- galaxy-commits - lists.galaxyproject.org

galaxy-dist commit 6d218af7906a: Add history import and export functionality to Galaxy. Options for exporting the current history to a file or importing a history from a file are now listed in the history options menu. Also modified the form builder to support file inputs.
by commits-noreply＠bitbucket.org 07 Jun '10

07 Jun '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User jeremy goecks <jeremy.goecks(a)emory.edu> # Date 1275581854 14400 # Node ID 6d218af7906af1f9524d02f785885bf1fd508f16 # Parent a12eeed213ff6d8581073ad77914b12dfc26f9bd Add history import and export functionality to Galaxy. Options for exporting the current history to a file or importing a history from a file are now listed in the history options menu. Also modified the form builder to support file inputs. --- a/templates/root/index.mako +++ b/templates/root/index.mako @@ -35,12 +35,19 @@ "Show structure": function() { galaxy_main.location = "${h.url_for( controller='history', action='display_structured' )}"; }, + "Export to File": function() { + galaxy_main.location = "${h.url_for( controller='history', action='export_archive' )}"; + }, "Delete": function() { if ( confirm( "Really delete the current history?" ) ) { galaxy_main.location = "${h.url_for( controller='history', action='delete_current' )}"; } + }, + "Other Actions": null, + "Import from File": function() { + galaxy_main.location = "${h.url_for( controller='history', action='import_archive' )}"; } }); }); --- a/templates/form.mako +++ b/templates/form.mako @@ -55,7 +55,18 @@ <div class="form" style="margin: 1em"><div class="form-title">${form.title}</div><div class="form-body"> - <form name="${form.name}" action="${form.action}" method="post" > + <% + has_file_input = False + for input in form.inputs: + if input.type == 'file': + has_file_input = True + break + %> + <form name="${form.name}" action="${form.action}" method="post" + %if has_file_input: + enctype="multipart/form-data" + %endif + > %for input in form.inputs: <% cls = "form-row" --- /dev/null +++ b/database/export/info.txt @@ -0,0 +1,1 @@ +This folder contains the data that can be exported. --- a/lib/galaxy/web/controllers/history.py +++ b/lib/galaxy/web/controllers/history.py @@ -6,9 +6,10 @@ from galaxy.model.mapping import desc from galaxy.model.orm import * from galaxy.util.json import * from galaxy.util.sanitize_html import sanitize_html +from galaxy.tools.actions import upload_common from galaxy.tags.tag_handler import GalaxyTagHandler from sqlalchemy.sql.expression import ClauseElement -import webhelpers, logging, operator +import webhelpers, logging, operator, tempfile, subprocess, shutil from datetime import datetime from cgi import escape @@ -441,6 +442,226 @@ class HistoryController( BaseController, self.add_item_annotation( trans, history, new_annotation ) trans.sa_session.flush() return new_annotation + + @web.expose + def import_archive( self, trans, archived_history=None ): + """ Import a history. """ + + if archived_history is not None: + # Import archived history. + try: + archive_file = archived_history.file + + # Unpack archive in temporary directory. + temp_output_dir = tempfile.mkdtemp() + cmd = "pax -z -r < %s " % archive_file.name + temp_stderr_name = tempfile.NamedTemporaryFile( dir=temp_output_dir ).name + temp_stderr = open( temp_stderr_name, 'wb' ) + proc = subprocess.Popen( args=cmd, shell=True, cwd=temp_output_dir, stderr=temp_stderr.fileno() ) + returncode = proc.wait() + temp_stderr.close() + + # Read history attributes. + history_attr_in = open( '%s/%s' % ( temp_output_dir, 'history_attrs.txt'), 'rb' ) + history_attr_str = '' + buffsize = 1048576 + try: + while True: + history_attr_str += history_attr_in.read( buffsize ) + if not history_attr_str or len( history_attr_str ) % buffsize != 0: + break + except OverflowError: + pass + history_attrs = from_json_string( history_attr_str ) + + # Create history. + # TODO: set tags, annotations. + new_history = model.History( name='imported: %s' % history_attrs['name'].encode( 'utf-8' ), user=trans.user ) + trans.sa_session.add( new_history ) + trans.sa_session.flush() + # TODO: Ignore hid_counter for now since it just artificially increases the hid for all the history's HDAs. + #new_history.hid_counter = history_attrs['hid_counter'] + new_history.genome_build = history_attrs['genome_build'] + trans.sa_session.flush() + + # Read datasets attributes. + datasets_attr_in = open( '%s/%s' % ( temp_output_dir, 'datasets_attrs.txt'), 'rb' ) + datasets_attr_str = '' + buffsize = 1048576 + try: + while True: + datasets_attr_str += datasets_attr_in.read( buffsize ) + if not datasets_attr_str or len( datasets_attr_str ) % buffsize != 0: + break + except OverflowError: + pass + datasets_attrs = from_json_string( datasets_attr_str ) + + # Create datasets. + for dataset_attrs in datasets_attrs: + metadata = dataset_attrs['metadata'] + + # Create dataset and HDA. + hda = trans.app.model.HistoryDatasetAssociation( name = dataset_attrs['name'].encode( 'utf-8' ), + extension = dataset_attrs['extension'], + hid = dataset_attrs['hid'], + info = dataset_attrs['info'].encode( 'utf-8' ), + blurb = dataset_attrs['blurb'], + peek = dataset_attrs['peek'], + designation = dataset_attrs['designation'], + visible = dataset_attrs['visible'], + dbkey = metadata['dbkey'], + metadata = metadata, + history = new_history, + create_dataset = True, + sa_session = trans.sa_session ) + hda.state = hda.states.OK + trans.sa_session.add( hda ) + trans.sa_session.flush() + new_history.add_dataset( hda, genome_build = None ) + permissions = trans.app.security_agent.history_get_default_permissions( new_history ) + trans.app.security_agent.set_all_dataset_permissions( hda.dataset, permissions ) + trans.sa_session.flush() + + # Copy dataset data. + temp_dataset_name = '%s/datasets/%s' % ( temp_output_dir, dataset_attrs['file_name'] ) + shutil.copyfile( temp_dataset_name, hda.file_name ) + + # TODO: set tags, annotations. + + # Cleanup. + if os.path.exists( temp_output_dir ): + shutil.rmtree( temp_output_dir ) + + return trans.show_ok_message( message="History '%s' has been imported. " % history_attrs['name'] ) + except Exception, e: + return trans.show_error_message( 'Error importing history archive. ' + str( e ) ) + + + return trans.show_form( + web.FormBuilder( web.url_for(), "Import a History from an Archive", submit_text="Submit" ) + .add_input( "file", "Archived History File", "archived_history", value=None, error=None ) + ) + + @web.expose + def export_archive( self, trans, id=None ): + """ Export a history. """ + + # Get history to export. + if id: + history = self.get_history( trans, id, check_ownership=False, check_accessible=True ) + else: + # Use current history. + history = trans.history + + if not history: + return trans.show_error_message( "This history does not exist or you cannot export this history." ) + + history_export_dir_name = "./database/export" + archive_file_name = '%s/%s.tar.gz' % ( history_export_dir_name, trans.security.encode_id( history.id ) ) + # TODO: for now, always create archive when exporting; this is for debugging purposes. + if True: + # Condition for only creating an archive when history is newer than archive: + #not os.path.exists ( archive_file_name ) or datetime.utcfromtimestamp( os.path.getmtime( archive_file_name ) ) < history.update_time: + + # Create archive and stream back to client. + + # Simple method to convert strings to unicode in utf-8 format. Method should be used for all user input. + def unicode_wrangler( a_string ): + a_string_type = type ( a_string ) + if a_string_type is str: + return unicode( a_string, 'utf-8' ) + elif a_string_type is unicode: + return a_string.encode( 'utf-8' ) + + try: + # Use temporary directory for temp output files. + temp_output_dir = tempfile.mkdtemp() + + # Write history attributes to file. + # TODO: include tags, annotations. + history_attrs = { + "create_time" : history.create_time.__str__(), + "update_time" : history.update_time.__str__(), + "name" : unicode_wrangler( history.name ), + "hid_counter" : history.hid_counter, + "genome_build" : history.genome_build + } + history_attrs_file_name = tempfile.NamedTemporaryFile( dir=temp_output_dir ).name + history_attrs_out = open( history_attrs_file_name, 'w' ) + history_attrs_out.write( to_json_string( history_attrs ) ) + history_attrs_out.close() + new_name = '%s/%s' % ( temp_output_dir, "history_attrs.txt" ) + os.rename( history_attrs_file_name, new_name ) + history_attrs_file_name = new_name + + # Write datasets' attributes to file. + # TODO: include tags, annotations. + datasets = self.get_history_datasets( trans, history ) + datasets_attrs = [] + for dataset in datasets: + attribute_dict = { + "create_time" : dataset.create_time.__str__(), + "update_time" : dataset.update_time.__str__(), + "hid" : dataset.hid, + "name" : unicode_wrangler( dataset.name ), + "info" : unicode_wrangler( dataset.info ), + "blurb" : dataset.blurb, + "peek" : dataset.peek, + "extension" : dataset.extension, + "metadata" : dict( dataset.metadata.items() ), + "parent_id" : dataset.parent_id, + "designation" : dataset.designation, + "deleted" : dataset.deleted, + "visible" : dataset.visible, + "file_name" : dataset.file_name.split('/')[-1] + } + datasets_attrs.append( attribute_dict ) + datasets_attrs_file_name = tempfile.NamedTemporaryFile( dir=temp_output_dir ).name + datasets_attrs_out = open( datasets_attrs_file_name, 'w' ) + datasets_attrs_out.write( to_json_string( datasets_attrs ) ) + datasets_attrs_out.close() + new_name = '%s/%s' % ( temp_output_dir, "datasets_attrs.txt" ) + os.rename( datasets_attrs_file_name, new_name ) + datasets_attrs_file_name = new_name + + # Write temp file with all files to archive. These files are (a) history attributes file; (b) datasets attributes file; and (c) + # datasets files. + archive_list_file_name = tempfile.NamedTemporaryFile( dir=temp_output_dir ).name + archive_list_out = open( archive_list_file_name, 'w' ) + archive_list_out.write( '%s\n' % history_attrs_file_name ) + archive_list_out.write( '%s\n' % datasets_attrs_file_name ) + for dataset in datasets: + archive_list_out.write( '%s\n' % dataset.file_name ) + archive_list_out.close() + + # Use 'pax' to create compressed tar archive of history's datasets. -s options uses a regular expression to replace path + # information. + cmd = "pax -w -s ',.*history_attrs.txt,history_attrs.txt,' -s ',.*datasets_attrs.txt,datasets_attrs.txt,' -s ',/.*/,datasets/,' -x tar -z -f %s.tar.gz < %s" % ( trans.security.encode_id( history.id ), archive_list_file_name ) + temp_stderr_name = tempfile.NamedTemporaryFile( dir=temp_output_dir ).name + temp_stderr = open( temp_stderr_name, 'wb' ) + proc = subprocess.Popen( args=cmd, shell=True, cwd=history_export_dir_name, stderr=temp_stderr.fileno() ) + returncode = proc.wait() + temp_stderr.close() + + # Remove temp directory. + if os.path.exists( temp_output_dir ): + shutil.rmtree( temp_output_dir ) + + except Exception, e: + return trans.show_error_message( 'Error creating history archive. ' + str( e ) ) + + # Stream archive. + archive_file_name = '%s/%s.tar.gz' % ( history_export_dir_name, trans.security.encode_id( history.id ) ) + if os.path.exists( archive_file_name ): + valid_chars = '.,^_-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ' + hname = history.name + hname = ''.join(c in valid_chars and c or '_' for c in hname)[0:150] + trans.response.headers["Content-Disposition"] = "attachment; filename=Galaxy-History-%s.tar.gz" % ( hname ) + trans.response.set_content_type( 'application/x-gzip' ) + return open( archive_file_name ) + else: + return @web.expose @web.json

1 0

galaxy-dist commit ea2658d131b4: Fix for LibraryDatasetDatasetAssociation objects when created by importing a history item iinto a library, the copied_from_history_dataset_association_id will now be kept.
by commits-noreply＠bitbucket.org 07 Jun '10

07 Jun '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Greg Von Kuster <greg(a)bx.psu.edu> # Date 1275503088 14400 # Node ID ea2658d131b4c54fca14cdf2b5a66fbf128eaf40 # Parent cea1569d9efd3f89188f455e9eb101ac3ce48594 Fix for LibraryDatasetDatasetAssociation objects when created by importing a history item iinto a library, the copied_from_history_dataset_association_id will now be kept. Add a get_display_name() method to the LibraryDatasetDatasetAssociation class. Fix for the test_forms_and_requests.py functional test script, purge all created libraries created during the tests so following test runs will test correctly. --- a/lib/galaxy/model/__init__.py +++ b/lib/galaxy/model/__init__.py @@ -932,7 +932,7 @@ class LibraryFolder( object ): return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.dataset.deleted ] @property def active_datasets( self ): - # This needs to be a list + # This needs to be a list return [ ld.library_dataset_dataset_association.dataset for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] def get_display_name( self ): # Library folder name can be either a string or a unicode object. If string, @@ -997,8 +997,10 @@ class LibraryDatasetDatasetAssociation( # FIXME: sa_session is must be passed to DataSetInstance if the create_dataset # parameter in kwd is True so that the new object can be flushed. Is there a better way? DatasetInstance.__init__( self, sa_session=sa_session, **kwd ) - self.copied_from_history_dataset_association = copied_from_history_dataset_association - self.copied_from_library_dataset_dataset_association = copied_from_library_dataset_dataset_association + if copied_from_history_dataset_association: + self.copied_from_history_dataset_association_id = copied_from_history_dataset_association.id + if copied_from_library_dataset_dataset_association: + self.copied_from_library_dataset_dataset_association_id = copied_from_library_dataset_dataset_association.id self.library_dataset = library_dataset self.user = user def to_history_dataset_association( self, target_history, parent_id = None, add_to_history = False ): @@ -1085,6 +1087,15 @@ class LibraryDatasetDatasetAssociation( else: return template.get_widgets( trans.user ) return [] + def get_display_name( self ): + """ + LibraryDatasetDatasetAssociation name can be either a string or a unicode object. + If string, convert to unicode object assuming 'utf-8' format. + """ + ldda_name = self.name + if isinstance( ldda_name, str ): + ldda_name = unicode( ldda_name, 'utf-8' ) + return ldda_name class LibraryInfoAssociation( object ): def __init__( self, library, form_definition, info, inheritable=False ): --- a/test/functional/test_forms_and_requests.py +++ b/test/functional/test_forms_and_requests.py @@ -382,6 +382,16 @@ class TestFormsAndRequests( TwillTestCas sa_session.delete( a ) sa_session.flush() ################## + # Purge all libraries + ################## + for library in [ library_one ]: + self.delete_library_item( 'library_admin', + self.security.encode_id( library.id ), + self.security.encode_id( library.id ), + library.name, + item_type='library' ) + self.purge_library( self.security.encode_id( library.id ), library.name ) + ################## # Eliminate all non-private roles ################## for role in [ role_one, role_two ]:

1 0

galaxy-dist commit cea1569d9efd: add fly_modencode, worm_modencode, and wormbase tools to main
by commits-noreply＠bitbucket.org 01 Jun '10

01 Jun '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Nate Coraor <nate(a)bx.psu.edu> # Date 1275405570 14400 # Node ID cea1569d9efd3f89188f455e9eb101ac3ce48594 # Parent f65470ca24068dfb7e8c4539e2c30f64402224c1 add fly_modencode, worm_modencode, and wormbase tools to main --- a/tool_conf.xml.main +++ b/tool_conf.xml.main @@ -9,6 +9,9 @@ <tool file="data_source/biomart.xml" /><tool file="data_source/gramene_mart.xml" /><tool file="data_source/flymine.xml" /> + <tool file="data_source/fly_modencode.xml" /> + <tool file="data_source/worm_modencode.xml" /> + <tool file="data_source/wormbase.xml" /><tool file="data_source/eupathdb.xml" /><tool file="data_source/encode_db.xml" /><tool file="data_source/epigraph_import.xml" />

1 0

galaxy-dist commit bf51b81ec7b2: Add missing location files for buildbot
by commits-noreply＠bitbucket.org 01 Jun '10

01 Jun '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Nate Coraor <nate(a)bx.psu.edu> # Date 1274977347 14400 # Node ID bf51b81ec7b25d05676a408d0d12e773d538ef10 # Parent fbb990ec01fa7ee3bd9b13ea3f610c8463ad64b8 Add missing location files for buildbot --- a/buildbot_setup.sh +++ b/buildbot_setup.sh @@ -25,6 +25,7 @@ case "$OSTYPE" in esac LINKS=" +/galaxy/data/location/add_scores.loc /galaxy/data/location/alignseq.loc /galaxy/data/annotation_profiler /galaxy/data/annotation_profiler/annotation_profiler.loc @@ -35,6 +36,7 @@ LINKS=" /galaxy/data/location/bowtie_indices.loc /galaxy/data/location/bowtie_indices_color.loc /galaxy/data/location/bwa_index.loc +/galaxy/data/location/codingSnps.loc /galaxy/data/location/encode_datasets.loc /galaxy/home/universe/encode_feature_partitions /galaxy/data/location/lastz_seqs.loc

1 0

[hg] galaxy 3820: Committed mod_zip code from the wrong repo
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/58108ced520b changeset: 3820:58108ced520b user: Nate Coraor <nate(a)bx.psu.edu> date: Mon May 24 16:11:13 2010 -0400 description: Committed mod_zip code from the wrong repo diffstat: lib/galaxy/web/controllers/library_common.py | 14 ++++++++------ 1 files changed, 8 insertions(+), 6 deletions(-) diffs (48 lines): diff -r d1624544bc55 -r 58108ced520b lib/galaxy/web/controllers/library_common.py --- a/lib/galaxy/web/controllers/library_common.py Mon May 24 16:00:03 2010 -0400 +++ b/lib/galaxy/web/controllers/library_common.py Mon May 24 16:11:13 2010 -0400 @@ -1267,7 +1267,7 @@ for fname, relpath in self.files.items(): size = os.stat( fname ).st_size quoted_fname = urllib.quote_plus( fname, '/' ) - rval += '- %i %s%s %s\n' % ( size, self.url_base, quoted_fname, relpath ) + rval += '- %i %s%s %s\r\n' % ( size, self.url_base, quoted_fname, relpath ) return rval # Perform an action on a list of library datasets. params = util.Params( kwd ) @@ -1429,6 +1429,8 @@ message = "Unable to create archive for download, please report this error" status = 'error' if not error: + lname = trans.sa_session.query( trans.app.model.Library ).get( trans.security.decode_id( library_id ) ).name + fname = lname.replace( ' ', '_' ) + '_files' if action == 'zip': archive.close() tmpfh = open( tmpf ) @@ -1443,21 +1445,21 @@ status = 'error' if not error: trans.response.set_content_type( "application/x-zip-compressed" ) - trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (outfname,outext) + trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) return tmpfh elif action == 'ngxzip': - #trans.response.set_content_type( "application/x-zip-compressed" ) - #trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (outfname,outext) + trans.response.set_content_type( "application/x-zip-compressed" ) + trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) trans.response.headers[ "X-Archive-Files" ] = "zip" return archive else: trans.response.set_content_type( "application/x-tar" ) - trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (outfname,outext) + trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) archive.wsgi_status = trans.response.wsgi_status() archive.wsgi_headeritems = trans.response.wsgi_headeritems() return archive.stream else: # unknown action - message = '### unknown action = %s in act_on_multiple_datasets' % action + message = '### unknown action = %s in act_on_multiple_datasets' % action return trans.response.send_redirect( web.url_for( controller='library_common', action='browse_library',

1 0

[hg] galaxy 3819: lims: ui fixes in adding samples
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/d1624544bc55 changeset: 3819:d1624544bc55 user: rc date: Mon May 24 16:00:03 2010 -0400 description: lims: ui fixes in adding samples diffstat: lib/galaxy/web/controllers/requests.py | 63 +++++++++++++++---------- lib/galaxy/web/controllers/requests_admin.py | 63 +++++++++++++++---------- templates/admin/requests/show_request.mako | 52 ++++++++++++++------ templates/requests/show_request.mako | 69 +++++++++++++++++---------- test/base/twilltestcase.py | 6 +- 5 files changed, 159 insertions(+), 94 deletions(-) diffs (388 lines): diff -r f7525fb463e0 -r d1624544bc55 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Mon May 24 15:33:55 2010 -0400 +++ b/lib/galaxy/web/controllers/requests.py Mon May 24 16:00:03 2010 -0400 @@ -288,7 +288,7 @@ sample_copy=self.__copy_sample(current_samples), details='hide', edit_mode=util.restore_text( params.get( 'edit_mode', 'False' ) ), message=message, status=status ) - def __library_widgets(self, trans, user, sample_index, libraries, sample=None, **kwd): + def __library_widgets(self, trans, user, sample_index, libraries, sample=None, lib_id=None, folder_id=None, **kwd): ''' This method creates the data library & folder selectbox for creating & editing samples. First we get a list of all the libraries accessible to @@ -298,7 +298,8 @@ ''' params = util.Params( kwd ) # data library selectbox - lib_id = params.get( "sample_%i_library_id" % sample_index, 'none' ) + if not lib_id: + lib_id = params.get( "sample_%i_library_id" % sample_index, 'none' ) selected_lib = None if sample and lib_id == 'none': if sample.library: @@ -317,7 +318,7 @@ lib_widget.add_option('Select one', 'none') # all the libraries available to the selected user for lib, hidden_folder_ids in libraries.items(): - if str(lib.id) == lib_id: + if str(lib.id) == str(lib_id): lib_widget.add_option(lib.name, lib.id, selected=True) selected_lib, selected_hidden_folder_ids = lib, hidden_folder_ids.split(',') else: @@ -338,7 +339,10 @@ else: current_fid = params.get( "sample_%i_folder_id" % sample_index, 'none' ) else: - current_fid = 'none' + if folder_id: + current_fid = folder_id + else: + current_fid = 'none' # first option if lib_id == 'none': folder_widget.add_option('Select one', 'none', selected=True) @@ -479,29 +483,38 @@ # if the user has selected a sample no. to copy then copy the contents # of the src sample to the new sample else an empty sample src_sample_index = int(params.get( 'copy_sample', -1 )) + # get the number of new copies of the src sample + num_sample_to_copy = int(params.get( 'num_sample_to_copy', 1 )) if src_sample_index == -1: - # empty sample - lib_widget, folder_widget = self.__library_widgets(trans, request.user, - len(current_samples), - libraries, None, **kwd) - current_samples.append(dict(name='Sample_%i' % (len(current_samples)+1), - barcode='', - library=None, - folder=None, - field_values=['' for field in request.type.sample_form.fields], - lib_widget=lib_widget, - folder_widget=folder_widget)) + for ns in range(num_sample_to_copy): + # empty sample + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, None, **kwd) + current_samples.append(dict(name='Sample_%i' % (len(current_samples)+1), + barcode='', + library=None, + folder=None, + field_values=['' for field in request.type.sample_form.fields], + lib_widget=lib_widget, + folder_widget=folder_widget)) else: - lib_widget, folder_widget = self.__library_widgets(trans, request.user, - len(current_samples), - libraries, None, **kwd) - current_samples.append(dict(name=current_samples[src_sample_index]['name']+'_%i' % (len(current_samples)+1), - barcode='', - library_id='none', - folder_id='none', - field_values=[val for val in current_samples[src_sample_index]['field_values']], - lib_widget=lib_widget, - folder_widget=folder_widget)) + src_library_id = current_samples[src_sample_index]['lib_widget'].get_selected()[1] + src_folder_id = current_samples[src_sample_index]['folder_widget'].get_selected()[1] + for ns in range(num_sample_to_copy): + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, sample=None, + lib_id=src_library_id, + folder_id=src_folder_id, + **kwd) + current_samples.append(dict(name=current_samples[src_sample_index]['name']+'_%i' % (len(current_samples)+1), + barcode='', + library_id='none', + folder_id='none', + field_values=[val for val in current_samples[src_sample_index]['field_values']], + lib_widget=lib_widget, + folder_widget=folder_widget)) return trans.fill_template( '/requests/show_request.mako', request=request, request_details=self.request_details(trans, request.id), diff -r f7525fb463e0 -r d1624544bc55 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Mon May 24 15:33:55 2010 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Mon May 24 16:00:03 2010 -0400 @@ -805,7 +805,7 @@ sample_copy=self.__copy_sample(current_samples), details='hide', edit_mode=util.restore_text( params.get( 'edit_mode', 'False' ) ), message=message, status=status ) - def __library_widgets(self, trans, user, sample_index, libraries, sample=None, **kwd): + def __library_widgets(self, trans, user, sample_index, libraries, sample=None, lib_id=None, folder_id=None, **kwd): ''' This method creates the data library & folder selectbox for creating & editing samples. First we get a list of all the libraries accessible to @@ -815,7 +815,8 @@ ''' params = util.Params( kwd ) # data library selectbox - lib_id = params.get( "sample_%i_library_id" % sample_index, 'none' ) + if not lib_id: + lib_id = params.get( "sample_%i_library_id" % sample_index, 'none' ) selected_lib = None if sample and lib_id == 'none': if sample.library: @@ -834,7 +835,7 @@ lib_widget.add_option('Select one', 'none') # all the libraries available to the selected user for lib, hidden_folder_ids in libraries.items(): - if str(lib.id) == lib_id: + if str(lib.id) == str(lib_id): lib_widget.add_option(lib.name, lib.id, selected=True) selected_lib, selected_hidden_folder_ids = lib, hidden_folder_ids.split(',') else: @@ -855,7 +856,10 @@ else: current_fid = params.get( "sample_%i_folder_id" % sample_index, 'none' ) else: - current_fid = 'none' + if folder_id: + current_fid = folder_id + else: + current_fid = 'none' # first option if lib_id == 'none': folder_widget.add_option('Select one', 'none', selected=True) @@ -995,29 +999,38 @@ # if the user has selected a sample no. to copy then copy the contents # of the src sample to the new sample else an empty sample src_sample_index = int(params.get( 'copy_sample', -1 )) + # get the number of new copies of the src sample + num_sample_to_copy = int(params.get( 'num_sample_to_copy', 1 )) if src_sample_index == -1: - # empty sample - lib_widget, folder_widget = self.__library_widgets(trans, request.user, - len(current_samples), - libraries, None, **kwd) - current_samples.append(dict(name='Sample_%i' % (len(current_samples)+1), - barcode='', - library=None, - folder=None, - field_values=['' for field in request.type.sample_form.fields], - lib_widget=lib_widget, - folder_widget=folder_widget)) + for ns in range(num_sample_to_copy): + # empty sample + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, None, **kwd) + current_samples.append(dict(name='Sample_%i' % (len(current_samples)+1), + barcode='', + library=None, + folder=None, + field_values=['' for field in request.type.sample_form.fields], + lib_widget=lib_widget, + folder_widget=folder_widget)) else: - lib_widget, folder_widget = self.__library_widgets(trans, request.user, - len(current_samples), - libraries, None, **kwd) - current_samples.append(dict(name=current_samples[src_sample_index]['name']+'_%i' % (len(current_samples)+1), - barcode='', - library_id='none', - folder_id='none', - field_values=[val for val in current_samples[src_sample_index]['field_values']], - lib_widget=lib_widget, - folder_widget=folder_widget)) + src_library_id = current_samples[src_sample_index]['lib_widget'].get_selected()[1] + src_folder_id = current_samples[src_sample_index]['folder_widget'].get_selected()[1] + for ns in range(num_sample_to_copy): + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, sample=None, + lib_id=src_library_id, + folder_id=src_folder_id, + **kwd) + current_samples.append(dict(name=current_samples[src_sample_index]['name']+'_%i' % (len(current_samples)+1), + barcode='', + library_id='none', + folder_id='none', + field_values=[val for val in current_samples[src_sample_index]['field_values']], + lib_widget=lib_widget, + folder_widget=folder_widget)) return trans.fill_template( '/admin/requests/show_request.mako', request=request, request_details=self.request_details(trans, request.id), diff -r f7525fb463e0 -r d1624544bc55 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Mon May 24 15:33:55 2010 -0400 +++ b/templates/admin/requests/show_request.mako Mon May 24 16:00:03 2010 -0400 @@ -444,8 +444,7 @@ %else: <label>There are no samples.</label> %endif - </div> - + </div> %if request.samples and request.submitted(): <script type="text/javascript"> // Updater @@ -458,25 +457,23 @@ <tbody> <tr> <div class="form-row"> + + %if request.unsubmitted(): + <td> + %if current_samples: + <label>Copy </label> + <input type="integer" name="num_sample_to_copy" value="1" size="3"/> + <label>sample(s) from sample</label> + ${sample_copy.get_html()} + %endif + <input type="submit" name="add_sample_button" value="Add New"/> + </td> + %endif <td> %if current_samples: <input type="submit" name="edit_samples_button" value="Edit samples"/> %endif </td> - %if request.unsubmitted(): - <td> - <label>Import from csv file</label> - <input type="file" name="file_data" /> - <input type="submit" name="import_samples_button" value="Import samples"/> - </td> - <td> - %if current_samples: - <label>Copy from sample</label> - ${sample_copy.get_html()} - %endif - <input type="submit" name="add_sample_button" value="Add New"/> - </td> - %endif </div> </tr> </tbody> @@ -504,3 +501,26 @@ <input type="hidden" name="request_id" value="${request.id}" /> </form> </div> + +<br/> + +%if request.unsubmitted(): +<div class="toolForm"> + <div class="form-row"> + <div class="msg_list"> + <h4 class="msg_head"><u>Import Samples</u></h4> + <div class="msg_body"> + <label>Import from csv file</label> + <input type="file" name="file_data" /> + <input type="submit" name="import_samples_button" value="Import samples"/> + <br/> + <div class="toolParamHelp" style="clear: both;"> + The csv file must be in the following format:<br/> + SampleName,DataLibrary,DataLibraryFolder,FieldValue1,FieldValue2... + </div> + </div> + </div> + </div> +</div> +%endif + diff -r f7525fb463e0 -r d1624544bc55 templates/requests/show_request.mako --- a/templates/requests/show_request.mako Mon May 24 15:33:55 2010 -0400 +++ b/templates/requests/show_request.mako Mon May 24 16:00:03 2010 -0400 @@ -364,31 +364,28 @@ %endif </div> %if request.unsubmitted() and edit_mode == 'False': - <table class="grid"> - <tbody> - <tr> - <div class="form-row"> - <td> - %if current_samples: - <input type="submit" name="edit_samples_button" value="Edit samples"/> - %endif - </td> - <td> - <label>Import from csv file</label> - <input type="file" name="file_data" /> - <input type="submit" name="import_samples_button" value="Import samples"/> - </td> - <td> - %if current_samples: - <label>Copy from sample</label> - ${sample_copy.get_html()} - %endif - <input type="submit" name="add_sample_button" value="Add New"/> - </td> - </div> - </tr> - </tbody> - </table> + <table class="grid"> + <tbody> + <tr> + <div class="form-row"> + <td> + %if current_samples: + <label>Copy </label> + <input type="integer" name="num_sample_to_copy" value="1" size="3"/> + <label>sample(s) from sample</label> + ${sample_copy.get_html()} + %endif + <input type="submit" name="add_sample_button" value="Add New"/> + </td> + <td> + %if current_samples: + <input type="submit" name="edit_samples_button" value="Edit samples"/> + %endif + </td> + </div> + </tr> + </tbody> + </table> %endif %if request.unsubmitted() and (request.samples or current_samples): <div class="form-row"> @@ -407,3 +404,25 @@ <input type="hidden" name="request_id" value="${request.id}" /> </form> </div> + + +<br/> +%if request.unsubmitted(): +<div class="toolForm"> + <div class="form-row"> + <div class="msg_list"> + <h4 class="msg_head"><u>Import Samples</u></h4> + <div class="msg_body"> + <label>Import from csv file</label> + <input type="file" name="file_data" /> + <input type="submit" name="import_samples_button" value="Import samples"/> + <br/> + <div class="toolParamHelp" style="clear: both;"> + The csv file must be in the following format:<br/> + SampleName,DataLibrary,DataLibraryFolder,FieldValue1,FieldValue2... + </div> + </div> + </div> + </div> +</div> +%endif diff -r f7525fb463e0 -r d1624544bc55 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Mon May 24 15:33:55 2010 -0400 +++ b/test/base/twilltestcase.py Mon May 24 16:00:03 2010 -0400 @@ -1572,14 +1572,14 @@ self.check_page_for_string( 'There are no samples.' ) # this redundant stmt below is add so that the second form in # the page gets selected - tc.fv( "2", "request_id", request_id ) + tc.fv( "3", "request_id", request_id ) for sample_index, sample in enumerate(samples): tc.submit( "add_sample_button" ) self.check_page_for_string( 'Sequencing Request "%s"' % request_name ) sample_name, fields = sample - tc.fv( "2", "sample_%i_name" % sample_index, sample_name ) + tc.fv( "3", "sample_%i_name" % sample_index, sample_name ) for field_index, field_value in enumerate(fields): - tc.fv( "2", "sample_%i_field_%i" % ( sample_index, field_index ), field_value ) + tc.fv( "3", "sample_%i_field_%i" % ( sample_index, field_index ), field_value ) tc.submit( "save_samples_button" ) for sample_name, fields in samples: self.check_page_for_string( sample_name )

1 0

[hg] galaxy 3818: Allow FASTQ Groomer/parser to work on tab-deli...
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/f7525fb463e0 changeset: 3818:f7525fb463e0 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Mon May 24 15:33:55 2010 -0400 description: Allow FASTQ Groomer/parser to work on tab-delimited decimal scores. diffstat: lib/galaxy_utils/sequence/fastq.py | 11 ++++++++--- test-data/sanger_full_range_as_tab_decimal_sanger.fastqsanger | 8 ++++++++ tools/fastq/fastq_groomer.xml | 11 ++++++++++- 3 files changed, 26 insertions(+), 4 deletions(-) diffs (72 lines): diff -r 86fe916dbdb5 -r f7525fb463e0 lib/galaxy_utils/sequence/fastq.py --- a/lib/galaxy_utils/sequence/fastq.py Mon May 24 15:10:31 2010 -0400 +++ b/lib/galaxy_utils/sequence/fastq.py Mon May 24 15:33:55 2010 -0400 @@ -41,7 +41,12 @@ def convert_color_to_base_space( cls, sequence ): return cls.color_space_converter.to_base_space( sequence ) def is_ascii_encoded( self ): - return ' ' not in self.quality #as per fastq definition only decimal quality strings can have spaces in them (and must have a trailing space) + #as per fastq definition only decimal quality strings can have spaces (and TABs for our purposes) in them (and must have a trailing space) + if ' ' in self.quality: + return False + if '\t' in self.quality: + return False + return True def get_ascii_quality_scores( self ): if self.is_ascii_encoded(): return list( self.quality ) @@ -49,7 +54,7 @@ quality = self.quality.rstrip() #decimal scores should have a trailing space if quality: try: - return [ chr( int( val ) + self.ascii_min - self.quality_min ) for val in quality.split( ' ' ) ] + return [ chr( int( val ) + self.ascii_min - self.quality_min ) for val in quality.split() ] except ValueError, e: raise ValueError( 'Error Parsing quality String. ASCII quality strings cannot contain spaces (%s): %s' % ( self.quality, e ) ) else: @@ -60,7 +65,7 @@ else: quality = self.quality.rstrip() #decimal scores should have a trailing space if quality: - return [ int( val ) for val in quality.split( ' ' ) if val.strip() ] + return [ int( val ) for val in quality.split() if val.strip() ] else: return [] def convert_read_to_format( self, format, force_quality_encoding = None ): diff -r 86fe916dbdb5 -r f7525fb463e0 test-data/sanger_full_range_as_tab_decimal_sanger.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sanger_full_range_as_tab_decimal_sanger.fastqsanger Mon May 24 15:33:55 2010 -0400 @@ -0,0 +1,8 @@ +@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) +ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC ++ +0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 +@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) +CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ++ +93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 diff -r 86fe916dbdb5 -r f7525fb463e0 tools/fastq/fastq_groomer.xml --- a/tools/fastq/fastq_groomer.xml Mon May 24 15:10:31 2010 -0400 +++ b/tools/fastq/fastq_groomer.xml Mon May 24 15:33:55 2010 -0400 @@ -1,4 +1,4 @@ -<tool id="fastq_groomer" name="FASTQ Groomer" version="1.0.2"> +<tool id="fastq_groomer" name="FASTQ Groomer" version="1.0.3"> <description>convert between various FASTQ quality formats</description> <command interpreter="python">fastq_groomer.py '$input_file' '$input_type' '$output_file' #if str( $options_type['options_type_selector'] ) == 'basic': @@ -288,6 +288,15 @@ <param name="summarize_input" value="summarize_input" /> <output name="output_file" file="sanger_full_range_as_decimal_sanger.fastqsanger" /> </test> + <test> + <param name="input_file" value="sanger_full_range_as_tab_decimal_sanger.fastqsanger" ftype="fastq" /> + <param name="input_type" value="sanger" /> + <param name="options_type_selector" value="advanced" /> + <param name="output_type" value="sanger" /> + <param name="force_quality_encoding" value="ascii" /> + <param name="summarize_input" value="summarize_input" /> + <output name="output_file" file="sanger_full_range_original_sanger.fastqsanger" /> + </test>  <test> <param name="input_file" value="solexa_full_range_as_decimal_solexa.fastqsolexa" ftype="fastq" />

1 0

[hg] galaxy 3817: fixed the status message box layout in grid
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/86fe916dbdb5 changeset: 3817:86fe916dbdb5 user: rc date: Mon May 24 15:10:31 2010 -0400 description: fixed the status message box layout in grid diffstat: templates/grid_base.mako | 7 ++++++- 1 files changed, 6 insertions(+), 1 deletions(-) diffs (17 lines): diff -r 8833ebe82ed1 -r 86fe916dbdb5 templates/grid_base.mako --- a/templates/grid_base.mako Mon May 24 15:08:57 2010 -0400 +++ b/templates/grid_base.mako Mon May 24 15:10:31 2010 -0400 @@ -679,7 +679,12 @@ <tr> <td width="75%">${self.render_grid_header( grid )}</td> <td></td> - <td width="25%" id="grid-message" valign="top">${render_message( message, status )}</td> + <td></td> + </tr> + <tr> + <td width="100%" id="grid-message" valign="top">${render_message( message, status )}</td> + <td></td> + <td></td> </tr> </table>

1 0

[hg] galaxy 3816: sff_converter tool functional test
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/8833ebe82ed1 changeset: 3816:8833ebe82ed1 user: rc date: Mon May 24 15:08:57 2010 -0400 description: sff_converter tool functional test diffstat: test-data/2.sff | 0 test-data/sff_converter_fasta.dat | 6 ++ test-data/sff_converter_fastq.dat | 12 +++++ test-data/sff_converter_qual.dat | 6 ++ test-data/sff_converter_xml_1.dat | 18 ++++++++ test-data/sff_converter_xml_2.dat | 18 ++++++++ tools/filters/sff_extractor.xml | 83 +++++++++++++++++++++++-------------- 7 files changed, 111 insertions(+), 32 deletions(-) diffs (176 lines): diff -r cbacbb736899 -r 8833ebe82ed1 test-data/2.sff Binary file test-data/2.sff has changed diff -r cbacbb736899 -r 8833ebe82ed1 test-data/sff_converter_fasta.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sff_converter_fasta.dat Mon May 24 15:08:57 2010 -0400 @@ -0,0 +1,6 @@ +>GGOQ6K301BJT46 +gactACACGTAGTATAAGCTAAATGTTGGAGAGGATGCTGTAATCAACGTTTTGTGTCTCCTTACAGGACACCAGCTGATTTGGAGGTCATCCAATATAAACCTGGCTGGAACTTGCTATGGTTAGGAGAGCTATGAATGGAAGAGATAATTCCATTATTTAATAAGGCTACAGACAAATTAGGACAAGAAGCAGCTATTAGATTATTTAGTGCTAGCACACCTAAATAGAGAGAGATAAATTCATTAGACTTTTTGCTAttttattgacttttggagagacagtatttaaagtaccaaatcccagaggttgcctatgttggtggtgttgcaagctctattattggcgattgcaatctaccttatccataagttctgcttagagattatttgttattaattttcatctacatcaataaatataggacagtaaggattttgtacaaaatagacaatgggataggtaccagaagaggacagaggaattactggtattttgatatagactacactaacgtacgtacgtaggaattttaaccgggg +>GGOQ6K301AWPXS +gactACGTACACACTGGAATAAAATGGAGTTTTCATACTAGAGATTATTATATGGGCTATGTAAAAGAACTAGTAGCAGGATCTAGCACACCAGACAGCCTAAGACTGTATATTTTATATAAGCAACCCGTTATGGCATGGGAAATATCGCCCAGGGTTAAAAAATTTTAACAAGGAATGGCCTTTTTGTAAATATGTGGATAAAAAACAGGGTTCATGTGGGATGATATTGAAAAACAAAAGATTTGCGTAGGAGGAGAAATATCACCAGGATGGGGACCTGGAATGGTTGGCATAGCAAATAAAAGCCTTTAGTTGTGGGGAGAGAAAAATCGAGGCAACTCCTGTTATGATTATAAGAGAAGAGATAGATCCCAAAAAATGGTGTGGAGATTGTTGGAATTTAATGTGTCTTAGAAACTCACCTCCAGGAACGTTGTCAAAGACTCGCTATGTTGGCATGTGGACGGaaagactaaatgttggagaggatgctgtatcaacgttttgttgtcgtccttacacggacaccagctgtagttgtctgtagnttttaccggg +>GGOQ6K301A8J46 +gactACTATACGAGTCTGCCAATCTTCTTCACTCATCCCCTTCAGGAAGAGTGCAGGGTTCTGGGACTCTCCGTATGTGCCTCCTAGGTACAAGAAAATATCCCCTCTCTTCATCCTTTAATAACACTGATCCTTGTCCCCAATACTCTACTCTCATTGGTCCTTTCCAATTTTTGTCTTTTTTGATCTTTATAGTAAATCCACTGACCTTGCAATTTGCTTGGAATTTGAGAAAAATAATCCTGTATTCTTAATGATTCTTGTTGTGTTAATAATTCATATGGGGGCCATTCCCCCTATTCTACCCCTTTGTTTAAAATTAAGGCAATGCAGAGCGAGAGCCAAAGCATTGTCTAAAGATGTTGTTTCAGGCAAAAACTTCTGAATCCAACACTTTAAAGTATTATTggcattttcaaccaaagcttgagtattgagggttgcctggtattccaaatttatgttttattccctatgtaattgtagtaaaccttcctattttttgattttctaaaatttggtccctattgttctgtttgctagttctgtaactattatgagtccaacctgtttagg diff -r cbacbb736899 -r 8833ebe82ed1 test-data/sff_converter_fastq.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sff_converter_fastq.dat Mon May 24 15:08:57 2010 -0400 @@ -0,0 +1,12 @@ +@GGOQ6K301BJT46 +gactACACGTAGTATAAGCTAAATGTTGGAGAGGATGCTGTAATCAACGTTTTGTGTCTCCTTACAGGACACCAGCTGATTTGGAGGTCATCCAATATAAACCTGGCTGGAACTTGCTATGGTTAGGAGAGCTATGAATGGAAGAGATAATTCCATTATTTAATAAGGCTACAGACAAATTAGGACAAGAAGCAGCTATTAGATTATTTAGTGCTAGCACACCTAAATAGAGAGAGATAAATTCATTAGACTTTTTGCTAttttattgacttttggagagacagtatttaaagtaccaaatcccagaggttgcctatgttggtggtgttgcaagctctattattggcgattgcaatctaccttatccataagttctgcttagagattatttgttattaattttcatctacatcaataaatataggacagtaaggattttgtacaaaatagacaatgggataggtaccagaagaggacagaggaattactggtattttgatatagactacactaacgtacgtacgtaggaattttaaccgggg ++ +FFFFFFFFFFFFFFFIIIIIHHHHHFFBBBFEDDFFFFFHHGFFFFFFF????FFFFFFDDFFFFF<==<ADDDDDDAC8::DCDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFDDDFFFFFFFFFFFFFFFFFFFFFFA@@FFFFFFDD?????AAAAAB=??ADAACFFFFFDDDFFFFFFFFFDDDD544??8888000<2449=:<<?@841114?>AAAA?:::A???DBBA:::A?A//...::33,,,,------,,,,;;:89=9:9733...2223//9<688<444<AA::::8::BBAA@@>>>43434<4444449??@AA@BBBA:8:<A998<?4448<<<<244<3338<<>:884433822255,,,3--3,,,,,,,,,3774,,,33043///0,,,,,,,,,,,,111,,,,,),0....0),,,.,,,,,,,143.,,,.---86---20787777870206433,,,,,0,,,,,,,0..,,,...3,,,,-44444489965225666---- +@GGOQ6K301AWPXS +gactACGTACACACTGGAATAAAATGGAGTTTTCATACTAGAGATTATTATATGGGCTATGTAAAAGAACTAGTAGCAGGATCTAGCACACCAGACAGCCTAAGACTGTATATTTTATATAAGCAACCCGTTATGGCATGGGAAATATCGCCCAGGGTTAAAAAATTTTAACAAGGAATGGCCTTTTTGTAAATATGTGGATAAAAAACAGGGTTCATGTGGGATGATATTGAAAAACAAAAGATTTGCGTAGGAGGAGAAATATCACCAGGATGGGGACCTGGAATGGTTGGCATAGCAAATAAAAGCCTTTAGTTGTGGGGAGAGAAAAATCGAGGCAACTCCTGTTATGATTATAAGAGAAGAGATAGATCCCAAAAAATGGTGTGGAGATTGTTGGAATTTAATGTGTCTTAGAAACTCACCTCCAGGAACGTTGTCAAAGACTCGCTATGTTGGCATGTGGACGGaaagactaaatgttggagaggatgctgtatcaacgttttgttgtcgtccttacacggacaccagctgtagttgtctgtagnttttaccggg ++ +FFFFFFFFFFFFFDDDFFD@3333BAA?95558HFFFFFHIIIIIIIHIIIHH?;;A???940000836?AAABDFFFFFFFFFFFFA@@FFFFFFFFFF===?<?????88111119??????ADCCCCAAAAAAAAB555:::?>CFD==;A<9966,,,,,,,,,,,,=887766=;;22-----<466694?ABAAAD666666D7FFFFFFFFFF666FFFF?;;:A;<<75B....D7333<@A@?888<AA==;;<7@><;;<688<00009<>???<<<===<<897==73...3----:99666:>7996/////-<<11202>??AA=:55448BBB===AAADDDDDAA>>===DB@>9723000,,,,,,300004;;><<:99666666.,,,,/7600,,,9922/33000020.00011742---223380220786646770---0331.00..,,,,,,0,,,,,,,..0144330,,,0.0,,,,,,,,,,,)),,,,,,1..,,,,,,,...,,,,,,.,,,,,,,,,,,,!//,--226:: +@GGOQ6K301A8J46 +gactACTATACGAGTCTGCCAATCTTCTTCACTCATCCCCTTCAGGAAGAGTGCAGGGTTCTGGGACTCTCCGTATGTGCCTCCTAGGTACAAGAAAATATCCCCTCTCTTCATCCTTTAATAACACTGATCCTTGTCCCCAATACTCTACTCTCATTGGTCCTTTCCAATTTTTGTCTTTTTTGATCTTTATAGTAAATCCACTGACCTTGCAATTTGCTTGGAATTTGAGAAAAATAATCCTGTATTCTTAATGATTCTTGTTGTGTTAATAATTCATATGGGGGCCATTCCCCCTATTCTACCCCTTTGTTTAAAATTAAGGCAATGCAGAGCGAGAGCCAAAGCATTGTCTAAAGATGTTGTTTCAGGCAAAAACTTCTGAATCCAACACTTTAAAGTATTATTggcattttcaaccaaagcttgagtattgagggttgcctggtattccaaatttatgttttattccctatgtaattgtagtaaaccttcctattttttgattttctaaaatttggtccctattgttctgtttgctagttctgtaactattatgagtccaacctgtttagg ++ +FFFFFFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIFFFFIIIIIIIIIIIIFHFFFFFFFF:::DFFFFFFFFFFFFFDDDFFFFAAABBDD=3333=7B::99?7BBBBBA?4400088/0008??BDDDDFFFFDDBBFFFFFFFFFFFFFFFFFFFFFF???DDB@--,,,=/7,,,,,-::==68<BAFFFFFFFDDDFFFFFFFFFDDD???FFFFDBA>999?94/////>34=;;?>?ABBB5666=BBBB?><=<<986....255---3==8,,,,,--357,,,,-8766=<=2444000977757664400554444<<?@@BDDDDDAAA???AAAAA555:???D<??>DD===DD88833553B443238<76654222....,07/166622///345429:<8888022263,,,.1300,,,00,0034413..,,,,-330-,000207..2220202.344.0.0.00027:----8://22--00,,,,,),,,,,,,00-000.0..00,,,0,,,.0430,,,.2022611...143,,,,,,,,,,000000 diff -r cbacbb736899 -r 8833ebe82ed1 test-data/sff_converter_qual.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sff_converter_qual.dat Mon May 24 15:08:57 2010 -0400 @@ -0,0 +1,6 @@ +>GGOQ6K301BJT46 +37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 39 39 39 39 39 37 37 33 33 33 37 36 35 35 37 37 37 37 37 39 39 38 37 37 37 37 37 37 37 30 30 30 30 37 37 37 37 37 37 35 35 37 37 37 37 37 27 28 28 27 32 35 35 35 35 35 35 32 34 23 25 25 35 34 35 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 35 35 35 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 32 31 31 37 37 37 37 37 37 35 35 30 30 30 30 30 32 32 32 32 32 33 28 30 30 32 35 32 32 34 37 37 37 37 37 35 35 35 37 37 37 37 37 37 37 37 37 35 35 35 35 20 19 19 30 30 23 23 23 23 15 15 15 27 17 19 19 24 28 25 27 27 30 31 23 19 16 16 16 19 30 29 32 32 32 32 30 25 25 25 32 30 30 30 35 33 33 32 25 25 25 32 30 32 14 14 13 13 13 25 25 18 18 11 11 11 11 12 12 12 12 12 12 11 11 11 11 26 26 25 23 24 28 24 25 24 22 18 18 13 13 13 17 17 17 18 14 14 24 27 21 23 23 27 19 19 19 27 32 32 25 25 25 25 23 25 25 33 33 32 32 31 31 29 29 29 19 18 19 18 19 27 1! 9 19 19 19 19 19 24 30 30 31 32 32 31 33 33 33 32 25 23 25 27 32 24 24 23 27 30 19 19 19 23 27 27 27 27 17 19 19 27 18 18 18 23 27 27 29 25 23 23 19 19 18 18 23 17 17 17 20 20 11 11 11 18 12 12 18 11 11 11 11 11 11 11 11 11 18 22 22 19 11 11 11 18 18 15 19 18 14 14 14 15 11 11 11 11 11 11 11 11 11 11 11 11 16 16 16 11 11 11 11 11 8 11 15 13 13 13 13 15 8 11 11 11 13 11 11 11 11 11 11 11 16 19 18 13 11 11 11 13 12 12 12 23 21 12 12 12 17 15 22 23 22 22 22 22 23 22 15 17 15 21 19 18 18 11 11 11 11 11 15 11 11 11 11 11 11 11 15 13 13 11 11 11 13 13 13 18 11 11 11 11 12 19 19 19 19 19 19 23 24 24 21 20 17 17 20 21 21 21 12 12 12 12 +>GGOQ6K301AWPXS +37 37 37 37 37 37 37 37 37 37 37 37 37 35 35 35 37 37 35 31 18 18 18 18 33 32 32 30 24 20 20 20 23 39 37 37 37 37 37 39 40 40 40 40 40 40 40 39 40 40 40 39 39 30 26 26 32 30 30 30 24 19 15 15 15 15 23 18 21 30 32 32 32 33 35 37 37 37 37 37 37 37 37 37 37 37 37 32 31 31 37 37 37 37 37 37 37 37 37 37 28 28 28 30 27 30 30 30 30 30 23 23 16 16 16 16 16 24 30 30 30 30 30 30 32 35 34 34 34 34 32 32 32 32 32 32 32 32 33 20 20 20 25 25 25 30 29 34 37 35 28 28 26 32 27 24 24 21 21 11 11 11 11 11 11 11 11 11 11 11 11 28 23 23 22 22 21 21 28 26 26 17 17 12 12 12 12 12 27 19 21 21 21 24 19 30 32 33 32 32 32 35 21 21 21 21 21 21 35 22 37 37 37 37 37 37 37 37 37 37 21 21 21 37 37 37 37 30 26 26 25 32 26 27 27 22 20 33 13 13 13 13 35 22 18 18 18 27 31 32 31 30 23 23 23 27 32 32 28 28 26 26 27 22 31 29 27 26 26 27 21 23 23 27 15 15 15 15 24 27 29 30 30 30 27 27 27 28 28 28 27 27 23 24 22 28 28 22 18 13 13 13 18 12 12 12 12 25 24 24 21 21 21 25 29 22 24 24 21 14 14 14 14 14 12 27 27 16 16 1! 7 15 17 29 30 30 32 32 28 25 20 20 19 19 23 33 33 33 28 28 28 32 32 32 35 35 35 35 35 32 32 29 29 28 28 28 35 33 31 29 24 22 17 18 15 15 15 11 11 11 11 11 11 18 15 15 15 15 19 26 26 29 27 27 25 24 24 21 21 21 21 21 21 13 11 11 11 11 14 22 21 15 15 11 11 11 24 24 17 17 14 18 18 15 15 15 15 17 15 13 15 15 15 16 16 22 19 17 12 12 12 17 17 18 18 23 15 17 17 15 22 23 21 21 19 21 22 22 15 12 12 12 15 18 18 16 13 15 15 13 13 11 11 11 11 11 11 15 11 11 11 11 11 11 11 13 13 15 16 19 19 18 18 15 11 11 11 15 13 15 11 11 11 11 11 11 11 11 11 11 11 8 8 11 11 11 11 11 11 16 13 13 11 11 11 11 11 11 11 13 13 13 11 11 11 11 11 11 13 11 11 11 11 11 11 11 11 11 11 11 11 0 14 14 11 12 12 17 17 21 25 25 +>GGOQ6K301A8J46 +37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 40 40 40 40 40 40 40 40 40 40 40 40 37 39 37 37 37 37 37 37 37 37 25 25 25 35 37 37 37 37 37 37 37 37 37 37 37 37 37 35 35 35 37 37 37 37 32 32 32 33 33 35 35 28 18 18 18 18 28 22 33 25 25 24 24 30 22 33 33 33 33 33 32 30 19 19 15 15 15 23 23 14 15 15 15 23 30 30 33 35 35 35 35 37 37 37 37 35 35 33 33 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 30 30 30 35 35 33 31 12 12 11 11 11 28 14 22 11 11 11 11 11 12 25 25 28 28 21 23 27 33 32 37 37 37 37 37 37 37 35 35 35 37 37 37 37 37 37 37 37 37 35 35 35 30 30 30 37 37 37 37 35 33 32 29 24 24 24 30 24 19 14 14 14 14 14 29 18 19 28 26 26 30 29 30 32 33 33 33 20 21 21 21 28 33 33 33 33 30 29 27 28 27 27 24 23 21 13 13 13 13 17 20 20 12 12 12 18 28 28 23 11 11 11 11 11 12 12 18 20 22 11 11 11 11 12 23 22 21 21 28 27 28 17 19 19 19 15 15 15 24 22 22 22 20 22 21 21 19 19 15 15 20 20 19 19 19 19 2! 7 27 30 31 31 33 35 35 35 35 35 32 32 32 30 30 30 32 32 32 32 32 20 20 20 25 30 30 30 35 27 30 30 29 35 35 28 28 28 35 35 23 23 23 18 18 20 20 18 33 19 19 18 17 18 23 27 22 21 21 20 19 17 17 17 13 13 13 13 11 15 22 14 16 21 21 21 17 17 14 14 14 18 19 20 19 17 24 25 27 23 23 23 23 15 17 17 17 21 18 11 11 11 13 16 18 15 15 11 11 11 15 15 11 15 15 18 19 19 16 18 13 13 11 11 11 11 12 18 18 15 12 11 15 15 15 17 15 22 13 13 17 17 17 15 17 15 17 13 18 19 19 13 15 13 15 13 15 15 15 17 22 25 12 12 12 12 23 25 14 14 17 17 12 12 15 15 11 11 11 11 11 8 11 11 11 11 11 11 11 15 15 12 15 15 15 13 15 13 13 15 15 11 11 11 15 11 11 11 13 15 19 18 15 11 11 11 13 17 15 17 17 21 16 16 13 13 13 16 19 18 11 11 11 11 11 11 11 11 11 11 15 15 15 15 15 15 diff -r cbacbb736899 -r 8833ebe82ed1 test-data/sff_converter_xml_1.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sff_converter_xml_1.dat Mon May 24 15:08:57 2010 -0400 @@ -0,0 +1,18 @@ +<?xml version="1.0"?> +<trace_volume> + <trace> + <trace_name>GGOQ6K301BJT46</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>260</clip_vector_right> + </trace> + <trace> + <trace_name>GGOQ6K301AWPXS</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>470</clip_vector_right> + </trace> + <trace> + <trace_name>GGOQ6K301A8J46</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>408</clip_vector_right> + </trace> +</trace_volume> diff -r cbacbb736899 -r 8833ebe82ed1 test-data/sff_converter_xml_2.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sff_converter_xml_2.dat Mon May 24 15:08:57 2010 -0400 @@ -0,0 +1,18 @@ +<?xml version="1.0"?> +<trace_volume> + <trace> + <trace_name>GGOQ6K301BJT46</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>260</clip_vector_right> + </trace> + <trace> + <trace_name>GGOQ6K301AWPXS</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>470</clip_vector_right> + </trace> + <trace> + <trace_name>GGOQ6K301A8J46</trace_name> + <clip_vector_left>5</clip_vector_left> + <clip_vector_right>408</clip_vector_right> + </trace> +</trace_volume> diff -r cbacbb736899 -r 8833ebe82ed1 tools/filters/sff_extractor.xml --- a/tools/filters/sff_extractor.xml Mon May 24 15:05:55 2010 -0400 +++ b/tools/filters/sff_extractor.xml Mon May 24 15:08:57 2010 -0400 @@ -1,39 +1,58 @@ <tool id="Sff_extractor" name="SFF converter" version="1.0.0"> - <description></description> - <command interpreter="python"> - #if str($fastq_output) == "fastq_false" #sff_extract.py $clip --seq_file=$out_file3 --qual_file=$out_file4 --xml_file=$out_file2 $input - #elif str($fastq_output) == "fastq_true" #sff_extract.py $clip --fastq --seq_file=$out_file1 --xml_file=$out_file2 $input - #end if# - </command> - <inputs> - <param format="sff" name="input" type="data" label="Extract from this dataset"/> - <param name="clip" type="select" label="Completely remove ends with low qual and/or adaptor sequence"> - <option value="">No</option> - <option value="--clip">Yes</option> - </param> - <param name="fastq_output" type="boolean" truevalue="fastq_true" falsevalue="fastq_false" checked="False" label="Do you want FASTQ file instead of FASTA + FASTA quality file?" /> - </inputs> - <outputs> - <data format="fastq" name="out_file1" > - <filter>fastq_output is True</filter> - </data> - <data format="xml" name="out_file2"> - </data> - <data format="fasta" name="out_file3"> - <filter>fastq_output is False</filter> - </data> - <data format="qual" name="out_file4"> - <filter>fastq_output is False</filter> - </data> - </outputs> - <help> + <description></description> + <command interpreter="python"> + #if str($fastq_output) == "fastq_false" #sff_extract.py $clip --seq_file=$out_file3 --qual_file=$out_file4 --xml_file=$out_file2 $input + #elif str($fastq_output) == "fastq_true" #sff_extract.py $clip --fastq --seq_file=$out_file1 --xml_file=$out_file2 $input + #end if# + </command> + <inputs> + <param format="sff" name="input" type="data" label="Extract from this dataset"/> + <param name="clip" type="select" label="Completely remove ends with low qual and/or adaptor sequence"> + <option value="">No</option> + <option value="--clip">Yes</option> + </param> + <param name="fastq_output" type="boolean" truevalue="fastq_true" falsevalue="fastq_false" checked="False" label="Do you want FASTQ file instead of FASTA + FASTA quality file?" /> + </inputs> + <outputs> + <data format="fastq" name="out_file1" > + <filter>fastq_output is True</filter> + </data> + <data format="xml" name="out_file2"> + </data> + <data format="fasta" name="out_file3"> + <filter>fastq_output is False</filter> + </data> + <data format="qual" name="out_file4"> + <filter>fastq_output is False</filter> + </data> + </outputs> + <tests> + <test> + <param name="input" value="2.sff"/> + <param name="clip" value=""/> + <param name="fastq_output" value="false"/> + <output name="out_file2" file="sff_converter_xml_1.dat"/> + <output name="out_file3" file="sff_converter_fasta.dat"/> + <output name="out_file4" file="sff_converter_qual.dat"/> + </test> + <test> + <param name="input" value="2.sff"/> + <param name="clip" value=""/> + <param name="fastq_output" value="true"/> + <output name="out_file1" file="sff_converter_fastq.dat"/> + <output name="out_file2" file="sff_converter_xml_2.dat"/> + </test> + </tests> + <help> + **What it does** This tool extracts data from the 454 Sequencer SFF format and creates three files containing the: - Sequences (FASTA), - Qualities (QUAL) and - Clippings (XML) - </help> +Sequences (FASTA), +Qualities (QUAL) and +Clippings (XML) + + </help> </tool>

1 0

[hg] galaxy 3815: Minor cleanup for ensembl display applications...
by Nate Coraor 25 May '10

25 May '10

details: http://www.bx.psu.edu/hg/galaxy/rev/cbacbb736899 changeset: 3815:cbacbb736899 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Mon May 24 15:05:55 2010 -0400 description: Minor cleanup for ensembl display applications and fastq masker tool. diffstat: display_applications/ensembl/ensembl_gff.xml | 6 ++---- display_applications/ensembl/ensembl_interval_as_bed.xml | 6 ++---- tool_conf.xml.main | 1 + tools/fastq/fastq_masker_by_quality.py | 2 +- 4 files changed, 6 insertions(+), 9 deletions(-) diffs (69 lines): diff -r 6056caca2503 -r cbacbb736899 display_applications/ensembl/ensembl_gff.xml --- a/display_applications/ensembl/ensembl_gff.xml Mon May 24 14:50:20 2010 -0400 +++ b/display_applications/ensembl/ensembl_gff.xml Mon May 24 15:05:55 2010 -0400 @@ -18,8 +18,7 @@ <param type="data" name="gff_file" url="galaxy_${DATASET_HASH}.gff" /> <param type="template" name="site_organism" strip="True" > - #set index = $site_dbkeys.index( $gff_file.dbkey ) - $site_organisms[ $index ] + $site_organisms[ $site_dbkeys.index( $gff_file.dbkey ) ] </param> <param type="template" name="position" strip="True" > #set line_count = 0 @@ -82,8 +81,7 @@ <param type="data" name="gff_file" url="galaxy_${DATASET_HASH}.gff" /> <param type="template" name="site_organism" strip="True" > - #set index = $site_dbkeys.index( $gff_file.dbkey ) - $site_organisms[ $index ] + $site_organisms[ $site_dbkeys.index( $gff_file.dbkey ) ] </param> <param type="template" name="position" strip="True" > #set line_count = 0 diff -r 6056caca2503 -r cbacbb736899 display_applications/ensembl/ensembl_interval_as_bed.xml --- a/display_applications/ensembl/ensembl_interval_as_bed.xml Mon May 24 14:50:20 2010 -0400 +++ b/display_applications/ensembl/ensembl_interval_as_bed.xml Mon May 24 15:05:55 2010 -0400 @@ -18,8 +18,7 @@ <param type="data" name="bed_file" url="galaxy_${DATASET_HASH}.bed" format="bedstrict"/> <param type="template" name="site_organism" strip="True" > - #set index = $site_dbkeys.index( $bed_file.dbkey ) - $site_organisms[ $index ] + $site_organisms[ $site_dbkeys.index( $bed_file.dbkey ) ] </param> <param type="template" name="position" strip="True" > #set line_count = 0 @@ -82,8 +81,7 @@ <param type="data" name="bed_file" url="galaxy_${DATASET_HASH}.bed" format="bedstrict"/> <param type="template" name="site_organism" strip="True" > - #set index = $site_dbkeys.index( $bed_file.dbkey ) - $site_organisms[ $index ] + $site_organisms[ $site_dbkeys.index( $bed_file.dbkey ) ] </param> <param type="template" name="position" strip="True" > #set line_count = 0 diff -r 6056caca2503 -r cbacbb736899 tool_conf.xml.main --- a/tool_conf.xml.main Mon May 24 14:50:20 2010 -0400 +++ b/tool_conf.xml.main Mon May 24 15:05:55 2010 -0400 @@ -298,6 +298,7 @@ <tool file="fastq/fastq_filter.xml" /> <tool file="fastq/fastq_trimmer.xml" /> <tool file="fastq/fastq_trimmer_by_quality.xml" /> + <tool file="fastq/fastq_masker_by_quality.xml" /> <tool file="fastq/fastq_manipulation.xml" /> <tool file="fastq/fastq_to_fasta.xml" /> <tool file="fastq/fastq_to_tabular.xml" /> diff -r 6056caca2503 -r cbacbb736899 tools/fastq/fastq_masker_by_quality.py --- a/tools/fastq/fastq_masker_by_quality.py Mon May 24 14:50:20 2010 -0400 +++ b/tools/fastq/fastq_masker_by_quality.py Mon May 24 15:05:55 2010 -0400 @@ -46,7 +46,7 @@ def main(): usage = "usage: %prog [options] input_file output_file" parser = OptionParser( usage=usage ) - parser.add_option( '-f', '--format', dest='format', type='choice', default='sanger', choices=( 'sanger', 'cssanger', 'solexa', 'illumina' ), help='FASTQ variant type' ) + parser.add_option( '-f', '--format', dest='format', type='choice', default='sanger', choices=( 'sanger', 'solexa', 'illumina' ), help='FASTQ variant type' ) parser.add_option( '-m', '--mask_character', dest='mask_character', default='N', help='Mask Character to use' ) parser.add_option( '-c', '--score_comparison', type="choice", dest='score_comparison', default='le', choices=('gt','ge','eq','lt', 'le', 'ne' ), help='Mask base when score is' ) parser.add_option( '-s', '--quality_score', type="float", dest='quality_score', default='0', help='Quality Score' )

1 0