == "radio" && input.checked) {
+ var evt = document.createEvent("MouseEvents");
+ evt.initMouseEvent("click", true, true, window, 0, 0, 0, 0, 0, false, false, false, false, 0, null);
+ input.dispatchEvent(evt);
+ }
+ }
+
+ for (var i = 1; i <= motif_count; i++) {
+ tbl = document.getElementById("tbl_sites_" + i);
+ wireUpTable(tbl, false);
+ tbl = document.getElementById("tbl_blocks_" + i);
+ wireUpTable(tbl, true);
+ }
+ }
+ function showDesc(source, targetid) {
+ document.getElementById(targetid).childNodes[0].nodeValue = source.title;
+ }
+ function hideDesc(targetid) {
+ document.getElementById(targetid).childNodes[0].nodeValue = "Mouse-over buttons for more information.";
+ }
+ function showEmbededFormat(motifnum, format) {
+ var source = document.getElementById(format + motifnum);
+ var txtarea = document.getElementById("format_display_area_" + motifnum);
+ txtarea.value = source.value;
+ txtarea.style.display = 'block';
+ }
+ function hideFormat(motifnum) {
+ var txtarea = document.getElementById("format_display_area_" + motifnum);
+ txtarea.style.display = 'none';
+ }
+ function block2raw(block) {
+ var raw = "";
+ var endpat = /\/\//;
+ var wordpat = /\S+/gi;
+ var lines = block.split("\n");
+ for (i = 2; i < lines.length; ++i) {
+ if (lines[i].match(endpat) != null) break;
+ var words = lines[i].match(wordpat);
+ raw += words[3] + "\n";
+ }
+ return raw;
+ }
+ function block2fasta(block) {
+ var fasta = "";
+ var endpat = /\/\//;
+ var wordpat = /\S+/gi;
+ var lines = block.split("\n");
+ for (i = 2; i < lines.length; ++i) {
+ if (lines[i].match(endpat) != null) break;
+ var words = lines[i].match(wordpat);
+ var start = words[2].substring(0, words[2].length - 1);
+ fasta += ">" + words[0] + " ( start= " + start + " )\n" + words[3] + "\n";
+ }
+ return fasta;
+ }
+ function showRaw(motifnum) {
+ var source = document.getElementById('blocks' + motifnum);
+ var txtarea = document.getElementById("format_display_area_" + motifnum);
+ txtarea.value = block2raw(source.value);
+ txtarea.style.display = 'block';
+ }
+ function showFasta(motifnum) {
+ var source = document.getElementById('blocks' + motifnum);
+ var txtarea = document.getElementById("format_display_area_" + motifnum);
+ txtarea.value = block2fasta(source.value);
+ txtarea.style.display = 'block';
+ }
+ function showHidden(prefix) {
+ document.getElementById(prefix + '_activator').style.display = 'none';
+ document.getElementById(prefix + '_deactivator').style.display = 'block';
+ document.getElementById(prefix + '_data').style.display = 'block';
+ }
+ function hideShown(prefix) {
+ document.getElementById(prefix + '_activator').style.display = 'block';
+ document.getElementById(prefix + '_deactivator').style.display = 'none';
+ document.getElementById(prefix + '_data').style.display = 'none';
+ }
+ function wireUpTable(table, skiplast) {
+ if (table && table.rows) {
+ var nRows = table.rows.length;
+ if (skiplast) {nRows--;}
+ for (var i = 1; i < nRows; i++) {
+ var row = table.rows[i];
+ row.style.cursor = 'pointer';
+ row.onclick = function()
+ {
+ processHighlight(this);
+ }
+ }
+ } else {
+ alert(table);
+ }
+ }
+ function processHighlight(sourceRow) {
+ var name = sourceRow.cells[0].firstChild.nodeValue;
+
+ for (var i = 1; i <= 1; i++) {
+ tbl = document.getElementById("tbl_sites_" + i);
+ highlightTable(name, tbl);
+ tbl = document.getElementById("tbl_blocks_" + i);
+ highlightTable(name, tbl);
+ }
+ }
+ function highlightTable(name, table) {
+ if (table == null) return;
+ nRows = table.rows.length;
+ for (var i = 0; i < nRows; i++) {
+ var row = table.rows[i];
+ if(row.cells[0].firstChild.nodeValue == name) {
+ row.style.backgroundColor = "#aaffaa";
+ } else {
+ row.style.backgroundColor = "white";
+ }
+ }
+ }
+ function warnExternal() {
+ if (confirm("Using BLOCKS requires the data to be sent to an external webservice even if you have setup your own meme installation. Continue?")) {
+ return true;
+ }
+ return false;
+ }
+ function clickLogoTab(is_rc, num) {
+ var stdTab = document.getElementById("logo_tab_std_" + num);
+ var rcTab = document.getElementById("logo_tab_rc_" + num);
+ var logoImg = document.getElementById("logo_img_" + num);
+ var logoRcImg = document.getElementById("logo_rc_img_" + num);
+ if (is_rc) {
+ logoImg.style.display = 'none';
+ logoRcImg.style.display = 'block';
+ rcTab.setAttribute("class", "tab activeTab");
+ stdTab.setAttribute("class", "tab");
+ } else {
+ logoRcImg.style.display = 'none';
+ logoImg.style.display = 'block';
+ rcTab.setAttribute("class", "tab");
+ stdTab.setAttribute("class", "tab activeTab");
+ }
+ }
+ </script>
+</head>
+<body onload="javascript:setup()"><form enctype="application/x-www-form-urlencoded" method="post" target="_new" action="http://dan/meme_request.cgi">
+<!--+++++++++++++++++++++++START DATA+++++++++++++++++++++++++++++++++++++-->
+<input type="hidden" name="version" value="MEME version 4.5.0">
+<input type="hidden" name="alphabet" id="alphabet" value="ACDEFGHIKLMNPQRSTVWY">
+<input type="hidden" name="strands" value="none">
+<input type="hidden" name="bgfreq" id="bgfreq" value="A 0.291 C 0.229 D 0.001 E 0.001 F 0.001 G 0.255 H 0.001 I 0.001 K 0.001
+L 0.001 M 0.001 N 0.001 P 0.001 Q 0.001 R 0.001 S 0.001 T 0.215 V 0.001
+W 0.001 Y 0.001">
+<input type="hidden" name="name" value="dan.dat">
+<input type="hidden" name="combinedblock" value="
+chr21_19617074_19617124_+ 1.22e-03 1 50 1 39 3.06e-05
+chr21_26934381_26934431_+ 2.21e-03 1 50 1 27 5.52e-05
+chr21_28217753_28217803_- 7.29e-01 0 50
+chr21_31710037_31710087_- 2.37e-03 1 50 1 14 5.94e-05
+chr21_31744582_31744632_- 1.22e-03 1 50 1 12 3.06e-05
+chr21_31768316_31768366_+ 1.53e-03 1 50 1 0 3.82e-05
+chr21_31914206_31914256_- 6.70e-04 1 50 1 15 1.68e-05
+chr21_31933633_31933683_- 1.81e-03 1 50 1 4 4.54e-05
+chr21_31962741_31962791_- 1.61e-02 0 50
+chr21_31964683_31964733_+ 1.36e-04 1 50 1 13 3.41e-06
+chr21_31973364_31973414_+ 1.99e-01 0 50
+chr21_31992870_31992920_+ 3.47e-04 1 50 1 16 8.67e-06
+chr21_32185595_32185645_- 3.47e-04 1 50 1 18 8.67e-06
+chr21_32202076_32202126_- 2.01e-04 1 50 1 13 5.01e-06
+chr21_32253899_32253949_- 8.11e-04 1 50 1 19 2.03e-05
+chr21_32410820_32410870_- 3.47e-04 1 50 1 21 8.67e-06
+chr21_36411748_36411798_- 2.71e-03 1 50 1 22 6.78e-05
+chr21_37838750_37838800_- 8.23e-02 0 50
+chr21_45705687_45705737_+ 1.53e-03 1 50 1 37 3.82e-05
+chr21_45971413_45971463_- 1.36e-04 1 50 1 9 3.41e-06
+chr21_45978668_45978718_- 6.37e-04 1 50 1 4 1.59e-05
+chr21_45993530_45993580_+ 1.60e-04 1 50 1 7 4.00e-06
+chr21_46020421_46020471_+ 4.83e-04 1 50 1 2 1.21e-05
+chr21_46031920_46031970_+ 2.43e-04 1 50 1 15 6.06e-06
+chr21_46046964_46047014_+ 4.26e-05 1 50 1 12 1.06e-06
+chr21_46057197_46057247_+ 1.36e-04 1 50 1 36 3.41e-06
+chr21_46086869_46086919_- 4.30e-02 0 50
+chr21_46102103_46102153_- 4.30e-02 0 50
+chr21_47517957_47518007_+ 6.37e-04 1 50 1 32 1.59e-05
+chr21_47575506_47575556_- 1.61e-03 1 50 1 30 4.02e-05
+">
+<input type="hidden" name="nmotifs" value="1">
+<!--data for motif 1-->
+<input type="hidden" id="motifblock1" name="motifblock1" value="
+BL MOTIF 1 width=11 seqs=25
+">
+<input type="hidden" id="pssm1" name="pssm1" value="
+log-odds matrix: alength= 20 w= 11 n= 25 bayes= 5.33554 E= 2.4e-011
+-32 -680 91 77 7 138 -20 55 64 107 11 150 142 72 87 396 -148 221 -140 -36
+-11 -680 89 76 7 137 -21 55 63 107 10 149 141 71 87 396 -239 220 -140 -36
+-79 41 4 21 -7 44 -62 42 -5 99 0 99 138 52 42 399 -46 223 -173 -68
+11 -677 48 47 -2 127 -43 46 27 101 3 124 138 60 62 397 -235 220 -160 -55
+-596 -820 12 -21 -53 -267 -74 37 16 44 -37 98 31 9 19 319 212 127 -193 -95
+165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8
+-838 -990 -89 -149 -151 -841 -161 -117 -113 -66 -209 -68 -69 -129 -91 111 221 -55 -255 -173
+176 -858 -79 -103 -115 -717 -148 -95 -108 -17 -162 -61 -12 -95 -69 193 -737 52 -240 -153
+134 -686 0 16 -12 -553 -68 44 -8 96 -9 88 124 41 36 384 11 216 -177 -71
+165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8
+147 -614 89 129 93 -121 12 160 113 217 108 144 144 111 125 447 -241 332 -81 22
+
+">
+<input type="hidden" id="pspm1" name="pspm1" value="
+letter-probability matrix: alength= 20 w= 11 nsites= 25 E= 2.4e-011
+0.240000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.080000 0.000000 0.000000 0.000000
+0.280000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+0.160000 0.320000 0.000000 0.000000 0.000000 0.360000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.000000 0.000000 0.000000
+0.320000 0.000000 0.000000 0.000000 0.000000 0.640000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000
+0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000
+1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+0.760000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.240000 0.000000 0.000000 0.000000
+0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+0.840000 0.000000 0.000000 0.000000 0.000000 0.120000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+
+">
+<input type="hidden" id="blocks1" name="BLOCKS1" value="
+BL MOTIF 1 width=11 seqs=25
+chr21_46046964_46047014_+ ( 12) GGGGTATAAAA 1
+chr21_46057197_46057247_+ ( 36) GGCATATAAAA 1
+chr21_45971413_45971463_- ( 9) GGCATATAAAA 1
+chr21_31964683_31964733_+ ( 13) GGCATATAAAA 1
+chr21_45993530_45993580_+ ( 7) GGAGTATAAAA 1
+chr21_32202076_32202126_- ( 13) GAGGTATAAAA 1
+chr21_46031920_46031970_+ ( 15) AGGGTATAAAA 1
+chr21_32410820_32410870_- ( 21) GATGTATAAAA 1
+chr21_32185595_32185645_- ( 18) GGGATATATAA 1
+chr21_31992870_31992920_+ ( 16) GATGTATAAAA 1
+chr21_46020421_46020471_+ ( 2) GACATATAAAA 1
+chr21_47517957_47518007_+ ( 32) GGGGTATAAAG 1
+chr21_45978668_45978718_- ( 4) GGGGTATAAAG 1
+chr21_31914206_31914256_- ( 15) AGAGTATAAAA 1
+chr21_32253899_32253949_- ( 19) GATATATAAAA 1
+chr21_31744582_31744632_- ( 12) AGCATATATAA 1
+chr21_19617074_19617124_+ ( 39) TGGGTATATAA 1
+chr21_45705687_45705737_+ ( 37) GGGGTATAACA 1
+chr21_31768316_31768366_+ ( 0) AACGTATATAA 1
+chr21_47575506_47575556_- ( 30) AGCGTATAAAG 1
+chr21_26934381_26934431_+ ( 27) GAGTTATAAAA 1
+chr21_31710037_31710087_- ( 14) TGAGTATATAA 1
+chr21_36411748_36411798_- ( 22) GGCATCTAAAA 1
+chr21_31933633_31933683_- ( 2) AGAGTATATAT 1
+chr21_31962741_31962791_- ( 13) GTTGGATAAAA 1
+//
+
+">
+<!--++++++++++++++++++++++++++++FINISHED DATA++++++++++++++++++++++++++++++++-->
+<a name="top_buttons"></a><div class="pad1">
+<h1><img src="http://meme.nbcr.net/meme/images/meme.png" alt="MEME"></h1>
+<p class="spaced">
+ For further information on how to interpret these results or to get a
+ copy of the MEME software please access
+ <a href="http://meme.nbcr.net/">http://meme.nbcr.net</a>.
+ </p>
+</div>
+<div class="pad2">
+<a class="jump" href="#overview">Discovered Motifs</a>
+ Â Â |Â Â
+ <a class="jump" href="#combined">Block diagrams of Motifs</a>
+ Â Â |Â Â
+ <a class="jump" href="#version">Program information</a>
+ Â Â |Â Â
+ <a class="jump" href="#explanation">Explanation</a>
+</div>
+<a name="overview"></a><h2 class="mainh pad2">Discovered Motifs</h2>
+<div class="box">
+<h4>Motif Overview</h4>
+<div class="pad"><table>
+<col style="text-align: center">
+<col style="text-align: right">
+<col style="text-align: right">
+<col>
+<tbody><tr>
+<td><a href="#motif_1">Motif 1</a></td>
+<td style="padding-left:20px"><ul>
+<li>2.4e-011</li>
+<li>25 sites</li>
+</ul></td>
+<td style="padding-left:20px"></td>
+<td style="padding-left:20px;"><a href="#motif_1"><img style="display:block; height:75px" src="logo1.png" id="thumbnail_logo_1" alt="Motif 1 Logo"></a></td>
+</tr></tbody>
+</table></div>
+<h4>Further Analysis</h4>
+<div class="pad">
+ Submit all motifs to
+ <input name="do_MAST_all" value="MAST" type="submit" title="Search sequence databases for the best combined matches with these motifs using MAST." onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')">Â
+ <a href="#MAST_doc" title="Click for more information on MAST." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="do_FIMO_all" value="FIMO" type="submit" title="Search sequence databases for all matches with these motifs using FIMO." onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')">Â
+ <a href="#FIMO_doc" title="Click for more information on FIMO." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="do_BLOCKS_all" value="BLOCKS" type="submit" title="Submit these motifs to BLOCKS multiple alignment processor." onclick="return warnExternal()" onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')">Â
+ <a href="#BLOCKS_doc" title="Click for more information on BLOCKS." class="help"><div class="help"></div></a>
+ Â <span id="overview_action_desc">Mouse-over buttons for more information.</span>
+</div>
+</div>
+<a name="motif_1"></a><table width="100%" border="0" cellspacing="1" cellpadding="4" bgcolor="#FFFFFF"><tr>
+<td><h2 class="mainh">Motif 1</h2></td>
+<td align="right" valign="bottom"><a href="#top_buttons">Top</a></td>
+</tr></table>
+<div class="box">
+<table style="width:100%; background-color:#ddddff">
+<tr>
+<th class="majorth"><h4>Summary <a href="#summary_doc"><div class="help"></div></a>
+</h4></th>
+<th class="majorth"><h4>Sequence Logo <a href="#logo_doc"><div class="help"></div></a>
+</h4></th>
+</tr>
+<tr>
+<td style="width:15em; vertical-align:text-top;">
+<table style="width:100%; " cellspacing="0">
+<col>
+<col style="text-align:left;">
+<tr>
+<th class="minorth">E-value</th>
+<td>2.4e-011</td>
+</tr>
+<tr>
+<th class="minorth">Width</th>
+<td>11</td>
+</tr>
+<tr>
+<th class="minorth">Sites</th>
+<td>25</td>
+</tr>
+</table>
+<a href="javascript:showHidden('summary_extra_1')" id="summary_extra_1_activator">show more</a><div id="summary_extra_1_data" style="display:none"><table style="width:100%;" cellspacing="0">
+<tr><th colspan="2" class="minorth">Log Likelihood Ratio <a href="#llr_doc"><div class="help"></div></a>
+</th></tr>
+<tr>
+<td style="width:8em;">Â </td>
+<td>239</td>
+</tr>
+<tr><th colspan="2" class="minorth">Information Content <a href="#ic_doc"><div class="help"></div></a>
+</th></tr>
+<tr>
+<td>Â </td>
+<td>40.0Â (bits)</td>
+</tr>
+<tr><th colspan="2" class="minorth">Relative Entropy <a href="#re_doc"><div class="help"></div></a>
+</th></tr>
+<tr>
+<td>Â </td>
+<td>13.8Â (bits)</td>
+</tr>
+</table></div>
+<a href="javascript:hideShown('summary_extra_1')" id="summary_extra_1_deactivator" style="display:none;">show less</a>
+</td>
+<td>
+<div class="tabMain"><img src="logo1.png" style="display:block;" id="logo_img_1" height="140" width="260" alt="PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide"></div>
+<div class="tabArea"><a id="logo_tab_std_1" href="javascript:clickLogoTab(false,1)" class="tab activeTab">Standard</a></div>
+<br>
+ Download LOGO <a href="#download_doc" class="help"><div class="help"></div></a>
+ Â Â
+ Orientation:
+ <select name="logorc_1"><option value="false">standard</option>
+<option value="true" disabled>reverse complement</option></select>
+ Â Â
+ SSC:
+ <select name="logossc_1"><option value="false">off</option>
+<option value="true">on</option></select>
+ Â Â
+ Format:
+ <select name="logoformat_1"><option value="png">web (png)</option>
+<option value="eps">publication (eps)</option></select>
+ Â Â
+ Width:
+ <input type="text" size="2" maxlength="5" value="11" title="Width of logo in cm." name="logowidth_1"> cm
+ Â Â
+ Height:
+ <input type="text" size="2" maxlength="5" value="7.5" title="Height of logo in cm." name="logoheight_1"> cm
+ Â Â
+ <input type="submit" value="Download" title="Download a logo" name="do_LOGO_1">
+</td>
+</tr>
+</table>
+<h4>Regular expression <a href="#regular_expression_doc" class="help"><div class="help"></div></a>
+</h4>
+<p class="pad">
+[GA][GA][GC][GA]TATA[AT]AA
+</p>
+<h4>Further Analysis <a href="#further_analysis_doc" class="help"><div class="help"></div></a>
+</h4>
+<div class="pad">
+ Submit this motif to
+ <input type="submit" name="do_MAST_1" value="MAST" title="Scan sequence databases for the best match in each sequence using MAST." onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')">Â
+ <a href="#MAST_doc" title="Click for more information on MAST." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input type="submit" name="do_FIMO_1" value="FIMO" title="Scan sequence databases for all matches with this motif using FIMO." onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')">Â
+ <a href="#FIMO_doc" title="Click for more information on FIMO." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input type="submit" name="do_BLOCKS_1" value="BLOCKS" title="Submit this motif to BLOCKS multiple alignment processor." onclick="return warnExternal()" onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')">Â
+ <a href="#BLOCKS_doc" title="Click for more information on BLOCKS." class="help"><div class="help"></div></a>
+ Â <span id="motif1_action_desc">Mouse-over buttons for more information.</span>
+</div>
+<h4>Data Formats <a href="#formats_doc" class="help"><div class="help"></div></a>
+</h4>
+<div class="pad">
+ View the motif in
+ <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'pspm')">PSPM FormatÂ
+ <a href="#format_PSPM_doc" title="Click for more information on PSPMs." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'pssm')">PSSM FormatÂ
+ <a href="#format_PSSM_doc" title="Click for more information on PSSMs." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'blocks')">BLOCKS FormatÂ
+ <a href="#format_BLOCKS_doc" title="Click for more information on BLOCKS format." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="format_display_1" type="radio" onclick="javascript:showFasta(1)">FASTA FormatÂ
+ <a href="#format_FASTA_doc" title="Click for more information on FASTA format." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ <input name="format_display_1" type="radio" onclick="javascript:showRaw(1)">Raw FormatÂ
+ <a href="#format_raw_doc" title="Click for more information on raw format." class="help"><div class="help"></div></a>
+ Â Â Â Â
+ or
+ <input name="format_display_1" type="radio" onclick="javascript:hideFormat(1)" checked>Hide<br><textarea id="format_display_area_1" rows="20" style="display:none; width:100%;" readonly></textarea><noscript>This feature requires javascript.</noscript>
+</div>
+<h4>Sites <a href="#sites_doc" class="help"><div class="help"></div></a>
+</h4>
+<div class="pad">
+<p>Click on any row to highlight sequence in all motifs.</p>
+<table id="tbl_sites_1" cellpadding="0.5cm">
+<col style="">
+<col style="">
+<col style="">
+<col style="">
+<col style="">
+<col style="">
+<thead><tr>
+<th>Name <a name="sites1"></a>
+</th>
+<th>Start</th>
+<th>
+<i>p</i>-value</th>
+<th colspan="3">Sites <a href="#sites_doc" class="help"><div class="help"></div></a>
+</th>
+</tr></thead>
+<tbody>
+<tr>
+<td class="strand_name">chr21_46046964_46047014_+</td>
+<td class="strand_start">12</td>
+<td class="strand_pvalue">1.06e-06</td>
+<td class="strand_lflank">AAGGCCAGGA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCCTGAGAGC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_46057197_46057247_+</td>
+<td class="strand_start">36</td>
+<td class="strand_pvalue">3.41e-06</td>
+<td class="strand_lflank">ACAGGCCCTG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_45971413_45971463_-</td>
+<td class="strand_start">9</td>
+<td class="strand_pvalue">3.41e-06</td>
+<td class="strand_lflank">CAGGCCCTG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCCCCAGCAG</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31964683_31964733_+</td>
+<td class="strand_start">13</td>
+<td class="strand_pvalue">3.41e-06</td>
+<td class="strand_lflank">GATTCACTGA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GGCCCTCTGC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_45993530_45993580_+</td>
+<td class="strand_start">7</td>
+<td class="strand_pvalue">4.00e-06</td>
+<td class="strand_lflank">CCAAGGA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCCCCACAAA</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_32202076_32202126_-</td>
+<td class="strand_start">13</td>
+<td class="strand_pvalue">5.01e-06</td>
+<td class="strand_lflank">CCACCAGCTT</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">AGCCCTGTAC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_46031920_46031970_+</td>
+<td class="strand_start">15</td>
+<td class="strand_pvalue">6.06e-06</td>
+<td class="strand_lflank">ATACCCAGGG</td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">CCTCAGCAGC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_32410820_32410870_-</td>
+<td class="strand_start">21</td>
+<td class="strand_pvalue">8.67e-06</td>
+<td class="strand_lflank">AATCACTGAG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GTCCCAGGGA</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_32185595_32185645_-</td>
+<td class="strand_start">18</td>
+<td class="strand_pvalue">8.67e-06</td>
+<td class="strand_lflank">CACCAGAGCT</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">AGAAGGTTCT</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31992870_31992920_+</td>
+<td class="strand_start">16</td>
+<td class="strand_pvalue">8.67e-06</td>
+<td class="strand_lflank">CACTATTGAA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">TTTCATTTGC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_46020421_46020471_+</td>
+<td class="strand_start">2</td>
+<td class="strand_pvalue">1.21e-05</td>
+<td class="strand_lflank">GA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCCAACATCC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_47517957_47518007_+</td>
+<td class="strand_start">32</td>
+<td class="strand_pvalue">1.59e-05</td>
+<td class="strand_lflank">CCGGCGGGGC</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span>
+</td>
+<td class="strand_rflank">GGGGCGG</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_45978668_45978718_-</td>
+<td class="strand_start">4</td>
+<td class="strand_pvalue">1.59e-05</td>
+<td class="strand_lflank">CAGA</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span>
+</td>
+<td class="strand_rflank">GTTCCGACCA</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31914206_31914256_-</td>
+<td class="strand_start">15</td>
+<td class="strand_pvalue">1.68e-05</td>
+<td class="strand_lflank">CCCACTACTT</td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">TCATTCTGAG</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_32253899_32253949_-</td>
+<td class="strand_start">19</td>
+<td class="strand_pvalue">2.03e-05</td>
+<td class="strand_lflank">CACCAGCAAG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GCTCAGGAGT</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31744582_31744632_-</td>
+<td class="strand_start">12</td>
+<td class="strand_pvalue">3.06e-05</td>
+<td class="strand_lflank">CAGGTCTAAG</td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">CTTGGAGTCC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_19617074_19617124_+</td>
+<td class="strand_start">39</td>
+<td class="strand_pvalue">3.06e-05</td>
+<td class="strand_lflank">CCTCGGGACG</td>
+<td class="strand_seq">
+<span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank"></td>
+</tr>
+<tr>
+<td class="strand_name">chr21_45705687_45705737_+</td>
+<td class="strand_start">37</td>
+<td class="strand_pvalue">3.82e-05</td>
+<td class="strand_lflank">CGTGGTCGCG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31768316_31768366_+</td>
+<td class="strand_start">0</td>
+<td class="strand_pvalue">3.82e-05</td>
+<td class="strand_lflank"></td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">ATGGTCCTGT</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_47575506_47575556_-</td>
+<td class="strand_start">30</td>
+<td class="strand_pvalue">4.02e-05</td>
+<td class="strand_lflank">GCTGCCGGTG</td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span>
+</td>
+<td class="strand_rflank">GCCCTGGCG</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_26934381_26934431_+</td>
+<td class="strand_start">27</td>
+<td class="strand_pvalue">5.52e-05</td>
+<td class="strand_lflank">AGTCACAAGT</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">GGGTCGCACG</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31710037_31710087_-</td>
+<td class="strand_start">14</td>
+<td class="strand_pvalue">5.94e-05</td>
+<td class="strand_lflank">CCCAGGTTTC</td>
+<td class="strand_seq">
+<span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">TCGCCGCACC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_36411748_36411798_-</td>
+<td class="strand_start">22</td>
+<td class="strand_pvalue">6.78e-05</td>
+<td class="strand_lflank">AGTTTCAGTT</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">C</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">ATTATATAAC</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31933633_31933683_-</td>
+<td class="strand_start">2</td>
+<td class="strand_pvalue">2.08e-04</td>
+<td class="strand_lflank">TC</td>
+<td class="strand_seq">
+<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span>
+</td>
+<td class="strand_rflank">AAATGTTCCT</td>
+</tr>
+<tr>
+<td class="strand_name">chr21_31962741_31962791_-</td>
+<td class="strand_start">13</td>
+<td class="strand_pvalue">4.05e-04</td>
+<td class="strand_lflank">TATAACTCAG</td>
+<td class="strand_seq">
+<span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span>
+</td>
+<td class="strand_rflank">TAATTTGTAC</td>
+</tr>
+</tbody>
+</table>
+</div>
+<h4>Block Diagrams <a href="#diagrams_doc" class="help"><div class="help"></div></a>
+</h4>
+<div class="pad">
+<p>
+ The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.<br>
+ Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.
+ </p>
+<table id="tbl_blocks_1" style="width:100%;" border="0">
+<col style="width:10em;">
+<col style="width:5em;">
+<col>
+<thead><tr>
+<th>Name</th>
+<th>Lowest <i>p</i>-value</th>
+<th>Motif Location</th>
+</tr></thead>
+<tbody>
+<tr>
+<td>chr21_19617074_19617124_+</td>
+<td>3.06e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:78%; top:5.6px; width:22%; height:5.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.06e-05 starts: 40 ends: 50 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_26934381_26934431_+</td>
+<td>5.52e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:54%; top:5.9px; width:22%; height:5.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.52e-05 starts: 28 ends: 38 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31710037_31710087_-</td>
+<td>5.94e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:28%; top:5.9px; width:22%; height:5.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.94e-05 starts: 15 ends: 25 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31744582_31744632_-</td>
+<td>3.06e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:24%; top:5.6px; width:22%; height:5.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.06e-05 starts: 13 ends: 23 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31768316_31768366_+</td>
+<td>3.82e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:0%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.82e-05 starts: 1 ends: 11 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31914206_31914256_-</td>
+<td>1.68e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:30%; top:5.3px; width:22%; height:5.7px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.68e-05 starts: 16 ends: 26 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31933633_31933683_-</td>
+<td>2.08e-04</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:4%; top:6.6px; width:22%; height:4.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 2.08e-04 starts: 3 ends: 13 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31962741_31962791_-</td>
+<td>4.05e-04</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:26%; top:6.9px; width:22%; height:4.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.05e-04 starts: 14 ends: 24 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31964683_31964733_+</td>
+<td>3.41e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:26%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 14 ends: 24 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_31992870_31992920_+</td>
+<td>8.67e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:32%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 17 ends: 27 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_32185595_32185645_-</td>
+<td>8.67e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:36%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 19 ends: 29 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_32202076_32202126_-</td>
+<td>5.01e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:26%; top:4.6px; width:22%; height:6.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.01e-06 starts: 14 ends: 24 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_32253899_32253949_-</td>
+<td>2.03e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:38%; top:5.4px; width:22%; height:5.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 2.03e-05 starts: 20 ends: 30 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_32410820_32410870_-</td>
+<td>8.67e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:42%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 22 ends: 32 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_36411748_36411798_-</td>
+<td>6.78e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:44%; top:6px; width:22%; height:5px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 6.78e-05 starts: 23 ends: 33 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_45705687_45705737_+</td>
+<td>3.82e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:74%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.82e-05 starts: 38 ends: 48 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_45971413_45971463_-</td>
+<td>3.41e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:18%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 10 ends: 20 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_45978668_45978718_-</td>
+<td>1.59e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:8%; top:5.2px; width:22%; height:5.8px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.59e-05 starts: 5 ends: 15 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_45993530_45993580_+</td>
+<td>4.00e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:14%; top:4.5px; width:22%; height:6.5px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.00e-06 starts: 8 ends: 18 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_46020421_46020471_+</td>
+<td>1.21e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:4%; top:5.1px; width:22%; height:5.9px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.21e-05 starts: 3 ends: 13 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_46031920_46031970_+</td>
+<td>6.06e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:30%; top:4.7px; width:22%; height:6.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 6.06e-06 starts: 16 ends: 26 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_46046964_46047014_+</td>
+<td>1.06e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:24%; top:3.8px; width:22%; height:7.2px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.06e-06 starts: 13 ends: 23 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_46057197_46057247_+</td>
+<td>3.41e-06</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:72%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 37 ends: 47 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_47517957_47518007_+</td>
+<td>1.59e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:64%; top:5.2px; width:22%; height:5.8px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.59e-05 starts: 33 ends: 43 "></div>
+</div></td>
+</tr>
+<tr>
+<td>chr21_47575506_47575556_-</td>
+<td>4.02e-05</td>
+<td class="block_td"><div class="block_container">
+<div class="block_rule" style="width:100%"></div>
+<div class="block_motif" style="left:60%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.02e-05 starts: 31 ends: 41 "></div>
+</div></td>
+</tr>
+<tr>
+<td colspan="2">Â </td>
+<td class="block_td" style="color: blue;"><div class="block_container">
+<div class="tic_major" style="left:0%"><div class="tic_label" style="left:-0.5em; width:1em;">0</div></div>
+<div class="tic_minor" style="left:4%;"></div>
+<div class="tic_minor" style="left:8%;"></div>
+<div class="tic_minor" style="left:12%;"></div>
+<div class="tic_minor" style="left:16%;"></div>
+<div class="tic_major" style="left:20%"><div class="tic_label" style="left:-1em; width:2em;">10</div></div>
+<div class="tic_minor" style="left:24%;"></div>
+<div class="tic_minor" style="left:28%;"></div>
+<div class="tic_minor" style="left:32%;"></div>
+<div class="tic_minor" style="left:36%;"></div>
+<div class="tic_major" style="left:40%"><div class="tic_label" style="left:-1em; width:2em;">20</div></div>
+<div class="tic_minor" style="left:44%;"></div>
+<div class="tic_minor" style="left:48%;"></div>
+<div class="tic_minor" style="left:52%;"></div>
+<div class="tic_minor" style="left:56%;"></div>
+<div class="tic_major" style="left:60%"><div class="tic_label" style="left:-1em; width:2em;">30</div></div>
+<div class="tic_minor" style="left:64%;"></div>
+<div class="tic_minor" style="left:68%;"></div>
+<div class="tic_minor" style="left:72%;"></div>
+<div class="tic_minor" style="left:76%;"></div>
+<div class="tic_major" style="left:80%"><div class="tic_label" style="left:-1em; width:2em;">40</div></div>
+<div class="tic_minor" style="left:84%;"></div>
+<div class="tic_minor" style="left:88%;"></div>
+<div class="tic_minor" style="left:92%;"></div>
+<div class="tic_minor" style="left:96%;"></div>
+<div class="tic_major" style="left:100%"><div class="tic_label" style="left:-1em; width:2em;">50</div></div>
+</div></td>
+</tr>
+</tbody>
+</table>
+</div>
+<p>Time 1.6 secs.</p>
+</div>
+<div class="bar">
+<div style="text-align:right;"><a href="#top_buttons">Top</a></div>
+<div class="subsection">
+<a name="version"></a><h5>MEME version</h5>4.5.0 (Release date: Thu Oct 14 08:44:28 EST 2010)
+ </div>
+<div class="subsection">
+<a name="reference"></a><h5>Reference</h5>
+ Timothy L. Bailey and Charles Elkan,
+ "Fitting a mixture model by expectation maximization to discover
+ motifs in biopolymers", Proceedings of the Second International
+ Conference on Intelligent Systems for Molecular Biology, pp. 28-36,
+ AAAI Press, Menlo Park, California, 1994.
+ </div>
+<a name="sequences"></a><a href="javascript:showHidden('trainingseq')" id="trainingseq_activator">show training set...</a><div class="subsection" id="trainingseq_data" style="display:none;">
+<h5>Training set:</h5>
+ Datafile = dan.dat<br>
+ Alphabet = ACDEFGHIKLMNPQRSTVWY<br><table>
+<col>
+<col>
+<col>
+<tr style="vertical-align:top;">
+<td><table class="trainingset">
+<col>
+<col>
+<col>
+<tr>
+<th>Sequence name</th>
+<th>Weighting</th>
+<th>Length</th>
+</tr>
+<tr>
+<td>chr21_19617074_19617124_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31710037_31710087_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31914206_31914256_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31964683_31964733_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_32185595_32185645_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_32410820_32410870_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_45705687_45705737_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_45993530_45993580_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46046964_46047014_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46102103_46102153_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+</table></td>
+<td><table class="trainingset">
+<col>
+<col>
+<col>
+<tr>
+<th>Sequence name</th>
+<th>Weighting</th>
+<th>Length</th>
+</tr>
+<tr>
+<td>chr21_26934381_26934431_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31744582_31744632_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31933633_31933683_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31973364_31973414_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_32202076_32202126_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_36411748_36411798_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_45971413_45971463_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46020421_46020471_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46057197_46057247_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_47517957_47518007_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+</table></td>
+<td><table class="trainingset">
+<col>
+<col>
+<col>
+<tr>
+<th>Sequence name</th>
+<th>Weighting</th>
+<th>Length</th>
+</tr>
+<tr>
+<td>chr21_28217753_28217803_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31768316_31768366_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31962741_31962791_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_31992870_31992920_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_32253899_32253949_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_37838750_37838800_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_45978668_45978718_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46031920_46031970_+</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_46086869_46086919_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+<tr>
+<td>chr21_47575506_47575556_-</td>
+<td>1.000000</td>
+<td>50</td>
+</tr>
+</table></td>
+</tr>
+</table>
+</div>
+<a href="javascript:hideShown('trainingseq')" style="display:none;" id="trainingseq_deactivator">hide training set...</a><div class="subsection">
+<a name="command"></a><h5>Command line summary</h5>
+<textarea rows="1" style="width:100%;" readonly>meme dan.dat -o /dataset_dan_files -nostatus </textarea><br>
+ Letter frequencies in dataset<br><div style="margin-left:25px;">A:Â 0.294Â Â Â C:Â 0.231Â Â Â D:Â 0.000Â Â Â E:Â 0.000Â Â Â F:Â 0.000Â Â Â G:Â 0.257Â Â Â H:Â 0.000Â Â Â I:Â 0.000Â Â Â K:Â 0.000Â Â Â L:Â 0.000Â Â Â M:Â 0.000Â Â Â N:Â 0.000Â Â Â P:Â 0.000Â Â Â Q:Â 0.000Â Â Â R:Â 0.000Â Â Â S:Â 0.000Â Â Â T:Â 0.217Â Â Â V:Â 0.000Â Â Â W:Â 0.000Â Â Â Y:Â 0.000</div>
+<br>
+ Background letter frequencies (from dataset with add-one prior applied):<br><div style="margin-left:25px;">A:Â 0.291Â Â Â C:Â 0.229Â Â Â D:Â 0.001Â Â Â E:Â 0.001Â Â Â F:Â 0.001Â Â Â G:Â 0.255Â Â Â H:Â 0.001Â Â Â I:Â 0.001Â Â Â K:Â 0.001Â Â Â L:Â 0.001Â Â Â M:Â 0.001Â Â Â N:Â 0.001Â Â Â P:Â 0.001Â Â Â Q:Â 0.001Â Â Â R:Â 0.001Â Â Â S:Â 0.001Â Â Â T:Â 0.215Â Â Â V:Â 0.001Â Â Â W:Â 0.001Â Â Â Y:Â 0.001</div>
+<br>
+</div>
+<div class="subsection">
+<a name="stopped"></a><h5>Stopping Reason</h5>Stopped because nmotifs = 1 reached. Program ran on <i>dan</i>.
+ </div>
+<a href="javascript:showHidden('model')" id="model_activator">show model parameters...</a><div class="subsection" id="model_data" style="display:none;">
+<h5>Model parameters</h5>
+<textarea style="width:100%;" rows="28" readonly>
+host = dan
+type = zoops
+nmotifs = 1
+evalue_threshold = inf
+object_function = E-value of product of p-values
+min_width = 8
+max_width = 50
+minic = 0.00
+wg = 11
+ws = 1
+endgaps = yes
+minsites = 2
+maxsites = 30
+wnsites = 0.8
+prob = 1
+spmap = pam
+spfuzz = 120
+prior = megap
+beta = 7500
+maxiter = 50
+distance = 1e-05
+num_sequences = 30
+num_positions = 1500
+seed = 0
+seqfrac = 1
+strands = none
+priors_file = prior30.plib
+reason_for_stopping = Stopped because nmotifs = 1 reached.
+</textarea>
+</div>
+<a href="javascript:hideShown('model')" style="display:none;" id="model_deactivator">hide model parameters...</a>
+</div>
+<span class="explain"><a name="explanation"></a><table width="100%" border="0" cellspacing="1" cellpadding="4" bgcolor="#FFFFFF"><tr>
+<td><h2 class="mainh">Explanation of MEME Results</h2></td>
+<td align="right" valign="bottom"><a href="#top_buttons">Top</a></td>
+</tr></table>
+<div class="box">
+<h4>The MEME results consist of</h4>
+<ul>
+<li>The <a href="#overview"><b>overview</b></a> of all discovered motifs.</li>
+<li>Information on each of the <a href="#motifs"><b>motifs</b></a> MEME discovered, including:
+ <ol>
+<li>
+ A <a href="#summary_doc"><b>summary table</b></a> showing the width, number of contributing sites, log likelihood ratio,
+ statistical significance, information content and relative entropy of the motif.
+ </li>
+<li>A <a href="#logo_doc"><b>sequence LOGO</b></a>.</li>
+<li>Downloadable <a href="#download"><b>LOGO files</b></a> suitable for publication.</li>
+<li>A <a href="#regular_expression_doc"><b>regular expression</b></a> describing the motif.</li>
+<li>Some <a href="#further_analysis_doc"><b>further analysis</b></a> that can be performed on the motif.</li>
+<li>A list of <a href="#formats_doc"><b>data formats</b></a> describing the motif.</li>
+<li>The <a href="#sites_doc"><b>contributing sites</b></a> of the motif sorted by <i>p</i>-value and aligned with each other.</li>
+<li>
+ The <a href="#diagrams_doc"><b>block diagrams</b></a> of the contributing sites of the motif within each sequence in the training set.
+ </li>
+</ol>
+</li>
+<li>A <a href="#combined"><b>combined block diagram</b></a> showing an optimized (non-overlapping)
+ tiling of all of the motifs onto each of the sequences in the training set.
+ </li>
+<li>The <a href="#version"><b>version</b></a> of MEME and the date it was released.</li>
+<li>The <a href="#reference"><b>reference</b></a> to cite if you use MEME in your research.</li>
+<li>
+ A description of the <a href="#sequences"><b>sequences</b></a> you submitted (the "training set") showing the name,
+ "weight" and length of each sequence.
+ </li>
+<li>The <a href="#command"><b>command line summary</b></a> detailing the parameters with which you ran MEME.</li>
+<li>The reason why MEME <a href="#stopped"><b>stopped</b></a> and the name of the CPU on which it ran.</li>
+<li>This <b>explanation</b> of how to interpret MEME results.</li>
+</ul>
+<a name="motifs"></a><h4>Motifs</h4>
+<p>
+ For each motif that it discovers in the training set,
+ MEME prints the following information:
+ </p>
+<a name="summary_doc"></a><h5>Summary Table</h5>
+<div class="doc">
+<p>
+ This summary table gives the main attributes of the motif.
+ </p>
+<dl>
+<dt>
+<i>E</i>-value</dt>
+<dd>
+ The statistical significance of the motif. MEME usually finds the most statistically significant (low <i>E</i>-value) motifs first.
+ The <i>E</i>-value of a motif is based on its log likelihood ratio, width, sites, the background letter frequencies (given in the
+ <a href="#command">command line summary</a>), and the size of the training set. The <i>E</i>-value is an estimate of the expected
+ number of motifs with the given log likelihood ratio (or higher), and with the same width and site count, that one would find in
+ a similarly sized set of random sequences. (In random sequences each position is independent with letters chosen according to
+ the background letter frequencies.)
+ </dd>
+<dt>Width</dt>
+<dd>The width of the motif. Each motif describes a pattern of a fixed with as no gaps are allowed in MEME motifs.</dd>
+<dt>Sites</dt>
+<dd>The number of sites contributing to the construction of the motif.</dd>
+<dt>
+<a name="llr_doc"></a>Log Likelihood Ratio</dt>
+<dd>
+ The log likelihood ratio of the motif.The log likelihood ratio is the logarithm of the ratio of the probability of the occurrences
+ of the motif given the motif model (likelihood given the motif) versus their probability given the background model
+ (likelihood given the null model). (Normally the background model is a 0-order Markov model using the background letter
+ frequencies, but higher order Markov models may be specified via the <b>-bfile</b> option to MEME.)
+ </dd>
+<dt>
+<a name="ic_doc"></a>Information Content</dt>
+<dd>
+ The information content of the motif in bits. It is equal to the sum of the <b>uncorrected</b> information content, <tt>R()</tt>,
+ in the columns of the <a href="#logo_doc">LOGO</a>. This is equal relative entropy of the motif relative to a uniform background frequency
+ model.
+ </dd>
+<dt>
+<a name="re_doc"></a>Relative Entropy</dt>
+<dd>
+ The relative entropy of the motif, computed in bits and relative to the background letter frequencies given in the
+ <a href="#command">command line summary</a>. It is equal to the log-likelihood ratio (llr) divided by the
+ number of contributing sites of the motif times <tt>1/ln(2)</tt>,<br><br><tt>re = llr / (sites * ln(2))</tt>.
+ </dd>
+</dl>
+</div>
+<a name="logo_doc"></a><h5 class="doc">Sequence LOGO</h5>
+<div class="doc">
+<p>
+ MEME motifs are represented by position-specific probability matrices
+ that specify the probability of each possible letter appearing at each
+ possible position in an occurrence of the motif. These are displayed
+ as "sequence LOGOS", containing stacks of letters at each position
+ in the motif. The total height of the stack is the "information
+ content" of that position in the motif in bits. The height of the
+ individual letters in a stack is the probability of the letter at that
+ position multiplied by the total information content of the stack.
+ </p>
+<p>
+ Note: The MEME LOGO differs from those produced by the
+ <a href="http://weblogo.berkeley.edu">Weblogo</a> program
+ because a <b>small-sample correction is NOT applied</b>.
+ However, MEME LOGOs in PNG and encapsulated postscript (EPS) formats
+ <b>with small-sample correction (SSC)</b> are available by clicking
+ on the download button with "SSC" set to "on" under
+ <a href="#download_doc">Download LOGO</a>.
+ The MEME LOGOs without small sample correction are similarly available.
+ Error bars are included in the LOGOs with small-sample correction.
+ </p>
+<p>
+ Modern web browsers supporting the canvas element and it's text manipulation functions as described in the
+ html 5 standard, can render the sequence LOGOs without needing the images. The browsers which work with this
+ feature are:
+ </p>
+<ul>
+<li>Firefox 3.5 and above</li>
+<li>Safari 4 and above</li>
+<li>Google Chrome 4 and above</li>
+</ul>
+<p>
+ Unfortunately Internet Explorer 8 does not support any html 5 features.
+ </p>
+<p>
+ The information content of each motif position is computed as described in the paper by Schneider and Stephens,
+ "Sequence Logos: A New Way to Display Consensus Sequences" but
+ <b>the small-sample correction, <tt>e(n)</tt>, is set to zero for the LOGO displayed in the MEME output.</b>
+ The corrected information content of position <tt>i</tt> is given by
+ </p>
+<pre>
+ R(i) for amino acids = log2(20) - (H(i) + e(n)) (1a)
+ R(i) for nucleic acids = 2 - (H(i) + e(n)) (1b)
+ </pre>
+<p>where H(i) is the entropy of position <tt>i</tt>,</p>
+<pre>
+ H(l) = - (Sum f(a,i) * log2[ f(a,i) ]). (2)
+ </pre>
+<p>
+ Here, f(a,i) is the frequency of base or amino acid <tt>a</tt> at position <tt>i</tt>, and <tt>e(n)</tt> is the small-sample correction
+ for an alignment of <tt>n</tt> letters. The height of letter <tt>a</tt> in column <tt>i</tt> is given by
+ </p>
+<pre>
+ height = f(a,i) * R(i) (3)
+ </pre>
+<p>The approximation for the small-sample correction, <tt>e(n)</tt>, is given by:</p>
+<pre>
+ e(n) = (s-1) / (2 * ln(2) * n), (4)
+ </pre>
+<p>where <tt>s</tt> is 4 for nucleotides, 20 for amino acids, and <tt>n</tt> is the number of sequences in the alignment.</p>
+<p>
+ The letters in the logos are colored as follows.<br>
+ For DNA sequences, the letter categories contain one letter each.
+ </p>
+<table border="1">
+<thead><tr>
+<th>NUCLEIC ACIDS</th>
+<th>COLOR</th>
+</tr></thead>
+<tbody>
+<tr>
+<td>A</td>
+<td style="color:red;">RED</td>
+</tr>
+<tr>
+<td>C</td>
+<td style="color:blue;">BLUE</td>
+</tr>
+<tr>
+<td>G</td>
+<td style="color:orange;">ORANGE</td>
+</tr>
+<tr>
+<td>T</td>
+<td style="color:green;">GREEN</td>
+</tr>
+</tbody>
+</table>
+<p>For proteins, the categories are based on the biochemical properties of the various amino acids.</p>
+<table border="1">
+<thead><tr>
+<th>AMINO ACIDS</th>
+<th>COLOR</th>
+<th>PROPERTIES</th>
+</tr></thead>
+<tbody>
+<tr>
+<td>A, C, F, I, L, V, W and M</td>
+<td style="color:blue;">BLUE</td>
+<td>Most hydrophobic[Kyte and Doolittle, 1982]</td>
+</tr>
+<tr>
+<td>NQST</td>
+<td style="color:green;">GREEN</td>
+<td>Polar, non-charged, non-aliphatic residues</td>
+</tr>
+<tr>
+<td>DE</td>
+<td style="color:magenta;">MAGENTA</td>
+<td>Acidic</td>
+</tr>
+<tr>
+<td>KR</td>
+<td style="color:red;">RED</td>
+<td>Positively charged</td>
+</tr>
+<tr>
+<td>H</td>
+<td style="color:pink;">PINK</td>
+<td>Â </td>
+</tr>
+<tr>
+<td>G</td>
+<td style="color:orange;">ORANGE</td>
+<td>Â </td>
+</tr>
+<tr>
+<td>P</td>
+<td style="color:yellow;">YELLOW</td>
+<td>Â </td>
+</tr>
+<tr>
+<td>Y</td>
+<td style="color:turquoise;">TURQUOISE</td>
+<td>Â </td>
+</tr>
+</tbody>
+</table>
+<p>
+ J. Kyte and R. Doolittle, 1982. "A Simple Method for Displaying the Hydropathic Character of a Protein",
+ J. Mol Biol. 157, 105-132.
+ </p>
+<p><b>Note:</b> the "text" output format of MEME preserves the historical MEME format where LOGOS are replaced by a simplified probability
+ matrix, a relative entropy plot, and a multi-level consensus sequence.
+ </p>
+</div>
+<a name="download_doc"></a><h5 class="doc">Download LOGO</h5>
+<div class="doc"><p>
+ Logos can be generated on the fly by the meme webservice and you may specify a number of options to customize them to your needs.
+ The options are:
+ <dl>
+<dt>Orientation</dt>
+<dd>Only valid for nucleotide motifs. Generate the standard view or the reverse complemented view of the motif.</dd>
+<dt>SSC</dt>
+<dd>Use small sample correction and show errorbars on the image.
+ Small sample correction is used by the <a href="http://weblogo.berkeley.edu">Weblogo</a> program.</dd>
+<dt>Format</dt>
+<dd>The format of the generated image.
+ If the image is to be used on the web then png is recommend.
+ If the image is to be published then eps is recommended.
+ </dd>
+<dt>Width</dt>
+<dd>The width of the generated image in centimetres.</dd>
+<dt>Height</dt>
+<dd>The height of the generated image in centimetres.</dd>
+</dl></p></div>
+<a name="regular_expression_doc"></a><h5>Regular Expression</h5>
+<div class="doc"><p>
+ This is a regular expression (RE) describing the motif. In each column, all letters with observed frequencies greater than 0.2 are shown;
+ less-frequent letters are not included in the RE. MEME regular expressions are interpreted as follows: single letters match that letter;
+ groups of letters in square brackets match any of the letters in the group. Regular expressions can be used for searching for the motif
+ in sequences (using, for example, <a href="http://nar.oxfordjournals.org/cgi/content/full/33/suppl_2/W262">PatMatch</a>) but the search
+ accuracy will usually be better with the PSSM (using, for example <a href="http://meme.nbcr.net/meme/mast-intro.html">MAST</a>.)
+ </p></div>
+<a name="further_analysis_doc"></a><h5>Further Analysis</h5>
+<div class="doc">
+<p>Either as a group or individually the motifs have a number of options for further analysis.</p>
+<dl>
+<dt>
+<a name="MAST_doc"></a>MAST</dt>
+<dd>
+ Finds the best matching positions for a set of motifs in each sequence provided to it, ranked by the combined score of each sequence.
+ For more information about MAST please read the <a href="http://meme.nbcr.net/meme/mast-intro.html">introduction</a>.
+ </dd>
+<dt>
+<a name="FIMO_doc"></a>FIMO</dt>
+<dd>
+ Finds all matches for a motif.
+ For more information about FIMO please read the <a href="http://meme.nbcr.net/meme/fimo-intro.html">introduction</a>.
+ </dd>
+<dt>
+<a name="TOMTOM_doc"></a>TOMTOM</dt>
+<dd>
+ Compares a single motif to a database of motifs.
+ For more information about TOMTOM please read the <a href="http://meme.nbcr.net/meme/tomtom-intro.html">introduction</a>.
+ </dd>
+<dt>
+<a name="GOMO_doc"></a>GOMO</dt>
+<dd>
+ Identifies possible roles of DNA binding motifs.
+ For more information about GOMO please read the <a href="http://meme.nbcr.net/meme/gomo-intro.html">introduction</a>.
+ </dd>
+<dt>
+<a name="BLOCKS_doc"></a>BLOCKS</dt>
+<dd>
+ Submit to Blocks Multiple Alignment Processor where you can do several things like create phylogeny trees and search the blocks
+ against a database of other blocks (protein only). For more information about BLOCKS Multiple Alignment Processor please visit the
+ <a href="http://blocks.fhcrc.org/blocks/process_blocks.html">website</a>.
+ </dd>
+</dl>
+</div>
+<a name="formats_doc"></a><h5>Data Formats</h5>
+<div class="doc">
+<p>The extracted data is avaliable in the following formats.</p>
+<dl>
+<dt>
+<a name="format_PSPM_doc"></a>PSPM Format</dt>
+<dd>
+ The motif itself is a position-specific probability matrix giving, for each position in the pattern, the observed frequency ("probability")
+ of each possible letter. The probability matrix is printed "sideways"--columns correspond to the letters in the alphabet (in the same order
+ as shown in the simplified motif) and rows corresponding to the positions of the motif, position one first. The motif is preceded by a line
+ starting with "letter-probability matrix:" and containing the length of the alphabet, width of the motif, number of occurrences of the motif,
+ and the <i>E</i>-value of the motif.<br><b>Note:</b> Earlier versions of MEME gave the posterior probabilities--the probability after applying a prior on letter frequencies--rather
+ than the observed frequencies. These versions of MEME also gave the number of <i>possible</i> positions for the motif rather than the actual
+ number of occurrences. The output from these earlier versions of MEME can be distinguished by "n=" rather than "nsites=" in the line
+ preceding the matrix.
+ </dd>
+<dt>
+<a name="format_PSSM_doc"></a>PSSM Format</dt>
+<dd>
+ The position-specific scoring matrix corresponding to the motif is printed for use by database search programs such as MAST.
+ This matrix is a log-odds matrix calculated by taking 100 times the log (base 2) of the ratio <i>p/f</i> at each position in
+ the motif where <i>p</i> is the probability of a particular letter at that position in the motif, and <i>f</i> is the background
+ frequency of the letter (given in the <a href="#command">command line summary</a> section.) This is the same matrix that is used
+ above in computing the <i>p</i>-values of the occurrences of the motif in the <a href="#sites_doc">Sites</a>
+ and <a href="#diagrams_doc">Block Diagrams</a> sections. The scoring matrix is printed "sideways"--columns
+ correspond to the letters in the alphabet (in the same order as shown in the simplified motif) and rows corresponding to the
+ positions of the motif, position one first. The scoring matrix is preceded by a line starting with "log-odds matrix:" and
+ containing the length of the alphabet, width of the motif, number of characters in the training set, the scoring threshold
+ (obsolete) and the motif <i>E</i>-value.<br><b>Note:</b> The probability <i>p</i> used to compute the PSSM is <i>not</i> exactly the same as the corresponding value in the
+ Position Specific Probability Matrix (PSPM). The values of <i>p</i> used to compute the PSSM take into account the motif prior,
+ whereas the values in the PSPM are just the <i>observed</i> frequencies of letters in the motif sites.
+ </dd>
+<dt>
+<a name="format_BLOCKS_doc"></a>BLOCKS Format</dt>
+<dd>
+ For use with <a href="http://blocks.fhcrc.org/blocks">BLOCKS tools</a>.
+ </dd>
+<dt>
+<a name="format_FASTA_doc"></a>FASTA Format</dt>
+<dd>
+ The FASTA format as described <a href="http://meme.nbcr.net/meme/doc/fasta-format.html">here</a>.
+ </dd>
+<dt>
+<a name="format_raw_doc"></a>Raw Format</dt>
+<dd>
+ Just the sites of the sequences that contributed to the motif. One site per line.
+ </dd>
+</dl>
+</div>
+<a name="sites_doc"></a><h5 class="doc">Sites</h5>
+<div class="doc"><p>
+ MEME displays the occurrences (sites) of the motif in the training set. The sites are shown aligned with each other, and the ten sequence
+ positions preceding and following each site are also shown. Each site is identified by the name of the sequence where it occurs,
+ the strand (if both strands of DNA sequences are being used), and the position in the sequence where the site begins. When the DNA strand
+ is specified, '+' means the sequence in the training set, and '-' means the reverse complement of the training set sequence.
+ (For '-' strands, the 'start' position is actually the position on the <b>positive</b> strand where the site ends.) The sites are <b>listed
+ in order of increasing statistical significance</b> (<i>p</i>-value). The <i>p</i>-value of a site is computed from the the match score of
+ the site with the <a href="#format_PSSM_doc">position specific scoring matrix</a> for the motif. The <i>p</i>-value gives the probability of a
+ random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the
+ <b>position <i>p</i>-value</b> by the MAST algorithm.)
+ </p></div>
+<a name="diagrams_doc"></a><h5 class="doc">Block Diagrams</h5>
+<div class="doc"><p>
+ The occurrences of the motif in the training set sequences are shown as coloured blocks on a line. One diagram is printed for each
+ sequence showing all the sites contributating to that motif in that sequence. The sequences are <b>listed in the same order as in the input</b>
+ to make it easier to compare multiple block diagrams. Additionally the best <i>p</i>-value for the sequence/motif combination is
+ listed though this may not be in ascending order as with the sites. The <i>p</i>-value of an occurrence is the probability of a single
+ random subsequence the length of the motif, generated according to the 0-order background model, having a score at least as high as
+ the score of the occurrence. When the DNA strand is specified '+', it means the motif appears from left to right on the sequence, and '-'
+ means the motif appears from right to left on the complementary strand. A sequence position scale is shown at the end of each table of
+ block diagrams.
+ </p></div>
+<a name="combined_doc"></a><h5>Combined Block Diagrams</h5>
+<div class="doc">
+<p>
+ The motif occurrences shown in the motif summary <b>may not be exactly the same as those reported in each motif section</b> because
+ only motifs with a position <em>p</em>-value of 0.0001 that don't overlap other, more significant motif occurrences are shown.
+ </p>
+<p>
+ See the documentation for <a href="http://meme.nbcr.net/meme/mast-output.html">MAST output</a> for the definition of position and
+ combined <em>p</em>-values.
+ </p>
+</div>
+</div></span><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br>
+</form></body>
+</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme/meme/meme_output_txt_1.txt Tue Feb 01 11:20:02 2011 -0500
@@ -0,0 +1,325 @@
+********************************************************************************
+MEME - Motif discovery tool
+********************************************************************************
+MEME version 4.5.0 (Release date: Thu Oct 14 08:44:28 EST 2010)
+
+For further information on how to interpret these results or to get
+a copy of the MEME software please access http://meme.nbcr.net.
+
+This file may be used as input to the MAST algorithm for searching
+sequence databases for matches to groups of motifs. MAST is available
+for interactive use and downloading at http://meme.nbcr.net.
+********************************************************************************
+
+
+********************************************************************************
+REFERENCE
+********************************************************************************
+If you use this program in your research, please cite:
+
+Timothy L. Bailey and Charles Elkan,
+"Fitting a mixture model by expectation maximization to discover
+motifs in biopolymers", Proceedings of the Second International
+Conference on Intelligent Systems for Molecular Biology, pp. 28-36,
+AAAI Press, Menlo Park, California, 1994.
+********************************************************************************
+
+
+********************************************************************************
+TRAINING SET
+********************************************************************************
+DATAFILE= dan.dat
+ALPHABET= ACDEFGHIKLMNPQRSTVWY
+Sequence name Weight Length Sequence name Weight Length
+------------- ------ ------ ------------- ------ ------
+chr21_19617074_19617124_ 1.0000 50 chr21_26934381_26934431_ 1.0000 50
+chr21_28217753_28217803_ 1.0000 50 chr21_31710037_31710087_ 1.0000 50
+chr21_31744582_31744632_ 1.0000 50 chr21_31768316_31768366_ 1.0000 50
+chr21_31914206_31914256_ 1.0000 50 chr21_31933633_31933683_ 1.0000 50
+chr21_31962741_31962791_ 1.0000 50 chr21_31964683_31964733_ 1.0000 50
+chr21_31973364_31973414_ 1.0000 50 chr21_31992870_31992920_ 1.0000 50
+chr21_32185595_32185645_ 1.0000 50 chr21_32202076_32202126_ 1.0000 50
+chr21_32253899_32253949_ 1.0000 50 chr21_32410820_32410870_ 1.0000 50
+chr21_36411748_36411798_ 1.0000 50 chr21_37838750_37838800_ 1.0000 50
+chr21_45705687_45705737_ 1.0000 50 chr21_45971413_45971463_ 1.0000 50
+chr21_45978668_45978718_ 1.0000 50 chr21_45993530_45993580_ 1.0000 50
+chr21_46020421_46020471_ 1.0000 50 chr21_46031920_46031970_ 1.0000 50
+chr21_46046964_46047014_ 1.0000 50 chr21_46057197_46057247_ 1.0000 50
+chr21_46086869_46086919_ 1.0000 50 chr21_46102103_46102153_ 1.0000 50
+chr21_47517957_47518007_ 1.0000 50 chr21_47575506_47575556_ 1.0000 50
+********************************************************************************
+
+********************************************************************************
+COMMAND LINE SUMMARY
+********************************************************************************
+This information can also be useful in the event you wish to report a
+problem with the MEME software.
+
+command: meme dan.dat -o dan/dataset_dan_files -nostatus
+
+model: mod= zoops nmotifs= 1 evt= inf
+object function= E-value of product of p-values
+width: minw= 8 maxw= 50 minic= 0.00
+width: wg= 11 ws= 1 endgaps= yes
+nsites: minsites= 2 maxsites= 30 wnsites= 0.8
+theta: prob= 1 spmap= pam spfuzz= 120
+global: substring= yes branching= no wbranch= no
+em: prior= megap b= 7500 maxiter= 50
+ distance= 1e-05
+data: n= 1500 N= 30
+
+sample: seed= 0 seqfrac= 1
+Dirichlet mixture priors file: prior30.plib
+Letter frequencies in dataset:
+A 0.294 C 0.231 D 0.000 E 0.000 F 0.000 G 0.257 H 0.000 I 0.000 K 0.000
+L 0.000 M 0.000 N 0.000 P 0.000 Q 0.000 R 0.000 S 0.000 T 0.217 V 0.000
+W 0.000 Y 0.000
+Background letter frequencies (from dataset with add-one prior applied):
+A 0.291 C 0.229 D 0.001 E 0.001 F 0.001 G 0.255 H 0.001 I 0.001 K 0.001
+L 0.001 M 0.001 N 0.001 P 0.001 Q 0.001 R 0.001 S 0.001 T 0.215 V 0.001
+W 0.001 Y 0.001
+********************************************************************************
+
+
+********************************************************************************
+MOTIF 1 width = 11 sites = 25 llr = 239 E-value = 2.4e-011
+********************************************************************************
+--------------------------------------------------------------------------------
+ Motif 1 Description
+--------------------------------------------------------------------------------
+Simplified A 2323:a:a8a8
+pos.-specific C ::3::::::::
+probability D :::::::::::
+matrix E :::::::::::
+ F :::::::::::
+ G 7746::::::1
+ H :::::::::::
+ I :::::::::::
+ K :::::::::::
+ L :::::::::::
+ M :::::::::::
+ N :::::::::::
+ P :::::::::::
+ Q :::::::::::
+ R :::::::::::
+ S :::::::::::
+ T 1:2:a:a:2::
+ V :::::::::::
+ W :::::::::::
+ Y :::::::::::
+
+ bits 10.6
+ 9.5
+ 8.5
+ 7.4
+Relative 6.3
+Entropy 5.3
+(13.8 bits) 4.2
+ 3.2
+ 2.1 * **
+ 1.1 ** ********
+ 0.0 -----------
+
+Multilevel GGGGTATAAAA
+consensus AACA T
+sequence
+
+
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 sites sorted by position p-value
+--------------------------------------------------------------------------------
+Sequence name Start P-value Site
+------------- ----- --------- -----------
+chr21_46046964_46047014_ 13 1.06e-06 AAGGCCAGGA GGGGTATAAAA GCCTGAGAGC
+chr21_46057197_46057247_ 37 3.41e-06 ACAGGCCCTG GGCATATAAAA GCC
+chr21_45971413_45971463_ 10 3.41e-06 CAGGCCCTG GGCATATAAAA GCCCCAGCAG
+chr21_31964683_31964733_ 14 3.41e-06 GATTCACTGA GGCATATAAAA GGCCCTCTGC
+chr21_45993530_45993580_ 8 4.00e-06 CCAAGGA GGAGTATAAAA GCCCCACAAA
+chr21_32202076_32202126_ 14 5.01e-06 CCACCAGCTT GAGGTATAAAA AGCCCTGTAC
+chr21_46031920_46031970_ 16 6.06e-06 ATACCCAGGG AGGGTATAAAA CCTCAGCAGC
+chr21_32410820_32410870_ 22 8.67e-06 AATCACTGAG GATGTATAAAA GTCCCAGGGA
+chr21_32185595_32185645_ 19 8.67e-06 CACCAGAGCT GGGATATATAA AGAAGGTTCT
+chr21_31992870_31992920_ 17 8.67e-06 CACTATTGAA GATGTATAAAA TTTCATTTGC
+chr21_46020421_46020471_ 3 1.21e-05 GA GACATATAAAA GCCAACATCC
+chr21_47517957_47518007_ 33 1.59e-05 CCGGCGGGGC GGGGTATAAAG GGGGCGG
+chr21_45978668_45978718_ 5 1.59e-05 CAGA GGGGTATAAAG GTTCCGACCA
+chr21_31914206_31914256_ 16 1.68e-05 CCCACTACTT AGAGTATAAAA TCATTCTGAG
+chr21_32253899_32253949_ 20 2.03e-05 CACCAGCAAG GATATATAAAA GCTCAGGAGT
+chr21_31744582_31744632_ 13 3.06e-05 CAGGTCTAAG AGCATATATAA CTTGGAGTCC
+chr21_19617074_19617124_ 40 3.06e-05 CCTCGGGACG TGGGTATATAA
+chr21_45705687_45705737_ 38 3.82e-05 CGTGGTCGCG GGGGTATAACA GC
+chr21_31768316_31768366_ 1 3.82e-05 . AACGTATATAA ATGGTCCTGT
+chr21_47575506_47575556_ 31 4.02e-05 GCTGCCGGTG AGCGTATAAAG GCCCTGGCG
+chr21_26934381_26934431_ 28 5.52e-05 AGTCACAAGT GAGTTATAAAA GGGTCGCACG
+chr21_31710037_31710087_ 15 5.94e-05 CCCAGGTTTC TGAGTATATAA TCGCCGCACC
+chr21_36411748_36411798_ 23 6.78e-05 AGTTTCAGTT GGCATCTAAAA ATTATATAAC
+chr21_31933633_31933683_ 3 2.08e-04 TC AGAGTATATAT AAATGTTCCT
+chr21_31962741_31962791_ 14 4.05e-04 TATAACTCAG GTTGGATAAAA TAATTTGTAC
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 block diagrams
+--------------------------------------------------------------------------------
+SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM
+------------- ---------------- -------------
+chr21_46046964_46047014_ 1.1e-06 12_[1]_27
+chr21_46057197_46057247_ 3.4e-06 36_[1]_3
+chr21_45971413_45971463_ 3.4e-06 9_[1]_30
+chr21_31964683_31964733_ 3.4e-06 13_[1]_26
+chr21_45993530_45993580_ 4e-06 7_[1]_32
+chr21_32202076_32202126_ 5e-06 13_[1]_26
+chr21_46031920_46031970_ 6.1e-06 15_[1]_24
+chr21_32410820_32410870_ 8.7e-06 21_[1]_18
+chr21_32185595_32185645_ 8.7e-06 18_[1]_21
+chr21_31992870_31992920_ 8.7e-06 16_[1]_23
+chr21_46020421_46020471_ 1.2e-05 2_[1]_37
+chr21_47517957_47518007_ 1.6e-05 32_[1]_7
+chr21_45978668_45978718_ 1.6e-05 4_[1]_35
+chr21_31914206_31914256_ 1.7e-05 15_[1]_24
+chr21_32253899_32253949_ 2e-05 19_[1]_20
+chr21_31744582_31744632_ 3.1e-05 12_[1]_27
+chr21_19617074_19617124_ 3.1e-05 39_[1]
+chr21_45705687_45705737_ 3.8e-05 37_[1]_2
+chr21_31768316_31768366_ 3.8e-05 [1]_39
+chr21_47575506_47575556_ 4e-05 30_[1]_9
+chr21_26934381_26934431_ 5.5e-05 27_[1]_12
+chr21_31710037_31710087_ 5.9e-05 14_[1]_25
+chr21_36411748_36411798_ 6.8e-05 22_[1]_17
+chr21_31933633_31933683_ 0.00021 2_[1]_37
+chr21_31962741_31962791_ 0.0004 13_[1]_26
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 in BLOCKS format
+--------------------------------------------------------------------------------
+BL MOTIF 1 width=11 seqs=25
+chr21_46046964_46047014_ ( 13) GGGGTATAAAA 1
+chr21_46057197_46057247_ ( 37) GGCATATAAAA 1
+chr21_45971413_45971463_ ( 10) GGCATATAAAA 1
+chr21_31964683_31964733_ ( 14) GGCATATAAAA 1
+chr21_45993530_45993580_ ( 8) GGAGTATAAAA 1
+chr21_32202076_32202126_ ( 14) GAGGTATAAAA 1
+chr21_46031920_46031970_ ( 16) AGGGTATAAAA 1
+chr21_32410820_32410870_ ( 22) GATGTATAAAA 1
+chr21_32185595_32185645_ ( 19) GGGATATATAA 1
+chr21_31992870_31992920_ ( 17) GATGTATAAAA 1
+chr21_46020421_46020471_ ( 3) GACATATAAAA 1
+chr21_47517957_47518007_ ( 33) GGGGTATAAAG 1
+chr21_45978668_45978718_ ( 5) GGGGTATAAAG 1
+chr21_31914206_31914256_ ( 16) AGAGTATAAAA 1
+chr21_32253899_32253949_ ( 20) GATATATAAAA 1
+chr21_31744582_31744632_ ( 13) AGCATATATAA 1
+chr21_19617074_19617124_ ( 40) TGGGTATATAA 1
+chr21_45705687_45705737_ ( 38) GGGGTATAACA 1
+chr21_31768316_31768366_ ( 1) AACGTATATAA 1
+chr21_47575506_47575556_ ( 31) AGCGTATAAAG 1
+chr21_26934381_26934431_ ( 28) GAGTTATAAAA 1
+chr21_31710037_31710087_ ( 15) TGAGTATATAA 1
+chr21_36411748_36411798_ ( 23) GGCATCTAAAA 1
+chr21_31933633_31933683_ ( 3) AGAGTATATAT 1
+chr21_31962741_31962791_ ( 14) GTTGGATAAAA 1
+//
+
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 position-specific scoring matrix
+--------------------------------------------------------------------------------
+log-odds matrix: alength= 20 w= 11 n= 1200 bayes= 5.33554 E= 2.4e-011
+ -32 -680 91 77 7 138 -20 55 64 107 11 150 142 72 87 396 -148 221 -140 -36
+ -11 -680 89 76 7 137 -21 55 63 107 10 149 141 71 87 396 -239 220 -140 -36
+ -79 41 4 21 -7 44 -62 42 -5 99 0 99 138 52 42 399 -46 223 -173 -68
+ 11 -677 48 47 -2 127 -43 46 27 101 3 124 138 60 62 397 -235 220 -160 -55
+ -596 -820 12 -21 -53 -267 -74 37 16 44 -37 98 31 9 19 319 212 127 -193 -95
+ 165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8
+ -838 -990 -89 -149 -151 -841 -161 -117 -113 -66 -209 -68 -69 -129 -91 111 221 -55 -255 -173
+ 176 -858 -79 -103 -115 -717 -148 -95 -108 -17 -162 -61 -12 -95 -69 193 -737 52 -240 -153
+ 134 -686 0 16 -12 -553 -68 44 -8 96 -9 88 124 41 36 384 11 216 -177 -71
+ 165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8
+ 147 -614 89 129 93 -121 12 160 113 217 108 144 144 111 125 447 -241 332 -81 22
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 position-specific probability matrix
+--------------------------------------------------------------------------------
+letter-probability matrix: alength= 20 w= 11 nsites= 25 E= 2.4e-011
+ 0.240000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.080000 0.000000 0.000000 0.000000
+ 0.280000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+ 0.160000 0.320000 0.000000 0.000000 0.000000 0.360000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.000000 0.000000 0.000000
+ 0.320000 0.000000 0.000000 0.000000 0.000000 0.640000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+ 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000
+ 0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+ 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000
+ 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+ 0.760000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.240000 0.000000 0.000000 0.000000
+ 0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000
+ 0.840000 0.000000 0.000000 0.000000 0.000000 0.120000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000
+--------------------------------------------------------------------------------
+
+--------------------------------------------------------------------------------
+ Motif 1 regular expression
+--------------------------------------------------------------------------------
+[GA][GA][GC][GA]TATA[AT]AA
+--------------------------------------------------------------------------------
+
+
+
+
+Time 1.56 secs.
+
+********************************************************************************
+
+
+********************************************************************************
+SUMMARY OF MOTIFS
+********************************************************************************
+
+--------------------------------------------------------------------------------
+ Combined block diagrams: non-overlapping sites with p-value < 0.0001
+--------------------------------------------------------------------------------
+SEQUENCE NAME COMBINED P-VALUE MOTIF DIAGRAM
+------------- ---------------- -------------
+chr21_19617074_19617124_ 1.22e-03 39_[1(3.06e-05)]
+chr21_26934381_26934431_ 2.21e-03 27_[1(5.52e-05)]_12
+chr21_28217753_28217803_ 7.29e-01 50
+chr21_31710037_31710087_ 2.37e-03 14_[1(5.94e-05)]_25
+chr21_31744582_31744632_ 1.22e-03 12_[1(3.06e-05)]_27
+chr21_31768316_31768366_ 1.53e-03 [1(3.82e-05)]_39
+chr21_31914206_31914256_ 6.70e-04 15_[1(1.68e-05)]_24
+chr21_31933633_31933683_ 1.81e-03 4_[1(4.54e-05)]_35
+chr21_31962741_31962791_ 1.61e-02 50
+chr21_31964683_31964733_ 1.36e-04 13_[1(3.41e-06)]_26
+chr21_31973364_31973414_ 1.99e-01 50
+chr21_31992870_31992920_ 3.47e-04 16_[1(8.67e-06)]_23
+chr21_32185595_32185645_ 3.47e-04 18_[1(8.67e-06)]_21
+chr21_32202076_32202126_ 2.01e-04 13_[1(5.01e-06)]_26
+chr21_32253899_32253949_ 8.11e-04 19_[1(2.03e-05)]_20
+chr21_32410820_32410870_ 3.47e-04 21_[1(8.67e-06)]_18
+chr21_36411748_36411798_ 2.71e-03 22_[1(6.78e-05)]_17
+chr21_37838750_37838800_ 8.23e-02 50
+chr21_45705687_45705737_ 1.53e-03 37_[1(3.82e-05)]_2
+chr21_45971413_45971463_ 1.36e-04 9_[1(3.41e-06)]_30
+chr21_45978668_45978718_ 6.37e-04 4_[1(1.59e-05)]_35
+chr21_45993530_45993580_ 1.60e-04 7_[1(4.00e-06)]_32
+chr21_46020421_46020471_ 4.83e-04 2_[1(1.21e-05)]_37
+chr21_46031920_46031970_ 2.43e-04 15_[1(6.06e-06)]_24
+chr21_46046964_46047014_ 4.26e-05 12_[1(1.06e-06)]_27
+chr21_46057197_46057247_ 1.36e-04 36_[1(3.41e-06)]_3
+chr21_46086869_46086919_ 4.30e-02 50
+chr21_46102103_46102153_ 4.30e-02 50
+chr21_47517957_47518007_ 6.37e-04 32_[1(1.59e-05)]_7
+chr21_47575506_47575556_ 1.61e-03 30_[1(4.02e-05)]_9
+--------------------------------------------------------------------------------
+
+********************************************************************************
+
+
+********************************************************************************
+Stopped because nmotifs = 1 reached.
+********************************************************************************
+
+CPU: dan
+
+********************************************************************************
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme/meme/meme_output_xml_1.xml Tue Feb 01 11:20:02 2011 -0500
@@ -0,0 +1,1284 @@
+<?xml version='1.0' encoding='UTF-8' standalone='yes'?>
+<!-- Document definition -->
+<!DOCTYPE MEME[
+<!ELEMENT MEME (
+ training_set,
+ model,
+ motifs,
+ scanned_sites_summary?
+)>
+<!ATTLIST MEME
+ version CDATA #REQUIRED
+ release CDATA #REQUIRED
+>
+<!-- Training-set elements -->
+<!ELEMENT training_set (alphabet, ambigs, sequence+, letter_frequencies)>
+<!ATTLIST training_set datafile CDATA #REQUIRED length CDATA #REQUIRED>
+<!ELEMENT alphabet (letter+)>
+<!ATTLIST alphabet id (amino-acid|nucleotide) #REQUIRED
+ length CDATA #REQUIRED>
+<!ELEMENT ambigs (letter+)>
+<!ELEMENT letter EMPTY>
+<!ATTLIST letter id ID #REQUIRED>
+<!ATTLIST letter symbol CDATA #REQUIRED>
+<!ELEMENT sequence EMPTY>
+<!ATTLIST sequence id ID #REQUIRED
+ name CDATA #REQUIRED
+ length CDATA #REQUIRED
+ weight CDATA #REQUIRED
+>
+<!ELEMENT letter_frequencies (alphabet_array)>
+
+<!-- Model elements -->
+<!ELEMENT model (
+ command_line,
+ host,
+ type,
+ nmotifs,
+ evalue_threshold,
+ object_function,
+ min_width,
+ max_width,
+ minic,
+ wg,
+ ws,
+ endgaps,
+ minsites,
+ maxsites,
+ wnsites,
+ prob,
+ spmap,
+ spfuzz,
+ prior,
+ beta,
+ maxiter,
+ distance,
+ num_sequences,
+ num_positions,
+ seed,
+ seqfrac,
+ strands,
+ priors_file,
+ reason_for_stopping,
+ background_frequencies
+)>
+<!ELEMENT command_line (#PCDATA)*>
+<!ELEMENT host (#PCDATA)*>
+<!ELEMENT type (#PCDATA)*>
+<!ELEMENT nmotifs (#PCDATA)*>
+<!ELEMENT evalue_threshold (#PCDATA)*>
+<!ELEMENT object_function (#PCDATA)*>
+<!ELEMENT min_width (#PCDATA)*>
+<!ELEMENT max_width (#PCDATA)*>
+<!ELEMENT minic (#PCDATA)*>
+<!ELEMENT wg (#PCDATA)*>
+<!ELEMENT ws (#PCDATA)*>
+<!ELEMENT endgaps (#PCDATA)*>
+<!ELEMENT minsites (#PCDATA)*>
+<!ELEMENT maxsites (#PCDATA)*>
+<!ELEMENT wnsites (#PCDATA)*>
+<!ELEMENT prob (#PCDATA)*>
+<!ELEMENT spmap (#PCDATA)*>
+<!ELEMENT spfuzz (#PCDATA)*>
+<!ELEMENT prior (#PCDATA)*>
+<!ELEMENT beta (#PCDATA)*>
+<!ELEMENT maxiter (#PCDATA)*>
+<!ELEMENT distance (#PCDATA)*>
+<!ELEMENT num_sequences (#PCDATA)*>
+<!ELEMENT num_positions (#PCDATA)*>
+<!ELEMENT seed (#PCDATA)*>
+<!ELEMENT seqfrac (#PCDATA)*>
+<!ELEMENT strands (#PCDATA)*>
+<!ELEMENT priors_file (#PCDATA)*>
+<!ELEMENT reason_for_stopping (#PCDATA)*>
+<!ELEMENT background_frequencies (alphabet_array)>
+<!ATTLIST background_frequencies source CDATA #REQUIRED>
+
+<!-- Motif elements -->
+<!ELEMENT motifs (motif+)>
+<!ELEMENT motif (scores, probabilities, regular_expression?, contributing_sites)>
+<!ATTLIST motif id ID #REQUIRED
+ name CDATA #REQUIRED
+ width CDATA #REQUIRED
+ sites CDATA #REQUIRED
+ llr CDATA #REQUIRED
+ ic CDATA #REQUIRED
+ re CDATA #REQUIRED
+ bayes_threshold CDATA #REQUIRED
+ e_value CDATA #REQUIRED
+ elapsed_time CDATA #REQUIRED
+ url CDATA ""
+>
+<!ELEMENT scores (alphabet_matrix)>
+<!ELEMENT probabilities (alphabet_matrix)>
+<!ELEMENT regular_expression (#PCDATA)*>
+
+<!-- Contributing site elements -->
+<!-- Contributing sites are motif occurences found during the motif discovery phase -->
+<!ELEMENT contributing_sites (contributing_site+)>
+<!ELEMENT contributing_site (left_flank, site, right_flank)>
+<!ATTLIST contributing_site sequence_id IDREF #REQUIRED
+ position CDATA #REQUIRED
+ strand (plus|minus|none) 'none'
+ pvalue CDATA #REQUIRED
+>
+<!-- The left_flank contains the sequence for 10 bases to the left of the motif start -->
+<!ELEMENT left_flank (#PCDATA)>
+<!-- The site contains the sequence for the motif instance -->
+<!ELEMENT site (letter_ref+)>
+<!-- The right_flank contains the sequence for 10 bases to the right of the motif end -->
+<!ELEMENT right_flank (#PCDATA)>
+
+<!-- Scanned site elements -->
+<!-- Scanned sites are motif occurences found during the sequence scan phase -->
+<!ELEMENT scanned_sites_summary (scanned_sites+)>
+<!ATTLIST scanned_sites_summary p_thresh CDATA #REQUIRED>
+<!ELEMENT scanned_sites (scanned_site*)>
+<!ATTLIST scanned_sites sequence_id IDREF #REQUIRED
+ pvalue CDATA #REQUIRED
+ num_sites CDATA #REQUIRED>
+<!ELEMENT scanned_site EMPTY>
+<!ATTLIST scanned_site motif_id IDREF #REQUIRED
+ strand (plus|minus|none) 'none'
+ position CDATA #REQUIRED
+ pvalue CDATA #REQUIRED>
+
+<!-- Utility elements -->
+<!-- A reference to a letter in the alphabet -->
+<!ELEMENT letter_ref EMPTY>
+<!ATTLIST letter_ref letter_id IDREF #REQUIRED>
+<!-- A alphabet-array contains one floating point value for each letter in an alphabet -->
+<!ELEMENT alphabet_array (value+)>
+<!ELEMENT value (#PCDATA)>
+<!ATTLIST value letter_id IDREF #REQUIRED>
+
+<!-- A alphabet_matrix contains one alphabet_array for each position in a motif -->
+<!ELEMENT alphabet_matrix (alphabet_array+)>
+
+]>
+<!-- Begin document body -->
+<MEME version="4.5.0" release="Thu Oct 14 08:44:28 EST 2010">
+<training_set datafile="/dan_110.dat" length="30">
+<alphabet id="amino-acid" length="20">
+<letter id="letter_A" symbol="A"/>
+<letter id="letter_C" symbol="C"/>
+<letter id="letter_D" symbol="D"/>
+<letter id="letter_E" symbol="E"/>
+<letter id="letter_F" symbol="F"/>
+<letter id="letter_G" symbol="G"/>
+<letter id="letter_H" symbol="H"/>
+<letter id="letter_I" symbol="I"/>
+<letter id="letter_K" symbol="K"/>
+<letter id="letter_L" symbol="L"/>
+<letter id="letter_M" symbol="M"/>
+<letter id="letter_N" symbol="N"/>
+<letter id="letter_P" symbol="P"/>
+<letter id="letter_Q" symbol="Q"/>
+<letter id="letter_R" symbol="R"/>
+<letter id="letter_S" symbol="S"/>
+<letter id="letter_T" symbol="T"/>
+<letter id="letter_V" symbol="V"/>
+<letter id="letter_W" symbol="W"/>
+<letter id="letter_Y" symbol="Y"/>
+</alphabet>
+<ambigs>
+<letter id="letter_B" symbol="B"/>
+<letter id="letter_U" symbol="U"/>
+<letter id="letter_X" symbol="X"/>
+<letter id="letter_Z" symbol="Z"/>
+<letter id="letter_star" symbol="*"/>
+<letter id="letter_-" symbol="-"/>
+</ambigs>
+<sequence id="sequence_0" name="chr21_19617074_19617124_+" length="50" weight="1.000000" />
+<sequence id="sequence_1" name="chr21_26934381_26934431_+" length="50" weight="1.000000" />
+<sequence id="sequence_2" name="chr21_28217753_28217803_-" length="50" weight="1.000000" />
+<sequence id="sequence_3" name="chr21_31710037_31710087_-" length="50" weight="1.000000" />
+<sequence id="sequence_4" name="chr21_31744582_31744632_-" length="50" weight="1.000000" />
+<sequence id="sequence_5" name="chr21_31768316_31768366_+" length="50" weight="1.000000" />
+<sequence id="sequence_6" name="chr21_31914206_31914256_-" length="50" weight="1.000000" />
+<sequence id="sequence_7" name="chr21_31933633_31933683_-" length="50" weight="1.000000" />
+<sequence id="sequence_8" name="chr21_31962741_31962791_-" length="50" weight="1.000000" />
+<sequence id="sequence_9" name="chr21_31964683_31964733_+" length="50" weight="1.000000" />
+<sequence id="sequence_10" name="chr21_31973364_31973414_+" length="50" weight="1.000000" />
+<sequence id="sequence_11" name="chr21_31992870_31992920_+" length="50" weight="1.000000" />
+<sequence id="sequence_12" name="chr21_32185595_32185645_-" length="50" weight="1.000000" />
+<sequence id="sequence_13" name="chr21_32202076_32202126_-" length="50" weight="1.000000" />
+<sequence id="sequence_14" name="chr21_32253899_32253949_-" length="50" weight="1.000000" />
+<sequence id="sequence_15" name="chr21_32410820_32410870_-" length="50" weight="1.000000" />
+<sequence id="sequence_16" name="chr21_36411748_36411798_-" length="50" weight="1.000000" />
+<sequence id="sequence_17" name="chr21_37838750_37838800_-" length="50" weight="1.000000" />
+<sequence id="sequence_18" name="chr21_45705687_45705737_+" length="50" weight="1.000000" />
+<sequence id="sequence_19" name="chr21_45971413_45971463_-" length="50" weight="1.000000" />
+<sequence id="sequence_20" name="chr21_45978668_45978718_-" length="50" weight="1.000000" />
+<sequence id="sequence_21" name="chr21_45993530_45993580_+" length="50" weight="1.000000" />
+<sequence id="sequence_22" name="chr21_46020421_46020471_+" length="50" weight="1.000000" />
+<sequence id="sequence_23" name="chr21_46031920_46031970_+" length="50" weight="1.000000" />
+<sequence id="sequence_24" name="chr21_46046964_46047014_+" length="50" weight="1.000000" />
+<sequence id="sequence_25" name="chr21_46057197_46057247_+" length="50" weight="1.000000" />
+<sequence id="sequence_26" name="chr21_46086869_46086919_-" length="50" weight="1.000000" />
+<sequence id="sequence_27" name="chr21_46102103_46102153_-" length="50" weight="1.000000" />
+<sequence id="sequence_28" name="chr21_47517957_47518007_+" length="50" weight="1.000000" />
+<sequence id="sequence_29" name="chr21_47575506_47575556_-" length="50" weight="1.000000" />
+<letter_frequencies>
+<alphabet_array>
+<value letter_id="letter_A">0.294</value>
+<value letter_id="letter_C">0.231</value>
+<value letter_id="letter_D">0.000</value>
+<value letter_id="letter_E">0.000</value>
+<value letter_id="letter_F">0.000</value>
+<value letter_id="letter_G">0.257</value>
+<value letter_id="letter_H">0.000</value>
+<value letter_id="letter_I">0.000</value>
+<value letter_id="letter_K">0.000</value>
+<value letter_id="letter_L">0.000</value>
+<value letter_id="letter_M">0.000</value>
+<value letter_id="letter_N">0.000</value>
+<value letter_id="letter_P">0.000</value>
+<value letter_id="letter_Q">0.000</value>
+<value letter_id="letter_R">0.000</value>
+<value letter_id="letter_S">0.000</value>
+<value letter_id="letter_T">0.217</value>
+<value letter_id="letter_V">0.000</value>
+<value letter_id="letter_W">0.000</value>
+<value letter_id="letter_Y">0.000</value>
+</alphabet_array>
+</letter_frequencies>
+</training_set>
+<model>
+<command_line>meme /dan.dat -o /dataset_dan_files -nostatus </command_line>
+<host>dan</host>
+<type>zoops</type>
+<nmotifs>1</nmotifs>
+<evalue_threshold>inf</evalue_threshold>
+<object_function>E-value of product of p-values</object_function>
+<min_width>8</min_width>
+<max_width>50</max_width>
+<minic> 0.00</minic>
+<wg>11</wg>
+<ws>1</ws>
+<endgaps>yes</endgaps>
+<minsites>2</minsites>
+<maxsites>30</maxsites>
+<wnsites>0.8</wnsites>
+<prob>1</prob>
+<spmap>pam</spmap>
+<spfuzz>120</spfuzz>
+<prior>megap</prior>
+<beta>7500</beta>
+<maxiter>50</maxiter>
+<distance>1e-05</distance>
+<num_sequences>30</num_sequences>
+<num_positions>1500</num_positions>
+<seed>0</seed>
+<seqfrac> 1</seqfrac>
+<strands>none</strands>
+<priors_file>prior30.plib</priors_file>
+<reason_for_stopping>Stopped because nmotifs = 1 reached.</reason_for_stopping>
+<background_frequencies source="dataset with add-one prior applied">
+<alphabet_array>
+<value letter_id="letter_A">0.291</value>
+<value letter_id="letter_C">0.229</value>
+<value letter_id="letter_D">0.001</value>
+<value letter_id="letter_E">0.001</value>
+<value letter_id="letter_F">0.001</value>
+<value letter_id="letter_G">0.255</value>
+<value letter_id="letter_H">0.001</value>
+<value letter_id="letter_I">0.001</value>
+<value letter_id="letter_K">0.001</value>
+<value letter_id="letter_L">0.001</value>
+<value letter_id="letter_M">0.001</value>
+<value letter_id="letter_N">0.001</value>
+<value letter_id="letter_P">0.001</value>
+<value letter_id="letter_Q">0.001</value>
+<value letter_id="letter_R">0.001</value>
+<value letter_id="letter_S">0.001</value>
+<value letter_id="letter_T">0.215</value>
+<value letter_id="letter_V">0.001</value>
+<value letter_id="letter_W">0.001</value>
+<value letter_id="letter_Y">0.001</value>
+</alphabet_array>
+</background_frequencies>
+</model>
+<motifs>
+<motif id="motif_1" name="1" width="11" sites="25" ic="40.0" re="13.8" llr="239" e_value="2.4e-011" bayes_threshold="5.33554" elapsed_time="1.563760">
+<scores>
+<alphabet_matrix>
+<alphabet_array>
+<value letter_id="letter_A">-32</value>
+<value letter_id="letter_C">-680</value>
+<value letter_id="letter_D">91</value>
+<value letter_id="letter_E">77</value>
+<value letter_id="letter_F">7</value>
+<value letter_id="letter_G">138</value>
+<value letter_id="letter_H">-20</value>
+<value letter_id="letter_I">55</value>
+<value letter_id="letter_K">64</value>
+<value letter_id="letter_L">107</value>
+<value letter_id="letter_M">11</value>
+<value letter_id="letter_N">150</value>
+<value letter_id="letter_P">142</value>
+<value letter_id="letter_Q">72</value>
+<value letter_id="letter_R">87</value>
+<value letter_id="letter_S">396</value>
+<value letter_id="letter_T">-148</value>
+<value letter_id="letter_V">221</value>
+<value letter_id="letter_W">-140</value>
+<value letter_id="letter_Y">-36</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">-11</value>
+<value letter_id="letter_C">-680</value>
+<value letter_id="letter_D">89</value>
+<value letter_id="letter_E">76</value>
+<value letter_id="letter_F">7</value>
+<value letter_id="letter_G">137</value>
+<value letter_id="letter_H">-21</value>
+<value letter_id="letter_I">55</value>
+<value letter_id="letter_K">63</value>
+<value letter_id="letter_L">107</value>
+<value letter_id="letter_M">10</value>
+<value letter_id="letter_N">149</value>
+<value letter_id="letter_P">141</value>
+<value letter_id="letter_Q">71</value>
+<value letter_id="letter_R">87</value>
+<value letter_id="letter_S">396</value>
+<value letter_id="letter_T">-239</value>
+<value letter_id="letter_V">220</value>
+<value letter_id="letter_W">-140</value>
+<value letter_id="letter_Y">-36</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">-79</value>
+<value letter_id="letter_C">41</value>
+<value letter_id="letter_D">4</value>
+<value letter_id="letter_E">21</value>
+<value letter_id="letter_F">-7</value>
+<value letter_id="letter_G">44</value>
+<value letter_id="letter_H">-62</value>
+<value letter_id="letter_I">42</value>
+<value letter_id="letter_K">-5</value>
+<value letter_id="letter_L">99</value>
+<value letter_id="letter_M">0</value>
+<value letter_id="letter_N">99</value>
+<value letter_id="letter_P">138</value>
+<value letter_id="letter_Q">52</value>
+<value letter_id="letter_R">42</value>
+<value letter_id="letter_S">399</value>
+<value letter_id="letter_T">-46</value>
+<value letter_id="letter_V">223</value>
+<value letter_id="letter_W">-173</value>
+<value letter_id="letter_Y">-68</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">11</value>
+<value letter_id="letter_C">-677</value>
+<value letter_id="letter_D">48</value>
+<value letter_id="letter_E">47</value>
+<value letter_id="letter_F">-2</value>
+<value letter_id="letter_G">127</value>
+<value letter_id="letter_H">-43</value>
+<value letter_id="letter_I">46</value>
+<value letter_id="letter_K">27</value>
+<value letter_id="letter_L">101</value>
+<value letter_id="letter_M">3</value>
+<value letter_id="letter_N">124</value>
+<value letter_id="letter_P">138</value>
+<value letter_id="letter_Q">60</value>
+<value letter_id="letter_R">62</value>
+<value letter_id="letter_S">397</value>
+<value letter_id="letter_T">-235</value>
+<value letter_id="letter_V">220</value>
+<value letter_id="letter_W">-160</value>
+<value letter_id="letter_Y">-55</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">-596</value>
+<value letter_id="letter_C">-820</value>
+<value letter_id="letter_D">12</value>
+<value letter_id="letter_E">-21</value>
+<value letter_id="letter_F">-53</value>
+<value letter_id="letter_G">-267</value>
+<value letter_id="letter_H">-74</value>
+<value letter_id="letter_I">37</value>
+<value letter_id="letter_K">16</value>
+<value letter_id="letter_L">44</value>
+<value letter_id="letter_M">-37</value>
+<value letter_id="letter_N">98</value>
+<value letter_id="letter_P">31</value>
+<value letter_id="letter_Q">9</value>
+<value letter_id="letter_R">19</value>
+<value letter_id="letter_S">319</value>
+<value letter_id="letter_T">212</value>
+<value letter_id="letter_V">127</value>
+<value letter_id="letter_W">-193</value>
+<value letter_id="letter_Y">-95</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">165</value>
+<value letter_id="letter_C">-261</value>
+<value letter_id="letter_D">70</value>
+<value letter_id="letter_E">110</value>
+<value letter_id="letter_F">77</value>
+<value letter_id="letter_G">-521</value>
+<value letter_id="letter_H">-4</value>
+<value letter_id="letter_I">147</value>
+<value letter_id="letter_K">95</value>
+<value letter_id="letter_L">201</value>
+<value letter_id="letter_M">90</value>
+<value letter_id="letter_N">121</value>
+<value letter_id="letter_P">124</value>
+<value letter_id="letter_Q">91</value>
+<value letter_id="letter_R">107</value>
+<value letter_id="letter_S">425</value>
+<value letter_id="letter_T">-527</value>
+<value letter_id="letter_V">314</value>
+<value letter_id="letter_W">-95</value>
+<value letter_id="letter_Y">8</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">-838</value>
+<value letter_id="letter_C">-990</value>
+<value letter_id="letter_D">-89</value>
+<value letter_id="letter_E">-149</value>
+<value letter_id="letter_F">-151</value>
+<value letter_id="letter_G">-841</value>
+<value letter_id="letter_H">-161</value>
+<value letter_id="letter_I">-117</value>
+<value letter_id="letter_K">-113</value>
+<value letter_id="letter_L">-66</value>
+<value letter_id="letter_M">-209</value>
+<value letter_id="letter_N">-68</value>
+<value letter_id="letter_P">-69</value>
+<value letter_id="letter_Q">-129</value>
+<value letter_id="letter_R">-91</value>
+<value letter_id="letter_S">111</value>
+<value letter_id="letter_T">221</value>
+<value letter_id="letter_V">-55</value>
+<value letter_id="letter_W">-255</value>
+<value letter_id="letter_Y">-173</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">176</value>
+<value letter_id="letter_C">-858</value>
+<value letter_id="letter_D">-79</value>
+<value letter_id="letter_E">-103</value>
+<value letter_id="letter_F">-115</value>
+<value letter_id="letter_G">-717</value>
+<value letter_id="letter_H">-148</value>
+<value letter_id="letter_I">-95</value>
+<value letter_id="letter_K">-108</value>
+<value letter_id="letter_L">-17</value>
+<value letter_id="letter_M">-162</value>
+<value letter_id="letter_N">-61</value>
+<value letter_id="letter_P">-12</value>
+<value letter_id="letter_Q">-95</value>
+<value letter_id="letter_R">-69</value>
+<value letter_id="letter_S">193</value>
+<value letter_id="letter_T">-737</value>
+<value letter_id="letter_V">52</value>
+<value letter_id="letter_W">-240</value>
+<value letter_id="letter_Y">-153</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">134</value>
+<value letter_id="letter_C">-686</value>
+<value letter_id="letter_D">0</value>
+<value letter_id="letter_E">16</value>
+<value letter_id="letter_F">-12</value>
+<value letter_id="letter_G">-553</value>
+<value letter_id="letter_H">-68</value>
+<value letter_id="letter_I">44</value>
+<value letter_id="letter_K">-8</value>
+<value letter_id="letter_L">96</value>
+<value letter_id="letter_M">-9</value>
+<value letter_id="letter_N">88</value>
+<value letter_id="letter_P">124</value>
+<value letter_id="letter_Q">41</value>
+<value letter_id="letter_R">36</value>
+<value letter_id="letter_S">384</value>
+<value letter_id="letter_T">11</value>
+<value letter_id="letter_V">216</value>
+<value letter_id="letter_W">-177</value>
+<value letter_id="letter_Y">-71</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">165</value>
+<value letter_id="letter_C">-261</value>
+<value letter_id="letter_D">70</value>
+<value letter_id="letter_E">110</value>
+<value letter_id="letter_F">77</value>
+<value letter_id="letter_G">-521</value>
+<value letter_id="letter_H">-4</value>
+<value letter_id="letter_I">147</value>
+<value letter_id="letter_K">95</value>
+<value letter_id="letter_L">201</value>
+<value letter_id="letter_M">90</value>
+<value letter_id="letter_N">121</value>
+<value letter_id="letter_P">124</value>
+<value letter_id="letter_Q">91</value>
+<value letter_id="letter_R">107</value>
+<value letter_id="letter_S">425</value>
+<value letter_id="letter_T">-527</value>
+<value letter_id="letter_V">314</value>
+<value letter_id="letter_W">-95</value>
+<value letter_id="letter_Y">8</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">147</value>
+<value letter_id="letter_C">-614</value>
+<value letter_id="letter_D">89</value>
+<value letter_id="letter_E">129</value>
+<value letter_id="letter_F">93</value>
+<value letter_id="letter_G">-121</value>
+<value letter_id="letter_H">12</value>
+<value letter_id="letter_I">160</value>
+<value letter_id="letter_K">113</value>
+<value letter_id="letter_L">217</value>
+<value letter_id="letter_M">108</value>
+<value letter_id="letter_N">144</value>
+<value letter_id="letter_P">144</value>
+<value letter_id="letter_Q">111</value>
+<value letter_id="letter_R">125</value>
+<value letter_id="letter_S">447</value>
+<value letter_id="letter_T">-241</value>
+<value letter_id="letter_V">332</value>
+<value letter_id="letter_W">-81</value>
+<value letter_id="letter_Y">22</value>
+</alphabet_array>
+</alphabet_matrix>
+</scores>
+<probabilities>
+<alphabet_matrix>
+<alphabet_array>
+<value letter_id="letter_A">0.240000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.680000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.080000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.280000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.680000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.040000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.160000</value>
+<value letter_id="letter_C">0.320000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.360000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.160000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.320000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.640000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.040000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.000000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.040000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.960000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.960000</value>
+<value letter_id="letter_C">0.040000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.000000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.000000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.000000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.000000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">1.000000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">1.000000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.000000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.000000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.760000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.000000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.240000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.960000</value>
+<value letter_id="letter_C">0.040000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.000000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.000000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+<alphabet_array>
+<value letter_id="letter_A">0.840000</value>
+<value letter_id="letter_C">0.000000</value>
+<value letter_id="letter_D">0.000000</value>
+<value letter_id="letter_E">0.000000</value>
+<value letter_id="letter_F">0.000000</value>
+<value letter_id="letter_G">0.120000</value>
+<value letter_id="letter_H">0.000000</value>
+<value letter_id="letter_I">0.000000</value>
+<value letter_id="letter_K">0.000000</value>
+<value letter_id="letter_L">0.000000</value>
+<value letter_id="letter_M">0.000000</value>
+<value letter_id="letter_N">0.000000</value>
+<value letter_id="letter_P">0.000000</value>
+<value letter_id="letter_Q">0.000000</value>
+<value letter_id="letter_R">0.000000</value>
+<value letter_id="letter_S">0.000000</value>
+<value letter_id="letter_T">0.040000</value>
+<value letter_id="letter_V">0.000000</value>
+<value letter_id="letter_W">0.000000</value>
+<value letter_id="letter_Y">0.000000</value>
+</alphabet_array>
+</alphabet_matrix>
+</probabilities>
+<regular_expression>
+[GA][GA][GC][GA]TATA[AT]AA
+</regular_expression>
+<contributing_sites>
+<contributing_site sequence_id="sequence_24" position="12" strand="none" pvalue="1.06e-06" >
+<left_flank>AAGGCCAGGA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCCTGAGAGC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_25" position="36" strand="none" pvalue="3.41e-06" >
+<left_flank>ACAGGCCCTG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_19" position="9" strand="none" pvalue="3.41e-06" >
+<left_flank>CAGGCCCTG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCCCCAGCAG</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_9" position="13" strand="none" pvalue="3.41e-06" >
+<left_flank>GATTCACTGA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GGCCCTCTGC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_21" position="7" strand="none" pvalue="4.00e-06" >
+<left_flank>CCAAGGA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCCCCACAAA</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_13" position="13" strand="none" pvalue="5.01e-06" >
+<left_flank>CCACCAGCTT</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>AGCCCTGTAC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_23" position="15" strand="none" pvalue="6.06e-06" >
+<left_flank>ATACCCAGGG</left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>CCTCAGCAGC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_15" position="21" strand="none" pvalue="8.67e-06" >
+<left_flank>AATCACTGAG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GTCCCAGGGA</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_12" position="18" strand="none" pvalue="8.67e-06" >
+<left_flank>CACCAGAGCT</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>AGAAGGTTCT</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_11" position="16" strand="none" pvalue="8.67e-06" >
+<left_flank>CACTATTGAA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>TTTCATTTGC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_22" position="2" strand="none" pvalue="1.21e-05" >
+<left_flank>GA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCCAACATCC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_28" position="32" strand="none" pvalue="1.59e-05" >
+<left_flank>CCGGCGGGGC</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+</site>
+<right_flank>GGGGCGG</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_20" position="4" strand="none" pvalue="1.59e-05" >
+<left_flank>CAGA</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+</site>
+<right_flank>GTTCCGACCA</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_6" position="15" strand="none" pvalue="1.68e-05" >
+<left_flank>CCCACTACTT</left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>TCATTCTGAG</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_14" position="19" strand="none" pvalue="2.03e-05" >
+<left_flank>CACCAGCAAG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GCTCAGGAGT</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_4" position="12" strand="none" pvalue="3.06e-05" >
+<left_flank>CAGGTCTAAG</left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>CTTGGAGTCC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_0" position="39" strand="none" pvalue="3.06e-05" >
+<left_flank>CCTCGGGACG</left_flank>
+<site>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank></right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_18" position="37" strand="none" pvalue="3.82e-05" >
+<left_flank>CGTGGTCGCG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_5" position="0" strand="none" pvalue="3.82e-05" >
+<left_flank></left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>ATGGTCCTGT</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_29" position="30" strand="none" pvalue="4.02e-05" >
+<left_flank>GCTGCCGGTG</left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+</site>
+<right_flank>GCCCTGGCG</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_1" position="27" strand="none" pvalue="5.52e-05" >
+<left_flank>AGTCACAAGT</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>GGGTCGCACG</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_3" position="14" strand="none" pvalue="5.94e-05" >
+<left_flank>CCCAGGTTTC</left_flank>
+<site>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>TCGCCGCACC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_16" position="22" strand="none" pvalue="6.78e-05" >
+<left_flank>AGTTTCAGTT</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_C"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>ATTATATAAC</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_7" position="2" strand="none" pvalue="2.08e-04" >
+<left_flank>TC</left_flank>
+<site>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+</site>
+<right_flank>AAATGTTCCT</right_flank>
+</contributing_site>
+<contributing_site sequence_id="sequence_8" position="13" strand="none" pvalue="4.05e-04" >
+<left_flank>TATAACTCAG</left_flank>
+<site>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_G"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_T"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+<letter_ref letter_id="letter_A"/>
+</site>
+<right_flank>TAATTTGTAC</right_flank>
+</contributing_site>
+</contributing_sites>
+</motif>
+</motifs>
+<scanned_sites_summary p_thresh="0.0001">
+<scanned_sites sequence_id="sequence_0" pvalue="1.22e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="39" pvalue="3.06e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_1" pvalue="2.21e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="27" pvalue="5.52e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_2" pvalue="7.29e-01" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_3" pvalue="2.37e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="14" pvalue="5.94e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_4" pvalue="1.22e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="12" pvalue="3.06e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_5" pvalue="1.53e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="0" pvalue="3.82e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_6" pvalue="6.70e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="15" pvalue="1.68e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_7" pvalue="1.81e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="4" pvalue="4.54e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_8" pvalue="1.61e-02" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_9" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="13" pvalue="3.41e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_10" pvalue="1.99e-01" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_11" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="16" pvalue="8.67e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_12" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="18" pvalue="8.67e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_13" pvalue="2.01e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="13" pvalue="5.01e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_14" pvalue="8.11e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="19" pvalue="2.03e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_15" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="21" pvalue="8.67e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_16" pvalue="2.71e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="22" pvalue="6.78e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_17" pvalue="8.23e-02" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_18" pvalue="1.53e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="37" pvalue="3.82e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_19" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="9" pvalue="3.41e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_20" pvalue="6.37e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="4" pvalue="1.59e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_21" pvalue="1.60e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="7" pvalue="4.00e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_22" pvalue="4.83e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="2" pvalue="1.21e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_23" pvalue="2.43e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="15" pvalue="6.06e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_24" pvalue="4.26e-05" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="12" pvalue="1.06e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_25" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="36" pvalue="3.41e-06"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_26" pvalue="4.30e-02" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_27" pvalue="4.30e-02" num_sites="0"></scanned_sites>
+<scanned_sites sequence_id="sequence_28" pvalue="6.37e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="32" pvalue="1.59e-05"/>
+</scanned_sites>
+<scanned_sites sequence_id="sequence_29" pvalue="1.61e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="30" pvalue="4.02e-05"/>
+</scanned_sites>
+</scanned_sites_summary>
+</MEME>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme_input_1.fasta Tue Feb 01 11:20:02 2011 -0500
@@ -0,0 +1,66 @@
+>chr21_19617074_19617124_+
+AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
+>chr21_26934381_26934431_+
+GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
+>chr21_28217753_28217803_-
+CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
+>chr21_31710037_31710087_-
+AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
+>chr21_31744582_31744632_-
+CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
+>chr21_31768316_31768366_+
+AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
+>chr21_31914206_31914256_-
+TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
+>chr21_31933633_31933683_-
+TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
+>chr21_31962741_31962791_-
+ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
+>chr21_31964683_31964733_+
+TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
+>chr21_31973364_31973414_+
+aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
+>chr21_31992870_31992920_+
+CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
+>chr21_32185595_32185645_-
+TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
+>chr21_32202076_32202126_-
+TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
+>chr21_32253899_32253949_-
+AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
+>chr21_32410820_32410870_-
+TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
+>chr21_36411748_36411798_-
+ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
+>chr21_37838750_37838800_-
+gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
+>chr21_45705687_45705737_+
+CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
+>chr21_45971413_45971463_-
+CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
+>chr21_45978668_45978718_-
+CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
+>chr21_45993530_45993580_+
+CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
+>chr21_46020421_46020471_+
+GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
+>chr21_46031920_46031970_+
+GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
+>chr21_46046964_46047014_+
+ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
+>chr21_46057197_46057247_+
+ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
+>chr21_46086869_46086919_-
+GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
+>chr21_46102103_46102153_-
+AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47575506_47575556_-
+TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
+>chr21_47575506_47575556_-
+TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
--- a/tool_conf.xml.sample Tue Feb 01 11:19:40 2011 -0500
+++ b/tool_conf.xml.sample Tue Feb 01 11:20:02 2011 -0500
@@ -197,6 +197,9 @@
<tool file="evolution/codingSnps.xml" /><tool file="evolution/add_scores.xml" /></section>
+ <section name="Motif Tools" id="motifs">
+ <tool file="meme/meme.xml"/>
+ </section><section name="Metagenomic analyses" id="tax_manipulation"><tool file="taxonomy/gi2taxonomy.xml" /><tool file="taxonomy/t2t_report.xml" />
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/meme/meme.xml Tue Feb 01 11:20:02 2011 -0500
@@ -0,0 +1,347 @@
+<tool id="meme_meme" name="MEME" version="1.0.0">
+ <requirements><requirement type='package'>meme</requirement></requirements>
+ <description>- Multiple Em for Motif Elicitation</description>
+ <command>meme "$input1" -o "${html_outfile.files_path}"
+ -nostatus
+
+ ##-p 8 ##number of processors
+
+ #if str( $options_type.options_type_selector ) == 'advanced':
+ -sf "${ str( $options_type.sf ).replace( ' ', '_' ) }"
+ -${options_type.alphabet_type.alphabet_type_selector}
+ -mod "${options_type.mod_type.mod_type_selector}"
+ -nmotifs "${options_type.nmotifs}"
+ -wnsites "${options_type.wnsites}"
+
+ #if $options_type.evt < float('inf'):
+ -evt "${options_type.evt}"
+ #end if
+
+ #if str( $options_type.mod_type.mod_type_selector ) != 'oops':
+ #if str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'nsites':
+ -nsites "${options_type.mod_type.motif_occurrence_type.nsites}"
+ #elif str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'min_max_sites':
+ -minsites "${options_type.mod_type.motif_occurrence_type.minsites}" -maxsites "${options_type.mod_type.motif_occurrence_type.maxsites}"
+ #end if
+ #end if
+
+ #if str( $options_type.motif_width_type.motif_width_type_selector ) == 'exact':
+ -w "${options_type.motif_width_type.width}"
+ #else
+ -minw "${options_type.motif_width_type.minw}" -maxw "${options_type.motif_width_type.maxw}"
+ #end if
+
+ #if str( $options_type.motif_trim_type.motif_trim_type_selector ) == 'nomatrim':
+ -nomatrim
+ #else
+ -wg "${options_type.motif_trim_type.wg}" -ws "${options_type.motif_trim_type.ws}" ${options_type.motif_trim_type.noendgaps}
+ #end if
+
+ #if str( $options_type.bfile ) != 'None':
+ -bfile "${options_type.bfile}"
+ #end if
+
+ #if str( $options_type.pspfile ) != 'None':
+ -psp "${options_type.pspfile}"
+ #end if
+
+ #if str( $options_type.alphabet_type.alphabet_type_selector ) == "dna":
+ ${options_type.alphabet_type.revcomp} ${options_type.alphabet_type.pal}
+ #end if
+
+ -maxiter "${options_type.maxiter}" -distance "${options_type.distance}"
+
+ -prior "${options_type.alphabet_type.prior_type.prior_type_selector}"
+ #if str( $options_type.alphabet_type.prior_type.prior_type_selector ) != 'addone':
+ -b "${options_type.alphabet_type.prior_type.prior_b}"
+ #if str( $options_type.alphabet_type.prior_type.plib ) != 'None':
+ -plib "${options_type.alphabet_type.prior_type.plib}"
+ #end if
+ #end if
+
+ #if str( $options_type.alphabet_type.spmap_type.spmap_type_selector ) == 'cons':
+ -cons "${options_type.alphabet_type.spmap_type.cons}"
+ #else
+ -spmap "${options_type.alphabet_type.spmap_type.spmap_type_selector}"
+ -spfuzz "${options_type.alphabet_type.spmap_type.spfuzz}"
+ #end if
+
+ #if str( $options_type.branching_type.branching_type_selector ) == 'x_branch':
+ -x_branch -bfactor "${options_type.branching_type.bfactor}" -heapsize "${options_type.branching_type.heapsize}"
+ #end if
+
+ ##-maxsize "1000000" ##remove hardcoded maxsize? should increase number of processors instead
+
+ #end if
+
+ 2>&1 || echo "Error running MEME."
+
+
+ && mv ${html_outfile.files_path}/meme.html ${html_outfile}
+
+ && mv ${html_outfile.files_path}/meme.txt ${txt_outfile}
+
+ && mv ${html_outfile.files_path}/meme.xml ${xml_outfile}
+
+ </command>
+ <inputs>
+ <param format="fasta" name="input1" type="data" label="Sequences"/>
+
+ <conditional name="options_type">
+ <param name="options_type_selector" type="select" label="Options Configuration">
+ <option value="basic" selected="true">Basic</option>
+ <option value="advanced">Advanced</option>
+ </param>
+ <when value="basic">
+ <!-- do nothing here -->
+ </when>
+ <when value="advanced">
+
+ <param name="sf" type="text" value="Galaxy FASTA Input" label="Name of sequence set" />
+
+ <conditional name="alphabet_type">
+ <param name="alphabet_type_selector" type="select" label="Sequence Alphabet">
+ <option value="protein">Protein</option>
+ <option value="dna" selected="true">DNA</option>
+ </param>
+ <when value="protein">
+ <conditional name="prior_type">
+ <param name="prior_type_selector" type="select" label="Choice of prior">
+ <option value="dirichlet">simple Dirichlet prior</option>
+ <option value="dmix" selected="true">mixture of Dirichlets prior</option>
+ <option value="mega">extremely low variance dmix</option>
+ <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option>
+ <option value="addone">add +1 to each observed count</option>
+ </param>
+ <when value="dirichlet">
+ <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="dmix">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="mega">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="megap">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="addone">
+ <!-- no values here? -->
+ </when>
+ </conditional>
+ <conditional name="spmap_type">
+ <param name="spmap_type_selector" type="select" label="EM starting points">
+ <option value="uni">uni</option>
+ <option value="pam" selected="true">pam</option>
+ <option value="cons">Use starting point from string</option>
+ </param>
+ <when value="uni">
+ <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" />
+ </when>
+ <when value="pam">
+ <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" />
+ </when>
+ <when value="cons">
+ <param name="cons" type="text" value="" label="Starting point from string" />
+ </when>
+ </conditional>
+ </when>
+ <when value="dna">
+ <param name="revcomp" label="Check reverse complement" type="boolean" truevalue="-revcomp" falsevalue="" checked="False"/>
+ <param name="pal" label="Check for palindromes" type="boolean" truevalue="-pal" falsevalue="" checked="False"/>
+ <conditional name="prior_type">
+ <param name="prior_type_selector" type="select" label="Sequence Alphabet">
+ <option value="dirichlet" selected="true">simple Dirichlet prior</option>
+ <option value="dmix">mixture of Dirichlets prior</option>
+ <option value="mega">extremely low variance dmix</option>
+ <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option>
+ <option value="addone">add +1 to each observed count</option>
+ </param>
+ <when value="dirichlet">
+ <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="dmix">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="mega">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="megap">
+ <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" />
+ <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" />
+ </when>
+ <when value="addone">
+ <!-- no values here? -->
+ </when>
+ </conditional>
+ <conditional name="spmap_type">
+ <param name="spmap_type_selector" type="select" label="EM starting points">
+ <option value="uni" selected="true">uni</option>
+ <option value="pam">pam</option>
+ <option value="cons">Use starting point from string</option>
+ </param>
+ <when value="uni">
+ <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" />
+ </when>
+ <when value="pam">
+ <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" />
+ </when>
+ <when value="cons">
+ <param name="cons" type="text" value="" label="Starting point from string" />
+ </when>
+ </conditional>
+ </when>
+ </conditional>
+
+ <param name="nmotifs" type="integer" value="1" label="Number of different motifs to search" />
+ <param name="evt" type="float" value="inf" label="E-value to stop looking for motifs" />
+ <conditional name="mod_type">
+ <param name="mod_type_selector" type="select" label="Expected motif distribution">
+ <option value="oops">One Occurrence Per Sequence</option>
+ <option value="zoops" selected="true">Zero or One Occurrence Per Sequence</option>
+ <option value="anr">Any Number of Repetitions</option>
+ </param>
+ <when value="oops">
+ <!-- no values here -->
+ </when>
+ <when value="zoops">
+ <conditional name="motif_occurrence_type">
+ <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences">
+ <option value="default" selected="true">Use defaults</option>
+ <option value="nsites">nsites</option>
+ <option value="min_max_sites">min and max sites</option>
+ </param>
+ <when value="default">
+ <!-- no values here -->
+ </when>
+ <when value="nsites">
+ <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" />
+ </when>
+ <when value="min_max_sites">
+ <param name="minsites" type="integer" value="1" label="minsites" />
+ <param name="maxsites" type="integer" value="50" label="maxsites" />
+ </when>
+ </conditional>
+ </when>
+ <when value="anr">
+ <conditional name="motif_occurrence_type">
+ <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences">
+ <option value="default" selected="true">Use defaults</option>
+ <option value="nsites">nsites</option>
+ <option value="min_max_sites">min and max sites</option>
+ </param>
+ <when value="default">
+ <!-- no values here -->
+ </when>
+ <when value="nsites">
+ <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" />
+ </when>
+ <when value="min_max_sites">
+ <param name="minsites" type="integer" value="1" label="minsites" />
+ <param name="maxsites" type="integer" value="50" label="maxsites" />
+ </when>
+ </conditional>
+ </when>
+ </conditional>
+ <param name="wnsites" type="float" value="0.8" label="Weight on the prior on nsites" />
+
+ <conditional name="motif_width_type">
+ <param name="motif_width_type_selector" type="select" label="Motif width type">
+ <option value="exact">Exact width</option>
+ <option value="range" selected="true">Specify a range</option>
+ </param>
+ <when value="exact">
+ <param name="width" type="integer" value="10" label="Width of motif to search" />
+ </when>
+ <when value="range">
+ <param name="minw" type="integer" value="8" label="Min width of motif to search" />
+ <param name="maxw" type="integer" value="50" label="Max width of motif to search" />
+ </when>
+ </conditional>
+
+ <conditional name="motif_trim_type">
+ <param name="motif_trim_type_selector" type="select" label="Motif trim type">
+ <option value="nomatrim">No motif trim</option>
+ <option value="trim" selected="true">Trim motif</option>
+ </param>
+ <when value="nomatrim">
+ <!-- no values here -->
+ </when>
+ <when value="trim">
+ <param name="wg" type="integer" value="11" label="Gap cost" />
+ <param name="ws" type="integer" value="1" label="Space cost" />
+ <param name="noendgaps" label="Do not penalize endgaps" type="boolean" truevalue="-noendgaps" falsevalue="" checked="False"/>
+ </when>
+ </conditional>
+
+ <param name="bfile" type="data" format="txt" optional="True" label="Background Model" />
+ <param name="pspfile" type="data" format="txt" optional="True" label="Position-Specific Prior" />
+
+ <param name="maxiter" type="integer" value="50" label="Number of iterations of EM to run" />
+ <param name="distance" type="float" value="0.001" label="Convergence criterion" />
+
+ <conditional name="branching_type">
+ <param name="branching_type_selector" type="select" label="x-branching type">
+ <option value="x_branch">Perform x-branching</option>
+ <option value="no_x_branch" selected="true">No x-branching</option>
+ </param>
+ <when value="no_x_branch">
+ <!-- no values here -->
+ </when>
+ <when value="x_branch">
+ <param name="bfactor" type="integer" value="3" label="Number of iterations of branching" />
+ <param name="heapsize" type="integer" value="64" label="Maximum number of heaps to use" />
+ </when>
+ </conditional>
+
+ </when>
+ </conditional>
+
+ <param name="non_commercial_use" label="I certify that I am not using this tool for commercial purposes." type="boolean" truevalue="NON_COMMERCIAL_USE" falsevalue="COMMERCIAL_USE" checked="False">
+ <validator type="expression" message="This tool is only available for non-commercial use.">value == True</validator>
+ </param>
+
+ </inputs>
+ <outputs>
+ <data format="html" name="html_outfile" label="${tool.name} on ${on_string} (html)"/>
+ <data format="txt" name="txt_outfile" label="${tool.name} on ${on_string} (text)"/>
+ <data format="memexml" name="xml_outfile" label="${tool.name} on ${on_string} (xml)"/>
+ </outputs>
+ <tests>
+ <test>
+ <param name="input1" value="meme_input_1.fasta" ftype="fasta" dbkey="hg19"/>
+ <param name="options_type_selector" value="basic"/>
+ <param name="non_commercial_use" value="True"/>
+ <output name="html_outfile" file="meme/meme/meme_output_html_1.html" lines_diff="14"/>
+ <output name="txt_outfile" file="meme/meme/meme_output_txt_1.txt" lines_diff="12"/>
+ <output name="xml_outfile" file="meme/meme/meme_output_xml_1.xml" lines_diff="8"/>
+ </test>
+ </tests>
+ <help>
+
+.. class:: warningmark
+
+**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted. Before using, be sure to review, agree, and comply with the license.**
+
+If you want to specify sequence weights, you must include them at the top of your input FASTA file.
+
+.. class:: infomark
+
+**To cite MEME:**
+Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.
+
+
+For detailed information on MEME, click here_. To view the license_.
+
+.. _here: http://meme.nbcr.net/meme/meme-intro.html
+.. _license: http://meme.nbcr.net/meme/COPYRIGHT.html
+
+ </help>
+</tool>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1
0
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/8c81782aa093/
changeset: r4966:8c81782aa093
user: dan
date: 2011-02-01 17:17:44
summary: Add MEME tool configuration file.
affected #: 8 files (722 bytes)
Diff too large to display.
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1
0
commit/galaxy-central: jgoecks: Add GTF sniffer to datatypes config sample file.
by Bitbucket 31 Jan '11
by Bitbucket 31 Jan '11
31 Jan '11
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/bf060b28bb8b/
changeset: r4965:bf060b28bb8b
user: jgoecks
date: 2011-02-01 00:25:33
summary: Add GTF sniffer to datatypes config sample file.
affected #: 1 file (56 bytes)
--- a/datatypes_conf.xml.sample Mon Jan 31 16:41:03 2011 -0500
+++ b/datatypes_conf.xml.sample Mon Jan 31 18:25:33 2011 -0500
@@ -289,6 +289,7 @@
<sniffer type="galaxy.datatypes.sequence:Axt"/><sniffer type="galaxy.datatypes.interval:Bed"/><sniffer type="galaxy.datatypes.interval:CustomTrack"/>
+ <sniffer type="galaxy.datatypes.interval:Gtf"/><sniffer type="galaxy.datatypes.interval:Gff"/><sniffer type="galaxy.datatypes.interval:Gff3"/><sniffer type="galaxy.datatypes.tabular:Pileup"/>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1
0
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/82107691d26e/
changeset: r4964:82107691d26e
user: greg
date: 2011-01-31 22:41:03
summary: Several data library improvements:
1. Enhance importing library dataset into the current history by now allowing the user to select from a list of existing histories or create a new named history ( similar to copying datasets ).  This feature is available for a specific library dataset, a folder ( or root folder ), when selecting multiple datasets from in a library,  and on the results page for searched library datasets.
2. Add Brad Chapman's latest patch for fixing the lucene search implementation
3. Eliminate searches on dataset state for both whoosh and lucene searches
4. Clarify the objects being searched in the regular search and advanced search boxes in the data libraries grids.
5. Add the ability to perform certain actions on 1 or more selected library datasets on the results page for searched library datasets.
6. Add a "select all" checkbox to the browse_library.mako template.
7. Fixed library functional tests accordingly.
affected #: 14 files (14.7 KB)
--- a/lib/galaxy/web/controllers/library.py Mon Jan 31 12:57:42 2011 -0500
+++ b/lib/galaxy/web/controllers/library.py Mon Jan 31 16:41:03 2011 -0500
@@ -6,7 +6,7 @@
from galaxy.datatypes import sniff
from galaxy import model, util
from galaxy.util.odict import odict
-from library_common import lucene_search, whoosh_search
+from library_common import get_comptypes, lucene_search, whoosh_search
log = logging.getLogger( __name__ )
@@ -25,17 +25,17 @@
template='/library/grid.mako'
default_sort_key = "name"
columns = [
- NameColumn( "Name",
+ NameColumn( "Data library name",
key="name",
link=( lambda library: dict( operation="browse", id=library.id ) ),
attach_popup=False,
filterable="advanced" ),
- DescriptionColumn( "Description",
+ DescriptionColumn( "Data library description",
key="description",
attach_popup=False,
filterable="advanced" ),
]
- columns.append( grids.MulticolFilterColumn( "Search",
+ columns.append( grids.MulticolFilterColumn( "search library dataset name, info, message, dbkey",
cols_to_filter=[ columns[0], columns[1] ],
key="free-text-search",
visible=False,
@@ -74,8 +74,9 @@
params = util.Params( kwd )
message = util.restore_text( params.get( 'message', '' ) )
status = params.get( 'status', 'done' )
+ default_action = params.get( 'default_action', None )
return trans.fill_template( "/library/index.mako",
- default_action=params.get( 'default_action', None ),
+ default_action=default_action,
message=message,
status=status )
@web.expose
@@ -91,8 +92,9 @@
search_term = kwd[ "f-free-text-search" ]
if trans.app.config.enable_lucene_library_search:
indexed_search_enabled = True
- search_url = trans.app.config.config_dict.get( "fulltext_find_url", "" )
+ search_url = trans.app.config.config_dict.get( "fulltext_url", "" )
if search_url:
+ indexed_search_enabled = True
status, message, lddas = lucene_search( trans, 'library', search_term, search_url, **kwd )
elif trans.app.config.enable_whoosh_library_search:
indexed_search_enabled = True
@@ -100,11 +102,15 @@
else:
indexed_search_enabled = False
if indexed_search_enabled:
+ comptypes = get_comptypes( trans )
+ show_deleted = util.string_as_bool( kwd.get( 'show_deleted', False ) )
use_panels = util.string_as_bool( kwd.get( 'use_panels', False ) )
return trans.fill_template( '/library/common/library_dataset_search_results.mako',
cntrller='library',
search_term=search_term,
+ comptypes=comptypes,
lddas=lddas,
+ show_deleted=show_deleted,
use_panels=use_panels,
message=message,
status=status )
--- a/lib/galaxy/web/controllers/library_admin.py Mon Jan 31 12:57:42 2011 -0500
+++ b/lib/galaxy/web/controllers/library_admin.py Mon Jan 31 16:41:03 2011 -0500
@@ -3,7 +3,7 @@
from galaxy.web.base.controller import *
from galaxy.web.framework.helpers import time_ago, iff, grids
from galaxy.model.orm import *
-from library_common import lucene_search, whoosh_search
+from library_common import get_comptypes, lucene_search, whoosh_search
# Older py compatibility
try:
set()
@@ -35,12 +35,12 @@
template='/admin/library/grid.mako'
default_sort_key = "name"
columns = [
- NameColumn( "Name",
+ NameColumn( "Data library name",
key="name",
link=( lambda library: dict( operation="browse", id=library.id ) ),
attach_popup=False,
filterable="advanced" ),
- DescriptionColumn( "Description",
+ DescriptionColumn( "Data library description",
key="description",
attach_popup=False,
filterable="advanced" ),
@@ -50,7 +50,7 @@
# Columns that are valid for filtering but are not visible.
grids.DeletedColumn( "Deleted", key="deleted", visible=False, filterable="advanced" )
]
- columns.append( grids.MulticolFilterColumn( "Search",
+ columns.append( grids.MulticolFilterColumn( "search library dataset name, info, message, dbkey",
cols_to_filter=[ columns[0], columns[1] ],
key="free-text-search",
visible=False,
@@ -133,11 +133,15 @@
else:
indexed_search_enabled = False
if indexed_search_enabled:
+ comptypes = get_comptypes( trans )
+ show_deleted = util.string_as_bool( kwd.get( 'show_deleted', False ) )
use_panels = util.string_as_bool( kwd.get( 'use_panels', False ) )
return trans.fill_template( '/library/common/library_dataset_search_results.mako',
cntrller='library_admin',
search_term=search_term,
+ comptypes=comptypes,
lddas=lddas,
+ show_deleted=show_deleted,
use_panels=use_panels,
message=message,
status=status )
--- a/lib/galaxy/web/controllers/library_common.py Mon Jan 31 12:57:42 2011 -0500
+++ b/lib/galaxy/web/controllers/library_common.py Mon Jan 31 16:41:03 2011 -0500
@@ -1,4 +1,4 @@
-import os, os.path, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile, copy, glob, string
+import os, os.path, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile, copy, glob, string, urllib2
from galaxy.web.base.controller import *
from galaxy import util, jobs
from galaxy.datatypes import sniff
@@ -7,6 +7,7 @@
from galaxy.tools.actions import upload_common
from galaxy.model.orm import *
from galaxy.util.streamball import StreamBall
+from galaxy.util import inflector
from galaxy.web.form_builder import AddressField, CheckboxField, SelectField, TextArea, TextField, WorkflowField, WorkflowMappingField, HistoryField
import logging, tempfile, zipfile, tarfile, os, sys, operator
from galaxy.eggs import require
@@ -20,7 +21,7 @@
whoosh_search_enabled = True
# The following must be defined exactly like the
# schema in ~/scripts/data_libraries/build_whoosh_index.py
- schema = Schema( id=STORED, name=TEXT, info=TEXT, dbkey=TEXT, message=TEXT, state=TEXT )
+ schema = Schema( id=STORED, name=TEXT, info=TEXT, dbkey=TEXT, message=TEXT )
except ImportError, e:
whoosh_search_enabled = False
schema = None
@@ -125,16 +126,7 @@
message += "Don't navigate away from Galaxy or use the browser's \"stop\" or \"reload\" buttons (on this tab) until the "
message += "message \"This job is running\" is cleared from the \"Information\" column below for each selected dataset."
status = "info"
- comptypes_t = comptypes
- if trans.app.config.nginx_x_archive_files_base:
- comptypes_t = ['ngxzip']
- for comptype in trans.app.config.disable_library_comptypes:
- # TODO: do this once, not every time (we're gonna raise an
- # exception every time after the first time)
- try:
- comptypes_t.remove( comptype )
- except:
- pass
+ comptypes = get_comptypes( trans )
try:
return trans.fill_template( '/library/common/browse_library.mako',
cntrller=cntrller,
@@ -143,17 +135,18 @@
created_ldda_ids=created_ldda_ids,
hidden_folder_ids=hidden_folder_ids,
show_deleted=show_deleted,
- comptypes=comptypes_t,
+ comptypes=comptypes,
current_user_roles=current_user_roles,
message=message,
status=status )
except Exception, e:
message = 'Error attempting to display contents of library (%s): %s.' % ( str( library.name ), str( e ) )
status = 'error'
+ default_action = params.get( 'default_action', None )
return trans.response.send_redirect( web.url_for( use_panels=use_panels,
controller=cntrller,
action='browse_libraries',
- default_action=params.get( 'default_action', None ),
+ default_action=default_action,
message=util.sanitize_text( message ),
status=status ) )
@web.expose
@@ -871,7 +864,7 @@
message += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
default_action = 'manage_permissions'
else:
- default_action = 'add'
+ default_action = 'import_to_histories'
trans.response.send_redirect( web.url_for( controller='library_common',
action='browse_library',
cntrller=cntrller,
@@ -1247,7 +1240,7 @@
message += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
default_action = 'manage_permissions'
else:
- default_action = 'add'
+ default_action = 'import_to_histories'
return trans.response.send_redirect( web.url_for( controller='library_common',
action='browse_library',
cntrller=cntrller,
@@ -1512,7 +1505,12 @@
message=util.sanitize_text( message ),
status=status ) )
@web.expose
- def act_on_multiple_datasets( self, trans, cntrller, library_id, ldda_ids='', **kwd ):
+ def act_on_multiple_datasets( self, trans, cntrller, library_id=None, ldda_ids='', **kwd ):
+ # This method is called from 1 of 3 places:
+ # - this controller's download_dataset_from_folder() method
+ # - he browse_library.mako template
+ # - the library_dataset_search_results.mako template
+ # In the last case above, we will not have a library_id
class NgxZip( object ):
def __init__( self, url_base ):
self.files = {}
@@ -1534,6 +1532,16 @@
show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
use_panels = util.string_as_bool( params.get( 'use_panels', False ) )
action = params.get( 'do_action', None )
+ if action == 'import_to_histories':
+ return trans.response.send_redirect( web.url_for( controller='library_common',
+ action='import_datasets_to_histories',
+ cntrller=cntrller,
+ library_id=library_id,
+ ldda_ids=ldda_ids,
+ use_panels=use_panels,
+ show_deleted=show_deleted,
+ message=message,
+ status=status ) )
lddas = []
error = False
is_admin = trans.user_is_admin() and cntrller == 'library_admin'
@@ -1557,27 +1565,177 @@
message = "Invalid library dataset id ( %s ) specified." % str( ldda_id )
break
lddas.append( ldda )
- if action == 'import_to_history' or action == 'add':
- if trans.get_history() is None:
- # Must be a bot sending a request without having a history.
- error = True
- message = "You do not have a current history"
- elif action == 'manage_permissions':
- if not is_admin:
+ if not is_admin:
+ if action == 'manage_permissions':
for ldda in lddas:
if not ( trans.app.security_agent.can_manage_library_item( current_user_roles, ldda ) and \
trans.app.security_agent.can_manage_dataset( current_user_roles, ldda.dataset ) ):
error = True
message = "You are not authorized to manage permissions on library dataset '%s'." % ldda.name
break
- elif action == 'delete':
- if not is_admin:
+ elif action == 'delete':
for ldda in lddas:
if not trans.app.security_agent.can_modify_library_item( current_user_roles, ldda ):
error = True
message = "You are not authorized to modify library dataset '%s'." % ldda.name
break
- if error:
+ if not error:
+ if action == 'manage_permissions':
+ trans.response.send_redirect( web.url_for( controller='library_common',
+ action='ldda_permissions',
+ cntrller=cntrller,
+ use_panels=use_panels,
+ library_id=library_id,
+ folder_id=trans.security.encode_id( lddas[0].library_dataset.folder.id ),
+ id=",".join( ldda_ids ),
+ show_deleted=show_deleted,
+ message=util.sanitize_text( message ),
+ status=status ) )
+ elif action == 'delete':
+ for ldda in lddas:
+ # Do not delete the association, just delete the library_dataset. The
+ # cleanup_datasets.py script handles everything else.
+ ld = ldda.library_dataset
+ ld.deleted = True
+ trans.sa_session.add( ld )
+ trans.sa_session.flush()
+ message = "The selected datasets have been deleted."
+ elif action in ['zip','tgz','tbz','ngxzip']:
+ error = False
+ killme = string.punctuation + string.whitespace
+ trantab = string.maketrans(killme,'_'*len(killme))
+ try:
+ outext = 'zip'
+ if action == 'zip':
+ # Can't use mkstemp - the file must not exist first
+ tmpd = tempfile.mkdtemp()
+ tmpf = os.path.join( tmpd, 'library_download.' + action )
+ if ziptype == '64' and trans.app.config.upstream_gzip:
+ archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_STORED, True )
+ elif ziptype == '64':
+ archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_DEFLATED, True )
+ elif trans.app.config.upstream_gzip:
+ archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_STORED )
+ else:
+ archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_DEFLATED )
+ archive.add = lambda x, y: archive.write( x, y.encode('CP437') )
+ elif action == 'tgz':
+ if trans.app.config.upstream_gzip:
+ archive = util.streamball.StreamBall( 'w|' )
+ outext = 'tar'
+ else:
+ archive = util.streamball.StreamBall( 'w|gz' )
+ outext = 'tgz'
+ elif action == 'tbz':
+ archive = util.streamball.StreamBall( 'w|bz2' )
+ outext = 'tbz2'
+ elif action == 'ngxzip':
+ archive = NgxZip( trans.app.config.nginx_x_archive_files_base )
+ except ( OSError, zipfile.BadZipfile ):
+ error = True
+ log.exception( "Unable to create archive for download" )
+ message = "Unable to create archive for download, please report this error"
+ status = 'error'
+ except:
+ error = True
+ log.exception( "Unexpected error %s in create archive for download" % sys.exc_info()[0] )
+ message = "Unable to create archive for download, please report - %s" % sys.exc_info()[0]
+ status = 'error'
+ if not error:
+ composite_extensions = trans.app.datatypes_registry.get_composite_extensions()
+ seen = []
+ for ldda in lddas:
+ if ldda.dataset.state in [ 'new', 'upload', 'queued', 'running', 'empty', 'discarded' ]:
+ continue
+ ext = ldda.extension
+ is_composite = ext in composite_extensions
+ path = ""
+ parent_folder = ldda.library_dataset.folder
+ while parent_folder is not None:
+ # Exclude the now-hidden "root folder"
+ if parent_folder.parent is None:
+ path = os.path.join( parent_folder.library_root[0].name, path )
+ break
+ path = os.path.join( parent_folder.name, path )
+ parent_folder = parent_folder.parent
+ path += ldda.name
+ while path in seen:
+ path += '_'
+ seen.append( path )
+ zpath = os.path.split(path)[-1] # comes as base_name/fname
+ outfname,zpathext = os.path.splitext(zpath)
+ if is_composite:
+ # need to add all the components from the extra_files_path to the zip
+ if zpathext == '':
+ zpath = '%s.html' % zpath # fake the real nature of the html file
+ try:
+ archive.add(ldda.dataset.file_name,zpath) # add the primary of a composite set
+ except IOError:
+ error = True
+ log.exception( "Unable to add composite parent %s to temporary library download archive" % ldda.dataset.file_name)
+ message = "Unable to create archive for download, please report this error"
+ status = 'error'
+ continue
+ flist = glob.glob(os.path.join(ldda.dataset.extra_files_path,'*.*')) # glob returns full paths
+ for fpath in flist:
+ efp,fname = os.path.split(fpath)
+ if fname > '':
+ fname = fname.translate(trantab)
+ try:
+ archive.add( fpath,fname )
+ except IOError:
+ error = True
+ log.exception( "Unable to add %s to temporary library download archive %s" % (fname,outfname))
+ message = "Unable to create archive for download, please report this error"
+ status = 'error'
+ continue
+ else: # simple case
+ try:
+ archive.add( ldda.dataset.file_name, path )
+ except IOError:
+ error = True
+ log.exception( "Unable to write %s to temporary library download archive" % ldda.dataset.file_name)
+ message = "Unable to create archive for download, please report this error"
+ status = 'error'
+ if not error:
+ if library_id:
+ lname = trans.sa_session.query( trans.app.model.Library ).get( trans.security.decode_id( library_id ) ).name
+ else:
+ # Request must have coe from the library_dataset_search_results page.
+ lname = 'selected_dataset'
+ fname = lname.replace( ' ', '_' ) + '_files'
+ if action == 'zip':
+ archive.close()
+ tmpfh = open( tmpf )
+ # clean up now
+ try:
+ os.unlink( tmpf )
+ os.rmdir( tmpd )
+ except OSError:
+ error = True
+ log.exception( "Unable to remove temporary library download archive and directory" )
+ message = "Unable to create archive for download, please report this error"
+ status = 'error'
+ if not error:
+ trans.response.set_content_type( "application/x-zip-compressed" )
+ trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
+ return tmpfh
+ elif action == 'ngxzip':
+ trans.response.set_content_type( "application/zip" )
+ trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
+ trans.response.headers[ "X-Archive-Files" ] = "zip"
+ return archive
+ else:
+ trans.response.set_content_type( "application/x-tar" )
+ trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
+ archive.wsgi_status = trans.response.wsgi_status()
+ archive.wsgi_headeritems = trans.response.wsgi_headeritems()
+ return archive.stream
+ else:
+ status = 'error'
+ message = 'Invalid action ( %s ) specified.' % action
+ if library_id:
+ # If we have a library_id, browse the associated library
return trans.response.send_redirect( web.url_for( controller='library_common',
action='browse_library',
cntrller=cntrller,
@@ -1585,181 +1743,129 @@
id=library_id,
show_deleted=show_deleted,
message=util.sanitize_text( message ),
- status='error' ) )
- if action == 'import_to_history' or action == 'add':
- history = trans.get_history()
- total_imported_lddas = 0
- message = ''
- status = 'done'
- for ldda in lddas:
- if ldda.dataset.state in [ 'new', 'upload', 'queued', 'running', 'empty', 'discarded' ]:
- message += "Cannot import dataset '%s' since its state is '%s'. " % ( ldda.name, ldda.dataset.state )
+ status=status ) )
+ else:
+ # We must have arrived here from the library_dataset_search_results page, so reddirect there.
+ search_term = params.get( 'search_term', '' )
+ comptypes = get_comptypes( trans )
+ return trans.fill_template( '/library/common/library_dataset_search_results.mako',
+ cntrller=cntrller,
+ search_term=search_term,
+ comptypes=comptypes,
+ lddas=lddas,
+ show_deleted=show_deleted,
+ use_panels=use_panels,
+ message=message,
+ status=status )
+
+ @web.expose
+ def import_datasets_to_histories( self, trans, cntrller, library_id='', folder_id='', ldda_ids='', target_history_ids='', new_history_name='', **kwd ):
+ # This method is called from one of the following places:
+ # - a menu option for a library dataset ( ldda_ids will be a singel dataset id )
+ # - a menu option for a library folder ( folder_id will have a value )
+ # - a menu option for a library dataset search result set ( ldda_ids will be a comma separated string of dataset ids )
+ params = util.Params( kwd )
+ message = util.restore_text( params.get( 'message', '' ) )
+ status = params.get( 'status', 'done' )
+ show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
+ use_panels = util.string_as_bool( params.get( 'use_panels', False ) )
+ user = trans.get_user()
+ current_history = trans.get_history()
+ if library_id:
+ library = trans.sa_session.query( trans.model.Library ).get( trans.security.decode_id( library_id ) )
+ else:
+ library = None
+ if folder_id:
+ folder = trans.sa_session.query( trans.model.LibraryFolder ).get( trans.security.decode_id( folder_id ) )
+ else:
+ folder = None
+ ldda_ids = util.listify( ldda_ids )
+ if ldda_ids:
+ # Check boxes cause 2 copies of each id to be included in the request
+ ldda_ids = map( trans.security.decode_id, ldda_ids )
+ unique_ldda_ids = []
+ for ldda_id in ldda_ids:
+ if ldda_id not in unique_ldda_ids:
+ unique_ldda_ids.append( ldda_id )
+ ldda_ids = unique_ldda_ids
+ target_history_ids = util.listify( target_history_ids )
+ if target_history_ids:
+ target_history_ids = [ trans.security.decode_id( target_history_id ) for target_history_id in target_history_ids if target_history_id ]
+ if params.get( 'import_datasets_to_histories_button', False ):
+ invalid_datasets = 0
+ if not ldda_ids or not ( target_history_ids or new_history_name ):
+ message = "You must provide one or more source library datasets and one or more target histories."
+ status = 'error'
+ else:
+ if new_history_name:
+ new_history = trans.app.model.History()
+ new_history.name = new_history_name
+ new_history.user = user
+ trans.sa_session.add( new_history )
+ trans.sa_session.flush()
+ target_history_ids.append( new_history.id )
+ if user:
+ target_histories = [ hist for hist in map( trans.sa_session.query( trans.app.model.History ).get, target_history_ids ) if ( hist is not None and hist.user == user )]
+ else:
+ target_histories = [ current_history ]
+ if len( target_histories ) != len( target_history_ids ):
+ message += "You do not have permission to add datasets to %i requested histories. " % ( len( target_history_ids ) - len( target_histories ) )
status = 'error'
- elif ldda.dataset.state in [ 'ok', 'error' ]:
- hda = ldda.to_history_dataset_association( target_history=history, add_to_history=True )
- total_imported_lddas += 1
- if total_imported_lddas:
- trans.sa_session.add( history )
+ for ldda in map( trans.sa_session.query( trans.app.model.LibraryDatasetDatasetAssociation ).get, ldda_ids ):
+ if ldda is None:
+ message += "You tried to import a library dataset that does not exist. "
+ status = 'error'
+ invalid_datasets += 1
+ elif ldda.dataset.state not in [ trans.model.Dataset.states.OK, trans.model.Dataset.states.ERROR ]:
+ message += "Cannot import dataset '%s' since its state is '%s'. " % ( ldda.name, ldda.dataset.state )
+ status = 'error'
+ invalid_datasets += 1
+ elif not ldda.has_data():
+ message += "Cannot import empty dataset '%s'. " % ldda.name
+ status = 'error'
+ invalid_datasets += 1
+ else:
+ for target_history in target_histories:
+ hda = ldda.to_history_dataset_association( target_history=target_history, add_to_history=True )
trans.sa_session.flush()
- message += "%i dataset(s) have been imported into your history. " % total_imported_lddas
- elif action == 'manage_permissions':
- trans.response.send_redirect( web.url_for( controller='library_common',
- action='ldda_permissions',
- cntrller=cntrller,
- use_panels=use_panels,
- library_id=library_id,
- folder_id=trans.security.encode_id( lddas[0].library_dataset.folder.id ),
- id=",".join( ldda_ids ),
- show_deleted=show_deleted,
- message=util.sanitize_text( message ),
- status=status ) )
- elif action == 'delete':
- for ldda in lddas:
- # Do not delete the association, just delete the library_dataset. The
- # cleanup_datasets.py script handles everything else.
- ld = ldda.library_dataset
- ld.deleted = True
- trans.sa_session.add( ld )
- trans.sa_session.flush()
- message = "The selected datasets have been removed from this data library"
- elif action in ['zip','tgz','tbz','ngxzip']:
- error = False
- killme = string.punctuation + string.whitespace
- trantab = string.maketrans(killme,'_'*len(killme))
- try:
- outext = 'zip'
- if action == 'zip':
- # Can't use mkstemp - the file must not exist first
- tmpd = tempfile.mkdtemp()
- tmpf = os.path.join( tmpd, 'library_download.' + action )
- if ziptype == '64' and trans.app.config.upstream_gzip:
- archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_STORED, True )
- elif ziptype == '64':
- archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_DEFLATED, True )
- elif trans.app.config.upstream_gzip:
- archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_STORED )
- else:
- archive = zipfile.ZipFile( tmpf, 'w', zipfile.ZIP_DEFLATED )
- archive.add = lambda x, y: archive.write( x, y.encode('CP437') )
- elif action == 'tgz':
- if trans.app.config.upstream_gzip:
- archive = util.streamball.StreamBall( 'w|' )
- outext = 'tar'
- else:
- archive = util.streamball.StreamBall( 'w|gz' )
- outext = 'tgz'
- elif action == 'tbz':
- archive = util.streamball.StreamBall( 'w|bz2' )
- outext = 'tbz2'
- elif action == 'ngxzip':
- archive = NgxZip( trans.app.config.nginx_x_archive_files_base )
- except (OSError, zipfile.BadZipfile):
- error = True
- log.exception( "Unable to create archive for download" )
- message = "Unable to create archive for download, please report this error"
- status = 'error'
- except:
- error = True
- log.exception( "Unexpected error %s in create archive for download" % sys.exc_info()[0])
- message = "Unable to create archive for download, please report - %s" % sys.exc_info()[0]
- status = 'error'
- if not error:
- composite_extensions = trans.app.datatypes_registry.get_composite_extensions( )
- seen = []
- for ldda in lddas:
- if ldda.dataset.state in [ 'new', 'upload', 'queued', 'running', 'empty', 'discarded' ]:
- continue
- ext = ldda.extension
- is_composite = ext in composite_extensions
- path = ""
- parent_folder = ldda.library_dataset.folder
- while parent_folder is not None:
- # Exclude the now-hidden "root folder"
- if parent_folder.parent is None:
- path = os.path.join( parent_folder.library_root[0].name, path )
- break
- path = os.path.join( parent_folder.name, path )
- parent_folder = parent_folder.parent
- path += ldda.name
- while path in seen:
- path += '_'
- seen.append( path )
- zpath = os.path.split(path)[-1] # comes as base_name/fname
- outfname,zpathext = os.path.splitext(zpath)
- if is_composite:
- # need to add all the components from the extra_files_path to the zip
- if zpathext == '':
- zpath = '%s.html' % zpath # fake the real nature of the html file
- try:
- archive.add(ldda.dataset.file_name,zpath) # add the primary of a composite set
- except IOError:
- error = True
- log.exception( "Unable to add composite parent %s to temporary library download archive" % ldda.dataset.file_name)
- message = "Unable to create archive for download, please report this error"
- status = 'error'
- continue
- flist = glob.glob(os.path.join(ldda.dataset.extra_files_path,'*.*')) # glob returns full paths
- for fpath in flist:
- efp,fname = os.path.split(fpath)
- if fname > '':
- fname = fname.translate(trantab)
- try:
- archive.add( fpath,fname )
- except IOError:
- error = True
- log.exception( "Unable to add %s to temporary library download archive %s" % (fname,outfname))
- message = "Unable to create archive for download, please report this error"
- status = 'error'
- continue
- else: # simple case
- try:
- archive.add( ldda.dataset.file_name, path )
- except IOError:
- error = True
- log.exception( "Unable to write %s to temporary library download archive" % ldda.dataset.file_name)
- message = "Unable to create archive for download, please report this error"
- status = 'error'
- if not error:
- lname = trans.sa_session.query( trans.app.model.Library ).get( trans.security.decode_id( library_id ) ).name
- fname = lname.replace( ' ', '_' ) + '_files'
- if action == 'zip':
- archive.close()
- tmpfh = open( tmpf )
- # clean up now
- try:
- os.unlink( tmpf )
- os.rmdir( tmpd )
- except OSError:
- error = True
- log.exception( "Unable to remove temporary library download archive and directory" )
- message = "Unable to create archive for download, please report this error"
- status = 'error'
- if not error:
- trans.response.set_content_type( "application/x-zip-compressed" )
- trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
- return tmpfh
- elif action == 'ngxzip':
- trans.response.set_content_type( "application/zip" )
- trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
- trans.response.headers[ "X-Archive-Files" ] = "zip"
- return archive
- else:
- trans.response.set_content_type( "application/x-tar" )
- trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext)
- archive.wsgi_status = trans.response.wsgi_status()
- archive.wsgi_headeritems = trans.response.wsgi_headeritems()
- return archive.stream
- else:
- status = 'error'
- message = 'Invalid action ( %s ) specified.' % action
- return trans.response.send_redirect( web.url_for( controller='library_common',
- action='browse_library',
- cntrller=cntrller,
- use_panels=use_panels,
- id=library_id,
- show_deleted=show_deleted,
- message=util.sanitize_text( message ),
- status=status ) )
+ hist_names_str = ", ".join( [ target_history.name for target_history in target_histories ] )
+ num_source = len( ldda_ids ) - invalid_datasets
+ num_target = len( target_histories )
+ message = "%i %s have been imported into %i %s: %s" % ( num_source,
+ inflector.cond_plural( num_source, "dataset" ),
+ num_target,
+ inflector.cond_plural( num_target, "history" ),
+ hist_names_str )
+ trans.sa_session.refresh( current_history )
+ current_user_roles = trans.get_current_user_roles()
+ source_lddas = []
+ if folder:
+ for library_dataset in folder.datasets:
+ ldda = library_dataset.library_dataset_dataset_association
+ if not ldda.deleted and trans.app.security_agent.can_access_library_item( current_user_roles, ldda, trans.user ):
+ source_lddas.append( ldda )
+ elif ldda_ids:
+ for ldda_id in ldda_ids:
+ # Secuirty access permiision chcck is not needed here since the current user had access
+ # to the lddas in order for the menu optin to be available.
+ ldda = trans.sa_session.query( trans.model.LibraryDatasetDatasetAssociation ).get( ldda_id )
+ source_lddas.append( ldda )
+ target_histories = [ current_history ]
+ if user:
+ target_histories = user.active_histories
+ return trans.fill_template( "/library/common/import_datasets_to_histories.mako",
+ cntrller=cntrller,
+ library=library,
+ current_history=trans.get_history(),
+ ldda_ids=ldda_ids,
+ target_history_ids=target_history_ids,
+ source_lddas=source_lddas,
+ target_histories=target_histories,
+ new_history_name=new_history_name,
+ show_deleted=show_deleted,
+ use_panels=use_panels,
+ message=message,
+ status=status )
@web.expose
def manage_template_inheritance( self, trans, cntrller, item_type, library_id, folder_id=None, ldda_id=None, **kwd ):
params = util.Params( kwd )
@@ -2064,6 +2170,31 @@
if library.root_folder == folder:
return library
return None
+def get_comptypes( trans ):
+ comptypes_t = comptypes
+ if trans.app.config.nginx_x_archive_files_base:
+ comptypes_t = ['ngxzip']
+ for comptype in trans.app.config.disable_library_comptypes:
+ # TODO: do this once, not every time (we're gonna raise an
+ # exception every time after the first time)
+ try:
+ comptypes_t.remove( comptype )
+ except:
+ pass
+ return comptypes_t
+def get_sorted_accessible_library_items( trans, cntrller, items, sort_attr ):
+ is_admin = trans.user_is_admin() and cntrller == 'library_admin'
+ if is_admin:
+ accessible_items = items
+ else:
+ # Enforce access permission settings
+ current_user_roles = trans.get_current_user_roles()
+ accessible_items = []
+ for item in items:
+ if trans.app.security_agent.can_access_library_item( current_user_roles, item, trans.user ):
+ accessible_items.append( item )
+ # Sort by name
+ return sort_by_attr( [ item for item in accessible_items ], sort_attr )
def sort_by_attr( seq, attr ):
"""
Sort the sequence of objects by object's attribute
@@ -2079,25 +2210,12 @@
intermed = map( None, map( getattr, seq, ( attr, ) * len( seq ) ), xrange( len( seq ) ), seq )
intermed.sort()
return map( operator.getitem, intermed, ( -1, ) * len( intermed ) )
-def get_sorted_accessible_library_items( trans, cntrller, items, sort_attr ):
- is_admin = trans.user_is_admin() and cntrller == 'library_admin'
- if is_admin:
- accessible_items = items
- else:
- # Enforce access permission settings
- current_user_roles = trans.get_current_user_roles()
- accessible_items = []
- for item in items:
- if trans.app.security_agent.can_access_library_item( current_user_roles, item, trans.user ):
- accessible_items.append( item )
- # Sort by name
- return sort_by_attr( [ item for item in accessible_items ], sort_attr )
def lucene_search( trans, cntrller, search_term, search_url, **kwd ):
"""Return display of results from a full-text lucene search of data libraries."""
params = util.Params( kwd )
message = util.restore_text( params.get( 'message', '' ) )
status = params.get( 'status', 'done' )
- full_url = "%s?%s" % ( search_url, urllib.urlencode( { "kwd" : search_term } ) )
+ full_url = "%s/find?%s" % ( search_url, urllib.urlencode( { "kwd" : search_term } ) )
response = urllib2.urlopen( full_url )
ldda_ids = util.json.from_json_string( response.read() )[ "ids" ]
response.close()
@@ -2115,17 +2233,20 @@
if index_exists:
index = whoosh.index.open_dir( whoosh_index_dir )
# Set field boosts for searcher to place equal weight on all search fields.
- searcher = index.searcher( weighting=BM25F( field_B={ 'name_B' : 3.5,
- 'info_B' : 2.3,
- 'dbkey_B' : 3.1,
- 'message_B' : 2.1,
- 'state_B' : 1.2 } ) )
+ searcher = index.searcher( weighting=BM25F( field_B={ 'name_B' : 3.4,
+ 'info_B' : 3.2,
+ 'dbkey_B' : 3.3,
+ 'message_B' : 3.5 } ) )
# Perform search
- parser = MultifieldParser( [ 'name', 'info', 'dbkey', 'message', 'state' ], schema=schema )
+ parser = MultifieldParser( [ 'name', 'info', 'dbkey', 'message' ], schema=schema )
# Search term with wildcards may be slow...
- results = searcher.search( parser.parse( '*' + search_term + '*' ), minscore=1.0 )
+ results = searcher.search( parser.parse( '*' + search_term + '*' ), minscore=0.1 )
ldda_ids = [ result[ 'id' ] for result in results ]
- lddas = [ trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id ) for ldda_id in ldda_ids ]
+ lddas = []
+ for ldda_id in ldda_ids:
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id )
+ if ldda:
+ lddas.append( ldda )
lddas = get_sorted_accessible_library_items( trans, cntrller, lddas, 'name' )
else:
message = "Tell your Galaxy administrator that the directory %s does not contain valid whoosh indexes" % str( whoosh_index_dir )
--- a/scripts/data_libraries/build_lucene_index.py Mon Jan 31 12:57:42 2011 -0500
+++ b/scripts/data_libraries/build_lucene_index.py Mon Jan 31 16:41:03 2011 -0500
@@ -30,7 +30,7 @@
sa_session, gconfig = get_sa_session( ini_file )
max_size = float( gconfig.get( "fulltext_max_size", 100 ) ) * 1048576
ignore_exts = gconfig.get( "fulltext_noindex_filetypes", "" ).split( "," )
- search_url = gconfig.get( "fulltext_index_url", None )
+ search_url = gconfig.get( "fulltext_url", None )
if not search_url:
raise ValueError( "Need to specify search functionality in universe_wsgi.ini" )
dataset_file = create_dataset_file( get_lddas( sa_session, max_size, ignore_exts ) )
@@ -41,7 +41,7 @@
os.remove( dataset_file )
def build_index( search_url, dataset_file ):
- url = "%s?%s" % ( search_url, urllib.urlencode( { "docfile" : dataset_file } ) )
+ url = "%s/index?%s" % ( search_url, urllib.urlencode( { "docfile" : dataset_file } ) )
request = urllib2.Request( url )
request.get_method = lambda: "PUT"
response = urllib2.urlopen( request )
@@ -57,21 +57,35 @@
def get_lddas( sa_session, max_size, ignore_exts ):
for ldda in sa_session.query( model.LibraryDatasetDatasetAssociation ).filter_by( deleted=False ):
- id = ldda.id
- name = ldda.name
- info = ldda.library_dataset.get_info()
- if info and not info.startswith( 'upload' ):
- info = info.replace( 'no info', '' )
- else:
- info = ''
- dbkey = ldda.metadata.dbkey
- state = ldda.state
- message = ldda.message
if ( float( ldda.dataset.get_size() ) > max_size or ldda.extension in ignore_exts ):
fname = ""
else:
fname = ldda.dataset.get_file_name()
- yield id, name, info, dbkey, state, message, fname
+ yield ldda.id, fname, _get_dataset_metadata(ldda)
+
+def _get_dataset_metadata(ldda):
+ """Retrieve descriptions and information associated with a dataset.
+ """
+ lds = ldda.library_dataset
+ folder_info = _get_folder_info(lds.folder)
+ lds_info = lds.get_info()
+ if lds_info and not lds_info.startswith("upload"):
+ lds_info = lds_info.replace("no info", "")
+ else:
+ lds_info = ""
+ return "%s %s %s %s %s" % (lds.name or "", lds_info, ldda.metadata.dbkey,
+ ldda.message, folder_info)
+
+def _get_folder_info(folder):
+ """Get names and descriptions for all parent folders except top level.
+ """
+ folder_info = ""
+ if folder and folder.parent:
+ folder_info = _get_folder_info(folder.parent)
+ folder_info += " %s %s" % (
+ folder.name.replace("Unnamed folder", ""),
+ folder.description or "")
+ return folder_info
def get_sa_session( ini_file ):
conf_parser = ConfigParser.ConfigParser( { 'here':os.getcwd() } )
--- a/scripts/data_libraries/build_whoosh_index.py Mon Jan 31 12:57:42 2011 -0500
+++ b/scripts/data_libraries/build_whoosh_index.py Mon Jan 31 16:41:03 2011 -0500
@@ -24,7 +24,7 @@
from whoosh.fields import Schema, STORED, ID, KEYWORD, TEXT
from whoosh.index import Index
whoosh_search_enabled = True
- schema = Schema( id=STORED, name=TEXT, info=TEXT, dbkey=TEXT, message=TEXT, state=TEXT )
+ schema = Schema( id=STORED, name=TEXT, info=TEXT, dbkey=TEXT, message=TEXT )
import galaxy.model.mapping
from galaxy import config, model
import pkg_resources
@@ -43,13 +43,12 @@
else:
return a_basestr
lddas_indexed = 0
- for id, name, info, dbkey, state, message in get_lddas( sa_session ):
+ for id, name, info, dbkey, message in get_lddas( sa_session ):
writer.add_document( id=id,
name=to_unicode( name ),
info=to_unicode( info ),
dbkey=to_unicode( dbkey ),
- message=to_unicode( message ),
- state=to_unicode( state ) )
+ message=to_unicode( message ) )
lddas_indexed += 1
writer.commit()
print "Number of active library datasets indexed: ", lddas_indexed
@@ -64,9 +63,8 @@
else:
info = ''
dbkey = ldda.metadata.dbkey
- state = ldda.state
message = ldda.message
- yield id, name, info, dbkey, state, message
+ yield id, name, info, dbkey, message
def get_sa_session_and_needed_config_settings( ini_file ):
conf_parser = ConfigParser.ConfigParser( { 'here' : os.getcwd() } )
--- a/templates/library/common/browse_library.mako Mon Jan 31 12:57:42 2011 -0500
+++ b/templates/library/common/browse_library.mako Mon Jan 31 16:41:03 2011 -0500
@@ -1,6 +1,7 @@
<%namespace file="/message.mako" import="render_msg" /><%namespace file="/library/common/library_item_info.mako" import="render_library_item_info" /><%namespace file="/library/common/common.mako" import="render_actions_on_multiple_items" />
+<%namespace file="/library/common/common.mako" import="common_javascripts" /><%!
def inherit(context):
@@ -46,6 +47,7 @@
<%def name="javascripts()">
${parent.javascripts()}
${h.js("class", "jquery.jstore")}
+ ${common_javascripts()}
${self.grid_javascripts()}
</%def>
@@ -152,15 +154,6 @@
});
});
- function checkForm() {
- if ( $("select#action_on_datasets_select option:selected").text() == "delete" ) {
- if ( confirm( "Click OK to delete these datasets?" ) ) {
- return true;
- } else {
- return false;
- }
- }
- }
// Looks for changes in dataset state using an async request. Keeps
// calling itself (via setTimeout) until all datasets are in a terminal
// state.
@@ -212,7 +205,7 @@
</script></%def>
-<%def name="render_dataset( cntrller, ldda, library_dataset, selected, library, folder, pad, parent, row_counter, tracked_datasets, show_deleted=False, render_checkboxes=True )">
+<%def name="render_dataset( cntrller, ldda, library_dataset, selected, library, folder, pad, parent, row_counter, tracked_datasets, show_deleted=False )"><%
## The received ldda must always be a LibraryDatasetDatasetAssociation object. The object id passed to methods
## from the drop down menu should be the ldda id to prevent id collision ( which could happen when displaying
@@ -248,13 +241,11 @@
%endif
id="libraryItem-${ldda.id}"><td style="padding-left: ${pad+20}px;">
- %if render_checkboxes:
- <input style="float: left;" type="checkbox" name="ldda_ids" value="${trans.security.encode_id( ldda.id )}"
- %if selected:
- checked="checked"
- %endif
- />
+ <input style="float: left;" type="checkbox" name="ldda_ids" value="${trans.security.encode_id( ldda.id )}"
+ %if selected:
+ checked="checked"
%endif
+ />
%if ldda.library_dataset.deleted:
<span class="libraryItem-error">
%endif
@@ -288,7 +279,7 @@
<a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), replace_id=trans.security.encode_id( library_dataset.id ), show_deleted=show_deleted )}">Upload a new version of this dataset</a>
%endif
%if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ldda.has_data:
- <a class="action-button" href="${h.url_for( controller='library_common', action='act_on_multiple_datasets', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), do_action='import_to_history', use_panels=use_panels, show_deleted=show_deleted )}">Import this dataset into your current history</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='import_datasets_to_histories', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Import this dataset into selected histories</a><a class="action-button" href="${h.url_for( controller='library_common', action='download_dataset_from_folder', cntrller=cntrller, id=trans.security.encode_id( ldda.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels )}">Download this dataset</a>
%endif
%if can_modify:
@@ -379,6 +370,7 @@
<a class="action-button" href="${h.url_for( controller='library_common', action='create_folder', cntrller=cntrller, parent_id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add sub-folder</a>
%endif
%if not branch_deleted( folder ):
+ <a class="action-button" href="${h.url_for( controller='library_common', action='import_datasets_to_histories', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Select folder datasets for import into selected histories</a>
%if can_modify:
<a class="action-button" href="${h.url_for( controller='library_common', action='folder_info', cntrller=cntrller, id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a>
%else:
@@ -515,6 +507,7 @@
%endif
<a class="action-button" href="${h.url_for( controller='library_common', action='library_permissions', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a>
%endif
+ <a class="action-button" href="${h.url_for( controller='library_common', action='import_datasets_to_histories', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( library.root_folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Select datasets for import into selected histories</a>
%elif can_modify and not library.purged:
<a class="action-button" href="${h.url_for( controller='library_common', action='undelete_library_item', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library.id ), item_type='library', use_panels=use_panels )}">Undelete this data library</a>
%elif library.purged:
@@ -539,7 +532,10 @@
<table cellspacing="0" cellpadding="0" border="0" width="100%" class="grid" id="library-grid"><thead><tr class="libraryTitle">
- <th>Name</th>
+ <th>
+ <input type="checkbox" id="checkAll" name=select_all_datasets_checkbox value="true" onclick='checkAllFields(1);'/><input type="hidden" name=select_all_datasets_checkbox value="true"/>
+ Name
+ </th><th>Message</th><th>Uploaded By</th><th>Date</th>
--- a/templates/library/common/common.mako Mon Jan 31 12:57:42 2011 -0500
+++ b/templates/library/common/common.mako Mon Jan 31 16:41:03 2011 -0500
@@ -1,5 +1,48 @@
<%namespace file="/common/template_common.mako" import="render_template_field" />
+<%def name="common_javascripts()">
+ <script type="text/javascript">
+ function checkAllFields()
+ {
+ var chkAll = document.getElementById('checkAll');
+ var checks = document.getElementsByTagName('input');
+ var boxLength = checks.length;
+ var allChecked = false;
+ var totalChecked = 0;
+ if ( chkAll.checked == true )
+ {
+ for ( i=0; i < boxLength; i++ )
+ {
+ if ( checks[i].name.indexOf( 'ldda_ids' ) != -1)
+ {
+ checks[i].checked = true;
+ }
+ }
+ }
+ else
+ {
+ for ( i=0; i < boxLength; i++ )
+ {
+ if ( checks[i].name.indexOf( 'ldda_ids' ) != -1)
+ {
+ checks[i].checked = false
+ }
+ }
+ }
+ }
+
+ function checkForm() {
+ if ( $("select#action_on_datasets_select option:selected").text() == "delete" ) {
+ if ( confirm( "Click OK to delete these datasets?" ) ) {
+ return true;
+ } else {
+ return false;
+ }
+ }
+ }
+ </script>
+</%def>
+
<%def name="render_upload_form( cntrller, upload_option, action, library_id, folder_id, replace_dataset, file_formats, dbkeys, space_to_tab, link_data_only, widgets, roles_select_list, history, show_deleted )"><%
import os, os.path
@@ -319,26 +362,34 @@
%endif
</%def>
-<%def name="render_actions_on_multiple_items()">
+<%def name="render_actions_on_multiple_items( actions_to_exclude=[] )">
+ <%
+ is_admin = trans.user_is_admin() and cntrller=='library_admin'
+ can_delete = 'delete' not in actions_to_exclude and is_admin
+ can_download = 'download' not in actions_to_exclude
+ can_import_to_histories = 'import_to_histories' not in actions_to_exclude
+ can_manage_permissions = 'manage_permissions' not in actions_to_exclude
+ %><tfoot><tr><td colspan="5" style="padding-left: 42px;">
For selected items:
<select name="do_action" id="action_on_selected_items">
- %if ( trans.user_is_admin() and cntrller=='library_admin' ):
- <option value="manage_permissions">Edit permissions</option>
- <option value="delete">Delete</option>
- %elif cntrller in ['library', 'library_search']:
- %if default_action == 'add':
- <option value="add" selected>Import into your current history</option>
+ %if can_import_to_histories:
+ %if not is_admin and default_action == 'import_to_histories':
+ <option value="import_to_histories" selected>Import selected datasets to histories</option>
%else:
- <option value="add">Import into your current history</option>
+ <option value="import_to_histories">Import selected datasets to histories</option>
%endif
- %if default_action == 'manage_permissions':
+ %endif
+ %if can_manage_permissions:
+ %if not is_admin and default_action == 'manage_permissions':
<option value="manage_permissions" selected>Edit permissions</option>
- # This condition should not contain an else clause because the user is not authorized
- # to manage dataset permissions unless the default action is 'manage_permissions'
+ %else:
+ <option value="manage_permissions">Edit permissions</option>
%endif
+ %endif
+ %if can_download:
%if 'gz' in comptypes:
<option value="tgz"
%if default_action == 'download':
@@ -361,6 +412,9 @@
>Download as a .zip file</option>
%endif
%endif
+ %if can_delete:
+ <option value="delete">Delete</option>
+ %endif
</select><input type="submit" class="primary-button" name="action_on_datasets_button" id="action_on_datasets_button" value="Go"/></td>
--- a/templates/library/common/ldda_info.mako Mon Jan 31 12:57:42 2011 -0500
+++ b/templates/library/common/ldda_info.mako Mon Jan 31 16:41:03 2011 -0500
@@ -66,7 +66,7 @@
<a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), replace_id=trans.security.encode_id( ldda.library_dataset.id ) )}">Upload a new version of this dataset</a>
%endif
%if cntrller=='library' and ldda.has_data():
- <a class="action-button" href="${h.url_for( controller='library_common', action='act_on_multiple_datasets', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), do_action='import_to_history', use_panels=use_panels, show_deleted=show_deleted )}">Import this dataset into your current history</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='import_datasets_to_histories', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Select histories to import this dataset</a><a class="action-button" href="${h.url_for( controller='library_common', action='download_dataset_from_folder', cntrller=cntrller, id=trans.security.encode_id( ldda.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Download this dataset</a>
%endif
%if show_associated_hdas_and_lddas:
--- a/templates/library/common/library_dataset_search_results.mako Mon Jan 31 12:57:42 2011 -0500
+++ b/templates/library/common/library_dataset_search_results.mako Mon Jan 31 16:41:03 2011 -0500
@@ -1,5 +1,7 @@
<%namespace file="/message.mako" import="render_msg" /><%namespace file="/library/common/browse_library.mako" import="render_dataset" />
+<%namespace file="/library/common/common.mako" import="render_actions_on_multiple_items" />
+<%namespace file="/library/common/common.mako" import="common_javascripts" /><%!
def inherit(context):
@@ -44,6 +46,7 @@
<%def name="javascripts()">
${parent.javascripts()}
${h.js("class", "jquery.jstore")}
+ ${common_javascripts()}
</%def><%def name="render_searched_components()">
@@ -52,7 +55,6 @@
<li>info</li><li>dbkey (genome build)</li><li>message</li>
- <li>state</li>
%if trans.app.config.enable_lucene_library_search:
<li>disk file content</li>
%endif
@@ -91,34 +93,69 @@
%if lddas:
<p>The string "${search_term}" was found in at least one of the following information components of the displayed library datasets.</p>
${render_searched_components()}
- <table cellspacing="0" cellpadding="0" border="0" width="100%" class="grid" id="library-grid">
- <thead>
- <tr class="libraryTitle">
- <th>Name</th>
- <th>Message</th>
- <th>Uploaded By</th>
- <th>Date</th>
- <th>File Size</th>
- </tr>
- </thead>
- <%
- tracked_datasets = {}
- row_counter = RowCounter()
- my_row = row_counter.count
- %>
- %for ldda in lddas:
+ <form name="act_on_multiple_datasets" action="${h.url_for( controller='library_common', action='act_on_multiple_datasets', cntrller=cntrller, use_panels=use_panels, show_deleted=show_deleted )}" onSubmit="javascript:return checkForm();" method="post">
+ <table cellspacing="0" cellpadding="0" border="0" width="100%" class="grid" id="library-grid">
+ <thead>
+ <tr class="libraryTitle">
+ <th>
+ <input type="checkbox" id="checkAll" name=select_all_datasets_checkbox value="true" onclick='checkAllFields(1);'/><input type="hidden" name=select_all_datasets_checkbox value="true"/>
+ Name
+ </th>
+ <th>Message</th>
+ <th>Uploaded By</th>
+ <th>Date</th>
+ <th>File Size</th>
+ </tr>
+ </thead><%
- library_dataset = ldda.library_dataset
- folder = library_dataset.folder
- library = folder.parent_library
+ tracked_datasets = {}
+ row_counter = RowCounter()
+ my_row = row_counter.count
%>
- ${render_dataset( cntrller, ldda, library_dataset, False, library, folder, 0, my_row, row_counter, tracked_datasets, show_deleted=False, render_checkboxes=False )}
- <%
- my_row = row_counter.count
- row_counter.increment()
- %>
- %endfor
- </table>
+ %for ldda in lddas:
+ <%
+ library_dataset = ldda.library_dataset
+ folder = library_dataset.folder
+ library = folder.parent_library
+ %>
+ ${render_dataset( cntrller, ldda, library_dataset, False, library, folder, 0, my_row, row_counter, tracked_datasets, show_deleted=False )}
+ <%
+ my_row = row_counter.count
+ row_counter.increment()
+ %>
+ %endfor
+ ${render_actions_on_multiple_items( actions_to_exclude=[ 'manage_permissions' ] )}
+ </table>
+ </form>
+ ## Help about compression types
+
+ <div class="libraryItemBody">
+ <p class="infomark">
+ TIP: You can download individual library files by selecting "Download this dataset" from the context menu (triangle) next to the dataset's name.
+ </p>
+ </div>
+ %if len( comptypes ) > 1:
+ <div class="libraryItemBody">
+ <p class="infomark">
+ TIP: Multiple compression options are available for downloading library datasets:
+ </p>
+ <ul style="padding-left: 1em; list-style-type: disc;">
+ %if 'gz' in comptypes:
+ <li>gzip: Recommended for fast network connections
+ %if trans.app.config.upstream_gzip:
+ NOTE: The file you receive will be an uncompressed .tar file - this is because the Galaxy server compresses it and your browser decompresses it on the fly.
+ %endif
+ </li>
+ %endif
+ %if 'bz2' in comptypes:
+ <li>bzip2: Recommended for slower network connections (smaller size but takes longer to compress)</li>
+ %endif
+ %if 'zip' in comptypes:
+ <li>zip: Not recommended but is provided as an option for those who cannot open the above formats</li>
+ %endif
+ </ul>
+ </div>
+ %endif
%elif status != 'error':
<p>The string "${search_term}" was not found in any of the following information components for any library datasets that you can access.</p>
${render_searched_components()}
--- a/test/base/twilltestcase.py Mon Jan 31 12:57:42 2011 -0500
+++ b/test/base/twilltestcase.py Mon Jan 31 16:41:03 2011 -0500
@@ -2106,6 +2106,13 @@
% ( self.url, cntrller, library_id, ldda_ids, do_action ) )
for check_str in strings_displayed:
self.check_page_for_string( check_str )
+ def import_datasets_to_histories( self, cntrller, library_id, ldda_ids='', new_history_name='Unnamed history', strings_displayed=[] ):
+ # Can't use the ~/library_admin/libraries form as twill barfs on it so we'll simulate the form submission
+ # by going directly to the form action
+ self.visit_url( '%s/library_common/import_datasets_to_histories?cntrller=%s&library_id=%s&ldda_ids=%s&new_history_name=%s&import_datasets_to_histories_button=Import+library+datasets' \
+ % ( self.url, cntrller, library_id, ldda_ids, new_history_name ) )
+ for check_str in strings_displayed:
+ self.check_page_for_string( check_str )
def download_archive_of_library_files( self, cntrller, library_id, ldda_ids, format ):
self.home()
# Here it would be ideal to have twill set form values and submit the form, but
--- a/test/functional/test_library_security.py Mon Jan 31 12:57:42 2011 -0500
+++ b/test/functional/test_library_security.py Mon Jan 31 16:41:03 2011 -0500
@@ -296,11 +296,11 @@
strings_displayed=[ '2.bed',
'This is the latest version of this library dataset',
'Edit attributes of 2.bed' ] )
- self.act_on_multiple_datasets( 'library',
- self.security.encode_id( library1.id ),
- 'import_to_history',
- ldda_ids=self.security.encode_id( ldda2.id ),
- strings_displayed=[ '1 dataset(s) have been imported into your history' ] )
+ self.import_datasets_to_histories( cntrller='library',
+ library_id=self.security.encode_id( library1.id ),
+ ldda_ids=self.security.encode_id( ldda2.id ),
+ new_history_name='goodbye',
+ strings_displayed=[ '1 dataset have been imported into 1 history' ] )
self.logout()
# regular_user2 should not be able to see ldda2
self.login( email=regular_user2.email )
@@ -382,10 +382,10 @@
def check_edit_page( lddas, strings_displayed=[], strings_not_displayed=[] ):
for ldda in lddas:
# Import each library dataset into our history
- self.act_on_multiple_datasets( 'library',
- self.security.encode_id( library1.id ),
- 'import_to_history',
- ldda_ids=self.security.encode_id( ldda.id ) )
+ self.import_datasets_to_histories( cntrller='library',
+ library_id=self.security.encode_id( library1.id ),
+ ldda_ids=self.security.encode_id( ldda.id ),
+ new_history_name='hello' )
# Determine the new HistoryDatasetAssociation id created when the library dataset was imported into our history
last_hda_created = get_latest_hda()
self.edit_hda_attribute_info( str( last_hda_created.id ),
@@ -393,8 +393,8 @@
# admin_user is associated with role1, so should have all permissions on imported datasets
check_edit_page( latest_3_lddas,
strings_displayed=[ 'Manage dataset permissions on',
- 'can manage the roles associated with permissions on this dataset',
- 'can import this dataset into their history for analysis' ] )
+ 'can manage the roles associated with permissions on this dataset',
+ 'can import this dataset into their history for analysis' ] )
self.logout()
# regular_user1 is associated with role1, so should have all permissions on imported datasets
self.login( email=regular_user1.email )
--- a/tools/data_source/access_libraries.xml Mon Jan 31 12:57:42 2011 -0500
+++ b/tools/data_source/access_libraries.xml Mon Jan 31 16:41:03 2011 -0500
@@ -2,7 +2,7 @@
<tool name="Access Libraries" id="library_access1"><description>stored locally</description><inputs action="/library/index" method="get" target="_parent">
- <param name="default_action" type="hidden" value="add" />
+ <param name="default_action" type="hidden" value="import_to_histories" /></inputs><uihints minwidth="800"/></tool>
--- a/universe_wsgi.ini.sample Mon Jan 31 12:57:42 2011 -0500
+++ b/universe_wsgi.ini.sample Mon Jan 31 16:41:03 2011 -0500
@@ -337,18 +337,17 @@
#transfer_manager_port = 8163
# Search data libraries with whoosh
-enable_whoosh_library_search = True
+#enable_whoosh_library_search = True
# Whoosh indexes are stored in this directory.
-whoosh_index_dir = database/whoosh_indexes
+#whoosh_index_dir = database/whoosh_indexes
# Search data libraries with lucene
#enable_lucene_library_search = False
# maxiumum file size to index for searching, in MB
#fulltext_max_size = 500
#fulltext_noindex_filetypes=bam,sam,wig,bigwig,fasta,fastq,fastqsolexa,fastqillumina,fastqsanger
-# base URL of server providing search functionality using whoosh.
-#fulltext_index_url = http://localhost:8081/index
-#fulltext_find_url = http://localhost:8081/find
+# base URL of server providing search functionality using lucene
+#fulltext_url = http://localhost:8081
# -- Users and Security
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1
0
galaxy-dist commit 1449307bdaf7: Data libraries: 'Delete template' renamed to 'Unuse template', 'Add template' renamed to 'Use template' as these are more semantically correct. Checkbox form fields now have 'id' attribute as well. Fix bug when adding a template when no templates exist.
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kanwei Li <kanwei(a)gmail.com>
# Date 1289758795 18000
# Node ID 1449307bdaf7671bea8a879a6c0990bc0c3b7aa7
# Parent 0171a44ec8268209b762965d7a66a928e077e1d4
Data libraries: 'Delete template' renamed to 'Unuse template', 'Add template' renamed to 'Use template' as these are more semantically correct. Checkbox form fields now have 'id' attribute as well. Fix bug when adding a template when no templates exist.
--- a/templates/library/common/library_info.mako
+++ b/templates/library/common/library_info.mako
@@ -41,7 +41,7 @@
<div popupmenu="library-${library.id}-popup">
%if not library.deleted:
%if can_add and not library.info_association:
- <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Use template</a>
%endif
%if can_manage:
<a class="action-button" href="${h.url_for( controller='library_common', action='library_permissions', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a>
--- a/lib/galaxy/web/form_builder.py
+++ b/lib/galaxy/web/form_builder.py
@@ -90,25 +90,26 @@ class CheckboxField(BaseField):
A checkbox (boolean input)
>>> print CheckboxField( "foo" ).get_html()
- <input type="checkbox" name="foo" value="true" ><input type="hidden" name="foo" value="true">
+ <input type="checkbox" id="foo" name="foo" value="true"><input type="hidden" name="foo" value="true">
>>> print CheckboxField( "bar", checked="yes" ).get_html()
- <input type="checkbox" name="bar" value="true" checked><input type="hidden" name="bar" value="true">
+ <input type="checkbox" id="bar" name="bar" value="true" checked="checked"><input type="hidden" name="bar" value="true">
"""
def __init__( self, name, checked=None ):
self.name = name
self.checked = ( checked == True ) or ( isinstance( checked, basestring ) and ( checked.lower() in ( "yes", "true", "on" ) ) )
def get_html( self, prefix="", disabled=False ):
if self.checked:
- checked_text = "checked"
+ checked_text = ' checked="checked"'
else:
checked_text = ""
+ id_name = prefix + self.name
# The hidden field is necessary because if the check box is not checked on the form, it will
# not be included in the request params. The hidden field ensure that this will happen. When
# parsing the request, the value 'true' in the hidden field actually means it is NOT checked.
# See the is_checked() method below. The prefix is necessary in each case to ensure functional
# correctness when the param is inside a conditional.
- return '<input type="checkbox" name="%s%s" value="true" %s%s><input type="hidden" name="%s%s" value="true"%s>' \
- % ( prefix, self.name, checked_text, self.get_disabled_str( disabled ), prefix, self.name, self.get_disabled_str( disabled ) )
+ return '<input type="checkbox" id="%s" name="%s" value="true"%s%s><input type="hidden" name="%s%s" value="true"%s>' \
+ % ( id_name, id_name, checked_text, self.get_disabled_str( disabled ), prefix, self.name, self.get_disabled_str( disabled ) )
@staticmethod
def is_checked( value ):
if value == True:
--- a/templates/library/common/browse_library.mako
+++ b/templates/library/common/browse_library.mako
@@ -152,16 +152,6 @@
});
});
- // For view info links, use a modal popup
- /*$(".view-info").live("click", function() {
- $.get( $(this).attr("href"), function(info) {
- show_modal("View Information", info, {
- "Close": function() { hide_modal(); }
- });
- });
- return false;
- });*/
-
function checkForm() {
if ( $("select#action_on_datasets_select option:selected").text() == "delete" ) {
if ( confirm( "Click OK to delete these datasets?" ) ) {
@@ -276,14 +266,14 @@
%if not branch_deleted( folder ) and not ldda.library_dataset.deleted and can_modify:
<a class="action-button" href="${h.url_for( controller='library_common', action='ldda_edit_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a>
%else:
- <a class="action-button" class="view-info" href="${h.url_for( controller='library_common', action='ldda_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">View information</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">View information</a>
%endif
%if not branch_deleted( folder ) and not ldda.library_dataset.deleted and can_modify and not info_association:
- <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Use template</a>
%endif
%if not branch_deleted( folder ) and not ldda.library_dataset.deleted and can_modify and info_association:
<a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a>
- <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Unuse template</a>
%endif
%if not branch_deleted( folder ) and not ldda.library_dataset.deleted and can_manage:
%if not trans.app.security_agent.dataset_is_public( ldda.dataset ):
@@ -393,11 +383,11 @@
%endif
%endif
%if not branch_deleted( folder ) and can_modify and not info_association:
- <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Use template</a>
%endif
%if not branch_deleted( folder ) and can_modify and info_association:
<a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a>
- <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Unuse template</a>
%endif
%if not branch_deleted( folder ) and can_manage:
%if not trans.app.security_agent.folder_is_public( folder ):
@@ -509,11 +499,11 @@
%endif
%endif
%if can_modify and not library.info_association:
- <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Use template</a>
%endif
%if can_modify and info_association:
<a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a>
- <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='library', library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Unuse template</a>
%endif
%if can_manage:
%if not trans.app.security_agent.library_is_public( library, contents=True ):
--- a/lib/galaxy/tools/parameters/basic.py
+++ b/lib/galaxy/tools/parameters/basic.py
@@ -270,7 +270,7 @@ class BooleanToolParameter( ToolParamete
>>> print p.name
blah
>>> print p.get_html()
- <input type="checkbox" name="blah" value="true" checked><input type="hidden" name="blah" value="true">
+ <input type="checkbox" id="blah" name="blah" value="true" checked="checked"><input type="hidden" name="blah" value="true">
>>> print p.from_html( ["true","true"] )
True
>>> print p.to_param_dict_string( True )
--- a/templates/library/common/common.mako
+++ b/templates/library/common/common.mako
@@ -92,7 +92,7 @@
<a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}">Select a different template</a>
%elif info_association and not inherited and can_modify:
<a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}">Edit template</a>
- <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}">Delete template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}">Unuse template</a>
%if item_type not in [ 'ldda', 'library_dataset' ]:
%if info_association.inheritable:
<a class="action-button" href="${h.url_for( controller='library_common', action='manage_template_inheritance', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}">Dis-inherit template</a>
@@ -110,7 +110,7 @@
<b>
This is an inherited template and is not required to be used with this ${item_type}. You can
<a href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type=item_type, library_id=library_id, folder_id=folder_id, ldda_id=ldda_id, show_deleted=show_deleted )}"><font color="red">select a different template</font></a>
- or fill in the desired fields and save this one. This template will not be assocaiated with this ${item_type} until you click the Save button.
+ or fill in the desired fields and save this one. This template will not be associated with this ${item_type} until you click the Save button.
</b></font></div>
--- a/lib/galaxy/web/controllers/library_common.py
+++ b/lib/galaxy/web/controllers/library_common.py
@@ -1781,7 +1781,8 @@ class LibraryCommon( BaseController, Use
if not forms:
message = "There are no forms on which to base the template, so create a form and then add the template."
return trans.response.send_redirect( web.url_for( controller='forms',
- action='create_request',
+ action='create_form',
+ cntrller='library',
message=message,
status='done',
form_type=trans.app.model.FormDefinition.types.LIBRARY_INFO_TEMPLATE ) )
--- a/templates/library/common/select_template.mako
+++ b/templates/library/common/select_template.mako
@@ -28,18 +28,18 @@
</div>
% if item_type in [ 'library', 'folder' ]:
<div class="form-row">
- <label>Inherit template to contained folders and datasets?</label>
%if inheritable_checked:
<% inheritable_check_box.checked = True %>
%endif
${inheritable_check_box.get_html()}
+ <label for="inheritable" style="display:inline;">Inherit template to contained folders and datasets?</label><div class="toolParamHelp" style="clear: both;">
Check if you want this template to be used by other folders and datasets contained within this ${item_desc}
</div></div>
%endif
<div class="form-row">
- <input type="submit" name="add_template_button" value="Add template to ${item_desc}"/>
+ <input type="submit" name="add_template_button" value="Use this template"/></div></form></div>
--- a/templates/library/common/ldda_info.mako
+++ b/templates/library/common/ldda_info.mako
@@ -52,10 +52,10 @@
%if can_modify:
<a class="action-button" href="${h.url_for( controller='library_common', action='ldda_edit_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a>
%if not info_association:
- <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Use template</a>
%else:
<a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a>
- <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a>
+ <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( ldda.library_dataset.folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Unuse template</a>
%endif
%endif
%if can_manage:
1
0
galaxy-dist commit 2b8161827380: Move gff_util.py from galaxy/tools/util to galaxy/datatypes/util because gff_utils are now used by the framework as well as tools.
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User jeremy goecks <jeremy.goecks(a)emory.edu>
# Date 1289752184 18000
# Node ID 2b81618273808135efd9409f953161481944fec2
# Parent 98009db17cb2b21db626fc9c185a8fd22109a4cd
Move gff_util.py from galaxy/tools/util to galaxy/datatypes/util because gff_utils are now used by the framework as well as tools.
--- a/tools/new_operations/gops_subtract.py
+++ b/tools/new_operations/gops_subtract.py
@@ -21,7 +21,7 @@ from bx.intervals.io import *
from bx.intervals.operations.subtract import *
from bx.cookbook import doc_optparse
from galaxy.tools.util.galaxyops import *
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
assert sys.version_info[:2] >= ( 2, 4 )
--- a/tools/new_operations/gops_intersect.py
+++ b/tools/new_operations/gops_intersect.py
@@ -21,7 +21,7 @@ from bx.intervals.io import *
from bx.intervals.operations.intersect import *
from bx.cookbook import doc_optparse
from galaxy.tools.util.galaxyops import *
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
assert sys.version_info[:2] >= ( 2, 4 )
--- a/tools/extract/extract_genomic_dna.py
+++ b/tools/extract/extract_genomic_dna.py
@@ -15,7 +15,7 @@ from bx.cookbook import doc_optparse
import bx.seq.nib
import bx.seq.twobit
from galaxy.tools.util.galaxyops import *
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
assert sys.version_info[:2] >= ( 2, 4 )
--- a/lib/galaxy/datatypes/converters/interval_to_interval_index_converter.py
+++ b/lib/galaxy/datatypes/converters/interval_to_interval_index_converter.py
@@ -14,7 +14,7 @@ from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
from galaxy.visualization.tracks.summary import *
from bx.cookbook import doc_optparse
-from galaxy.tools.util.gff_util import convert_gff_coords_to_bed
+from galaxy.datatypes.util.gff_util import convert_gff_coords_to_bed
from bx.interval_index_file import Indexes
def main():
--- a/tools/filters/gff/gff_filter_by_feature_count.py
+++ b/tools/filters/gff/gff_filter_by_feature_count.py
@@ -7,7 +7,7 @@ Usage:
"""
import sys
from galaxy import eggs
-from galaxy.tools.util.gff_util import parse_gff_attributes
+from galaxy.datatypes.util.gff_util import parse_gff_attributes
assert sys.version_info[:2] >= ( 2, 4 )
--- a/tools/filters/gff_to_bed_converter.py
+++ b/tools/filters/gff_to_bed_converter.py
@@ -1,7 +1,7 @@
#!/usr/bin/env python
import sys
from galaxy import eggs
-from galaxy.tools.util.gff_util import parse_gff_attributes
+from galaxy.datatypes.util.gff_util import parse_gff_attributes
assert sys.version_info[:2] >= ( 2, 4 )
--- /dev/null
+++ b/lib/galaxy/datatypes/util/gff_util.py
@@ -0,0 +1,226 @@
+"""
+Provides utilities for working with GFF files.
+"""
+
+from bx.intervals.io import *
+
+class GFFInterval( GenomicInterval ):
+ """
+ A GFF interval, including attributes. If file is strictly a GFF file,
+ only attribute is 'group.'
+ """
+ def __init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, default_strand, \
+ fix_strand=False, raw_line='' ):
+ GenomicInterval.__init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, \
+ default_strand, fix_strand=fix_strand )
+ self.raw_line = raw_line
+ self.attributes = parse_gff_attributes( fields[8] )
+
+class GFFFeature( GenomicInterval ):
+ """
+ A GFF feature, which can include multiple intervals.
+ """
+ def __init__( self, reader, chrom_col, start_col, end_col, strand_col, default_strand, \
+ fix_strand=False, intervals=[] ):
+ GenomicInterval.__init__( self, reader, intervals[0].fields, chrom_col, start_col, end_col, \
+ strand_col, default_strand, fix_strand=fix_strand )
+ self.intervals = intervals
+ # Use intervals to set feature attributes.
+ for interval in self.intervals:
+ # Error checking.
+ if interval.chrom != self.chrom:
+ raise ValueError( "interval chrom does not match self chrom: %i != %i" % \
+ ( interval.chrom, self.chrom ) )
+ if interval.strand != self.strand:
+ raise ValueError( "interval strand does not match self strand: %s != %s" % \
+ ( interval.strand, self.strand ) )
+ # Set start, end of interval.
+ if interval.start < self.start:
+ self.start = interval.start
+ if interval.end > self.end:
+ self.end = interval.end
+
+class GFFIntervalToBEDReaderWrapper( NiceReaderWrapper ):
+ """
+ Reader wrapper that reads GFF intervals/lines and automatically converts
+ them to BED format.
+ """
+
+ def parse_row( self, line ):
+ # HACK: this should return a GFF interval, but bx-python operations
+ # require GenomicInterval objects and subclasses will not work.
+ interval = GenomicInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, \
+ self.end_col, self.strand_col, self.default_strand, \
+ fix_strand=self.fix_strand )
+ interval = convert_gff_coords_to_bed( interval )
+ return interval
+
+class GFFReaderWrapper( NiceReaderWrapper ):
+ """
+ Reader wrapper for GFF files.
+
+ Wrapper has two major functions:
+ (1) group entries for GFF file (via group column), GFF3 (via id attribute ),
+ or GTF (via gene_id/transcript id);
+ (2) convert coordinates from GFF format--starting and ending coordinates
+ are 1-based, closed--to the 'traditional'/BED interval format--0 based,
+ half-open. This is useful when using GFF files as inputs to tools that
+ expect traditional interval format.
+ """
+
+ def __init__( self, reader, **kwargs ):
+ """
+ Create wrapper. Defaults are group_entries=False and
+ convert_coords_to_bed=True to support backward compatibility.
+ """
+ NiceReaderWrapper.__init__( self, reader, **kwargs )
+ self.group_entries = kwargs.get( 'group_entries', False )
+ self.convert_coords_to_bed = kwargs.get( 'convert_coords_to_bed', True )
+ self.last_line = None
+ self.cur_offset = 0
+ self.seed_interval = None
+
+ def parse_row( self, line ):
+ interval = GFFInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, \
+ self.end_col, self.strand_col, self.default_strand, \
+ fix_strand=self.fix_strand, raw_line=line )
+ if self.convert_coords_to_bed:
+ interval = convert_gff_coords_to_bed( interval )
+ return interval
+
+ def next( self ):
+ """ Returns next GFFFeature. """
+
+ #
+ # Helper function.
+ #
+
+ def handle_parse_error( parse_error ):
+ """ Actions to take when ParseError found. """
+ if self.outstream:
+ if self.print_delegate and hasattr(self.print_delegate,"__call__"):
+ self.print_delegate( self.outstream, e, self )
+ self.skipped += 1
+ # no reason to stuff an entire bad file into memmory
+ if self.skipped < 10:
+ self.skipped_lines.append( ( self.linenum, self.current_line, str( e ) ) )
+
+ #
+ # Get next GFFFeature
+ #
+
+ # If there is no seed interval, set one. Also, if there are no more
+ # intervals to read, this is where iterator dies.
+ if not self.seed_interval:
+ while not self.seed_interval:
+ try:
+ self.seed_interval = GenomicIntervalReader.next( self )
+ except ParseError, e:
+ handle_parse_error( e )
+
+ # Initialize feature name from seed.
+ feature_group = self.seed_interval.attributes.get( 'group', None ) # For GFF
+ feature_id = self.seed_interval.attributes.get( 'id', None ) # For GFF3
+ feature_gene_id = self.seed_interval.attributes.get( 'gene_id', None ) # For GTF
+ feature_transcript_id = self.seed_interval.attributes.get( 'transcript_id', None ) # For GTF
+
+ # Read all intervals associated with seed.
+ feature_intervals = []
+ feature_intervals.append( self.seed_interval )
+ while True:
+ try:
+ interval = GenomicIntervalReader.next( self )
+ except StopIteration, e:
+ # No more intervals to read, but last feature needs to be
+ # returned.
+ interval = None
+ break
+ except ParseError, e:
+ handle_parse_error( e )
+
+ # If interval not associated with feature, break.
+ group = interval.attributes.get( 'group', None )
+ if group and feature_group != group:
+ break
+ id = interval.attributes.get( 'id', None )
+ if id and feature_id != id:
+ break
+ gene_id = interval.attributes.get( 'gene_id', None )
+ transcript_id = interval.attributes.get( 'transcript_id', None )
+ if transcript_id and transcript_id != feature_transcript_id and gene_id and \
+ gene_id != feature_gene_id:
+ break
+
+ # Interval associated with feature.
+ feature_intervals.append( interval )
+
+ # Last interval read is the seed for the next interval.
+ self.seed_interval = interval
+
+ # Return GFF feature with all intervals.
+ return GFFFeature( self, self.chrom_col, self.start_col, self.end_col, self.strand_col, \
+ self.default_strand, fix_strand=self.fix_strand, \
+ intervals=feature_intervals )
+
+
+def convert_bed_coords_to_gff( interval ):
+ """
+ Converts an interval object's coordinates from BED format to GFF format.
+ Accepted object types include GenomicInterval and list (where the first
+ element in the list is the interval's start, and the second element is
+ the interval's end).
+ """
+ if type( interval ) is GenomicInterval:
+ interval.start += 1
+ elif type ( interval ) is list:
+ interval[ 0 ] += 1
+ return interval
+
+def convert_gff_coords_to_bed( interval ):
+ """
+ Converts an interval object's coordinates from GFF format to BED format.
+ Accepted object types include GenomicInterval and list (where the first
+ element in the list is the interval's start, and the second element is
+ the interval's end).
+ """
+ if type( interval ) is GenomicInterval:
+ interval.start -= 1
+ elif type ( interval ) is list:
+ interval[ 0 ] -= 1
+ return interval
+
+def parse_gff_attributes( attr_str ):
+ """
+ Parses a GFF/GTF attribute string and returns a dictionary of name-value
+ pairs. The general format for a GFF3 attributes string is
+ name1=value1;name2=value2
+ The general format for a GTF attribute string is
+ name1 "value1" ; name2 "value2"
+ The general format for a GFF attribute string is a single string that
+ denotes the interval's group; in this case, method returns a dictionary
+ with a single key-value pair, and key name is 'group'
+ """
+ attributes_list = attr_str.split(";")
+ attributes = {}
+ for name_value_pair in attributes_list:
+ # Try splitting by space and, if necessary, by '=' sign.
+ pair = name_value_pair.strip().split(" ")
+ if len( pair ) == 1:
+ pair = name_value_pair.strip().split("=")
+ if len( pair ) == 1:
+ # Could not split for some reason -- raise exception?
+ continue
+ if pair == '':
+ continue
+ name = pair[0].strip()
+ if name == '':
+ continue
+ # Need to strip double quote from values
+ value = pair[1].strip(" \"")
+ attributes[ name ] = value
+
+ if len( attributes ) == 0:
+ # Could not split attributes string, so entire string must be
+ # 'group' attribute. This is the case for strictly GFF files.
+ attributes['group'] = attr_str
+ return attributes
--- a/lib/galaxy/datatypes/converters/gff_to_interval_index_converter.py
+++ b/lib/galaxy/datatypes/converters/gff_to_interval_index_converter.py
@@ -12,7 +12,7 @@ from __future__ import division
import sys, fileinput
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
from bx.interval_index_file import Indexes
def main():
--- a/lib/galaxy/datatypes/converters/interval_to_summary_tree_converter.py
+++ b/lib/galaxy/datatypes/converters/interval_to_summary_tree_converter.py
@@ -14,7 +14,7 @@ import pkg_resources; pkg_resources.requ
from galaxy.visualization.tracks.summary import *
from bx.intervals.io import *
from bx.cookbook import doc_optparse
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
def main():
# Read options, args.
--- a/tools/new_operations/flanking_features.py
+++ b/tools/new_operations/flanking_features.py
@@ -18,7 +18,7 @@ from bx.cookbook import doc_optparse
from galaxy.tools.util.galaxyops import *
from bx.intervals.io import *
from bx.intervals.operations import quicksect
-from galaxy.tools.util.gff_util import *
+from galaxy.datatypes.util.gff_util import *
assert sys.version_info[:2] >= ( 2, 4 )
--- a/lib/galaxy/tools/util/gff_util.py
+++ /dev/null
@@ -1,226 +0,0 @@
-"""
-Provides utilities for working with GFF files.
-"""
-
-from bx.intervals.io import *
-
-class GFFInterval( GenomicInterval ):
- """
- A GFF interval, including attributes. If file is strictly a GFF file,
- only attribute is 'group.'
- """
- def __init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, default_strand, \
- fix_strand=False, raw_line='' ):
- GenomicInterval.__init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, \
- default_strand, fix_strand=fix_strand )
- self.raw_line = raw_line
- self.attributes = parse_gff_attributes( fields[8] )
-
-class GFFFeature( GenomicInterval ):
- """
- A GFF feature, which can include multiple intervals.
- """
- def __init__( self, reader, chrom_col, start_col, end_col, strand_col, default_strand, \
- fix_strand=False, intervals=[] ):
- GenomicInterval.__init__( self, reader, intervals[0].fields, chrom_col, start_col, end_col, \
- strand_col, default_strand, fix_strand=fix_strand )
- self.intervals = intervals
- # Use intervals to set feature attributes.
- for interval in self.intervals:
- # Error checking.
- if interval.chrom != self.chrom:
- raise ValueError( "interval chrom does not match self chrom: %i != %i" % \
- ( interval.chrom, self.chrom ) )
- if interval.strand != self.strand:
- raise ValueError( "interval strand does not match self strand: %s != %s" % \
- ( interval.strand, self.strand ) )
- # Set start, end of interval.
- if interval.start < self.start:
- self.start = interval.start
- if interval.end > self.end:
- self.end = interval.end
-
-class GFFIntervalToBEDReaderWrapper( NiceReaderWrapper ):
- """
- Reader wrapper that reads GFF intervals/lines and automatically converts
- them to BED format.
- """
-
- def parse_row( self, line ):
- # HACK: this should return a GFF interval, but bx-python operations
- # require GenomicInterval objects and subclasses will not work.
- interval = GenomicInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, \
- self.end_col, self.strand_col, self.default_strand, \
- fix_strand=self.fix_strand )
- interval = convert_gff_coords_to_bed( interval )
- return interval
-
-class GFFReaderWrapper( NiceReaderWrapper ):
- """
- Reader wrapper for GFF files.
-
- Wrapper has two major functions:
- (1) group entries for GFF file (via group column), GFF3 (via id attribute ),
- or GTF (via gene_id/transcript id);
- (2) convert coordinates from GFF format--starting and ending coordinates
- are 1-based, closed--to the 'traditional'/BED interval format--0 based,
- half-open. This is useful when using GFF files as inputs to tools that
- expect traditional interval format.
- """
-
- def __init__( self, reader, **kwargs ):
- """
- Create wrapper. Defaults are group_entries=False and
- convert_coords_to_bed=True to support backward compatibility.
- """
- NiceReaderWrapper.__init__( self, reader, **kwargs )
- self.group_entries = kwargs.get( 'group_entries', False )
- self.convert_coords_to_bed = kwargs.get( 'convert_coords_to_bed', True )
- self.last_line = None
- self.cur_offset = 0
- self.seed_interval = None
-
- def parse_row( self, line ):
- interval = GFFInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, \
- self.end_col, self.strand_col, self.default_strand, \
- fix_strand=self.fix_strand, raw_line=line )
- if self.convert_coords_to_bed:
- interval = convert_gff_coords_to_bed( interval )
- return interval
-
- def next( self ):
- """ Returns next GFFFeature. """
-
- #
- # Helper function.
- #
-
- def handle_parse_error( parse_error ):
- """ Actions to take when ParseError found. """
- if self.outstream:
- if self.print_delegate and hasattr(self.print_delegate,"__call__"):
- self.print_delegate( self.outstream, e, self )
- self.skipped += 1
- # no reason to stuff an entire bad file into memmory
- if self.skipped < 10:
- self.skipped_lines.append( ( self.linenum, self.current_line, str( e ) ) )
-
- #
- # Get next GFFFeature
- #
-
- # If there is no seed interval, set one. Also, if there are no more
- # intervals to read, this is where iterator dies.
- if not self.seed_interval:
- while not self.seed_interval:
- try:
- self.seed_interval = GenomicIntervalReader.next( self )
- except ParseError, e:
- handle_parse_error( e )
-
- # Initialize feature name from seed.
- feature_group = self.seed_interval.attributes.get( 'group', None ) # For GFF
- feature_id = self.seed_interval.attributes.get( 'id', None ) # For GFF3
- feature_gene_id = self.seed_interval.attributes.get( 'gene_id', None ) # For GTF
- feature_transcript_id = self.seed_interval.attributes.get( 'transcript_id', None ) # For GTF
-
- # Read all intervals associated with seed.
- feature_intervals = []
- feature_intervals.append( self.seed_interval )
- while True:
- try:
- interval = GenomicIntervalReader.next( self )
- except StopIteration, e:
- # No more intervals to read, but last feature needs to be
- # returned.
- interval = None
- break
- except ParseError, e:
- handle_parse_error( e )
-
- # If interval not associated with feature, break.
- group = interval.attributes.get( 'group', None )
- if group and feature_group != group:
- break
- id = interval.attributes.get( 'id', None )
- if id and feature_id != id:
- break
- gene_id = interval.attributes.get( 'gene_id', None )
- transcript_id = interval.attributes.get( 'transcript_id', None )
- if transcript_id and transcript_id != feature_transcript_id and gene_id and \
- gene_id != feature_gene_id:
- break
-
- # Interval associated with feature.
- feature_intervals.append( interval )
-
- # Last interval read is the seed for the next interval.
- self.seed_interval = interval
-
- # Return GFF feature with all intervals.
- return GFFFeature( self, self.chrom_col, self.start_col, self.end_col, self.strand_col, \
- self.default_strand, fix_strand=self.fix_strand, \
- intervals=feature_intervals )
-
-
-def convert_bed_coords_to_gff( interval ):
- """
- Converts an interval object's coordinates from BED format to GFF format.
- Accepted object types include GenomicInterval and list (where the first
- element in the list is the interval's start, and the second element is
- the interval's end).
- """
- if type( interval ) is GenomicInterval:
- interval.start += 1
- elif type ( interval ) is list:
- interval[ 0 ] += 1
- return interval
-
-def convert_gff_coords_to_bed( interval ):
- """
- Converts an interval object's coordinates from GFF format to BED format.
- Accepted object types include GenomicInterval and list (where the first
- element in the list is the interval's start, and the second element is
- the interval's end).
- """
- if type( interval ) is GenomicInterval:
- interval.start -= 1
- elif type ( interval ) is list:
- interval[ 0 ] -= 1
- return interval
-
-def parse_gff_attributes( attr_str ):
- """
- Parses a GFF/GTF attribute string and returns a dictionary of name-value
- pairs. The general format for a GFF3 attributes string is
- name1=value1;name2=value2
- The general format for a GTF attribute string is
- name1 "value1" ; name2 "value2"
- The general format for a GFF attribute string is a single string that
- denotes the interval's group; in this case, method returns a dictionary
- with a single key-value pair, and key name is 'group'
- """
- attributes_list = attr_str.split(";")
- attributes = {}
- for name_value_pair in attributes_list:
- # Try splitting by space and, if necessary, by '=' sign.
- pair = name_value_pair.strip().split(" ")
- if len( pair ) == 1:
- pair = name_value_pair.strip().split("=")
- if len( pair ) == 1:
- # Could not split for some reason -- raise exception?
- continue
- if pair == '':
- continue
- name = pair[0].strip()
- if name == '':
- continue
- # Need to strip double quote from values
- value = pair[1].strip(" \"")
- attributes[ name ] = value
-
- if len( attributes ) == 0:
- # Could not split attributes string, so entire string must be
- # 'group' attribute. This is the case for strictly GFF files.
- attributes['group'] = attr_str
- return attributes
1
0
galaxy-dist commit fd4a22ba5b57: trackster: Make navbar more compact; line things up properly. Fix ReferenceTrack adding extra space to top LabelTrack
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kanwei Li <kanwei(a)gmail.com>
# Date 1289775205 18000
# Node ID fd4a22ba5b57a48a2bed45333c2dfddaec61c359
# Parent 9b2bc4d4d6ca9b1f4275cb335460c8d570c7eeaf
trackster: Make navbar more compact; line things up properly. Fix ReferenceTrack adding extra space to top LabelTrack
--- a/static/scripts/trackster.js
+++ b/static/scripts/trackster.js
@@ -155,8 +155,8 @@ var View = function( container, title, v
if (this.vis_id !== undefined) {
this.hidden_input = $("<input/>").attr("type", "hidden").val(this.vis_id).appendTo(this.chrom_form);
}
- this.zo_link = $("<a/>").click(function() { view.zoom_out(); view.redraw(); }).html('<img src="'+image_path+'/fugue/magnifier-zoom-out.png" />').appendTo(this.chrom_form);
- this.zi_link = $("<a/>").click(function() { view.zoom_in(); view.redraw(); }).html('<img src="'+image_path+'/fugue/magnifier-zoom.png" />').appendTo(this.chrom_form);
+ this.zo_link = $("<a id='zoom-out' />").click(function() { view.zoom_out(); view.redraw(); }).appendTo(this.chrom_form);
+ this.zi_link = $("<a id='zoom-in' />").click(function() { view.zoom_in(); view.redraw(); }).appendTo(this.chrom_form);
$.ajax({
url: chrom_url,
@@ -1039,10 +1039,10 @@ var LineTrack = function ( name, view, d
var min_label = $("<div />").addClass('yaxislabel').attr("id", 'linetrack_' + track_id + '_minval').text(round_1000(track.prefs.min_value));
var max_label = $("<div />").addClass('yaxislabel').attr("id", 'linetrack_' + track_id + '_maxval').text(round_1000(track.prefs.max_value));
- max_label.css({ position: "absolute", top: "22px", left: "10px" });
+ max_label.css({ position: "absolute", top: "24px", left: "10px" });
max_label.prependTo(track.container_div);
- min_label.css({ position: "absolute", top: track.height_px + 11 + "px", left: "10px" });
+ min_label.css({ position: "absolute", top: track.height_px + 12 + "px", left: "10px" });
min_label.prependTo(track.container_div);
});
},
--- a/static/june_2007_style/blue/trackster.css
+++ b/static/june_2007_style/blue/trackster.css
@@ -1,12 +1,14 @@
.viewport-container{overflow-x:hidden;overflow-y:auto;}
-.nav{padding:0 0;color:#333;font-weight:bold;background:#cccccc;background-image:url(panel_header_bg.png);background-position:bottom center;background-repeat:repeat-x;height:2.5em;border-bottom:solid #333 1px;}
+.nav{padding:0 0;color:#333;font-weight:bold;background:#cccccc;background-image:url(panel_header_bg.png);background-position:middle center;background-repeat:repeat-x;border-bottom:solid #333 1px;}
.content{font:10px verdana;}
-.nav-controls{text-align:center;position:relative;padding:2px 0;}
+.nav-controls{text-align:center;padding:1px 0;}
.nav-controls input{margin:0 5px;}
-.nav-controls a{padding:0 0.4em;}
+#zoom-in,#zoom-out{display:inline-block;height:16px;width:16px;margin-bottom:-3px;}
+#zoom-out{background:transparent url(../images/fugue/magnifier-zoom-out.png) center center no-repeat;}
+#zoom-in{margin-left:10px;background:transparent url(../images/fugue/magnifier-zoom.png) center center no-repeat;}
.nav-input{font-size:12px;width:30em;z-index:1000;}
-.location{display:inline-block;width:15em;margin:0px 10px;}
-.draghandle{cursor:move;float:left;background:transparent url(../images/visualization/draggable_horizontal.png) center center no-repeat;width:10px;height:12px;}
+.location{display:inline-block;width:15em;margin:0 10px;}
+.draghandle{margin-top:2px;cursor:move;float:left;background:transparent url(../images/visualization/draggable_horizontal.png) center center no-repeat;width:10px;height:12px;}
.intro{z-index:1000;margin-left:auto;margin-right:auto;color:#555;text-align:center;font-size:16px;}
.overview{width:100%;margin:0px;color:white;}
.overview-viewport{position:relative;height:14px;background:white;margin:0;}
@@ -17,15 +19,16 @@
.viewport-canvas{width:100%;height:100px;}
.yaxislabel{color:#777;z-index:100;}
.line-track .track-content{border-top:1px solid #ddd;border-bottom:1px solid #ddd;}
-.track{background:white;margin-bottom:1px;padding-bottom:4px;border-bottom:#eee solid 1px;}
+.track{background:white;margin-bottom:2px;border-bottom:#eee solid 1px;}
.track-header{text-align:left;padding:4px 0px;color:#666;}
-.track-header .menubutton{margin-left:3px;}
+.track-header .menubutton{margin-left:0px;}
.track-content{overflow:hidden;text-align:center;}
-.track.error .track-content{background-color:#ECB4AF;}
-.track.nodata .track-content{background-color:#ddd;}
+.track.error .track-content{background-color:#ECB4AF;padding:2px 0;}
+.track.nodata .track-content{background-color:#ddd;padding:2px 0;}
.loading{min-height:100px;}
.label-track{font-size:10px;border:none;padding:0;margin:0;height:1.3em;}
.label-track .label{border-left:solid #999 1px;padding:1px;padding-bottom:2px;display:inline-block;}
+.reference-track{border:none;margin:0;padding:0;}
.right-float{float:right;margin-left:5px;}
.top-labeltrack{position:relative;border-bottom:solid #999 1px;}
.nav-labeltrack{border-top:solid #999 1px;border-bottom:solid #333 1px;}
--- a/static/june_2007_style/trackster.css.tmpl
+++ b/static/june_2007_style/trackster.css.tmpl
@@ -4,12 +4,12 @@
}
.nav {
padding: 0 0;
- color:#333;font-weight:bold;
+ color:#333;
+ font-weight:bold;
background:#cccccc;
background-image:url(panel_header_bg.png);
- background-position: bottom center;
+ background-position: middle center;
background-repeat:repeat-x;
- height: 2.5em;
border-bottom: solid #333 1px;
}
.content {
@@ -17,14 +17,23 @@
}
.nav-controls {
text-align: center;
- position: relative;
- padding: 2px 0;
+ padding: 1px 0;
}
.nav-controls input {
margin: 0 5px;
}
-.nav-controls a {
- padding: 0 0.4em;
+#zoom-in, #zoom-out {
+ display:inline-block;
+ height: 16px;
+ width: 16px;
+ margin-bottom: -3px;
+}
+#zoom-out {
+ background: transparent url(../images/fugue/magnifier-zoom-out.png) center center no-repeat;
+}
+#zoom-in {
+ margin-left: 10px;
+ background: transparent url(../images/fugue/magnifier-zoom.png) center center no-repeat;
}
.nav-input {
font-size: 12px;
@@ -34,9 +43,10 @@
.location {
display: inline-block;
width: 15em;
- margin: 0px 10px;
+ margin: 0 10px;
}
.draghandle {
+ margin-top: 2px;
cursor: move;
float: left;
background: transparent url(../images/visualization/draggable_horizontal.png) center center no-repeat;
@@ -120,8 +130,7 @@
/* border-top: solid #DDDDDD 1px; */
/* border-bottom: solid #DDDDDD 1px; */
background: white;
- margin-bottom: 1px;
- padding-bottom: 4px;
+ margin-bottom: 2px;
border-bottom: #eee solid 1px;
}
@@ -132,7 +141,7 @@
}
.track-header .menubutton {
- margin-left: 3px;
+ margin-left: 0px;
}
.track-content {
@@ -142,9 +151,11 @@
.track.error .track-content {
background-color: #ECB4AF;
+ padding: 2px 0;
}
.track.nodata .track-content {
background-color: #ddd;
+ padding: 2px 0;
}
.loading {
@@ -165,6 +176,11 @@
padding-bottom: 2px;
display: inline-block;
}
+.reference-track {
+ border: none;
+ margin: 0;
+ padding: 0;
+}
.right-float {
float: right;
margin-left: 5px;
--- a/static/scripts/packed/trackster.js
+++ b/static/scripts/packed/trackster.js
@@ -1,1 +1,1 @@
-var DENSITY=200,FEATURE_LEVELS=10,MAX_FEATURE_DEPTH=50,CONNECTOR_COLOR="#ccc",DATA_ERROR="There was an error in indexing this dataset.",DATA_NOCONVERTER="A converter for this dataset is not installed. Please check your datatypes_conf.xml file.",DATA_NONE="No data for this chrom/contig.",DATA_PENDING="Currently indexing... please wait",DATA_LOADING="Loading data...",FILTERABLE_CLASS="filterable",CACHED_TILES_FEATURE=10,CACHED_TILES_LINE=5,CACHED_DATA=5,DUMMY_CANVAS=document.createElement("canvas"),RIGHT_STRAND,LEFT_STRAND;if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(DUMMY_CANVAS)}CONTEXT=DUMMY_CANVAS.getContext("2d");PX_PER_CHAR=CONTEXT.measureText("A").width;var right_img=new Image();right_img.src=image_path+"/visualization/strand_right.png";right_img.onload=function(){RIGHT_STRAND=CONTEXT.createPattern(right_img,"repeat")};var left_img=new Image();left_img.src=image_path+"/visualization/strand_left.png";left_img.onload=function(){LEFT_STRAND=CONTEXT.createPa
ttern(left_img,"repeat")};var right_img_inv=new Image();right_img_inv.src=image_path+"/visualization/strand_right_inv.png";right_img_inv.onload=function(){RIGHT_STRAND_INV=CONTEXT.createPattern(right_img_inv,"repeat")};var left_img_inv=new Image();left_img_inv.src=image_path+"/visualization/strand_left_inv.png";left_img_inv.onload=function(){LEFT_STRAND_INV=CONTEXT.createPattern(left_img_inv,"repeat")};function round_1000(a){return Math.round(a*1000)/1000}var Cache=function(a){this.num_elements=a;this.clear()};$.extend(Cache.prototype,{get:function(b){var a=this.key_ary.indexOf(b);if(a!=-1){this.key_ary.splice(a,1);this.key_ary.push(b)}return this.obj_cache[b]},set:function(b,c){if(!this.obj_cache[b]){if(this.key_ary.length>=this.num_elements){var a=this.key_ary.shift();delete this.obj_cache[a]}this.key_ary.push(b)}this.obj_cache[b]=c;return c},clear:function(){this.obj_cache={};this.key_ary=[]}});var View=function(a,d,c,b,e){this.container=a;this.vis_id=c;this.dbkey=b;this.
title=d;this.tracks=[];this.label_tracks=[];this.max_low=0;this.max_high=0;this.num_tracks=0;this.track_id_counter=0;this.zoom_factor=3;this.min_separation=30;this.has_changes=false;this.init(e);this.reset()};$.extend(View.prototype,{init:function(d){var c=this.container,a=this;this.top_container=$("<div/>").addClass("top-container").appendTo(c);this.content_div=$("<div/>").addClass("content").css("position","relative").appendTo(c);this.bottom_container=$("<div/>").addClass("bottom-container").appendTo(c);this.top_labeltrack=$("<div/>").addClass("top-labeltrack").appendTo(this.top_container);this.viewport_container=$("<div/>").addClass("viewport-container").addClass("viewport-container").appendTo(this.content_div);this.intro_div=$("<div/>").addClass("intro").text("Select a chrom from the dropdown below").hide();this.nav_labeltrack=$("<div/>").addClass("nav-labeltrack").appendTo(this.bottom_container);this.nav_container=$("<div/>").addClass("nav-container").prependTo(this.top
_container);this.nav=$("<div/>").addClass("nav").appendTo(this.nav_container);this.overview=$("<div/>").addClass("overview").appendTo(this.bottom_container);this.overview_viewport=$("<div/>").addClass("overview-viewport").appendTo(this.overview);this.overview_close=$("<a href='javascript:void(0);'>Close Overview</a>").addClass("overview-close").hide().appendTo(this.overview_viewport);this.overview_highlight=$("<div />").addClass("overview-highlight").hide().appendTo(this.overview_viewport);this.overview_box_background=$("<div/>").addClass("overview-boxback").appendTo(this.overview_viewport);this.overview_box=$("<div/>").addClass("overview-box").appendTo(this.overview_viewport);this.default_overview_height=this.overview_box.height();this.nav_controls=$("<div/>").addClass("nav-controls").appendTo(this.nav);this.chrom_form=$("<form/>").attr("action",function(){}).appendTo(this.nav_controls);this.chrom_select=$("<select/>").attr({name:"chrom"}).css("width","15em").addClass("no-a
utocomplete").append("<option value=''>Loading</option>").appendTo(this.chrom_form);var b=function(f){if(f.type==="focusout"||(f.keyCode||f.which)===13||(f.keyCode||f.which)===27){if((f.keyCode||f.which)!==27){a.go_to($(this).val())}$(this).hide();a.location_span.show();a.chrom_select.show();return false}};this.nav_input=$("<input/>").addClass("nav-input").hide().bind("keypress focusout",b).appendTo(this.chrom_form);this.location_span=$("<span/>").addClass("location").appendTo(this.chrom_form);this.location_span.bind("click",function(){a.location_span.hide();a.chrom_select.hide();a.nav_input.css("display","inline-block");a.nav_input.select();a.nav_input.focus()});if(this.vis_id!==undefined){this.hidden_input=$("<input/>").attr("type","hidden").val(this.vis_id).appendTo(this.chrom_form)}this.zo_link=$("<a/>").click(function(){a.zoom_out();a.redraw()}).html('<img src="'+image_path+'/fugue/magnifier-zoom-out.png" />').appendTo(this.chrom_form);this.zi_link=$("<a/>").click(funct
ion(){a.zoom_in();a.redraw()}).html('<img src="'+image_path+'/fugue/magnifier-zoom.png" />').appendTo(this.chrom_form);$.ajax({url:chrom_url,data:(this.vis_id!==undefined?{vis_id:this.vis_id}:{dbkey:this.dbkey}),dataType:"json",success:function(f){if(f.reference){a.add_label_track(new ReferenceTrack(a))}a.chrom_data=f.chrom_info;var j='<option value="">Select Chrom/Contig</option>';for(var h=0,e=a.chrom_data.length;h<e;h++){var g=a.chrom_data[h].chrom;j+='<option value="'+g+'">'+g+"</option>"}a.chrom_select.html(j);a.intro_div.show();a.chrom_select.bind("change",function(){a.change_chrom(a.chrom_select.val())});if(d){d()}},error:function(){alert("Could not load chroms for this dbkey:",a.dbkey)}});this.content_div.bind("dblclick",function(f){a.zoom_in(f.pageX,this.viewport_container)});this.overview_box.bind("dragstart",function(f){this.current_x=f.offsetX}).bind("drag",function(f){var h=f.offsetX-this.current_x;this.current_x=f.offsetX;var g=Math.round(h/a.viewport_container
.width()*(a.max_high-a.max_low));a.move_delta(-g)});this.overview_close.bind("click",function(){for(var f=0,e=a.tracks.length;f<e;f++){a.tracks[f].is_overview=false}$(this).siblings().filter("canvas").remove();$(this).parent().css("height",a.overview_box.height());a.overview_highlight.hide();$(this).hide()});this.viewport_container.bind("dragstart",function(f){this.original_low=a.low;this.current_height=f.clientY;this.current_x=f.offsetX;this.enable_pan=(f.clientX<a.viewport_container.width()-16)?true:false}).bind("drag",function(h){if(!this.enable_pan||this.in_reordering){return}var f=$(this);var j=h.offsetX-this.current_x;var g=f.scrollTop()-(h.clientY-this.current_height);f.scrollTop(g);this.current_height=h.clientY;this.current_x=h.offsetX;var i=Math.round(j/a.viewport_container.width()*(a.high-a.low));a.move_delta(i)});this.top_labeltrack.bind("dragstart",function(f){this.drag_origin_x=f.clientX;this.drag_origin_pos=f.clientX/a.viewport_container.width()*(a.high-a.low)+
a.low;this.drag_div=$("<div />").css({height:a.content_div.height()+a.top_labeltrack.height()+a.nav_labeltrack.height(),top:"0px",position:"absolute","background-color":"#ccf",opacity:0.5,"z-index":1000}).appendTo($(this))}).bind("drag",function(j){var g=Math.min(j.clientX,this.drag_origin_x)-a.container.offset().left,f=Math.max(j.clientX,this.drag_origin_x)-a.container.offset().left,i=(a.high-a.low),h=a.viewport_container.width();a.update_location(Math.round(g/h*i)+a.low,Math.round(f/h*i)+a.low);this.drag_div.css({left:g+"px",width:(f-g)+"px"})}).bind("dragend",function(k){var g=Math.min(k.clientX,this.drag_origin_x),f=Math.max(k.clientX,this.drag_origin_x),i=(a.high-a.low),h=a.viewport_container.width(),j=a.low;a.low=Math.round(g/h*i)+j;a.high=Math.round(f/h*i)+j;this.drag_div.remove();a.redraw()});this.add_label_track(new LabelTrack(this,this.top_labeltrack));this.add_label_track(new LabelTrack(this,this.nav_labeltrack));$(window).bind("resize",function(){a.resize_window(
)});$(document).bind("redraw",function(){a.redraw()});this.reset();$(window).trigger("resize")},update_location:function(a,b){this.location_span.text(commatize(a)+" - "+commatize(b));this.nav_input.val(this.chrom+":"+commatize(a)+"-"+commatize(b))},change_chrom:function(e,b,g){var d=this;var f=$.grep(d.chrom_data,function(j,k){return j.chrom===e})[0];if(f===undefined){return}if(e!==d.chrom){d.chrom=e;if(!d.chrom){d.intro_div.show()}else{d.intro_div.hide()}d.chrom_select.val(d.chrom);d.max_high=f.len;d.reset();d.redraw(true);for(var h=0,a=d.tracks.length;h<a;h++){var c=d.tracks[h];if(c.init){c.init()}}}if(b!==undefined&&g!==undefined){d.low=Math.max(b,0);d.high=Math.min(g,d.max_high)}d.reset_overview();d.redraw()},go_to:function(f){var j=this,a,d,b=f.split(":"),h=b[0],i=b[1];if(i!==undefined){try{var g=i.split("-");a=parseInt(g[0].replace(/,/g,""),10);d=parseInt(g[1].replace(/,/g,""),10)}catch(c){return false}}j.change_chrom(h,a,d)},move_fraction:function(c){var a=this;var b=
a.high-a.low;this.move_delta(c*b)},move_delta:function(c){var a=this;var b=a.high-a.low;if(a.low-c<a.max_low){a.low=a.max_low;a.high=a.max_low+b}else{if(a.high-c>a.max_high){a.high=a.max_high;a.low=a.max_high-b}else{a.high-=c;a.low-=c}}a.redraw()},add_track:function(a){a.view=this;a.track_id=this.track_id_counter;this.tracks.push(a);if(a.init){a.init()}a.container_div.attr("id","track_"+a.track_id);this.track_id_counter+=1;this.num_tracks+=1},add_label_track:function(a){a.view=this;this.label_tracks.push(a)},remove_track:function(a){this.has_changes=true;a.container_div.fadeOut("slow",function(){$(this).remove()});delete this.tracks[this.tracks.indexOf(a)];this.num_tracks-=1},reset:function(){this.low=this.max_low;this.high=this.max_high;this.viewport_container.find(".yaxislabel").remove()},redraw:function(h){var g=this.high-this.low,f=this.low,b=this.high;if(f<this.max_low){f=this.max_low}if(b>this.max_high){b=this.max_high}if(this.high!==0&&g<this.min_separation){b=f+this.
min_separation}this.low=Math.floor(f);this.high=Math.ceil(b);this.resolution=Math.pow(10,Math.ceil(Math.log((this.high-this.low)/200)/Math.LN10));this.zoom_res=Math.pow(FEATURE_LEVELS,Math.max(0,Math.ceil(Math.log(this.resolution,FEATURE_LEVELS)/Math.log(FEATURE_LEVELS))));var a=(this.low/(this.max_high-this.max_low)*this.overview_viewport.width())||0;var e=((this.high-this.low)/(this.max_high-this.max_low)*this.overview_viewport.width())||0;var j=13;this.overview_box.css({left:a,width:Math.max(j,e)}).show();if(e<j){this.overview_box.css("left",a-(j-e)/2)}if(this.overview_highlight){this.overview_highlight.css({left:a,width:e})}this.update_location(this.low,this.high);if(!h){for(var c=0,d=this.tracks.length;c<d;c++){if(this.tracks[c]&&this.tracks[c].enabled){this.tracks[c].draw()}}for(c=0,d=this.label_tracks.length;c<d;c++){this.label_tracks[c].draw()}}},zoom_in:function(b,c){if(this.max_high===0||this.high-this.low<this.min_separation){return}var d=this.high-this.low,e=d/2+
this.low,a=(d/this.zoom_factor)/2;if(b){e=b/this.viewport_container.width()*(this.high-this.low)+this.low}this.low=Math.round(e-a);this.high=Math.round(e+a);this.redraw()},zoom_out:function(){if(this.max_high===0){return}var b=this.high-this.low,c=b/2+this.low,a=(b*this.zoom_factor)/2;this.low=Math.round(c-a);this.high=Math.round(c+a);this.redraw()},resize_window:function(){this.viewport_container.height(this.container.height()-this.top_container.height()-this.bottom_container.height());this.nav_container.width(this.container.width());this.redraw()},reset_overview:function(){this.overview_viewport.find("canvas").remove();this.overview_viewport.height(this.default_overview_height);this.overview_box.height(this.default_overview_height);this.overview_close.hide();this.overview_highlight.hide()}});var Filter=function(b,a,c){this.name=b;this.index=a;this.value=c};var NumberFilter=function(b,a){this.name=b;this.index=a;this.low=-Number.MAX_VALUE;this.high=Number.MAX_VALUE;this.sli
der_min=Number.MAX_VALUE;this.slider_max=-Number.MAX_VALUE;this.slider=null;this.slider_label=null};$.extend(NumberFilter.prototype,{applies_to:function(a){if(a.length>this.index){return true}return false},keep:function(a){if(!this.applies_to(a)){return true}return(a[this.index]>=this.low&&a[this.index]<=this.high)},update_attrs:function(b){var a=false;if(!this.applies_to(b)){return a}if(b[this.index]<this.slider_min){this.slider_min=b[this.index];a=true}if(b[this.index]>this.slider_max){this.slider_max=b[this.index];a=false}return a},update_ui_elt:function(){var b=this.slider.slider("option","min"),a=this.slider.slider("option","max");if(this.slider_min<b||this.slider_max>a){this.slider.slider("option","min",this.slider_min);this.slider.slider("option","max",this.slider_max);this.slider.slider("option","values",[this.slider_min,this.slider_max])}}});var get_filters=function(a){var g=[];for(var d=0;d<a.length;d++){var f=a[d];var c=f.name,e=f.type,b=f.index;if(e=="int"||e=="f
loat"){g[d]=new NumberFilter(c,b)}else{g[d]=new Filter(c,b,e)}}return g};var Track=function(b,a,d,c){this.name=b;this.view=a;this.parent_element=d;this.filters=(c!==undefined?get_filters(c):[]);this.init_global()};$.extend(Track.prototype,{init_global:function(){this.container_div=$("<div />").addClass("track").css("position","relative");if(!this.hidden){this.header_div=$("<div class='track-header' />").appendTo(this.container_div);if(this.view.editor){this.drag_div=$("<div class='draghandle' />").appendTo(this.header_div)}this.name_div=$("<div class='menubutton popup' />").appendTo(this.header_div);this.name_div.text(this.name);this.name_div.attr("id",this.name.replace(/\s+/g,"-").replace(/[^a-zA-Z0-9\-]/g,"").toLowerCase())}this.filtering_div=$("<div class='track-filters'>").appendTo(this.container_div);this.filtering_div.hide();this.filtering_div.bind("drag",function(i){i.stopPropagation()});var b=$("<table class='filters'>").appendTo(this.filtering_div);var c=this;for(va
r e=0;e<this.filters.length;e++){var a=this.filters[e];var f=$("<tr>").appendTo(b);var g=$("<th class='filter-info'>").appendTo(f);var j=$("<span class='name'>").appendTo(g);j.text(a.name+" ");var d=$("<span class='values'>").appendTo(g);var h=$("<td>").appendTo(f);a.control_element=$("<div id='"+a.name+"-filter-control' style='width: 200px; position: relative'>").appendTo(h);a.control_element.slider({range:true,min:Number.MAX_VALUE,max:-Number.MIN_VALUE,values:[0,0],slide:function(k,l){var i=l.values;d.text("["+i[0]+"-"+i[1]+"]");a.low=i[0];a.high=i[1];c.draw(true)},change:function(i,k){a.control_element.slider("option","slide").call(a.control_element,i,k)}});a.slider=a.control_element;a.slider_label=d}this.content_div=$("<div class='track-content'>").appendTo(this.container_div);this.parent_element.append(this.container_div)},init_each:function(c,b){var a=this;a.enabled=false;a.data_queue={};a.tile_cache.clear();a.data_cache.clear();a.initial_canvas=undefined;a.content_di
v.css("height","auto");if(!a.content_div.text()){a.content_div.text(DATA_LOADING)}a.container_div.removeClass("nodata error pending");if(a.view.chrom){$.getJSON(data_url,c,function(d){if(!d||d==="error"||d.kind==="error"){a.container_div.addClass("error");a.content_div.text(DATA_ERROR);if(d.message){var f=a.view.tracks.indexOf(a);var e=$("<a href='javascript:void(0);'></a>").attr("id",f+"_error");e.text("Click to view error");$("#"+f+"_error").live("click",function(){show_modal("Trackster Error","<pre>"+d.message+"</pre>",{Close:hide_modal})});a.content_div.append(e)}}else{if(d==="no converter"){a.container_div.addClass("error");a.content_div.text(DATA_NOCONVERTER)}else{if(d.data!==undefined&&(d.data===null||d.data.length===0)){a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}else{if(d==="pending"){a.container_div.addClass("pending");a.content_div.text(DATA_PENDING);setTimeout(function(){a.init()},5000)}else{a.content_div.text("");a.content_div.css("height",a
.height_px+"px");a.enabled=true;b(d);a.draw()}}}}})}else{a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}}});var TiledTrack=function(){var b=this,j=b.view;if(b.hidden){return}if(b.display_modes!==undefined){if(b.mode_div===undefined){b.mode_div=$("<div class='right-float menubutton popup' />").appendTo(b.header_div);var e=b.display_modes[0];b.mode=e;b.mode_div.text(e);var c=function(i){b.mode_div.text(i);b.mode=i;b.tile_cache.clear();b.draw()};var a={};for(var f=0,h=b.display_modes.length;f<h;f++){var g=b.display_modes[f];a[g]=function(i){return function(){c(i)}}(g)}make_popupmenu(b.mode_div,a)}else{b.mode_div.hide()}}var d={};d["Set as overview"]=function(){j.overview_viewport.find("canvas").remove();b.is_overview=true;b.set_overview();for(var i in j.tracks){if(j.tracks[i]!==b){j.tracks[i].is_overview=false}}};d["Edit configuration"]=function(){var l=function(){hide_modal();$(window).unbind("keypress.check_enter_esc")},i=function(){b.update_options(b.track_
id);hide_modal();$(window).unbind("keypress.check_enter_esc")},k=function(m){if((m.keyCode||m.which)===27){l()}else{if((m.keyCode||m.which)===13){i()}}};$(window).bind("keypress.check_enter_esc",k);show_modal("Configure Track",b.gen_options(b.track_id),{Cancel:l,OK:i})};if(b.filters.length>0){d["Show filters"]=function(){var i;if(!b.filtering_div.is(":visible")){i="Hide filters";b.filters_visible=true}else{i="Show filters";b.filters_visible=false}$("#"+b.name_div.attr("id")+"-menu").find("li").eq(2).text(i);b.filtering_div.toggle()}}d.Remove=function(){j.remove_track(b);if(j.num_tracks===0){$("#no-tracks").show()}};b.popup_menu=make_popupmenu(b.name_div,d);show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters",false)};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(a){var k=this.view.low,g=this.view.high,h=g-k,f=this.view.resolution;var n=$("<div style='position: relative;'></div>"),o=this.content_div.width()/h;this.content_div.append(n);this.max_height=
0;var b=Math.floor(k/f/DENSITY);var j={};while((b*DENSITY*f)<g){var l=this.content_div.width()+"_"+o+"_"+b;var e=this.tile_cache.get(l);if(!a&&e){var i=b*DENSITY*f;var d=(i-k)*o;if(this.left_offset){d-=this.left_offset}e.css({left:d});this.show_tile(e,n)}else{this.delayed_draw(this,l,k,g,b,f,n,o,j)}b+=1}var c=this;var m=setInterval(function(){if(obj_length(j)===0){if(c.content_div.children().length>1){c.content_div.children(":first").remove()}for(var p=0;p<c.filters.length;p++){c.filters[p].update_ui_elt()}clearInterval(m)}},50)},delayed_draw:function(c,h,g,e,b,d,i,j,f){var a=setTimeout(function(){if(g<=c.view.high&&e>=c.view.low){var k=c.draw_tile(d,b,i,j);if(k){if(!c.initial_canvas&&!window.G_vmlCanvasManager){c.initial_canvas=$(k).clone();var n=k.get(0).getContext("2d");var l=c.initial_canvas.get(0).getContext("2d");var m=n.getImageData(0,0,n.canvas.width,n.canvas.height);l.putImageData(m,0,0);c.set_overview()}c.tile_cache.set(h,k);c.show_tile(k,i)}}delete f[a]},50);f[a]=
true},show_tile:function(a,c){var b=this;c.append(a);b.max_height=Math.max(b.max_height,a.height());b.content_div.css("height",b.max_height+"px");if(a.hasClass(FILTERABLE_CLASS)){show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters");if(b.filters_visible){b.filtering_div.show()}}else{show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters",false);b.filtering_div.hide()}},set_overview:function(){var a=this.view;if(this.initial_canvas&&this.is_overview){a.overview_close.show();a.overview_viewport.append(this.initial_canvas);a.overview_highlight.show().height(this.initial_canvas.height());a.overview_viewport.height(this.initial_canvas.height()+a.overview_box.height())}$(window).trigger("resize")}});var LabelTrack=function(a,b){this.track_type="LabelTrack";this.hidden=true;Track.call(this,null,a,b);this.container_div.addClass("label-track")};$.extend(LabelTrack.prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.
floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div style='position: relative; height: 1.3em;'></div>");while(a<c.high){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+commatize(a)+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.append(b)}});var ReferenceTrack=function(a){this.track_type="ReferenceTrack";this.hidden=true;Track.call(this,null,a,a.top_labeltrack);TiledTrack.call(this);this.left_offset=200;this.height_px=12;this.container_div.addClass("reference-track");this.data_queue={};this.data_cache=new Cache(CACHED_DATA);this.tile_cache=new Cache(CACHED_TILES_LINE)};$.extend(ReferenceTrack.prototype,TiledTrack.prototype,{get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;if(!c.data_queue[e]){c.data_queue[e]=true;$.ajax({url:reference_url,dataType:"json",data:{chrom:this.view.chrom,low:a,high:f,dbkey:this.view.dbkey},success:function(g)
{c.data_cache.set(e,g);delete c.data_queue[e];c.draw()},error:function(h,g,i){console.log(h,g,i)}})}},draw_tile:function(f,b,k,o){var g=b*DENSITY*f,d=DENSITY*f,j=f+"_"+b;var e=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(e)}e=$(e);var n=e.get(0).getContext("2d");if(o>PX_PER_CHAR){if(this.data_cache.get(j)===undefined){this.get_data(f,b);return}var m=this.data_cache.get(j);if(m===null){this.content_div.css("height","0px");return}e.get(0).width=Math.ceil(d*o+this.left_offset);e.get(0).height=this.height_px;e.css({position:"absolute",top:0,left:(g-this.view.low)*o-this.left_offset});for(var h=0,l=m.length;h<l;h++){var a=Math.round(h*o),i=Math.round(o/2);n.fillText(m[h],a+this.left_offset+i,10)}k.append(e);return e}this.content_div.css("height","0px")}});var LineTrack=function(d,b,a,c){this.track_type="LineTrack";this.display_modes=["Histogram","Line","Filled","Intensity"];this.mode="Histogram";Track.call(this,d,b,b.viewport_conta
iner);TiledTrack.call(this);this.height_px=80;this.dataset_id=a;this.data_cache=new Cache(CACHED_DATA);this.tile_cache=new Cache(CACHED_TILES_LINE);this.prefs={color:"black",min_value:undefined,max_value:undefined,mode:this.mode}};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:function(){var a=this,b=a.view.tracks.indexOf(a);a.vertical_range=undefined;this.init_each({stats:true,chrom:a.view.chrom,low:null,high:null,dataset_id:a.dataset_id},function(c){a.container_div.addClass("line-track");var e=c.data;if(isNaN(parseFloat(a.prefs.min_value))||isNaN(parseFloat(a.prefs.max_value))){a.prefs.min_value=e.min;a.prefs.max_value=e.max;$("#track_"+b+"_minval").val(a.prefs.min_value);$("#track_"+b+"_maxval").val(a.prefs.max_value)}a.vertical_range=a.prefs.max_value-a.prefs.min_value;a.total_frequency=e.total_frequency;a.container_div.find(".yaxislabel").remove();var f=$("<div />").addClass("yaxislabel").attr("id","linetrack_"+b+"_minval").text(round_1000(a.prefs.min_value));v
ar d=$("<div />").addClass("yaxislabel").attr("id","linetrack_"+b+"_maxval").text(round_1000(a.prefs.max_value));d.css({position:"absolute",top:"22px",left:"10px"});d.prependTo(a.container_div);f.css({position:"absolute",top:a.height_px+11+"px",left:"10px"});f.prependTo(a.container_div)})},get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;if(!c.data_queue[e]){c.data_queue[e]=true;$.ajax({url:data_url,dataType:"json",data:{chrom:this.view.chrom,low:a,high:f,dataset_id:this.dataset_id,resolution:this.view.resolution},success:function(g){var h=g.data;c.data_cache.set(e,h);delete c.data_queue[e];c.draw()},error:function(h,g,i){console.log(h,g,i)}})}},draw_tile:function(o,r,c,e){if(this.vertical_range===undefined){return}var s=r*DENSITY*o,a=DENSITY*o,w=o+"_"+r;var b=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(b)}b=$(b);if(this.data_cache.get(w)===undefined){this.get_data(o,r);return}var v=this.data_cache.
get(w);if(!v){return}b.css({position:"absolute",top:0,left:(s-this.view.low)*e});b.get(0).width=Math.ceil(a*e);b.get(0).height=this.height_px;var n=b.get(0).getContext("2d"),j=false,k=this.prefs.min_value,g=this.prefs.max_value,m=this.vertical_range,t=this.total_frequency,d=this.height_px,l=this.mode;n.beginPath();n.fillStyle=this.prefs.color;var u,h,f;if(v.length>1){f=Math.ceil((v[1][0]-v[0][0])*e)}else{f=10}for(var p=0,q=v.length;p<q;p++){u=Math.round((v[p][0]-s)*e);h=v[p][1];if(h===null){if(j&&l==="Filled"){n.lineTo(u,d)}j=false;continue}if(h<k){h=k}else{if(h>g){h=g}}if(l==="Histogram"){h=Math.round(d-(h-k)/m*d);n.fillRect(u,h,f,d-h)}else{if(l==="Intensity"){h=255-Math.floor((h-k)/m*255);n.fillStyle="rgb("+h+","+h+","+h+")";n.fillRect(u,0,f,d)}else{h=Math.round(d-(h-k)/m*d);if(j){n.lineTo(u,h)}else{j=true;if(l==="Filled"){n.moveTo(u,d);n.lineTo(u,h)}else{n.moveTo(u,h)}}}}}if(l==="Filled"){if(j){n.lineTo(u,d)}n.fill()}else{n.stroke()}c.append(b);return b},gen_options:funct
ion(m){var a=$("<div />").addClass("form-row");var e="track_"+m+"_color",b=$("<label />").attr("for",e).text("Color:"),c=$("<input />").attr("id",e).attr("name",e).val(this.prefs.color),h="track_"+m+"_minval",l=$("<label></label>").attr("for",h).text("Min value:"),d=(this.prefs.min_value===undefined?"":this.prefs.min_value),k=$("<input></input>").attr("id",h).val(d),j="track_"+m+"_maxval",g=$("<label></label>").attr("for",j).text("Max value:"),i=(this.prefs.max_value===undefined?"":this.prefs.max_value),f=$("<input></input>").attr("id",j).val(i);return a.append(l).append(k).append(g).append(f).append(b).append(c)},update_options:function(d){var a=$("#track_"+d+"_minval").val(),c=$("#track_"+d+"_maxval").val(),b=$("#track_"+d+"_color").val();if(a!==this.prefs.min_value||c!==this.prefs.max_value||b!==this.prefs.color){this.prefs.min_value=parseFloat(a);this.prefs.max_value=parseFloat(c);this.prefs.color=b;this.vertical_range=this.prefs.max_value-this.prefs.min_value;$("#linetr
ack_"+d+"_minval").text(this.prefs.min_value);$("#linetrack_"+d+"_maxval").text(this.prefs.max_value);this.tile_cache.clear();this.draw()}}});var FeatureTrack=function(d,b,a,e,c){this.track_type="FeatureTrack";this.display_modes=["Auto","Dense","Squish","Pack"];Track.call(this,d,b,b.viewport_container,e);TiledTrack.call(this);this.height_px=0;this.container_div.addClass("feature-track");this.dataset_id=a;this.zo_slots={};this.show_labels_scale=0.001;this.showing_details=false;this.vertical_detail_px=10;this.vertical_nodetail_px=3;this.summary_draw_height=30;this.default_font="9px Monaco, Lucida Console, monospace";this.inc_slots={};this.data_queue={};this.s_e_by_tile={};this.tile_cache=new Cache(CACHED_TILES_FEATURE);this.data_cache=new Cache(20);this.left_offset=200;this.prefs={block_color:"#444",label_color:"black",show_counts:true}};$.extend(FeatureTrack.prototype,TiledTrack.prototype,{init:function(){var a=this,b="initial";this.init_each({low:a.view.max_low,high:a.view.m
ax_high,dataset_id:a.dataset_id,chrom:a.view.chrom,resolution:this.view.resolution,mode:a.mode},function(c){a.mode_div.show();a.data_cache.set(b,c);a.draw()})},get_data:function(a,d){var b=this,c=a+"_"+d;if(!b.data_queue[c]){b.data_queue[c]=true;$.getJSON(data_url,{chrom:b.view.chrom,low:a,high:d,dataset_id:b.dataset_id,resolution:this.view.resolution,mode:this.mode},function(e){b.data_cache.set(c,e);delete b.data_queue[c];b.draw()})}},incremental_slots:function(a,g,b,q){if(!this.inc_slots[a]){this.inc_slots[a]={};this.inc_slots[a].w_scale=a;this.inc_slots[a].mode=q;this.s_e_by_tile[a]={}}var m=this.inc_slots[a].w_scale,y=[],h=0,n=this.view.max_low;var A=[];if(this.inc_slots[a].mode!==q){delete this.inc_slots[a];this.inc_slots[a]={mode:q,w_scale:m};delete this.s_e_by_tile[a];this.s_e_by_tile[a]={}}for(var v=0,w=g.length;v<w;v++){var f=g[v],l=f[0];if(this.inc_slots[a][l]!==undefined){h=Math.max(h,this.inc_slots[a][l]);A.push(this.inc_slots[a][l])}else{y.push(v)}}for(var v=0,w
=y.length;v<w;v++){var f=g[y[v]],l=f[0],r=f[1],c=f[2],p=f[3],d=Math.floor((r-n)*m),e=Math.ceil((c-n)*m);if(p!==undefined&&!b){var s=CONTEXT.measureText(p).width;if(d-s<0){e+=s}else{d-=s}}var u=0;while(u<=MAX_FEATURE_DEPTH){var o=true;if(this.s_e_by_tile[a][u]!==undefined){for(var t=0,z=this.s_e_by_tile[a][u].length;t<z;t++){var x=this.s_e_by_tile[a][u][t];if(e>x[0]&&d<x[1]){o=false;break}}}if(o){if(this.s_e_by_tile[a][u]===undefined){this.s_e_by_tile[a][u]=[]}this.s_e_by_tile[a][u].push([d,e]);this.inc_slots[a][l]=u;h=Math.max(h,u);break}u++}}return h},rect_or_text:function(r,l,t,b,q,f,i,e){r.textAlign="center";var k=0,p=Math.round(l/2);for(var m=0,s=i.length;m<s;m++){var j=i[m],d="MIDNSHP"[j[0]],n=j[1];if(d==="H"||d==="S"){k-=n}var g=q+k,w=Math.floor(Math.max(0,(g-t)*l)),h=Math.floor(Math.max(0,(g+n-t)*l));switch(d){case"S":case"H":case"M":var o=f.slice(k,n);if((this.mode==="Pack"||this.mode==="Auto")&&f!==undefined&&l>PX_PER_CHAR){r.fillStyle=this.prefs.block_color;r.fillR
ect(w+this.left_offset,e+1,h-w,9);r.fillStyle=CONNECTOR_COLOR;for(var u=0,a=o.length;u<a;u++){if(g+u>=t&&g+u<=b){var v=Math.floor(Math.max(0,(g+u-t)*l));r.fillText(o[u],v+this.left_offset+p,e+9)}}}else{r.fillStyle=this.prefs.block_color;r.fillRect(w+this.left_offset,e+4,h-w,3)}break;case"N":r.fillStyle=CONNECTOR_COLOR;r.fillRect(w+this.left_offset,e+5,h-w,1);break;case"D":r.fillStyle="red";r.fillRect(w+this.left_offset,e+4,h-w,3);break;case"P":case"I":break}k+=n}},draw_tile:function(ag,o,s,av){var N=o*DENSITY*ag,al=(o+1)*DENSITY*ag,M=al-N;var an=(!this.initial_canvas?"initial":N+"_"+al);var I=this.data_cache.get(an);var e;if(I===undefined||(this.mode!=="Auto"&&I.dataset_type==="summary_tree")){this.data_queue[[N,al]]=true;this.get_data(N,al);return}var a=Math.ceil(M*av),ai=this.prefs.label_color,l=this.prefs.block_color,r=this.mode,z=25,ae=(r==="Squish")||(r==="Dense")&&(r!=="Pack")||(r==="Auto"&&(I.extra_info==="no_detail")),W=this.left_offset,au,D,aw;var q=document.createE
lement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(q)}q=$(q);if(I.dataset_type==="summary_tree"){D=this.summary_draw_height}else{if(r==="Dense"){D=z;aw=10}else{aw=(ae?this.vertical_nodetail_px:this.vertical_detail_px);var A=(av<0.0001?1/this.view.zoom_res:av);D=this.incremental_slots(A,I.data,ae,r)*aw+z;au=this.inc_slots[A]}}q.css({position:"absolute",top:0,left:(N-this.view.low)*av-W});q.get(0).width=a+W;q.get(0).height=D;s.parent().css("height",Math.max(this.height_px,D)+"px");var J=q.get(0).getContext("2d");J.fillStyle=l;J.font=this.default_font;J.textAlign="right";this.container_div.find(".yaxislabel").remove();if(I.dataset_type=="summary_tree"){var Y=I.data,L=I.max,b=Math.ceil(I.delta*av);var p=$("<div />").addClass("yaxislabel").text(L);p.css({position:"absolute",top:"22px",left:"10px"});p.prependTo(this.container_div);for(var ap=0,H=Y.length;ap<H;ap++){var aa=Math.floor((Y[ap][0]-N)*av);var Z=Y[ap][1];if(!Z){continue}var am=Z/L*this.summary_
draw_height;J.fillStyle="black";J.fillRect(aa+W,this.summary_draw_height-am,b,am);if(this.prefs.show_counts&&J.measureText(Z).width<b){J.fillStyle="#bbb";J.textAlign="center";J.fillText(Z,aa+W+(b/2),this.summary_draw_height-5)}}e="Summary";s.append(q);return q}if(I.message){q.css({border:"solid red","border-width":"2px 2px 2px 0px"});J.fillStyle="red";J.textAlign="left";J.fillText(I.message,100+W,aw)}var ad=false;if(I.data){ad=true;for(var ar=0;ar<this.filters.length;ar++){if(!this.filters[ar].applies_to(I.data[0])){ad=false}}}if(ad){q.addClass(FILTERABLE_CLASS)}var at=I.data;var ao=0;for(var ap=0,H=at.length;ap<H;ap++){var S=at[ap],R=S[0],aq=S[1],ac=S[2],O=S[3];if(au[R]===undefined){continue}var ab=false;var U;for(var ar=0;ar<this.filters.length;ar++){U=this.filters[ar];U.update_attrs(S);if(!U.keep(S)){ab=true;break}}if(ab){continue}if(aq<=al&&ac>=N){var af=Math.floor(Math.max(0,(aq-N)*av)),K=Math.ceil(Math.min(a,Math.max(0,(ac-N)*av))),X=(r==="Dense"?1:(1+au[R]))*aw;var G,
aj,P=null,ax=null;if(I.dataset_type==="bai"){var v=S[4];J.fillStyle=l;if(S[5] instanceof Array){var E=Math.floor(Math.max(0,(S[5][0]-N)*av)),Q=Math.ceil(Math.min(a,Math.max(0,(S[5][1]-N)*av))),C=Math.floor(Math.max(0,(S[6][0]-N)*av)),w=Math.ceil(Math.min(a,Math.max(0,(S[6][1]-N)*av)));if(S[5][1]>=N&&S[5][0]<=al){this.rect_or_text(J,av,N,al,S[5][0],S[5][2],v,X)}if(S[6][1]>=N&&S[6][0]<=al){this.rect_or_text(J,av,N,al,S[6][0],S[6][2],v,X)}if(C>Q){J.fillStyle=CONNECTOR_COLOR;J.fillRect(Q+W,X+5,C-Q,1)}}else{J.fillStyle=l;this.rect_or_text(J,av,N,al,aq,O,v,X)}if(r!=="Dense"&&!ae&&aq>N){J.fillStyle=this.prefs.label_color;if(o===0&&af-J.measureText(O).width<0){J.textAlign="left";J.fillText(R,K+2+W,X+8)}else{J.textAlign="right";J.fillText(R,af-2+W,X+8)}J.fillStyle=l}}else{if(I.dataset_type==="interval_index"){if(ae){J.fillStyle=l;J.fillRect(af+W,X+5,K-af,1)}else{var F=S[4],V=S[5],ah=S[6],h=S[7];if(V&&ah){P=Math.floor(Math.max(0,(V-N)*av));ax=Math.ceil(Math.min(a,Math.max(0,(ah-N)*av)
))}if(r!=="Dense"&&O!==undefined&&aq>N){J.fillStyle=ai;if(o===0&&af-J.measureText(O).width<0){J.textAlign="left";J.fillText(O,K+2+W,X+8)}else{J.textAlign="right";J.fillText(O,af-2+W,X+8)}J.fillStyle=l}if(h){if(F){if(F=="+"){J.fillStyle=RIGHT_STRAND}else{if(F=="-"){J.fillStyle=LEFT_STRAND}}J.fillRect(af+W,X,K-af,10);J.fillStyle=l}for(var an=0,g=h.length;an<g;an++){var u=h[an],d=Math.floor(Math.max(0,(u[0]-N)*av)),T=Math.ceil(Math.min(a,Math.max((u[1]-N)*av)));if(d>T){continue}G=5;aj=3;J.fillRect(d+W,X+aj,T-d,G);if(P!==undefined&&!(d>ax||T<P)){G=9;aj=1;var ak=Math.max(d,P),B=Math.min(T,ax);J.fillRect(ak+W,X+aj,B-ak,G)}}}else{G=9;aj=1;J.fillRect(af+W,X+aj,K-af,G);if(S.strand){if(S.strand=="+"){J.fillStyle=RIGHT_STRAND_INV}else{if(S.strand=="-"){J.fillStyle=LEFT_STRAND_INV}}J.fillRect(af+W,X,K-af,10);J.fillStyle=l}}}}else{if(I.dataset_type==="vcf"){if(ae){J.fillStyle=l;J.fillRect(af+W,X+5,K-af,1)}else{var t=S[4],n=S[5],c=S[6];G=9;aj=1;J.fillRect(af+W,X,K-af,G);if(r!=="Dense"&&O!
==undefined&&aq>N){J.fillStyle=ai;if(o===0&&af-J.measureText(O).width<0){J.textAlign="left";J.fillText(O,K+2+W,X+8)}else{J.textAlign="right";J.fillText(O,af-2+W,X+8)}J.fillStyle=l}var m=t+" / "+n;if(aq>N&&J.measureText(m).width<(K-af)){J.fillStyle="white";J.textAlign="center";J.fillText(m,W+af+(K-af)/2,X+8);J.fillStyle=l}}}}}ao++}}return q},gen_options:function(i){var a=$("<div />").addClass("form-row");var e="track_"+i+"_block_color",k=$("<label />").attr("for",e).text("Block color:"),l=$("<input />").attr("id",e).attr("name",e).val(this.prefs.block_color),j="track_"+i+"_label_color",g=$("<label />").attr("for",j).text("Text color:"),h=$("<input />").attr("id",j).attr("name",j).val(this.prefs.label_color),f="track_"+i+"_show_count",c=$("<label />").attr("for",f).text("Show summary counts"),b=$('<input type="checkbox" style="float:left;"></input>').attr("id",f).attr("name",f).attr("checked",this.prefs.show_counts),d=$("<div />").append(b).append(c);return a.append(k).append(
l).append(g).append(h).append(d)},update_options:function(d){var b=$("#track_"+d+"_block_color").val(),c=$("#track_"+d+"_label_color").val(),a=$("#track_"+d+"_show_count").attr("checked");if(b!==this.prefs.block_color||c!==this.prefs.label_color||a!==this.prefs.show_counts){this.prefs.block_color=b;this.prefs.label_color=c;this.prefs.show_counts=a;this.tile_cache.clear();this.draw()}}});var ReadTrack=function(d,b,a,e,c){FeatureTrack.call(this,d,b,a,e,c);this.track_type="ReadTrack";this.vertical_detail_px=10;this.vertical_nodetail_px=5};$.extend(ReadTrack.prototype,TiledTrack.prototype,FeatureTrack.prototype,{});
+var DENSITY=200,FEATURE_LEVELS=10,MAX_FEATURE_DEPTH=50,CONNECTOR_COLOR="#ccc",DATA_ERROR="There was an error in indexing this dataset.",DATA_NOCONVERTER="A converter for this dataset is not installed. Please check your datatypes_conf.xml file.",DATA_NONE="No data for this chrom/contig.",DATA_PENDING="Currently indexing... please wait",DATA_LOADING="Loading data...",FILTERABLE_CLASS="filterable",CACHED_TILES_FEATURE=10,CACHED_TILES_LINE=5,CACHED_DATA=5,DUMMY_CANVAS=document.createElement("canvas"),RIGHT_STRAND,LEFT_STRAND;if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(DUMMY_CANVAS)}CONTEXT=DUMMY_CANVAS.getContext("2d");PX_PER_CHAR=CONTEXT.measureText("A").width;var right_img=new Image();right_img.src=image_path+"/visualization/strand_right.png";right_img.onload=function(){RIGHT_STRAND=CONTEXT.createPattern(right_img,"repeat")};var left_img=new Image();left_img.src=image_path+"/visualization/strand_left.png";left_img.onload=function(){LEFT_STRAND=CONTEXT.createPa
ttern(left_img,"repeat")};var right_img_inv=new Image();right_img_inv.src=image_path+"/visualization/strand_right_inv.png";right_img_inv.onload=function(){RIGHT_STRAND_INV=CONTEXT.createPattern(right_img_inv,"repeat")};var left_img_inv=new Image();left_img_inv.src=image_path+"/visualization/strand_left_inv.png";left_img_inv.onload=function(){LEFT_STRAND_INV=CONTEXT.createPattern(left_img_inv,"repeat")};function round_1000(a){return Math.round(a*1000)/1000}var Cache=function(a){this.num_elements=a;this.clear()};$.extend(Cache.prototype,{get:function(b){var a=this.key_ary.indexOf(b);if(a!=-1){this.key_ary.splice(a,1);this.key_ary.push(b)}return this.obj_cache[b]},set:function(b,c){if(!this.obj_cache[b]){if(this.key_ary.length>=this.num_elements){var a=this.key_ary.shift();delete this.obj_cache[a]}this.key_ary.push(b)}this.obj_cache[b]=c;return c},clear:function(){this.obj_cache={};this.key_ary=[]}});var View=function(a,d,c,b,e){this.container=a;this.vis_id=c;this.dbkey=b;this.
title=d;this.tracks=[];this.label_tracks=[];this.max_low=0;this.max_high=0;this.num_tracks=0;this.track_id_counter=0;this.zoom_factor=3;this.min_separation=30;this.has_changes=false;this.init(e);this.reset()};$.extend(View.prototype,{init:function(d){var c=this.container,a=this;this.top_container=$("<div/>").addClass("top-container").appendTo(c);this.content_div=$("<div/>").addClass("content").css("position","relative").appendTo(c);this.bottom_container=$("<div/>").addClass("bottom-container").appendTo(c);this.top_labeltrack=$("<div/>").addClass("top-labeltrack").appendTo(this.top_container);this.viewport_container=$("<div/>").addClass("viewport-container").addClass("viewport-container").appendTo(this.content_div);this.intro_div=$("<div/>").addClass("intro").text("Select a chrom from the dropdown below").hide();this.nav_labeltrack=$("<div/>").addClass("nav-labeltrack").appendTo(this.bottom_container);this.nav_container=$("<div/>").addClass("nav-container").prependTo(this.top
_container);this.nav=$("<div/>").addClass("nav").appendTo(this.nav_container);this.overview=$("<div/>").addClass("overview").appendTo(this.bottom_container);this.overview_viewport=$("<div/>").addClass("overview-viewport").appendTo(this.overview);this.overview_close=$("<a href='javascript:void(0);'>Close Overview</a>").addClass("overview-close").hide().appendTo(this.overview_viewport);this.overview_highlight=$("<div />").addClass("overview-highlight").hide().appendTo(this.overview_viewport);this.overview_box_background=$("<div/>").addClass("overview-boxback").appendTo(this.overview_viewport);this.overview_box=$("<div/>").addClass("overview-box").appendTo(this.overview_viewport);this.default_overview_height=this.overview_box.height();this.nav_controls=$("<div/>").addClass("nav-controls").appendTo(this.nav);this.chrom_form=$("<form/>").attr("action",function(){}).appendTo(this.nav_controls);this.chrom_select=$("<select/>").attr({name:"chrom"}).css("width","15em").addClass("no-a
utocomplete").append("<option value=''>Loading</option>").appendTo(this.chrom_form);var b=function(f){if(f.type==="focusout"||(f.keyCode||f.which)===13||(f.keyCode||f.which)===27){if((f.keyCode||f.which)!==27){a.go_to($(this).val())}$(this).hide();a.location_span.show();a.chrom_select.show();return false}};this.nav_input=$("<input/>").addClass("nav-input").hide().bind("keypress focusout",b).appendTo(this.chrom_form);this.location_span=$("<span/>").addClass("location").appendTo(this.chrom_form);this.location_span.bind("click",function(){a.location_span.hide();a.chrom_select.hide();a.nav_input.css("display","inline-block");a.nav_input.select();a.nav_input.focus()});if(this.vis_id!==undefined){this.hidden_input=$("<input/>").attr("type","hidden").val(this.vis_id).appendTo(this.chrom_form)}this.zo_link=$("<a id='zoom-out' />").click(function(){a.zoom_out();a.redraw()}).appendTo(this.chrom_form);this.zi_link=$("<a id='zoom-in' />").click(function(){a.zoom_in();a.redraw()}).append
To(this.chrom_form);$.ajax({url:chrom_url,data:(this.vis_id!==undefined?{vis_id:this.vis_id}:{dbkey:this.dbkey}),dataType:"json",success:function(f){if(f.reference){a.add_label_track(new ReferenceTrack(a))}a.chrom_data=f.chrom_info;var j='<option value="">Select Chrom/Contig</option>';for(var h=0,e=a.chrom_data.length;h<e;h++){var g=a.chrom_data[h].chrom;j+='<option value="'+g+'">'+g+"</option>"}a.chrom_select.html(j);a.intro_div.show();a.chrom_select.bind("change",function(){a.change_chrom(a.chrom_select.val())});if(d){d()}},error:function(){alert("Could not load chroms for this dbkey:",a.dbkey)}});this.content_div.bind("dblclick",function(f){a.zoom_in(f.pageX,this.viewport_container)});this.overview_box.bind("dragstart",function(f){this.current_x=f.offsetX}).bind("drag",function(f){var h=f.offsetX-this.current_x;this.current_x=f.offsetX;var g=Math.round(h/a.viewport_container.width()*(a.max_high-a.max_low));a.move_delta(-g)});this.overview_close.bind("click",function(){for
(var f=0,e=a.tracks.length;f<e;f++){a.tracks[f].is_overview=false}$(this).siblings().filter("canvas").remove();$(this).parent().css("height",a.overview_box.height());a.overview_highlight.hide();$(this).hide()});this.viewport_container.bind("dragstart",function(f){this.original_low=a.low;this.current_height=f.clientY;this.current_x=f.offsetX;this.enable_pan=(f.clientX<a.viewport_container.width()-16)?true:false}).bind("drag",function(h){if(!this.enable_pan||this.in_reordering){return}var f=$(this);var j=h.offsetX-this.current_x;var g=f.scrollTop()-(h.clientY-this.current_height);f.scrollTop(g);this.current_height=h.clientY;this.current_x=h.offsetX;var i=Math.round(j/a.viewport_container.width()*(a.high-a.low));a.move_delta(i)});this.top_labeltrack.bind("dragstart",function(f){this.drag_origin_x=f.clientX;this.drag_origin_pos=f.clientX/a.viewport_container.width()*(a.high-a.low)+a.low;this.drag_div=$("<div />").css({height:a.content_div.height()+a.top_labeltrack.height()+a.nav
_labeltrack.height(),top:"0px",position:"absolute","background-color":"#ccf",opacity:0.5,"z-index":1000}).appendTo($(this))}).bind("drag",function(j){var g=Math.min(j.clientX,this.drag_origin_x)-a.container.offset().left,f=Math.max(j.clientX,this.drag_origin_x)-a.container.offset().left,i=(a.high-a.low),h=a.viewport_container.width();a.update_location(Math.round(g/h*i)+a.low,Math.round(f/h*i)+a.low);this.drag_div.css({left:g+"px",width:(f-g)+"px"})}).bind("dragend",function(k){var g=Math.min(k.clientX,this.drag_origin_x),f=Math.max(k.clientX,this.drag_origin_x),i=(a.high-a.low),h=a.viewport_container.width(),j=a.low;a.low=Math.round(g/h*i)+j;a.high=Math.round(f/h*i)+j;this.drag_div.remove();a.redraw()});this.add_label_track(new LabelTrack(this,this.top_labeltrack));this.add_label_track(new LabelTrack(this,this.nav_labeltrack));$(window).bind("resize",function(){a.resize_window()});$(document).bind("redraw",function(){a.redraw()});this.reset();$(window).trigger("resize")},upd
ate_location:function(a,b){this.location_span.text(commatize(a)+" - "+commatize(b));this.nav_input.val(this.chrom+":"+commatize(a)+"-"+commatize(b))},change_chrom:function(e,b,g){var d=this;var f=$.grep(d.chrom_data,function(j,k){return j.chrom===e})[0];if(f===undefined){return}if(e!==d.chrom){d.chrom=e;if(!d.chrom){d.intro_div.show()}else{d.intro_div.hide()}d.chrom_select.val(d.chrom);d.max_high=f.len;d.reset();d.redraw(true);for(var h=0,a=d.tracks.length;h<a;h++){var c=d.tracks[h];if(c.init){c.init()}}}if(b!==undefined&&g!==undefined){d.low=Math.max(b,0);d.high=Math.min(g,d.max_high)}d.reset_overview();d.redraw()},go_to:function(f){var j=this,a,d,b=f.split(":"),h=b[0],i=b[1];if(i!==undefined){try{var g=i.split("-");a=parseInt(g[0].replace(/,/g,""),10);d=parseInt(g[1].replace(/,/g,""),10)}catch(c){return false}}j.change_chrom(h,a,d)},move_fraction:function(c){var a=this;var b=a.high-a.low;this.move_delta(c*b)},move_delta:function(c){var a=this;var b=a.high-a.low;if(a.low-c<
a.max_low){a.low=a.max_low;a.high=a.max_low+b}else{if(a.high-c>a.max_high){a.high=a.max_high;a.low=a.max_high-b}else{a.high-=c;a.low-=c}}a.redraw()},add_track:function(a){a.view=this;a.track_id=this.track_id_counter;this.tracks.push(a);if(a.init){a.init()}a.container_div.attr("id","track_"+a.track_id);this.track_id_counter+=1;this.num_tracks+=1},add_label_track:function(a){a.view=this;this.label_tracks.push(a)},remove_track:function(a){this.has_changes=true;a.container_div.fadeOut("slow",function(){$(this).remove()});delete this.tracks[this.tracks.indexOf(a)];this.num_tracks-=1},reset:function(){this.low=this.max_low;this.high=this.max_high;this.viewport_container.find(".yaxislabel").remove()},redraw:function(h){var g=this.high-this.low,f=this.low,b=this.high;if(f<this.max_low){f=this.max_low}if(b>this.max_high){b=this.max_high}if(this.high!==0&&g<this.min_separation){b=f+this.min_separation}this.low=Math.floor(f);this.high=Math.ceil(b);this.resolution=Math.pow(10,Math.ceil(
Math.log((this.high-this.low)/200)/Math.LN10));this.zoom_res=Math.pow(FEATURE_LEVELS,Math.max(0,Math.ceil(Math.log(this.resolution,FEATURE_LEVELS)/Math.log(FEATURE_LEVELS))));var a=(this.low/(this.max_high-this.max_low)*this.overview_viewport.width())||0;var e=((this.high-this.low)/(this.max_high-this.max_low)*this.overview_viewport.width())||0;var j=13;this.overview_box.css({left:a,width:Math.max(j,e)}).show();if(e<j){this.overview_box.css("left",a-(j-e)/2)}if(this.overview_highlight){this.overview_highlight.css({left:a,width:e})}this.update_location(this.low,this.high);if(!h){for(var c=0,d=this.tracks.length;c<d;c++){if(this.tracks[c]&&this.tracks[c].enabled){this.tracks[c].draw()}}for(c=0,d=this.label_tracks.length;c<d;c++){this.label_tracks[c].draw()}}},zoom_in:function(b,c){if(this.max_high===0||this.high-this.low<this.min_separation){return}var d=this.high-this.low,e=d/2+this.low,a=(d/this.zoom_factor)/2;if(b){e=b/this.viewport_container.width()*(this.high-this.low)+th
is.low}this.low=Math.round(e-a);this.high=Math.round(e+a);this.redraw()},zoom_out:function(){if(this.max_high===0){return}var b=this.high-this.low,c=b/2+this.low,a=(b*this.zoom_factor)/2;this.low=Math.round(c-a);this.high=Math.round(c+a);this.redraw()},resize_window:function(){this.viewport_container.height(this.container.height()-this.top_container.height()-this.bottom_container.height());this.nav_container.width(this.container.width());this.redraw()},reset_overview:function(){this.overview_viewport.find("canvas").remove();this.overview_viewport.height(this.default_overview_height);this.overview_box.height(this.default_overview_height);this.overview_close.hide();this.overview_highlight.hide()}});var Filter=function(b,a,c){this.name=b;this.index=a;this.value=c};var NumberFilter=function(b,a){this.name=b;this.index=a;this.low=-Number.MAX_VALUE;this.high=Number.MAX_VALUE;this.slider_min=Number.MAX_VALUE;this.slider_max=-Number.MAX_VALUE;this.slider=null;this.slider_label=null}
;$.extend(NumberFilter.prototype,{applies_to:function(a){if(a.length>this.index){return true}return false},keep:function(a){if(!this.applies_to(a)){return true}return(a[this.index]>=this.low&&a[this.index]<=this.high)},update_attrs:function(b){var a=false;if(!this.applies_to(b)){return a}if(b[this.index]<this.slider_min){this.slider_min=b[this.index];a=true}if(b[this.index]>this.slider_max){this.slider_max=b[this.index];a=false}return a},update_ui_elt:function(){var b=this.slider.slider("option","min"),a=this.slider.slider("option","max");if(this.slider_min<b||this.slider_max>a){this.slider.slider("option","min",this.slider_min);this.slider.slider("option","max",this.slider_max);this.slider.slider("option","values",[this.slider_min,this.slider_max])}}});var get_filters=function(a){var g=[];for(var d=0;d<a.length;d++){var f=a[d];var c=f.name,e=f.type,b=f.index;if(e=="int"||e=="float"){g[d]=new NumberFilter(c,b)}else{g[d]=new Filter(c,b,e)}}return g};var Track=function(b,a,d,c
){this.name=b;this.view=a;this.parent_element=d;this.filters=(c!==undefined?get_filters(c):[]);this.init_global()};$.extend(Track.prototype,{init_global:function(){this.container_div=$("<div />").addClass("track").css("position","relative");if(!this.hidden){this.header_div=$("<div class='track-header' />").appendTo(this.container_div);if(this.view.editor){this.drag_div=$("<div class='draghandle' />").appendTo(this.header_div)}this.name_div=$("<div class='menubutton popup' />").appendTo(this.header_div);this.name_div.text(this.name);this.name_div.attr("id",this.name.replace(/\s+/g,"-").replace(/[^a-zA-Z0-9\-]/g,"").toLowerCase())}this.filtering_div=$("<div class='track-filters'>").appendTo(this.container_div);this.filtering_div.hide();this.filtering_div.bind("drag",function(i){i.stopPropagation()});var b=$("<table class='filters'>").appendTo(this.filtering_div);var c=this;for(var e=0;e<this.filters.length;e++){var a=this.filters[e];var f=$("<tr>").appendTo(b);var g=$("<th cla
ss='filter-info'>").appendTo(f);var j=$("<span class='name'>").appendTo(g);j.text(a.name+" ");var d=$("<span class='values'>").appendTo(g);var h=$("<td>").appendTo(f);a.control_element=$("<div id='"+a.name+"-filter-control' style='width: 200px; position: relative'>").appendTo(h);a.control_element.slider({range:true,min:Number.MAX_VALUE,max:-Number.MIN_VALUE,values:[0,0],slide:function(k,l){var i=l.values;d.text("["+i[0]+"-"+i[1]+"]");a.low=i[0];a.high=i[1];c.draw(true)},change:function(i,k){a.control_element.slider("option","slide").call(a.control_element,i,k)}});a.slider=a.control_element;a.slider_label=d}this.content_div=$("<div class='track-content'>").appendTo(this.container_div);this.parent_element.append(this.container_div)},init_each:function(c,b){var a=this;a.enabled=false;a.data_queue={};a.tile_cache.clear();a.data_cache.clear();a.initial_canvas=undefined;a.content_div.css("height","auto");if(!a.content_div.text()){a.content_div.text(DATA_LOADING)}a.container_div.r
emoveClass("nodata error pending");if(a.view.chrom){$.getJSON(data_url,c,function(d){if(!d||d==="error"||d.kind==="error"){a.container_div.addClass("error");a.content_div.text(DATA_ERROR);if(d.message){var f=a.view.tracks.indexOf(a);var e=$("<a href='javascript:void(0);'></a>").attr("id",f+"_error");e.text("Click to view error");$("#"+f+"_error").live("click",function(){show_modal("Trackster Error","<pre>"+d.message+"</pre>",{Close:hide_modal})});a.content_div.append(e)}}else{if(d==="no converter"){a.container_div.addClass("error");a.content_div.text(DATA_NOCONVERTER)}else{if(d.data!==undefined&&(d.data===null||d.data.length===0)){a.container_div.addClass("nodata");a.content_div.text(DATA_NONE)}else{if(d==="pending"){a.container_div.addClass("pending");a.content_div.text(DATA_PENDING);setTimeout(function(){a.init()},5000)}else{a.content_div.text("");a.content_div.css("height",a.height_px+"px");a.enabled=true;b(d);a.draw()}}}}})}else{a.container_div.addClass("nodata");a.conte
nt_div.text(DATA_NONE)}}});var TiledTrack=function(){var b=this,j=b.view;if(b.hidden){return}if(b.display_modes!==undefined){if(b.mode_div===undefined){b.mode_div=$("<div class='right-float menubutton popup' />").appendTo(b.header_div);var e=b.display_modes[0];b.mode=e;b.mode_div.text(e);var c=function(i){b.mode_div.text(i);b.mode=i;b.tile_cache.clear();b.draw()};var a={};for(var f=0,h=b.display_modes.length;f<h;f++){var g=b.display_modes[f];a[g]=function(i){return function(){c(i)}}(g)}make_popupmenu(b.mode_div,a)}else{b.mode_div.hide()}}var d={};d["Set as overview"]=function(){j.overview_viewport.find("canvas").remove();b.is_overview=true;b.set_overview();for(var i in j.tracks){if(j.tracks[i]!==b){j.tracks[i].is_overview=false}}};d["Edit configuration"]=function(){var l=function(){hide_modal();$(window).unbind("keypress.check_enter_esc")},i=function(){b.update_options(b.track_id);hide_modal();$(window).unbind("keypress.check_enter_esc")},k=function(m){if((m.keyCode||m.which
)===27){l()}else{if((m.keyCode||m.which)===13){i()}}};$(window).bind("keypress.check_enter_esc",k);show_modal("Configure Track",b.gen_options(b.track_id),{Cancel:l,OK:i})};if(b.filters.length>0){d["Show filters"]=function(){var i;if(!b.filtering_div.is(":visible")){i="Hide filters";b.filters_visible=true}else{i="Show filters";b.filters_visible=false}$("#"+b.name_div.attr("id")+"-menu").find("li").eq(2).text(i);b.filtering_div.toggle()}}d.Remove=function(){j.remove_track(b);if(j.num_tracks===0){$("#no-tracks").show()}};b.popup_menu=make_popupmenu(b.name_div,d);show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters",false)};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(a){var k=this.view.low,g=this.view.high,h=g-k,f=this.view.resolution;var n=$("<div style='position: relative;'></div>"),o=this.content_div.width()/h;this.content_div.append(n);this.max_height=0;var b=Math.floor(k/f/DENSITY);var j={};while((b*DENSITY*f)<g){var l=this.content_div.width()+"_"+
o+"_"+b;var e=this.tile_cache.get(l);if(!a&&e){var i=b*DENSITY*f;var d=(i-k)*o;if(this.left_offset){d-=this.left_offset}e.css({left:d});this.show_tile(e,n)}else{this.delayed_draw(this,l,k,g,b,f,n,o,j)}b+=1}var c=this;var m=setInterval(function(){if(obj_length(j)===0){if(c.content_div.children().length>1){c.content_div.children(":first").remove()}for(var p=0;p<c.filters.length;p++){c.filters[p].update_ui_elt()}clearInterval(m)}},50)},delayed_draw:function(c,h,g,e,b,d,i,j,f){var a=setTimeout(function(){if(g<=c.view.high&&e>=c.view.low){var k=c.draw_tile(d,b,i,j);if(k){if(!c.initial_canvas&&!window.G_vmlCanvasManager){c.initial_canvas=$(k).clone();var n=k.get(0).getContext("2d");var l=c.initial_canvas.get(0).getContext("2d");var m=n.getImageData(0,0,n.canvas.width,n.canvas.height);l.putImageData(m,0,0);c.set_overview()}c.tile_cache.set(h,k);c.show_tile(k,i)}}delete f[a]},50);f[a]=true},show_tile:function(a,c){var b=this;c.append(a);b.max_height=Math.max(b.max_height,a.height())
;b.content_div.css("height",b.max_height+"px");if(a.hasClass(FILTERABLE_CLASS)){show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters");if(b.filters_visible){b.filtering_div.show()}}else{show_hide_popupmenu_options(b.popup_menu,"(Show|Hide) filters",false);b.filtering_div.hide()}},set_overview:function(){var a=this.view;if(this.initial_canvas&&this.is_overview){a.overview_close.show();a.overview_viewport.append(this.initial_canvas);a.overview_highlight.show().height(this.initial_canvas.height());a.overview_viewport.height(this.initial_canvas.height()+a.overview_box.height())}$(window).trigger("resize")}});var LabelTrack=function(a,b){this.track_type="LabelTrack";this.hidden=true;Track.call(this,null,a,b);this.container_div.addClass("label-track")};$.extend(LabelTrack.prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div styl
e='position: relative; height: 1.3em;'></div>");while(a<c.high){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+commatize(a)+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.append(b)}});var ReferenceTrack=function(a){this.track_type="ReferenceTrack";this.hidden=true;Track.call(this,null,a,a.top_labeltrack);TiledTrack.call(this);this.left_offset=200;this.height_px=12;this.container_div.addClass("reference-track");this.data_queue={};this.data_cache=new Cache(CACHED_DATA);this.tile_cache=new Cache(CACHED_TILES_LINE)};$.extend(ReferenceTrack.prototype,TiledTrack.prototype,{get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;if(!c.data_queue[e]){c.data_queue[e]=true;$.ajax({url:reference_url,dataType:"json",data:{chrom:this.view.chrom,low:a,high:f,dbkey:this.view.dbkey},success:function(g){c.data_cache.set(e,g);delete c.data_queue[e];c.draw()},error:function(h,g,i){console.log(h,g,i)}})
}},draw_tile:function(f,b,k,o){var g=b*DENSITY*f,d=DENSITY*f,j=f+"_"+b;var e=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(e)}e=$(e);var n=e.get(0).getContext("2d");if(o>PX_PER_CHAR){if(this.data_cache.get(j)===undefined){this.get_data(f,b);return}var m=this.data_cache.get(j);if(m===null){this.content_div.css("height","0px");return}e.get(0).width=Math.ceil(d*o+this.left_offset);e.get(0).height=this.height_px;e.css({position:"absolute",top:0,left:(g-this.view.low)*o-this.left_offset});for(var h=0,l=m.length;h<l;h++){var a=Math.round(h*o),i=Math.round(o/2);n.fillText(m[h],a+this.left_offset+i,10)}k.append(e);return e}this.content_div.css("height","0px")}});var LineTrack=function(d,b,a,c){this.track_type="LineTrack";this.display_modes=["Histogram","Line","Filled","Intensity"];this.mode="Histogram";Track.call(this,d,b,b.viewport_container);TiledTrack.call(this);this.height_px=80;this.dataset_id=a;this.data_cache=new Cache(CACHED_DA
TA);this.tile_cache=new Cache(CACHED_TILES_LINE);this.prefs={color:"black",min_value:undefined,max_value:undefined,mode:this.mode}};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:function(){var a=this,b=a.view.tracks.indexOf(a);a.vertical_range=undefined;this.init_each({stats:true,chrom:a.view.chrom,low:null,high:null,dataset_id:a.dataset_id},function(c){a.container_div.addClass("line-track");var e=c.data;if(isNaN(parseFloat(a.prefs.min_value))||isNaN(parseFloat(a.prefs.max_value))){a.prefs.min_value=e.min;a.prefs.max_value=e.max;$("#track_"+b+"_minval").val(a.prefs.min_value);$("#track_"+b+"_maxval").val(a.prefs.max_value)}a.vertical_range=a.prefs.max_value-a.prefs.min_value;a.total_frequency=e.total_frequency;a.container_div.find(".yaxislabel").remove();var f=$("<div />").addClass("yaxislabel").attr("id","linetrack_"+b+"_minval").text(round_1000(a.prefs.min_value));var d=$("<div />").addClass("yaxislabel").attr("id","linetrack_"+b+"_maxval").text(round_1000(a.pref
s.max_value));d.css({position:"absolute",top:"24px",left:"10px"});d.prependTo(a.container_div);f.css({position:"absolute",top:a.height_px+12+"px",left:"10px"});f.prependTo(a.container_div)})},get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;if(!c.data_queue[e]){c.data_queue[e]=true;$.ajax({url:data_url,dataType:"json",data:{chrom:this.view.chrom,low:a,high:f,dataset_id:this.dataset_id,resolution:this.view.resolution},success:function(g){var h=g.data;c.data_cache.set(e,h);delete c.data_queue[e];c.draw()},error:function(h,g,i){console.log(h,g,i)}})}},draw_tile:function(o,r,c,e){if(this.vertical_range===undefined){return}var s=r*DENSITY*o,a=DENSITY*o,w=o+"_"+r;var b=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(b)}b=$(b);if(this.data_cache.get(w)===undefined){this.get_data(o,r);return}var v=this.data_cache.get(w);if(!v){return}b.css({position:"absolute",top:0,left:(s-this.view.low)*e});b.get(0).width=Mat
h.ceil(a*e);b.get(0).height=this.height_px;var n=b.get(0).getContext("2d"),j=false,k=this.prefs.min_value,g=this.prefs.max_value,m=this.vertical_range,t=this.total_frequency,d=this.height_px,l=this.mode;n.beginPath();n.fillStyle=this.prefs.color;var u,h,f;if(v.length>1){f=Math.ceil((v[1][0]-v[0][0])*e)}else{f=10}for(var p=0,q=v.length;p<q;p++){u=Math.round((v[p][0]-s)*e);h=v[p][1];if(h===null){if(j&&l==="Filled"){n.lineTo(u,d)}j=false;continue}if(h<k){h=k}else{if(h>g){h=g}}if(l==="Histogram"){h=Math.round(d-(h-k)/m*d);n.fillRect(u,h,f,d-h)}else{if(l==="Intensity"){h=255-Math.floor((h-k)/m*255);n.fillStyle="rgb("+h+","+h+","+h+")";n.fillRect(u,0,f,d)}else{h=Math.round(d-(h-k)/m*d);if(j){n.lineTo(u,h)}else{j=true;if(l==="Filled"){n.moveTo(u,d);n.lineTo(u,h)}else{n.moveTo(u,h)}}}}}if(l==="Filled"){if(j){n.lineTo(u,d)}n.fill()}else{n.stroke()}c.append(b);return b},gen_options:function(m){var a=$("<div />").addClass("form-row");var e="track_"+m+"_color",b=$("<label />").attr("for
",e).text("Color:"),c=$("<input />").attr("id",e).attr("name",e).val(this.prefs.color),h="track_"+m+"_minval",l=$("<label></label>").attr("for",h).text("Min value:"),d=(this.prefs.min_value===undefined?"":this.prefs.min_value),k=$("<input></input>").attr("id",h).val(d),j="track_"+m+"_maxval",g=$("<label></label>").attr("for",j).text("Max value:"),i=(this.prefs.max_value===undefined?"":this.prefs.max_value),f=$("<input></input>").attr("id",j).val(i);return a.append(l).append(k).append(g).append(f).append(b).append(c)},update_options:function(d){var a=$("#track_"+d+"_minval").val(),c=$("#track_"+d+"_maxval").val(),b=$("#track_"+d+"_color").val();if(a!==this.prefs.min_value||c!==this.prefs.max_value||b!==this.prefs.color){this.prefs.min_value=parseFloat(a);this.prefs.max_value=parseFloat(c);this.prefs.color=b;this.vertical_range=this.prefs.max_value-this.prefs.min_value;$("#linetrack_"+d+"_minval").text(this.prefs.min_value);$("#linetrack_"+d+"_maxval").text(this.prefs.max_valu
e);this.tile_cache.clear();this.draw()}}});var FeatureTrack=function(d,b,a,e,c){this.track_type="FeatureTrack";this.display_modes=["Auto","Dense","Squish","Pack"];Track.call(this,d,b,b.viewport_container,e);TiledTrack.call(this);this.height_px=0;this.container_div.addClass("feature-track");this.dataset_id=a;this.zo_slots={};this.show_labels_scale=0.001;this.showing_details=false;this.vertical_detail_px=10;this.vertical_nodetail_px=3;this.summary_draw_height=30;this.default_font="9px Monaco, Lucida Console, monospace";this.inc_slots={};this.data_queue={};this.s_e_by_tile={};this.tile_cache=new Cache(CACHED_TILES_FEATURE);this.data_cache=new Cache(20);this.left_offset=200;this.prefs={block_color:"#444",label_color:"black",show_counts:true}};$.extend(FeatureTrack.prototype,TiledTrack.prototype,{init:function(){var a=this,b="initial";this.init_each({low:a.view.max_low,high:a.view.max_high,dataset_id:a.dataset_id,chrom:a.view.chrom,resolution:this.view.resolution,mode:a.mode},fun
ction(c){a.mode_div.show();a.data_cache.set(b,c);a.draw()})},get_data:function(a,d){var b=this,c=a+"_"+d;if(!b.data_queue[c]){b.data_queue[c]=true;$.getJSON(data_url,{chrom:b.view.chrom,low:a,high:d,dataset_id:b.dataset_id,resolution:this.view.resolution,mode:this.mode},function(e){b.data_cache.set(c,e);delete b.data_queue[c];b.draw()})}},incremental_slots:function(a,g,b,q){if(!this.inc_slots[a]){this.inc_slots[a]={};this.inc_slots[a].w_scale=a;this.inc_slots[a].mode=q;this.s_e_by_tile[a]={}}var m=this.inc_slots[a].w_scale,y=[],h=0,n=this.view.max_low;var A=[];if(this.inc_slots[a].mode!==q){delete this.inc_slots[a];this.inc_slots[a]={mode:q,w_scale:m};delete this.s_e_by_tile[a];this.s_e_by_tile[a]={}}for(var v=0,w=g.length;v<w;v++){var f=g[v],l=f[0];if(this.inc_slots[a][l]!==undefined){h=Math.max(h,this.inc_slots[a][l]);A.push(this.inc_slots[a][l])}else{y.push(v)}}for(var v=0,w=y.length;v<w;v++){var f=g[y[v]],l=f[0],r=f[1],c=f[2],p=f[3],d=Math.floor((r-n)*m),e=Math.ceil((c-n
)*m);if(p!==undefined&&!b){var s=CONTEXT.measureText(p).width;if(d-s<0){e+=s}else{d-=s}}var u=0;while(u<=MAX_FEATURE_DEPTH){var o=true;if(this.s_e_by_tile[a][u]!==undefined){for(var t=0,z=this.s_e_by_tile[a][u].length;t<z;t++){var x=this.s_e_by_tile[a][u][t];if(e>x[0]&&d<x[1]){o=false;break}}}if(o){if(this.s_e_by_tile[a][u]===undefined){this.s_e_by_tile[a][u]=[]}this.s_e_by_tile[a][u].push([d,e]);this.inc_slots[a][l]=u;h=Math.max(h,u);break}u++}}return h},rect_or_text:function(r,l,t,b,q,f,i,e){r.textAlign="center";var k=0,p=Math.round(l/2);for(var m=0,s=i.length;m<s;m++){var j=i[m],d="MIDNSHP"[j[0]],n=j[1];if(d==="H"||d==="S"){k-=n}var g=q+k,w=Math.floor(Math.max(0,(g-t)*l)),h=Math.floor(Math.max(0,(g+n-t)*l));switch(d){case"S":case"H":case"M":var o=f.slice(k,n);if((this.mode==="Pack"||this.mode==="Auto")&&f!==undefined&&l>PX_PER_CHAR){r.fillStyle=this.prefs.block_color;r.fillRect(w+this.left_offset,e+1,h-w,9);r.fillStyle=CONNECTOR_COLOR;for(var u=0,a=o.length;u<a;u++){if(g+
u>=t&&g+u<=b){var v=Math.floor(Math.max(0,(g+u-t)*l));r.fillText(o[u],v+this.left_offset+p,e+9)}}}else{r.fillStyle=this.prefs.block_color;r.fillRect(w+this.left_offset,e+4,h-w,3)}break;case"N":r.fillStyle=CONNECTOR_COLOR;r.fillRect(w+this.left_offset,e+5,h-w,1);break;case"D":r.fillStyle="red";r.fillRect(w+this.left_offset,e+4,h-w,3);break;case"P":case"I":break}k+=n}},draw_tile:function(ag,o,s,av){var N=o*DENSITY*ag,al=(o+1)*DENSITY*ag,M=al-N;var an=(!this.initial_canvas?"initial":N+"_"+al);var I=this.data_cache.get(an);var e;if(I===undefined||(this.mode!=="Auto"&&I.dataset_type==="summary_tree")){this.data_queue[[N,al]]=true;this.get_data(N,al);return}var a=Math.ceil(M*av),ai=this.prefs.label_color,l=this.prefs.block_color,r=this.mode,z=25,ae=(r==="Squish")||(r==="Dense")&&(r!=="Pack")||(r==="Auto"&&(I.extra_info==="no_detail")),W=this.left_offset,au,D,aw;var q=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(q)}q=$(q);if(I.datase
t_type==="summary_tree"){D=this.summary_draw_height}else{if(r==="Dense"){D=z;aw=10}else{aw=(ae?this.vertical_nodetail_px:this.vertical_detail_px);var A=(av<0.0001?1/this.view.zoom_res:av);D=this.incremental_slots(A,I.data,ae,r)*aw+z;au=this.inc_slots[A]}}q.css({position:"absolute",top:0,left:(N-this.view.low)*av-W});q.get(0).width=a+W;q.get(0).height=D;s.parent().css("height",Math.max(this.height_px,D)+"px");var J=q.get(0).getContext("2d");J.fillStyle=l;J.font=this.default_font;J.textAlign="right";this.container_div.find(".yaxislabel").remove();if(I.dataset_type=="summary_tree"){var Y=I.data,L=I.max,b=Math.ceil(I.delta*av);var p=$("<div />").addClass("yaxislabel").text(L);p.css({position:"absolute",top:"22px",left:"10px"});p.prependTo(this.container_div);for(var ap=0,H=Y.length;ap<H;ap++){var aa=Math.floor((Y[ap][0]-N)*av);var Z=Y[ap][1];if(!Z){continue}var am=Z/L*this.summary_draw_height;J.fillStyle="black";J.fillRect(aa+W,this.summary_draw_height-am,b,am);if(this.prefs.sho
w_counts&&J.measureText(Z).width<b){J.fillStyle="#bbb";J.textAlign="center";J.fillText(Z,aa+W+(b/2),this.summary_draw_height-5)}}e="Summary";s.append(q);return q}if(I.message){q.css({border:"solid red","border-width":"2px 2px 2px 0px"});J.fillStyle="red";J.textAlign="left";J.fillText(I.message,100+W,aw)}var ad=false;if(I.data){ad=true;for(var ar=0;ar<this.filters.length;ar++){if(!this.filters[ar].applies_to(I.data[0])){ad=false}}}if(ad){q.addClass(FILTERABLE_CLASS)}var at=I.data;var ao=0;for(var ap=0,H=at.length;ap<H;ap++){var S=at[ap],R=S[0],aq=S[1],ac=S[2],O=S[3];if(au[R]===undefined){continue}var ab=false;var U;for(var ar=0;ar<this.filters.length;ar++){U=this.filters[ar];U.update_attrs(S);if(!U.keep(S)){ab=true;break}}if(ab){continue}if(aq<=al&&ac>=N){var af=Math.floor(Math.max(0,(aq-N)*av)),K=Math.ceil(Math.min(a,Math.max(0,(ac-N)*av))),X=(r==="Dense"?1:(1+au[R]))*aw;var G,aj,P=null,ax=null;if(I.dataset_type==="bai"){var v=S[4];J.fillStyle=l;if(S[5] instanceof Array){var
E=Math.floor(Math.max(0,(S[5][0]-N)*av)),Q=Math.ceil(Math.min(a,Math.max(0,(S[5][1]-N)*av))),C=Math.floor(Math.max(0,(S[6][0]-N)*av)),w=Math.ceil(Math.min(a,Math.max(0,(S[6][1]-N)*av)));if(S[5][1]>=N&&S[5][0]<=al){this.rect_or_text(J,av,N,al,S[5][0],S[5][2],v,X)}if(S[6][1]>=N&&S[6][0]<=al){this.rect_or_text(J,av,N,al,S[6][0],S[6][2],v,X)}if(C>Q){J.fillStyle=CONNECTOR_COLOR;J.fillRect(Q+W,X+5,C-Q,1)}}else{J.fillStyle=l;this.rect_or_text(J,av,N,al,aq,O,v,X)}if(r!=="Dense"&&!ae&&aq>N){J.fillStyle=this.prefs.label_color;if(o===0&&af-J.measureText(O).width<0){J.textAlign="left";J.fillText(R,K+2+W,X+8)}else{J.textAlign="right";J.fillText(R,af-2+W,X+8)}J.fillStyle=l}}else{if(I.dataset_type==="interval_index"){if(ae){J.fillStyle=l;J.fillRect(af+W,X+5,K-af,1)}else{var F=S[4],V=S[5],ah=S[6],h=S[7];if(V&&ah){P=Math.floor(Math.max(0,(V-N)*av));ax=Math.ceil(Math.min(a,Math.max(0,(ah-N)*av)))}if(r!=="Dense"&&O!==undefined&&aq>N){J.fillStyle=ai;if(o===0&&af-J.measureText(O).width<0){J.tex
tAlign="left";J.fillText(O,K+2+W,X+8)}else{J.textAlign="right";J.fillText(O,af-2+W,X+8)}J.fillStyle=l}if(h){if(F){if(F=="+"){J.fillStyle=RIGHT_STRAND}else{if(F=="-"){J.fillStyle=LEFT_STRAND}}J.fillRect(af+W,X,K-af,10);J.fillStyle=l}for(var an=0,g=h.length;an<g;an++){var u=h[an],d=Math.floor(Math.max(0,(u[0]-N)*av)),T=Math.ceil(Math.min(a,Math.max((u[1]-N)*av)));if(d>T){continue}G=5;aj=3;J.fillRect(d+W,X+aj,T-d,G);if(P!==undefined&&!(d>ax||T<P)){G=9;aj=1;var ak=Math.max(d,P),B=Math.min(T,ax);J.fillRect(ak+W,X+aj,B-ak,G)}}}else{G=9;aj=1;J.fillRect(af+W,X+aj,K-af,G);if(S.strand){if(S.strand=="+"){J.fillStyle=RIGHT_STRAND_INV}else{if(S.strand=="-"){J.fillStyle=LEFT_STRAND_INV}}J.fillRect(af+W,X,K-af,10);J.fillStyle=l}}}}else{if(I.dataset_type==="vcf"){if(ae){J.fillStyle=l;J.fillRect(af+W,X+5,K-af,1)}else{var t=S[4],n=S[5],c=S[6];G=9;aj=1;J.fillRect(af+W,X,K-af,G);if(r!=="Dense"&&O!==undefined&&aq>N){J.fillStyle=ai;if(o===0&&af-J.measureText(O).width<0){J.textAlign="left";J.fillT
ext(O,K+2+W,X+8)}else{J.textAlign="right";J.fillText(O,af-2+W,X+8)}J.fillStyle=l}var m=t+" / "+n;if(aq>N&&J.measureText(m).width<(K-af)){J.fillStyle="white";J.textAlign="center";J.fillText(m,W+af+(K-af)/2,X+8);J.fillStyle=l}}}}}ao++}}return q},gen_options:function(i){var a=$("<div />").addClass("form-row");var e="track_"+i+"_block_color",k=$("<label />").attr("for",e).text("Block color:"),l=$("<input />").attr("id",e).attr("name",e).val(this.prefs.block_color),j="track_"+i+"_label_color",g=$("<label />").attr("for",j).text("Text color:"),h=$("<input />").attr("id",j).attr("name",j).val(this.prefs.label_color),f="track_"+i+"_show_count",c=$("<label />").attr("for",f).text("Show summary counts"),b=$('<input type="checkbox" style="float:left;"></input>').attr("id",f).attr("name",f).attr("checked",this.prefs.show_counts),d=$("<div />").append(b).append(c);return a.append(k).append(l).append(g).append(h).append(d)},update_options:function(d){var b=$("#track_"+d+"_block_color").va
l(),c=$("#track_"+d+"_label_color").val(),a=$("#track_"+d+"_show_count").attr("checked");if(b!==this.prefs.block_color||c!==this.prefs.label_color||a!==this.prefs.show_counts){this.prefs.block_color=b;this.prefs.label_color=c;this.prefs.show_counts=a;this.tile_cache.clear();this.draw()}}});var ReadTrack=function(d,b,a,e,c){FeatureTrack.call(this,d,b,a,e,c);this.track_type="ReadTrack";this.vertical_detail_px=10;this.vertical_nodetail_px=5};$.extend(ReadTrack.prototype,TiledTrack.prototype,FeatureTrack.prototype,{});
1
0
galaxy-dist commit 9b2bc4d4d6ca: Add full GFF support to trackster: GFF features blocks are now displayed correctly, along with name, strand, and score information. Added score column to GFFReaderWrapper as well.
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User jeremy goecks <jeremy.goecks(a)emory.edu>
# Date 1289766276 18000
# Node ID 9b2bc4d4d6ca9b1f4275cb335460c8d570c7eeaf
# Parent 1449307bdaf7671bea8a879a6c0990bc0c3b7aa7
Add full GFF support to trackster: GFF features blocks are now displayed correctly, along with name, strand, and score information. Added score column to GFFReaderWrapper as well.
--- a/lib/galaxy/visualization/tracks/data_providers.py
+++ b/lib/galaxy/visualization/tracks/data_providers.py
@@ -5,6 +5,7 @@ Data providers for tracks visualizations
from math import floor, ceil, log, pow
import pkg_resources
pkg_resources.require( "bx-python" ); pkg_resources.require( "pysam" ); pkg_resources.require( "numpy" )
+from galaxy.datatypes.util.gff_util import *
from bx.interval_index_file import Indexes
from bx.arrays.array_tree import FileArrayTreeDict
from galaxy.util.lrucache import LRUCache
@@ -330,25 +331,43 @@ class IntervalIndexDataProvider( TracksD
break
count += 1
source.seek(offset)
- feature = source.readline().split()
payload = [ offset, start, end ]
# TODO: can we use column metadata to fill out payload?
# TODO: use function to set payload data
if "no_detail" not in kwargs:
- length = len(feature)
if isinstance( self.original_dataset.datatype, Gff ):
# GFF dataset.
- if length >= 3:
- payload.append( feature[2] ) # name
- if length >= 7:
- payload.append( feature[6] ) # strand
+ reader = GFFReaderWrapper( source )
+ feature = reader.next()
+
+ payload.append( feature.name() )
+ # Strand:
+ payload.append( feature.strand )
+
+ # No notion of thick start, end in GFF, so make everything
+ # thick.
+ payload.append( start )
+ payload.append( end )
+
+ # Add blocks.
+ feature = convert_gff_coords_to_bed( feature )
+ block_sizes = [ (interval.end - interval.start ) for interval in feature.intervals ]
+ block_starts = [ ( interval.start - feature.start ) for interval in feature.intervals ]
+ blocks = zip( block_sizes, block_starts )
+ payload.append( [ ( start + block[1], start + block[1] + block[0] ) for block in blocks ] )
+
+ # Score.
+ payload.append( feature.score )
elif isinstance( self.original_dataset.datatype, Bed ):
# BED dataset.
+ feature = source.readline().split()
+ length = len(feature)
if length >= 4:
payload.append(feature[3]) # name
if length >= 6: # strand
payload.append(feature[5])
+ # Thick start, end.
if length >= 8:
payload.append(int(feature[6]))
payload.append(int(feature[7]))
@@ -356,8 +375,8 @@ class IntervalIndexDataProvider( TracksD
if length >= 12:
block_sizes = [ int(n) for n in feature[10].split(',') if n != '']
block_starts = [ int(n) for n in feature[11].split(',') if n != '' ]
- blocks = zip(block_sizes, block_starts)
- payload.append( [ (start + block[1], start + block[1] + block[0]) for block in blocks] )
+ blocks = zip( block_sizes, block_starts )
+ payload.append( [ ( start + block[1], start + block[1] + block[0] ) for block in blocks ] )
if length >= 5:
payload.append( int(feature[4]) ) # score
--- a/lib/galaxy/datatypes/util/gff_util.py
+++ b/lib/galaxy/datatypes/util/gff_util.py
@@ -9,21 +9,28 @@ class GFFInterval( GenomicInterval ):
A GFF interval, including attributes. If file is strictly a GFF file,
only attribute is 'group.'
"""
- def __init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, default_strand, \
- fix_strand=False, raw_line='' ):
+ def __init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, \
+ score_col, default_strand, fix_strand=False, raw_line='' ):
GenomicInterval.__init__( self, reader, fields, chrom_col, start_col, end_col, strand_col, \
default_strand, fix_strand=fix_strand )
+ # Handle score column.
+ self.score_col = score_col
+ if self.score_col >= self.nfields:
+ raise MissingFieldError( "No field for score_col (%d)" % score_col )
+ self.score = self.fields[ self.score_col ]
+
+ # Attributes specific to GFF.
self.raw_line = raw_line
self.attributes = parse_gff_attributes( fields[8] )
-class GFFFeature( GenomicInterval ):
+class GFFFeature( GFFInterval ):
"""
A GFF feature, which can include multiple intervals.
"""
- def __init__( self, reader, chrom_col, start_col, end_col, strand_col, default_strand, \
+ def __init__( self, reader, chrom_col, start_col, end_col, strand_col, score_col, default_strand, \
fix_strand=False, intervals=[] ):
- GenomicInterval.__init__( self, reader, intervals[0].fields, chrom_col, start_col, end_col, \
- strand_col, default_strand, fix_strand=fix_strand )
+ GFFInterval.__init__( self, reader, intervals[0].fields, chrom_col, start_col, end_col, \
+ strand_col, score_col, default_strand, fix_strand=fix_strand )
self.intervals = intervals
# Use intervals to set feature attributes.
for interval in self.intervals:
@@ -40,6 +47,15 @@ class GFFFeature( GenomicInterval ):
if interval.end > self.end:
self.end = interval.end
+ def name( self ):
+ """ Returns feature's name. """
+ name = self.attributes.get( 'transcript_id', None )
+ if not name:
+ name = self.attributes.get( 'id', None )
+ if not name:
+ name = self.attributes.get( 'group', None )
+ return name
+
class GFFIntervalToBEDReaderWrapper( NiceReaderWrapper ):
"""
Reader wrapper that reads GFF intervals/lines and automatically converts
@@ -60,7 +76,7 @@ class GFFReaderWrapper( NiceReaderWrappe
Reader wrapper for GFF files.
Wrapper has two major functions:
- (1) group entries for GFF file (via group column), GFF3 (via id attribute ),
+ (1) group entries for GFF file (via group column), GFF3 (via id attribute),
or GTF (via gene_id/transcript id);
(2) convert coordinates from GFF format--starting and ending coordinates
are 1-based, closed--to the 'traditional'/BED interval format--0 based,
@@ -68,24 +84,29 @@ class GFFReaderWrapper( NiceReaderWrappe
expect traditional interval format.
"""
- def __init__( self, reader, **kwargs ):
+ def __init__( self, reader, chrom_col=0, start_col=3, end_col=4, strand_col=6, score_col=5, **kwargs ):
"""
Create wrapper. Defaults are group_entries=False and
convert_coords_to_bed=True to support backward compatibility.
"""
+
+ # Add columns to kwargs here so that defaults can be used rather than
+ # requiring them to be passed in.
+ kwargs[ 'chrom_col' ] = chrom_col
+ kwargs[ 'start_col' ] = start_col
+ kwargs[ 'end_col' ] = end_col
+ kwargs[ 'strand_col' ] = strand_col
NiceReaderWrapper.__init__( self, reader, **kwargs )
- self.group_entries = kwargs.get( 'group_entries', False )
- self.convert_coords_to_bed = kwargs.get( 'convert_coords_to_bed', True )
+ # HACK: NiceReaderWrapper (bx-python) does not handle score_col yet, so store ourselves.
+ self.score_col = score_col
self.last_line = None
self.cur_offset = 0
self.seed_interval = None
def parse_row( self, line ):
interval = GFFInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, \
- self.end_col, self.strand_col, self.default_strand, \
+ self.end_col, self.strand_col, self.score_col, self.default_strand, \
fix_strand=self.fix_strand, raw_line=line )
- if self.convert_coords_to_bed:
- interval = convert_gff_coords_to_bed( interval )
return interval
def next( self ):
@@ -105,6 +126,9 @@ class GFFReaderWrapper( NiceReaderWrappe
if self.skipped < 10:
self.skipped_lines.append( ( self.linenum, self.current_line, str( e ) ) )
+ # For debugging, uncomment this to propogate parsing exceptions up.
+ # raise e
+
#
# Get next GFFFeature
#
@@ -159,7 +183,7 @@ class GFFReaderWrapper( NiceReaderWrappe
# Return GFF feature with all intervals.
return GFFFeature( self, self.chrom_col, self.start_col, self.end_col, self.strand_col, \
- self.default_strand, fix_strand=self.fix_strand, \
+ self.score_col, self.default_strand, fix_strand=self.fix_strand, \
intervals=feature_intervals )
@@ -179,12 +203,15 @@ def convert_bed_coords_to_gff( interval
def convert_gff_coords_to_bed( interval ):
"""
Converts an interval object's coordinates from GFF format to BED format.
- Accepted object types include GenomicInterval and list (where the first
- element in the list is the interval's start, and the second element is
- the interval's end).
+ Accepted object types include GFFFeature, GenomicInterval, and list (where
+ the first element in the list is the interval's start, and the second
+ element is the interval's end).
"""
- if type( interval ) is GenomicInterval:
+ if isinstance( interval, GenomicInterval ):
interval.start -= 1
+ if isinstance( interval, GFFFeature ):
+ for subinterval in interval:
+ convert_gff_coords_to_bed( subinterval )
elif type ( interval ) is list:
interval[ 0 ] -= 1
return interval
--- a/lib/galaxy/datatypes/converters/gff_to_interval_index_converter.py
+++ b/lib/galaxy/datatypes/converters/gff_to_interval_index_converter.py
@@ -20,15 +20,9 @@ def main():
input_fname, out_fname = sys.argv[1:]
# Do conversion.
- chr_col, start_col, end_col, strand_col = ( 0, 3, 4, 6 )
index = Indexes()
offset = 0
- reader_wrapper = GFFReaderWrapper( fileinput.FileInput( input_fname ),
- chrom_col=chr_col,
- start_col=start_col,
- end_col=end_col,
- strand_col=strand_col,
- fix_strand=True )
+ reader_wrapper = GFFReaderWrapper( fileinput.FileInput( input_fname ), fix_strand=True )
for feature in list( reader_wrapper ):
# TODO: need to address comments:
# if comment:
@@ -49,7 +43,7 @@ def main():
offset += feature_len
index.write( open(out_fname, "w") )
-
+
if __name__ == "__main__":
main()
1
0
galaxy-dist commit 98009db17cb2: Refactor sam_bitwise_flag_filter tool, simplifying it and making it faster, especially when there are multiple flag criteria
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kanwei Li <kanwei(a)gmail.com>
# Date 1289677046 18000
# Node ID 98009db17cb2b21db626fc9c185a8fd22109a4cd
# Parent cadf13f67c6593d99f8134ba10baa211a026439b
Refactor sam_bitwise_flag_filter tool, simplifying it and making it faster, especially when there are multiple flag criteria
--- a/tools/samtools/sam_bitwise_flag_filter.py
+++ b/tools/samtools/sam_bitwise_flag_filter.py
@@ -1,4 +1,5 @@
#!/usr/bin/env python
+# Refactored on 11/13/2010 by Kanwei Li
import sys
import optparse
@@ -104,74 +105,45 @@ options (listed below) default to 'None'
default = '2',
help='Column containing SAM bitwise flag. 1-based')
- parser.add_option(
- '-d','--debug',
- dest='debug',
- action='store_true',
- default = False,
- help='Print debugging info')
-
options, args = parser.parse_args()
if options.input_sam:
infile = open ( options.input_sam, 'r')
else:
infile = sys.stdin
-
- option_values = { '0': False, '1': True, None: None }
-
- states = [];
- states.append( option_values[ options.is_paired ] )
- states.append( option_values[ options.is_proper_pair ] )
- states.append( option_values[ options.is_unmapped ] )
- states.append( option_values[ options.mate_is_unmapped ] )
- states.append( option_values[ options.query_strand ] )
- states.append( option_values[ options.mate_strand ] )
- states.append( option_values[ options.is_first ] )
- states.append( option_values[ options.is_second ] )
- states.append( option_values[ options.is_not_primary ] )
- states.append( option_values[ options.is_bad_quality ] )
- states.append( option_values[ options.is_duplicate ] )
-
+
+ opt_ary = [
+ options.is_paired,
+ options.is_proper_pair,
+ options.is_unmapped,
+ options.mate_is_unmapped,
+ options.query_strand,
+ options.mate_strand,
+ options.is_first,
+ options.is_second,
+ options.is_not_primary,
+ options.is_bad_quality,
+ options.is_duplicate
+ ]
+
+ opt_map = { '0': False, '1': True }
+ used_indices = [(index, opt_map[opt]) for index, opt in enumerate(opt_ary) if opt is not None]
+ flag_col = int( options.flag_col ) - 1
+
for line in infile:
line = line.rstrip( '\r\n' )
if line and not line.startswith( '#' ) and not line.startswith( '@' ) :
fields = line.split( '\t' )
- sam_states = []
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0001 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0002 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0004 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0008 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0010 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0020 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0040 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0080 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0100 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0200 ) )
- sam_states.append( bool( int( fields[ int( options.flag_col ) - 1 ] ) & 0x0400 ) )
-
- joined_states = zip(states,sam_states)
- searchable_fields = []
-
- for i in range( len( joined_states ) ):
- if joined_states[i][0] != None:
- searchable_fields.append( joined_states[ i ] )
+ flags = int( fields[flag_col] )
valid_line = True
-
- for i in range( len( searchable_fields ) ):
- if searchable_fields[i][0] != searchable_fields[i][1]:
+ for index, opt_bool in used_indices:
+ if bool(flags & 0x0001 << index) != opt_bool:
valid_line = False
+ break
if valid_line:
print line
- if options.debug:
- for i in range( len( joined_states ) ):
- print i, joined_states[i][0], joined_states[i][1]
-
-# if skipped_lines > 0:
-# print 'Skipped %d invalid lines' % skipped_lines
-
if __name__ == "__main__": main()
1
0
galaxy-dist commit 0171a44ec826: Add necessary file for commit 4602:2b8161827380
by commits-noreplyï¼ bitbucket.org 20 Nov '10
by commits-noreplyï¼ bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User jeremy goecks <jeremy.goecks(a)emory.edu>
# Date 1289752267 18000
# Node ID 0171a44ec8268209b762965d7a66a928e077e1d4
# Parent 2b81618273808135efd9409f953161481944fec2
Add necessary file for commit 4602:2b8161827380
--- /dev/null
+++ b/lib/galaxy/datatypes/util/__init__.py
@@ -0,0 +1,3 @@
+"""
+Utilities for Galaxy datatypes.
+"""
1
0