September 2008 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 1523: Adding tools to compute Substitution rates.
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/dabed25dfbaf changeset: 1523:dabed25dfbaf user: guru date: Sun Sep 21 17:36:28 2008 -0400 description: Adding tools to compute Substitution rates. 7 file(s) affected in this change: test-data/subRates1.out test-data/subs.out tool_conf.xml.sample tools/regVariation/substitution_rates.py tools/regVariation/substitution_rates.xml tools/regVariation/substitutions.py tools/regVariation/substitutions.xml diffs (1734 lines): diff -r 05974294cbf1 -r dabed25dfbaf test-data/subRates1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subRates1.out Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,13 @@ +#Seq1 Start1 End1 Seq2 Start2 End2 L N p +hg17.chrX 3816458 3816983 fr1.chrUn 343715247 343715776 525 188 0.3581 +hg17.chrX 3795168 3795525 fr1.chrUn 343710815 343711179 357 92 0.2577 +hg17.chrX 3787425 3787599 fr1.chrUn 343708230 343708404 174 37 0.2126 +hg17.chrX 3787284 3787384 fr1.chrUn 62078707 62078816 100 33 0.3300 +hg17.chrX 3776942 3777227 fr1.chrUn 343707053 343707336 283 122 0.4311 +hg17.chrX 3760375 3760468 fr1.chrUn 343706399 343706492 93 20 0.2151 +hg17.chrX 3733405 3733881 fr1.chrUn 303515824 303516268 444 186 0.4189 +hg17.chrX 3731355 3731463 fr1.chrUn 303515724 303515815 91 36 0.3956 +hg17.chrX 3730591 3731038 fr1.chrUn 303515378 303515724 346 126 0.3642 +hg17.chrX 3729219 3729457 fr1.chrUn 343703525 343703763 238 57 0.2395 +hg17.chrX 3700391 3700698 fr1.chrUn 241017738 241018068 307 112 0.3648 +hg17.chrX 3639441 3639646 fr1.chrUn 333536350 333536563 205 66 0.3220 diff -r 05974294cbf1 -r dabed25dfbaf test-data/subs.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subs.out Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,1379 @@ +#Chr Start End +hg17.chrX 3816460 3816460 +fr1.chrUn 343715249 343715249 +hg17.chrX 3816462 3816463 +fr1.chrUn 343715251 343715252 +hg17.chrX 3816466 3816466 +fr1.chrUn 343715255 343715255 +hg17.chrX 3816471 3816471 +fr1.chrUn 343715260 343715260 +hg17.chrX 3816473 3816474 +fr1.chrUn 343715262 343715263 +hg17.chrX 3816478 3816479 +fr1.chrUn 343715267 343715268 +hg17.chrX 3816484 3816485 +fr1.chrUn 343715273 343715274 +hg17.chrX 3816493 3816494 +fr1.chrUn 343715284 343715285 +hg17.chrX 3816496 3816499 +fr1.chrUn 343715287 343715290 +hg17.chrX 3816502 3816502 +fr1.chrUn 343715293 343715293 +hg17.chrX 3816504 3816505 +fr1.chrUn 343715295 343715296 +hg17.chrX 3816507 3816507 +fr1.chrUn 343715298 343715298 +hg17.chrX 3816511 3816511 +fr1.chrUn 343715302 343715302 +hg17.chrX 3816515 3816516 +fr1.chrUn 343715306 343715307 +hg17.chrX 3816518 3816518 +fr1.chrUn 343715312 343715312 +hg17.chrX 3816521 3816522 +fr1.chrUn 343715315 343715316 +hg17.chrX 3816524 3816524 +fr1.chrUn 343715318 343715318 +hg17.chrX 3816531 3816531 +fr1.chrUn 343715324 343715324 +hg17.chrX 3816534 3816542 +fr1.chrUn 343715327 343715335 +hg17.chrX 3816544 3816544 +fr1.chrUn 343715337 343715337 +hg17.chrX 3816547 3816549 +fr1.chrUn 343715340 343715342 +hg17.chrX 3816551 3816554 +fr1.chrUn 343715344 343715347 +hg17.chrX 3816556 3816558 +fr1.chrUn 343715349 343715351 +hg17.chrX 3816561 3816561 +fr1.chrUn 343715354 343715354 +hg17.chrX 3816564 3816564 +fr1.chrUn 343715357 343715357 +hg17.chrX 3816568 3816568 +fr1.chrUn 343715361 343715361 +hg17.chrX 3816570 3816571 +fr1.chrUn 343715363 343715364 +hg17.chrX 3816578 3816579 +fr1.chrUn 343715367 343715368 +hg17.chrX 3816582 3816582 +fr1.chrUn 343715371 343715371 +hg17.chrX 3816586 3816591 +fr1.chrUn 343715375 343715380 +hg17.chrX 3816595 3816597 +fr1.chrUn 343715384 343715386 +hg17.chrX 3816600 3816602 +fr1.chrUn 343715389 343715391 +hg17.chrX 3816604 3816604 +fr1.chrUn 343715393 343715393 +hg17.chrX 3816607 3816607 +fr1.chrUn 343715396 343715396 +hg17.chrX 3816611 3816611 +fr1.chrUn 343715402 343715402 +hg17.chrX 3816614 3816616 +fr1.chrUn 343715405 343715407 +hg17.chrX 3816619 3816621 +fr1.chrUn 343715410 343715412 +hg17.chrX 3816625 3816625 +fr1.chrUn 343715416 343715416 +hg17.chrX 3816627 3816628 +fr1.chrUn 343715418 343715419 +hg17.chrX 3816632 3816635 +fr1.chrUn 343715423 343715426 +hg17.chrX 3816639 3817164 +fr1.chrUn 343715430 343715959 +hg17.chrX 3816645 3816646 +fr1.chrUn 343715441 343715442 +hg17.chrX 3816649 3816650 +fr1.chrUn 343715445 343715446 +hg17.chrX 3816662 3816662 +fr1.chrUn 343715467 343715467 +hg17.chrX 3816665 3816665 +fr1.chrUn 343715470 343715470 +hg17.chrX 3816667 3816668 +fr1.chrUn 343715472 343715473 +hg17.chrX 3816670 3816670 +fr1.chrUn 343715475 343715475 +hg17.chrX 3816672 3816672 +fr1.chrUn 343715477 343715477 +hg17.chrX 3816674 3816678 +fr1.chrUn 343715479 343715483 +hg17.chrX 3816680 3816682 +fr1.chrUn 343715485 343715487 +hg17.chrX 3816684 3816684 +fr1.chrUn 343715489 343715489 +hg17.chrX 3816687 3816687 +fr1.chrUn 343715492 343715492 +hg17.chrX 3816690 3816690 +fr1.chrUn 343715495 343715495 +hg17.chrX 3816693 3816693 +fr1.chrUn 343715498 343715498 +hg17.chrX 3816695 3816695 +fr1.chrUn 343715500 343715500 +hg17.chrX 3816698 3816699 +fr1.chrUn 343715503 343715504 +hg17.chrX 3816714 3816714 +fr1.chrUn 343715519 343715519 +hg17.chrX 3816720 3816720 +fr1.chrUn 343715525 343715525 +hg17.chrX 3816726 3816727 +fr1.chrUn 343715531 343715532 +hg17.chrX 3816736 3816736 +fr1.chrUn 343715541 343715541 +hg17.chrX 3816741 3816741 +fr1.chrUn 343715546 343715546 +hg17.chrX 3816748 3816750 +fr1.chrUn 343715553 343715555 +hg17.chrX 3816752 3816753 +fr1.chrUn 343715557 343715558 +hg17.chrX 3816756 3816757 +fr1.chrUn 343715561 343715562 +hg17.chrX 3816771 3816772 +fr1.chrUn 343715576 343715577 +hg17.chrX 3816777 3816778 +fr1.chrUn 343715582 343715583 +hg17.chrX 3816780 3816781 +fr1.chrUn 343715585 343715586 +hg17.chrX 3816784 3816784 +fr1.chrUn 343715589 343715589 +hg17.chrX 3816786 3816786 +fr1.chrUn 343715591 343715591 +hg17.chrX 3816789 3816790 +fr1.chrUn 343715594 343715595 +hg17.chrX 3816796 3816797 +fr1.chrUn 343715597 343715598 +hg17.chrX 3816800 3816800 +fr1.chrUn 343715601 343715601 +hg17.chrX 3816805 3816808 +fr1.chrUn 343715606 343715609 +hg17.chrX 3816810 3816811 +fr1.chrUn 343715611 343715612 +hg17.chrX 3816814 3816814 +fr1.chrUn 343715615 343715615 +hg17.chrX 3816818 3816819 +fr1.chrUn 343715619 343715620 +hg17.chrX 3816835 3816835 +fr1.chrUn 343715625 343715625 +hg17.chrX 3816837 3816837 +fr1.chrUn 343715627 343715627 +hg17.chrX 3816841 3816842 +fr1.chrUn 343715631 343715632 +hg17.chrX 3816844 3816846 +fr1.chrUn 343715634 343715636 +hg17.chrX 3816849 3816849 +fr1.chrUn 343715639 343715639 +hg17.chrX 3816853 3816853 +fr1.chrUn 343715643 343715643 +hg17.chrX 3816868 3816868 +fr1.chrUn 343715661 343715661 +hg17.chrX 3816870 3816870 +fr1.chrUn 343715663 343715663 +hg17.chrX 3816878 3816879 +fr1.chrUn 343715671 343715672 +hg17.chrX 3816882 3816882 +fr1.chrUn 343715675 343715675 +hg17.chrX 3816891 3816891 +fr1.chrUn 343715684 343715684 +hg17.chrX 3816894 3816894 +fr1.chrUn 343715687 343715687 +hg17.chrX 3816903 3816903 +fr1.chrUn 343715696 343715696 +hg17.chrX 3816906 3816906 +fr1.chrUn 343715699 343715699 +hg17.chrX 3816909 3816909 +fr1.chrUn 343715702 343715702 +hg17.chrX 3816912 3816912 +fr1.chrUn 343715705 343715705 +hg17.chrX 3816915 3816915 +fr1.chrUn 343715708 343715708 +hg17.chrX 3816918 3816920 +fr1.chrUn 343715711 343715713 +hg17.chrX 3816924 3816924 +fr1.chrUn 343715717 343715717 +hg17.chrX 3816930 3816931 +fr1.chrUn 343715723 343715724 +hg17.chrX 3816935 3816935 +fr1.chrUn 343715728 343715728 +hg17.chrX 3816939 3816939 +fr1.chrUn 343715732 343715732 +hg17.chrX 3816952 3816952 +fr1.chrUn 343715745 343715745 +hg17.chrX 3816958 3816958 +fr1.chrUn 343715751 343715751 +hg17.chrX 3816961 3816961 +fr1.chrUn 343715754 343715754 +hg17.chrX 3816964 3816964 +fr1.chrUn 343715757 343715757 +hg17.chrX 3816966 3816968 +fr1.chrUn 343715759 343715761 +hg17.chrX 3816972 3816972 +fr1.chrUn 343715765 343715765 +hg17.chrX 3816974 3816974 +fr1.chrUn 343715767 343715767 +hg17.chrX 3816976 3816977 +fr1.chrUn 343715769 343715770 +hg17.chrX 3816979 3816980 +fr1.chrUn 343715772 343715773 +hg17.chrX 3795168 3795168 +fr1.chrUn 343710815 343710815 +hg17.chrX 3795170 3795170 +fr1.chrUn 343710817 343710817 +hg17.chrX 3795175 3795175 +fr1.chrUn 343710822 343710822 +hg17.chrX 3795188 3795188 +fr1.chrUn 343710827 343710827 +hg17.chrX 3795192 3795194 +fr1.chrUn 343710831 343710833 +hg17.chrX 3795196 3795198 +fr1.chrUn 343710835 343710837 +hg17.chrX 3795207 3795208 +fr1.chrUn 343710846 343710847 +hg17.chrX 3795210 3795211 +fr1.chrUn 343710849 343710850 +hg17.chrX 3795218 3795222 +fr1.chrUn 343710861 343710865 +hg17.chrX 3795225 3795226 +fr1.chrUn 343710868 343710869 +hg17.chrX 3795229 3795230 +fr1.chrUn 343710874 343710875 +hg17.chrX 3795235 3795235 +fr1.chrUn 343710887 343710887 +hg17.chrX 3795239 3795239 +fr1.chrUn 343710891 343710891 +hg17.chrX 3795241 3795242 +fr1.chrUn 343710893 343710894 +hg17.chrX 3795245 3795251 +fr1.chrUn 343710897 343710903 +hg17.chrX 3795254 3795259 +fr1.chrUn 343710906 343710911 +hg17.chrX 3795265 3795265 +fr1.chrUn 343710917 343710917 +hg17.chrX 3795268 3795268 +fr1.chrUn 343710920 343710920 +hg17.chrX 3795272 3795272 +fr1.chrUn 343710924 343710924 +hg17.chrX 3795274 3795275 +fr1.chrUn 343710926 343710927 +hg17.chrX 3795284 3795284 +fr1.chrUn 343710940 343710940 +hg17.chrX 3795312 3795312 +fr1.chrUn 343710968 343710968 +hg17.chrX 3795317 3795317 +fr1.chrUn 343710973 343710973 +hg17.chrX 3795326 3795326 +fr1.chrUn 343710982 343710982 +hg17.chrX 3795332 3795332 +fr1.chrUn 343710988 343710988 +hg17.chrX 3795336 3795336 +fr1.chrUn 343710992 343710992 +hg17.chrX 3795338 3795338 +fr1.chrUn 343710994 343710994 +hg17.chrX 3795344 3795344 +fr1.chrUn 343711000 343711000 +hg17.chrX 3795350 3795350 +fr1.chrUn 343711006 343711006 +hg17.chrX 3795353 3795353 +fr1.chrUn 343711009 343711009 +hg17.chrX 3795356 3795356 +fr1.chrUn 343711012 343711012 +hg17.chrX 3795359 3795359 +fr1.chrUn 343711015 343711015 +hg17.chrX 3795377 3795377 +fr1.chrUn 343711033 343711033 +hg17.chrX 3795380 3795380 +fr1.chrUn 343711036 343711036 +hg17.chrX 3795383 3795383 +fr1.chrUn 343711039 343711039 +hg17.chrX 3795386 3795386 +fr1.chrUn 343711042 343711042 +hg17.chrX 3795389 3795389 +fr1.chrUn 343711045 343711045 +hg17.chrX 3795398 3795398 +fr1.chrUn 343711054 343711054 +hg17.chrX 3795401 3795401 +fr1.chrUn 343711057 343711057 +hg17.chrX 3795407 3795408 +fr1.chrUn 343711063 343711064 +hg17.chrX 3795416 3795416 +fr1.chrUn 343711072 343711072 +hg17.chrX 3795422 3795422 +fr1.chrUn 343711078 343711078 +hg17.chrX 3795425 3795425 +fr1.chrUn 343711081 343711081 +hg17.chrX 3795434 3795434 +fr1.chrUn 343711090 343711090 +hg17.chrX 3795443 3795443 +fr1.chrUn 343711099 343711099 +hg17.chrX 3795446 3795446 +fr1.chrUn 343711102 343711102 +hg17.chrX 3795449 3795449 +fr1.chrUn 343711105 343711105 +hg17.chrX 3795455 3795455 +fr1.chrUn 343711111 343711111 +hg17.chrX 3795461 3795461 +fr1.chrUn 343711117 343711117 +hg17.chrX 3795464 3795464 +fr1.chrUn 343711120 343711120 +hg17.chrX 3795467 3795467 +fr1.chrUn 343711123 343711123 +hg17.chrX 3795481 3795481 +fr1.chrUn 343711131 343711131 +hg17.chrX 3795483 3795483 +fr1.chrUn 343711133 343711133 +hg17.chrX 3795488 3795488 +fr1.chrUn 343711138 343711138 +hg17.chrX 3795491 3795491 +fr1.chrUn 343711141 343711141 +hg17.chrX 3795493 3795493 +fr1.chrUn 343711143 343711143 +hg17.chrX 3795500 3795501 +fr1.chrUn 343711150 343711151 +hg17.chrX 3795505 3795507 +fr1.chrUn 343711159 343711161 +hg17.chrX 3795511 3795511 +fr1.chrUn 343711165 343711165 +hg17.chrX 3795513 3795513 +fr1.chrUn 343711167 343711167 +hg17.chrX 3795515 3795515 +fr1.chrUn 343711169 343711169 +hg17.chrX 3795521 3795521 +fr1.chrUn 343711175 343711175 +hg17.chrX 3795523 3795523 +fr1.chrUn 343711177 343711177 +hg17.chrX 3787426 3787426 +fr1.chrUn 343708231 343708231 +hg17.chrX 3787430 3787430 +fr1.chrUn 343708235 343708235 +hg17.chrX 3787432 3787432 +fr1.chrUn 343708237 343708237 +hg17.chrX 3787435 3787436 +fr1.chrUn 343708240 343708241 +hg17.chrX 3787440 3787440 +fr1.chrUn 343708245 343708245 +hg17.chrX 3787449 3787449 +fr1.chrUn 343708254 343708254 +hg17.chrX 3787452 3787452 +fr1.chrUn 343708257 343708257 +hg17.chrX 3787461 3787462 +fr1.chrUn 343708266 343708267 +hg17.chrX 3787464 3787464 +fr1.chrUn 343708269 343708269 +hg17.chrX 3787471 3787471 +fr1.chrUn 343708276 343708276 +hg17.chrX 3787473 3787473 +fr1.chrUn 343708278 343708278 +hg17.chrX 3787476 3787477 +fr1.chrUn 343708281 343708282 +hg17.chrX 3787479 3787479 +fr1.chrUn 343708284 343708284 +hg17.chrX 3787491 3787491 +fr1.chrUn 343708296 343708296 +hg17.chrX 3787494 3787494 +fr1.chrUn 343708299 343708299 +hg17.chrX 3787500 3787500 +fr1.chrUn 343708305 343708305 +hg17.chrX 3787503 3787503 +fr1.chrUn 343708308 343708308 +hg17.chrX 3787510 3787510 +fr1.chrUn 343708315 343708315 +hg17.chrX 3787512 3787512 +fr1.chrUn 343708317 343708317 +hg17.chrX 3787515 3787515 +fr1.chrUn 343708320 343708320 +hg17.chrX 3787518 3787518 +fr1.chrUn 343708323 343708323 +hg17.chrX 3787539 3787539 +fr1.chrUn 343708344 343708344 +hg17.chrX 3787545 3787545 +fr1.chrUn 343708350 343708350 +hg17.chrX 3787548 3787548 +fr1.chrUn 343708353 343708353 +hg17.chrX 3787557 3787557 +fr1.chrUn 343708362 343708362 +hg17.chrX 3787561 3787561 +fr1.chrUn 343708366 343708366 +hg17.chrX 3787566 3787566 +fr1.chrUn 343708371 343708371 +hg17.chrX 3787569 3787569 +fr1.chrUn 343708374 343708374 +hg17.chrX 3787572 3787572 +fr1.chrUn 343708377 343708377 +hg17.chrX 3787578 3787578 +fr1.chrUn 343708383 343708383 +hg17.chrX 3787581 3787581 +fr1.chrUn 343708386 343708386 +hg17.chrX 3787584 3787584 +fr1.chrUn 343708389 343708389 +hg17.chrX 3787587 3787587 +fr1.chrUn 343708392 343708392 +hg17.chrX 3787590 3787590 +fr1.chrUn 343708395 343708395 +hg17.chrX 3787285 3787285 +fr1.chrUn 62078708 62078708 +hg17.chrX 3787293 3787296 +fr1.chrUn 62078716 62078719 +hg17.chrX 3787301 3787301 +fr1.chrUn 62078724 62078724 +hg17.chrX 3787303 3787303 +fr1.chrUn 62078726 62078726 +hg17.chrX 3787305 3787307 +fr1.chrUn 62078728 62078730 +hg17.chrX 3787323 3787423 +fr1.chrUn 62078739 62078848 +hg17.chrX 3787326 3787326 +fr1.chrUn 62078741 62078741 +hg17.chrX 3787328 3787328 +fr1.chrUn 62078743 62078743 +hg17.chrX 3787332 3787333 +fr1.chrUn 62078747 62078748 +hg17.chrX 3787335 3787336 +fr1.chrUn 62078750 62078751 +hg17.chrX 3787339 3787339 +fr1.chrUn 62078754 62078754 +hg17.chrX 3787342 3787343 +fr1.chrUn 62078757 62078758 +hg17.chrX 3787346 3787346 +fr1.chrUn 62078761 62078761 +hg17.chrX 3787348 3787448 +fr1.chrUn 62078763 62078872 +hg17.chrX 3787349 3787349 +fr1.chrUn 62078768 62078768 +hg17.chrX 3787355 3787355 +fr1.chrUn 62078774 62078774 +hg17.chrX 3787357 3787358 +fr1.chrUn 62078776 62078777 +hg17.chrX 3787360 3787360 +fr1.chrUn 62078779 62078779 +hg17.chrX 3787364 3787364 +fr1.chrUn 62078783 62078783 +hg17.chrX 3787369 3787369 +fr1.chrUn 62078796 62078796 +hg17.chrX 3787372 3787372 +fr1.chrUn 62078799 62078799 +hg17.chrX 3787378 3787378 +fr1.chrUn 62078810 62078810 +hg17.chrX 3776943 3776944 +fr1.chrUn 343707054 343707055 +hg17.chrX 3776946 3776946 +fr1.chrUn 343707057 343707057 +hg17.chrX 3776948 3776949 +fr1.chrUn 343707059 343707060 +hg17.chrX 3776951 3776951 +fr1.chrUn 343707062 343707062 +hg17.chrX 3776954 3776954 +fr1.chrUn 343707065 343707065 +hg17.chrX 3776957 3776958 +fr1.chrUn 343707068 343707069 +hg17.chrX 3776960 3776961 +fr1.chrUn 343707071 343707072 +hg17.chrX 3776963 3776963 +fr1.chrUn 343707074 343707074 +hg17.chrX 3776965 3776966 +fr1.chrUn 343707076 343707077 +hg17.chrX 3776968 3776969 +fr1.chrUn 343707079 343707080 +hg17.chrX 3776974 3776976 +fr1.chrUn 343707085 343707087 +hg17.chrX 3776980 3776980 +fr1.chrUn 343707091 343707091 +hg17.chrX 3776983 3776986 +fr1.chrUn 343707094 343707097 +hg17.chrX 3776995 3776995 +fr1.chrUn 343707102 343707102 +hg17.chrX 3776997 3776997 +fr1.chrUn 343707104 343707104 +hg17.chrX 3776999 3777000 +fr1.chrUn 343707106 343707107 +hg17.chrX 3777002 3777002 +fr1.chrUn 343707109 343707109 +hg17.chrX 3777005 3777007 +fr1.chrUn 343707112 343707114 +hg17.chrX 3777009 3777010 +fr1.chrUn 343707116 343707117 +hg17.chrX 3777012 3777012 +fr1.chrUn 343707119 343707119 +hg17.chrX 3777014 3777015 +fr1.chrUn 343707121 343707122 +hg17.chrX 3777018 3777018 +fr1.chrUn 343707125 343707125 +hg17.chrX 3777022 3777022 +fr1.chrUn 343707129 343707129 +hg17.chrX 3777024 3777026 +fr1.chrUn 343707131 343707133 +hg17.chrX 3777028 3777028 +fr1.chrUn 343707135 343707135 +hg17.chrX 3777030 3777033 +fr1.chrUn 343707137 343707140 +hg17.chrX 3777035 3777039 +fr1.chrUn 343707142 343707146 +hg17.chrX 3777041 3777041 +fr1.chrUn 343707148 343707148 +hg17.chrX 3777044 3777044 +fr1.chrUn 343707151 343707151 +hg17.chrX 3777046 3777046 +fr1.chrUn 343707153 343707153 +hg17.chrX 3777049 3777050 +fr1.chrUn 343707156 343707157 +hg17.chrX 3777053 3777054 +fr1.chrUn 343707160 343707161 +hg17.chrX 3777056 3777057 +fr1.chrUn 343707163 343707164 +hg17.chrX 3777059 3777059 +fr1.chrUn 343707166 343707166 +hg17.chrX 3777062 3777063 +fr1.chrUn 343707169 343707170 +hg17.chrX 3777065 3777066 +fr1.chrUn 343707172 343707173 +hg17.chrX 3777068 3777068 +fr1.chrUn 343707175 343707175 +hg17.chrX 3777071 3777073 +fr1.chrUn 343707178 343707180 +hg17.chrX 3777076 3777076 +fr1.chrUn 343707185 343707185 +hg17.chrX 3777081 3777081 +fr1.chrUn 343707190 343707190 +hg17.chrX 3777084 3777084 +fr1.chrUn 343707193 343707193 +hg17.chrX 3777087 3777087 +fr1.chrUn 343707196 343707196 +hg17.chrX 3777090 3777090 +fr1.chrUn 343707199 343707199 +hg17.chrX 3777092 3777095 +fr1.chrUn 343707201 343707204 +hg17.chrX 3777099 3777099 +fr1.chrUn 343707208 343707208 +hg17.chrX 3777103 3777103 +fr1.chrUn 343707212 343707212 +hg17.chrX 3777108 3777111 +fr1.chrUn 343707217 343707220 +hg17.chrX 3777119 3777120 +fr1.chrUn 343707228 343707229 +hg17.chrX 3777123 3777124 +fr1.chrUn 343707232 343707233 +hg17.chrX 3777126 3777127 +fr1.chrUn 343707235 343707236 +hg17.chrX 3777129 3777129 +fr1.chrUn 343707238 343707238 +hg17.chrX 3777131 3777132 +fr1.chrUn 343707240 343707241 +hg17.chrX 3777135 3777135 +fr1.chrUn 343707244 343707244 +hg17.chrX 3777139 3777141 +fr1.chrUn 343707248 343707250 +hg17.chrX 3777144 3777144 +fr1.chrUn 343707253 343707253 +hg17.chrX 3777148 3777148 +fr1.chrUn 343707257 343707257 +hg17.chrX 3777153 3777153 +fr1.chrUn 343707262 343707262 +hg17.chrX 3777156 3777156 +fr1.chrUn 343707265 343707265 +hg17.chrX 3777159 3777160 +fr1.chrUn 343707268 343707269 +hg17.chrX 3777162 3777163 +fr1.chrUn 343707271 343707272 +hg17.chrX 3777177 3777178 +fr1.chrUn 343707286 343707287 +hg17.chrX 3777180 3777181 +fr1.chrUn 343707289 343707290 +hg17.chrX 3777186 3777186 +fr1.chrUn 343707295 343707295 +hg17.chrX 3777189 3777189 +fr1.chrUn 343707298 343707298 +hg17.chrX 3777193 3777193 +fr1.chrUn 343707302 343707302 +hg17.chrX 3777198 3777198 +fr1.chrUn 343707307 343707307 +hg17.chrX 3777200 3777200 +fr1.chrUn 343707309 343707309 +hg17.chrX 3777204 3777204 +fr1.chrUn 343707313 343707313 +hg17.chrX 3777206 3777207 +fr1.chrUn 343707315 343707316 +hg17.chrX 3777211 3777211 +fr1.chrUn 343707320 343707320 +hg17.chrX 3777213 3777213 +fr1.chrUn 343707322 343707322 +hg17.chrX 3777216 3777216 +fr1.chrUn 343707325 343707325 +hg17.chrX 3777219 3777219 +fr1.chrUn 343707328 343707328 +hg17.chrX 3760376 3760376 +fr1.chrUn 343706400 343706400 +hg17.chrX 3760382 3760382 +fr1.chrUn 343706406 343706406 +hg17.chrX 3760385 3760385 +fr1.chrUn 343706409 343706409 +hg17.chrX 3760388 3760388 +fr1.chrUn 343706412 343706412 +hg17.chrX 3760391 3760391 +fr1.chrUn 343706415 343706415 +hg17.chrX 3760400 3760400 +fr1.chrUn 343706424 343706424 +hg17.chrX 3760409 3760410 +fr1.chrUn 343706433 343706434 +hg17.chrX 3760415 3760415 +fr1.chrUn 343706439 343706439 +hg17.chrX 3760418 3760418 +fr1.chrUn 343706442 343706442 +hg17.chrX 3760421 3760421 +fr1.chrUn 343706445 343706445 +hg17.chrX 3760430 3760432 +fr1.chrUn 343706454 343706456 +hg17.chrX 3760436 3760436 +fr1.chrUn 343706460 343706460 +hg17.chrX 3760442 3760442 +fr1.chrUn 343706466 343706466 +hg17.chrX 3760445 3760445 +fr1.chrUn 343706469 343706469 +hg17.chrX 3760448 3760448 +fr1.chrUn 343706472 343706472 +hg17.chrX 3760460 3760460 +fr1.chrUn 343706484 343706484 +hg17.chrX 3760465 3760465 +fr1.chrUn 343706489 343706489 +hg17.chrX 3733406 3733406 +fr1.chrUn 303515825 303515825 +hg17.chrX 3733409 3733409 +fr1.chrUn 303515828 303515828 +hg17.chrX 3733413 3733414 +fr1.chrUn 303515832 303515833 +hg17.chrX 3733417 3733419 +fr1.chrUn 303515836 303515838 +hg17.chrX 3733426 3733427 +fr1.chrUn 303515845 303515846 +hg17.chrX 3733429 3733429 +fr1.chrUn 303515848 303515848 +hg17.chrX 3733431 3733431 +fr1.chrUn 303515850 303515850 +hg17.chrX 3733433 3733433 +fr1.chrUn 303515852 303515852 +hg17.chrX 3733436 3733436 +fr1.chrUn 303515855 303515855 +hg17.chrX 3733440 3733440 +fr1.chrUn 303515859 303515859 +hg17.chrX 3733445 3733445 +fr1.chrUn 303515864 303515864 +hg17.chrX 3733454 3733454 +fr1.chrUn 303515871 303515871 +hg17.chrX 3733456 3733457 +fr1.chrUn 303515873 303515874 +hg17.chrX 3733479 3733479 +fr1.chrUn 303515877 303515877 +hg17.chrX 3733484 3733488 +fr1.chrUn 303515882 303515886 +hg17.chrX 3733491 3733491 +fr1.chrUn 303515889 303515889 +hg17.chrX 3733493 3733494 +fr1.chrUn 303515891 303515892 +hg17.chrX 3733496 3733499 +fr1.chrUn 303515894 303515897 +hg17.chrX 3733501 3733501 +fr1.chrUn 303515899 303515899 +hg17.chrX 3733503 3733504 +fr1.chrUn 303515901 303515902 +hg17.chrX 3733506 3733506 +fr1.chrUn 303515904 303515904 +hg17.chrX 3733508 3733508 +fr1.chrUn 303515906 303515906 +hg17.chrX 3733510 3733510 +fr1.chrUn 303515908 303515908 +hg17.chrX 3733519 3733519 +fr1.chrUn 303515910 303515910 +hg17.chrX 3733521 3733521 +fr1.chrUn 303515912 303515912 +hg17.chrX 3733523 3733523 +fr1.chrUn 303515914 303515914 +hg17.chrX 3733528 3733529 +fr1.chrUn 303515919 303515920 +hg17.chrX 3733537 3733538 +fr1.chrUn 303515925 303515926 +hg17.chrX 3733541 3733541 +fr1.chrUn 303515929 303515929 +hg17.chrX 3733543 3733543 +fr1.chrUn 303515931 303515931 +hg17.chrX 3733549 3733549 +fr1.chrUn 303515937 303515937 +hg17.chrX 3733551 3733553 +fr1.chrUn 303515939 303515941 +hg17.chrX 3733555 3733559 +fr1.chrUn 303515943 303515947 +hg17.chrX 3733563 3733564 +fr1.chrUn 303515951 303515952 +hg17.chrX 3733567 3733567 +fr1.chrUn 303515955 303515955 +hg17.chrX 3733569 3733569 +fr1.chrUn 303515957 303515957 +hg17.chrX 3733574 3733574 +fr1.chrUn 303515962 303515962 +hg17.chrX 3733579 3733581 +fr1.chrUn 303515967 303515969 +hg17.chrX 3733591 3733592 +fr1.chrUn 303515979 303515980 +hg17.chrX 3733594 3733596 +fr1.chrUn 303515982 303515984 +hg17.chrX 3733600 3733601 +fr1.chrUn 303515988 303515989 +hg17.chrX 3733607 3733608 +fr1.chrUn 303515995 303515996 +hg17.chrX 3733610 3734086 +fr1.chrUn 303515998 303516442 +hg17.chrX 3733612 3733612 +fr1.chrUn 303516003 303516003 +hg17.chrX 3733614 3733614 +fr1.chrUn 303516005 303516005 +hg17.chrX 3733617 3733618 +fr1.chrUn 303516008 303516009 +hg17.chrX 3733620 3733620 +fr1.chrUn 303516011 303516011 +hg17.chrX 3733623 3733625 +fr1.chrUn 303516014 303516016 +hg17.chrX 3733629 3733632 +fr1.chrUn 303516020 303516023 +hg17.chrX 3733634 3733634 +fr1.chrUn 303516025 303516025 +hg17.chrX 3733636 3733636 +fr1.chrUn 303516027 303516027 +hg17.chrX 3733642 3733642 +fr1.chrUn 303516033 303516033 +hg17.chrX 3733644 3733645 +fr1.chrUn 303516035 303516036 +hg17.chrX 3733647 3733648 +fr1.chrUn 303516038 303516039 +hg17.chrX 3733651 3733651 +fr1.chrUn 303516042 303516042 +hg17.chrX 3733653 3734129 +fr1.chrUn 303516044 303516488 +hg17.chrX 3733657 3733657 +fr1.chrUn 303516053 303516053 +hg17.chrX 3733661 3733662 +fr1.chrUn 303516057 303516058 +hg17.chrX 3733666 3733666 +fr1.chrUn 303516062 303516062 +hg17.chrX 3733670 3733671 +fr1.chrUn 303516066 303516067 +hg17.chrX 3733673 3733673 +fr1.chrUn 303516069 303516069 +hg17.chrX 3733677 3733677 +fr1.chrUn 303516073 303516073 +hg17.chrX 3733680 3733685 +fr1.chrUn 303516076 303516081 +hg17.chrX 3733689 3733692 +fr1.chrUn 303516085 303516088 +hg17.chrX 3733694 3733695 +fr1.chrUn 303516090 303516091 +hg17.chrX 3733697 3733698 +fr1.chrUn 303516093 303516094 +hg17.chrX 3733700 3733704 +fr1.chrUn 303516096 303516100 +hg17.chrX 3733709 3733710 +fr1.chrUn 303516105 303516106 +hg17.chrX 3733715 3733716 +fr1.chrUn 303516111 303516112 +hg17.chrX 3733718 3733718 +fr1.chrUn 303516114 303516114 +hg17.chrX 3733720 3733720 +fr1.chrUn 303516116 303516116 +hg17.chrX 3733723 3733723 +fr1.chrUn 303516119 303516119 +hg17.chrX 3733733 3733733 +fr1.chrUn 303516127 303516127 +hg17.chrX 3733735 3733736 +fr1.chrUn 303516129 303516130 +hg17.chrX 3733741 3733741 +fr1.chrUn 303516135 303516135 +hg17.chrX 3733747 3733748 +fr1.chrUn 303516143 303516144 +hg17.chrX 3733750 3733751 +fr1.chrUn 303516146 303516147 +hg17.chrX 3733753 3733753 +fr1.chrUn 303516149 303516149 +hg17.chrX 3733758 3733762 +fr1.chrUn 303516154 303516158 +hg17.chrX 3733765 3733765 +fr1.chrUn 303516161 303516161 +hg17.chrX 3733767 3733767 +fr1.chrUn 303516163 303516163 +hg17.chrX 3733769 3733769 +fr1.chrUn 303516165 303516165 +hg17.chrX 3733771 3733773 +fr1.chrUn 303516167 303516169 +hg17.chrX 3733775 3733775 +fr1.chrUn 303516171 303516171 +hg17.chrX 3733778 3733778 +fr1.chrUn 303516174 303516174 +hg17.chrX 3733781 3733781 +fr1.chrUn 303516177 303516177 +hg17.chrX 3733787 3734263 +fr1.chrUn 303516183 303516627 +hg17.chrX 3733809 3733810 +fr1.chrUn 303516191 303516192 +hg17.chrX 3733814 3733814 +fr1.chrUn 303516196 303516196 +hg17.chrX 3733819 3733819 +fr1.chrUn 303516206 303516206 +hg17.chrX 3733823 3733823 +fr1.chrUn 303516210 303516210 +hg17.chrX 3733825 3733825 +fr1.chrUn 303516212 303516212 +hg17.chrX 3733829 3733830 +fr1.chrUn 303516216 303516217 +hg17.chrX 3733832 3733832 +fr1.chrUn 303516219 303516219 +hg17.chrX 3733834 3733834 +fr1.chrUn 303516221 303516221 +hg17.chrX 3733836 3733837 +fr1.chrUn 303516223 303516224 +hg17.chrX 3733843 3733846 +fr1.chrUn 303516230 303516233 +hg17.chrX 3733850 3733854 +fr1.chrUn 303516237 303516241 +hg17.chrX 3733856 3733858 +fr1.chrUn 303516243 303516245 +hg17.chrX 3733861 3733861 +fr1.chrUn 303516248 303516248 +hg17.chrX 3733863 3733865 +fr1.chrUn 303516250 303516252 +hg17.chrX 3733869 3733869 +fr1.chrUn 303516256 303516256 +hg17.chrX 3733871 3733874 +fr1.chrUn 303516258 303516261 +hg17.chrX 3733879 3733879 +fr1.chrUn 303516266 303516266 +hg17.chrX 3731359 3731359 +fr1.chrUn 303515728 303515728 +hg17.chrX 3731361 3731361 +fr1.chrUn 303515730 303515730 +hg17.chrX 3731363 3731363 +fr1.chrUn 303515732 303515732 +hg17.chrX 3731365 3731366 +fr1.chrUn 303515734 303515735 +hg17.chrX 3731368 3731368 +fr1.chrUn 303515737 303515737 +hg17.chrX 3731376 3731376 +fr1.chrUn 303515739 303515739 +hg17.chrX 3731378 3731378 +fr1.chrUn 303515741 303515741 +hg17.chrX 3731381 3731382 +fr1.chrUn 303515744 303515745 +hg17.chrX 3731385 3731385 +fr1.chrUn 303515748 303515748 +hg17.chrX 3731391 3731391 +fr1.chrUn 303515753 303515753 +hg17.chrX 3731395 3731397 +fr1.chrUn 303515757 303515759 +hg17.chrX 3731400 3731400 +fr1.chrUn 303515762 303515762 +hg17.chrX 3731403 3731407 +fr1.chrUn 303515765 303515769 +hg17.chrX 3731410 3731410 +fr1.chrUn 303515772 303515772 +hg17.chrX 3731412 3731415 +fr1.chrUn 303515774 303515777 +hg17.chrX 3731419 3731419 +fr1.chrUn 303515781 303515781 +hg17.chrX 3731430 3731430 +fr1.chrUn 303515786 303515786 +hg17.chrX 3731433 3731433 +fr1.chrUn 303515789 303515789 +hg17.chrX 3731435 3731435 +fr1.chrUn 303515791 303515791 +hg17.chrX 3731439 3731439 +fr1.chrUn 303515795 303515795 +hg17.chrX 3731441 3731443 +fr1.chrUn 303515797 303515799 +hg17.chrX 3731446 3731446 +fr1.chrUn 303515802 303515802 +hg17.chrX 3731449 3731449 +fr1.chrUn 303515805 303515805 +hg17.chrX 3730593 3730593 +fr1.chrUn 303515380 303515380 +hg17.chrX 3730596 3730597 +fr1.chrUn 303515383 303515384 +hg17.chrX 3730600 3730600 +fr1.chrUn 303515387 303515387 +hg17.chrX 3730602 3730602 +fr1.chrUn 303515389 303515389 +hg17.chrX 3730604 3730608 +fr1.chrUn 303515391 303515395 +hg17.chrX 3730610 3730612 +fr1.chrUn 303515397 303515399 +hg17.chrX 3730618 3730618 +fr1.chrUn 303515405 303515405 +hg17.chrX 3730622 3730623 +fr1.chrUn 303515409 303515410 +hg17.chrX 3730628 3730628 +fr1.chrUn 303515415 303515415 +hg17.chrX 3730630 3730631 +fr1.chrUn 303515417 303515418 +hg17.chrX 3730633 3730633 +fr1.chrUn 303515420 303515420 +hg17.chrX 3730635 3730635 +fr1.chrUn 303515422 303515422 +hg17.chrX 3730639 3730642 +fr1.chrUn 303515426 303515429 +hg17.chrX 3730644 3730644 +fr1.chrUn 303515433 303515433 +hg17.chrX 3730646 3730647 +fr1.chrUn 303515435 303515436 +hg17.chrX 3730651 3730651 +fr1.chrUn 303515440 303515440 +hg17.chrX 3730659 3730659 +fr1.chrUn 303515448 303515448 +hg17.chrX 3730662 3730662 +fr1.chrUn 303515451 303515451 +hg17.chrX 3730664 3730664 +fr1.chrUn 303515453 303515453 +hg17.chrX 3730666 3730666 +fr1.chrUn 303515455 303515455 +hg17.chrX 3730670 3730670 +fr1.chrUn 303515457 303515457 +hg17.chrX 3730672 3730674 +fr1.chrUn 303515459 303515461 +hg17.chrX 3730681 3731128 +fr1.chrUn 303515468 303515814 +hg17.chrX 3730685 3730685 +fr1.chrUn 303515471 303515471 +hg17.chrX 3730688 3730690 +fr1.chrUn 303515474 303515476 +hg17.chrX 3730694 3730694 +fr1.chrUn 303515480 303515480 +hg17.chrX 3730696 3730696 +fr1.chrUn 303515482 303515482 +hg17.chrX 3730700 3730701 +fr1.chrUn 303515486 303515487 +hg17.chrX 3730703 3730705 +fr1.chrUn 303515489 303515491 +hg17.chrX 3730717 3730717 +fr1.chrUn 303515500 303515500 +hg17.chrX 3730721 3730721 +fr1.chrUn 303515504 303515504 +hg17.chrX 3730723 3730723 +fr1.chrUn 303515506 303515506 +hg17.chrX 3730726 3730728 +fr1.chrUn 303515509 303515511 +hg17.chrX 3730730 3730730 +fr1.chrUn 303515513 303515513 +hg17.chrX 3730732 3730733 +fr1.chrUn 303515515 303515516 +hg17.chrX 3730756 3730756 +fr1.chrUn 303515525 303515525 +hg17.chrX 3730758 3730758 +fr1.chrUn 303515527 303515527 +hg17.chrX 3730760 3730760 +fr1.chrUn 303515529 303515529 +hg17.chrX 3730762 3730762 +fr1.chrUn 303515531 303515531 +hg17.chrX 3730765 3730765 +fr1.chrUn 303515534 303515534 +hg17.chrX 3730774 3730774 +fr1.chrUn 303515540 303515540 +hg17.chrX 3730776 3730776 +fr1.chrUn 303515542 303515542 +hg17.chrX 3730778 3730779 +fr1.chrUn 303515544 303515545 +hg17.chrX 3730790 3730791 +fr1.chrUn 303515550 303515551 +hg17.chrX 3730796 3730796 +fr1.chrUn 303515556 303515556 +hg17.chrX 3730798 3730799 +fr1.chrUn 303515558 303515559 +hg17.chrX 3730802 3730802 +fr1.chrUn 303515562 303515562 +hg17.chrX 3730804 3730804 +fr1.chrUn 303515564 303515564 +hg17.chrX 3730807 3730807 +fr1.chrUn 303515567 303515567 +hg17.chrX 3730810 3730810 +fr1.chrUn 303515570 303515570 +hg17.chrX 3730822 3730822 +fr1.chrUn 303515578 303515578 +hg17.chrX 3730824 3730824 +fr1.chrUn 303515580 303515580 +hg17.chrX 3730828 3730831 +fr1.chrUn 303515584 303515587 +hg17.chrX 3730834 3730834 +fr1.chrUn 303515590 303515590 +hg17.chrX 3730837 3730838 +fr1.chrUn 303515593 303515594 +hg17.chrX 3730841 3730841 +fr1.chrUn 303515597 303515597 +hg17.chrX 3730850 3730850 +fr1.chrUn 303515602 303515602 +hg17.chrX 3730854 3730855 +fr1.chrUn 303515606 303515607 +hg17.chrX 3730857 3730857 +fr1.chrUn 303515609 303515609 +hg17.chrX 3730861 3730861 +fr1.chrUn 303515613 303515613 +hg17.chrX 3730863 3730864 +fr1.chrUn 303515615 303515616 +hg17.chrX 3730876 3730876 +fr1.chrUn 303515624 303515624 +hg17.chrX 3730880 3730880 +fr1.chrUn 303515628 303515628 +hg17.chrX 3730882 3730883 +fr1.chrUn 303515630 303515631 +hg17.chrX 3730885 3730885 +fr1.chrUn 303515633 303515633 +hg17.chrX 3730887 3730889 +fr1.chrUn 303515635 303515637 +hg17.chrX 3730892 3730892 +fr1.chrUn 303515640 303515640 +hg17.chrX 3730928 3730928 +fr1.chrUn 303515646 303515646 +hg17.chrX 3730931 3730931 +fr1.chrUn 303515649 303515649 +hg17.chrX 3730933 3730933 +fr1.chrUn 303515651 303515651 +hg17.chrX 3730936 3730936 +fr1.chrUn 303515654 303515654 +hg17.chrX 3730938 3730938 +fr1.chrUn 303515656 303515656 +hg17.chrX 3730950 3730950 +fr1.chrUn 303515664 303515664 +hg17.chrX 3730952 3730952 +fr1.chrUn 303515666 303515666 +hg17.chrX 3730955 3730955 +fr1.chrUn 303515669 303515669 +hg17.chrX 3730957 3730957 +fr1.chrUn 303515671 303515671 +hg17.chrX 3730959 3730959 +fr1.chrUn 303515673 303515673 +hg17.chrX 3730977 3730977 +fr1.chrUn 303515675 303515675 +hg17.chrX 3730981 3730981 +fr1.chrUn 303515679 303515679 +hg17.chrX 3730984 3730984 +fr1.chrUn 303515682 303515682 +hg17.chrX 3730988 3730988 +fr1.chrUn 303515686 303515686 +hg17.chrX 3730992 3731439 +fr1.chrUn 303515690 303516036 +hg17.chrX 3731005 3731005 +fr1.chrUn 303515693 303515693 +hg17.chrX 3731007 3731007 +fr1.chrUn 303515695 303515695 +hg17.chrX 3731019 3731019 +fr1.chrUn 303515705 303515705 +hg17.chrX 3731024 3731024 +fr1.chrUn 303515710 303515710 +hg17.chrX 3731026 3731027 +fr1.chrUn 303515712 303515713 +hg17.chrX 3731031 3731032 +fr1.chrUn 303515717 303515718 +hg17.chrX 3731034 3731034 +fr1.chrUn 303515720 303515720 +hg17.chrX 3729222 3729223 +fr1.chrUn 343703528 343703529 +hg17.chrX 3729234 3729234 +fr1.chrUn 343703540 343703540 +hg17.chrX 3729237 3729237 +fr1.chrUn 343703543 343703543 +hg17.chrX 3729240 3729240 +fr1.chrUn 343703546 343703546 +hg17.chrX 3729243 3729243 +fr1.chrUn 343703549 343703549 +hg17.chrX 3729246 3729246 +fr1.chrUn 343703552 343703552 +hg17.chrX 3729249 3729249 +fr1.chrUn 343703555 343703555 +hg17.chrX 3729252 3729252 +fr1.chrUn 343703558 343703558 +hg17.chrX 3729257 3729258 +fr1.chrUn 343703563 343703564 +hg17.chrX 3729262 3729264 +fr1.chrUn 343703568 343703570 +hg17.chrX 3729267 3729267 +fr1.chrUn 343703573 343703573 +hg17.chrX 3729270 3729270 +fr1.chrUn 343703576 343703576 +hg17.chrX 3729273 3729273 +fr1.chrUn 343703579 343703579 +hg17.chrX 3729276 3729276 +fr1.chrUn 343703582 343703582 +hg17.chrX 3729279 3729279 +fr1.chrUn 343703585 343703585 +hg17.chrX 3729288 3729288 +fr1.chrUn 343703594 343703594 +hg17.chrX 3729291 3729291 +fr1.chrUn 343703597 343703597 +hg17.chrX 3729295 3729295 +fr1.chrUn 343703601 343703601 +hg17.chrX 3729298 3729298 +fr1.chrUn 343703604 343703604 +hg17.chrX 3729300 3729301 +fr1.chrUn 343703606 343703607 +hg17.chrX 3729303 3729303 +fr1.chrUn 343703609 343703609 +hg17.chrX 3729306 3729306 +fr1.chrUn 343703612 343703612 +hg17.chrX 3729315 3729315 +fr1.chrUn 343703621 343703621 +hg17.chrX 3729324 3729324 +fr1.chrUn 343703630 343703630 +hg17.chrX 3729333 3729333 +fr1.chrUn 343703639 343703639 +hg17.chrX 3729339 3729339 +fr1.chrUn 343703645 343703645 +hg17.chrX 3729342 3729342 +fr1.chrUn 343703648 343703648 +hg17.chrX 3729351 3729351 +fr1.chrUn 343703657 343703657 +hg17.chrX 3729360 3729360 +fr1.chrUn 343703666 343703666 +hg17.chrX 3729363 3729363 +fr1.chrUn 343703669 343703669 +hg17.chrX 3729369 3729369 +fr1.chrUn 343703675 343703675 +hg17.chrX 3729372 3729372 +fr1.chrUn 343703678 343703678 +hg17.chrX 3729375 3729375 +fr1.chrUn 343703681 343703681 +hg17.chrX 3729378 3729378 +fr1.chrUn 343703684 343703684 +hg17.chrX 3729381 3729381 +fr1.chrUn 343703687 343703687 +hg17.chrX 3729390 3729390 +fr1.chrUn 343703696 343703696 +hg17.chrX 3729393 3729393 +fr1.chrUn 343703699 343703699 +hg17.chrX 3729396 3729396 +fr1.chrUn 343703702 343703702 +hg17.chrX 3729402 3729402 +fr1.chrUn 343703708 343703708 +hg17.chrX 3729408 3729409 +fr1.chrUn 343703714 343703715 +hg17.chrX 3729411 3729412 +fr1.chrUn 343703717 343703718 +hg17.chrX 3729417 3729417 +fr1.chrUn 343703723 343703723 +hg17.chrX 3729426 3729426 +fr1.chrUn 343703732 343703732 +hg17.chrX 3729429 3729429 +fr1.chrUn 343703735 343703735 +hg17.chrX 3729432 3729432 +fr1.chrUn 343703738 343703738 +hg17.chrX 3729435 3729435 +fr1.chrUn 343703741 343703741 +hg17.chrX 3729449 3729449 +fr1.chrUn 343703755 343703755 +hg17.chrX 3729452 3729454 +fr1.chrUn 343703758 343703760 +hg17.chrX 3700392 3700392 +fr1.chrUn 241017739 241017739 +hg17.chrX 3700394 3700394 +fr1.chrUn 241017741 241017741 +hg17.chrX 3700396 3700396 +fr1.chrUn 241017743 241017743 +hg17.chrX 3700400 3700401 +fr1.chrUn 241017747 241017748 +hg17.chrX 3700406 3700406 +fr1.chrUn 241017753 241017753 +hg17.chrX 3700409 3700410 +fr1.chrUn 241017756 241017757 +hg17.chrX 3700412 3700412 +fr1.chrUn 241017759 241017759 +hg17.chrX 3700418 3700420 +fr1.chrUn 241017766 241017768 +hg17.chrX 3700425 3700425 +fr1.chrUn 241017774 241017774 +hg17.chrX 3700430 3700431 +fr1.chrUn 241017782 241017783 +hg17.chrX 3700433 3700433 +fr1.chrUn 241017785 241017785 +hg17.chrX 3700438 3700438 +fr1.chrUn 241017790 241017790 +hg17.chrX 3700441 3700441 +fr1.chrUn 241017793 241017793 +hg17.chrX 3700448 3700449 +fr1.chrUn 241017800 241017801 +hg17.chrX 3700451 3700451 +fr1.chrUn 241017803 241017803 +hg17.chrX 3700454 3700460 +fr1.chrUn 241017806 241017812 +hg17.chrX 3700462 3700466 +fr1.chrUn 241017814 241017818 +hg17.chrX 3700469 3700469 +fr1.chrUn 241017821 241017821 +hg17.chrX 3700471 3700472 +fr1.chrUn 241017823 241017824 +hg17.chrX 3700474 3700474 +fr1.chrUn 241017826 241017826 +hg17.chrX 3700477 3700477 +fr1.chrUn 241017829 241017829 +hg17.chrX 3700480 3700787 +fr1.chrUn 241017832 241018162 +hg17.chrX 3700485 3700486 +fr1.chrUn 241017834 241017835 +hg17.chrX 3700489 3700489 +fr1.chrUn 241017838 241017838 +hg17.chrX 3700491 3700491 +fr1.chrUn 241017840 241017840 +hg17.chrX 3700493 3700493 +fr1.chrUn 241017842 241017842 +hg17.chrX 3700496 3700496 +fr1.chrUn 241017845 241017845 +hg17.chrX 3700502 3700502 +fr1.chrUn 241017851 241017851 +hg17.chrX 3700505 3700505 +fr1.chrUn 241017854 241017854 +hg17.chrX 3700511 3700511 +fr1.chrUn 241017860 241017860 +hg17.chrX 3700514 3700514 +fr1.chrUn 241017863 241017863 +hg17.chrX 3700517 3700517 +fr1.chrUn 241017866 241017866 +hg17.chrX 3700520 3700520 +fr1.chrUn 241017869 241017869 +hg17.chrX 3700526 3700526 +fr1.chrUn 241017875 241017875 +hg17.chrX 3700535 3700535 +fr1.chrUn 241017884 241017884 +hg17.chrX 3700547 3700549 +fr1.chrUn 241017896 241017898 +hg17.chrX 3700553 3700553 +fr1.chrUn 241017902 241017902 +hg17.chrX 3700563 3700564 +fr1.chrUn 241017921 241017922 +hg17.chrX 3700566 3700569 +fr1.chrUn 241017924 241017927 +hg17.chrX 3700571 3700571 +fr1.chrUn 241017929 241017929 +hg17.chrX 3700573 3700573 +fr1.chrUn 241017931 241017931 +hg17.chrX 3700579 3700579 +fr1.chrUn 241017937 241017937 +hg17.chrX 3700582 3700582 +fr1.chrUn 241017943 241017943 +hg17.chrX 3700584 3700584 +fr1.chrUn 241017945 241017945 +hg17.chrX 3700589 3700591 +fr1.chrUn 241017950 241017952 +hg17.chrX 3700597 3700597 +fr1.chrUn 241017962 241017962 +hg17.chrX 3700601 3700602 +fr1.chrUn 241017966 241017967 +hg17.chrX 3700604 3700604 +fr1.chrUn 241017969 241017969 +hg17.chrX 3700606 3700606 +fr1.chrUn 241017971 241017971 +hg17.chrX 3700609 3700609 +fr1.chrUn 241017974 241017974 +hg17.chrX 3700611 3700613 +fr1.chrUn 241017976 241017978 +hg17.chrX 3700615 3700615 +fr1.chrUn 241017980 241017980 +hg17.chrX 3700619 3700619 +fr1.chrUn 241017984 241017984 +hg17.chrX 3700622 3700626 +fr1.chrUn 241017987 241017991 +hg17.chrX 3700628 3700628 +fr1.chrUn 241017993 241017993 +hg17.chrX 3700630 3700937 +fr1.chrUn 241017995 241018325 +hg17.chrX 3700636 3700637 +fr1.chrUn 241018004 241018005 +hg17.chrX 3700640 3700640 +fr1.chrUn 241018008 241018008 +hg17.chrX 3700643 3700644 +fr1.chrUn 241018011 241018012 +hg17.chrX 3700646 3700649 +fr1.chrUn 241018014 241018017 +hg17.chrX 3700656 3700656 +fr1.chrUn 241018022 241018022 +hg17.chrX 3700658 3700658 +fr1.chrUn 241018024 241018024 +hg17.chrX 3700663 3700665 +fr1.chrUn 241018029 241018031 +hg17.chrX 3700669 3700669 +fr1.chrUn 241018035 241018035 +hg17.chrX 3700677 3700986 +fr1.chrUn 241018045 241018377 +hg17.chrX 3700681 3700681 +fr1.chrUn 241018051 241018051 +hg17.chrX 3700685 3700686 +fr1.chrUn 241018055 241018056 +hg17.chrX 3700691 3700692 +fr1.chrUn 241018061 241018062 +hg17.chrX 3639443 3639443 +fr1.chrUn 333536352 333536352 +hg17.chrX 3639445 3639445 +fr1.chrUn 333536354 333536354 +hg17.chrX 3639449 3639449 +fr1.chrUn 333536358 333536358 +hg17.chrX 3639452 3639452 +fr1.chrUn 333536361 333536361 +hg17.chrX 3639454 3639456 +fr1.chrUn 333536363 333536365 +hg17.chrX 3639458 3639458 +fr1.chrUn 333536367 333536367 +hg17.chrX 3639468 3639469 +fr1.chrUn 333536381 333536382 +hg17.chrX 3639471 3639471 +fr1.chrUn 333536384 333536384 +hg17.chrX 3639474 3639474 +fr1.chrUn 333536387 333536387 +hg17.chrX 3639476 3639477 +fr1.chrUn 333536389 333536390 +hg17.chrX 3639479 3639479 +fr1.chrUn 333536392 333536392 +hg17.chrX 3639487 3639491 +fr1.chrUn 333536400 333536404 +hg17.chrX 3639493 3639495 +fr1.chrUn 333536406 333536408 +hg17.chrX 3639498 3639498 +fr1.chrUn 333536411 333536411 +hg17.chrX 3639509 3639510 +fr1.chrUn 333536425 333536426 +hg17.chrX 3639512 3639512 +fr1.chrUn 333536428 333536428 +hg17.chrX 3639515 3639515 +fr1.chrUn 333536431 333536431 +hg17.chrX 3639517 3639520 +fr1.chrUn 333536433 333536436 +hg17.chrX 3639522 3639522 +fr1.chrUn 333536438 333536438 +hg17.chrX 3639525 3639525 +fr1.chrUn 333536441 333536441 +hg17.chrX 3639527 3639528 +fr1.chrUn 333536443 333536444 +hg17.chrX 3639532 3639533 +fr1.chrUn 333536451 333536452 +hg17.chrX 3639536 3639536 +fr1.chrUn 333536455 333536455 +hg17.chrX 3639539 3639539 +fr1.chrUn 333536458 333536458 +hg17.chrX 3639545 3639550 +fr1.chrUn 333536464 333536469 +hg17.chrX 3639552 3639552 +fr1.chrUn 333536471 333536471 +hg17.chrX 3639554 3639556 +fr1.chrUn 333536473 333536475 +hg17.chrX 3639563 3639564 +fr1.chrUn 333536480 333536481 +hg17.chrX 3639572 3639572 +fr1.chrUn 333536489 333536489 +hg17.chrX 3639576 3639577 +fr1.chrUn 333536493 333536494 +hg17.chrX 3639579 3639579 +fr1.chrUn 333536496 333536496 +hg17.chrX 3639588 3639588 +fr1.chrUn 333536505 333536505 +hg17.chrX 3639592 3639592 +fr1.chrUn 333536509 333536509 +hg17.chrX 3639598 3639598 +fr1.chrUn 333536515 333536515 +hg17.chrX 3639600 3639600 +fr1.chrUn 333536517 333536517 +hg17.chrX 3639603 3639603 +fr1.chrUn 333536520 333536520 +hg17.chrX 3639606 3639606 +fr1.chrUn 333536523 333536523 +hg17.chrX 3639612 3639612 +fr1.chrUn 333536529 333536529 +hg17.chrX 3639615 3639615 +fr1.chrUn 333536532 333536532 +hg17.chrX 3639622 3639622 +fr1.chrUn 333536539 333536539 +hg17.chrX 3639642 3639642 +fr1.chrUn 333536559 333536559 diff -r 05974294cbf1 -r dabed25dfbaf tool_conf.xml.sample --- a/tool_conf.xml.sample Sat Sep 20 18:14:24 2008 -0400 +++ b/tool_conf.xml.sample Sun Sep 21 17:36:28 2008 -0400 @@ -128,6 +128,8 @@ <tool file="regVariation/getIndels_2way.xml" /> <tool file="regVariation/getIndels_3way.xml" /> <tool file="regVariation/getIndelRates_3way.xml" /> + <tool file="regVariation/substitutions.xml" /> + <tool file="regVariation/substitution_rates.xml" /> </section> <section name="Multiple regression" id="multReg"> <tool file="regVariation/linear_regression.xml" /> diff -r 05974294cbf1 -r dabed25dfbaf tools/regVariation/substitution_rates.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/regVariation/substitution_rates.py Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,118 @@ +#! /usr/bin/python +#guruprasad Ananda +""" +Estimates substitution rates from pairwise alignments using JC69 model. +""" + +from galaxy import eggs +from galaxy.tools.util.galaxyops import * +from galaxy.tools.util import maf_utilities +import bx.align.maf +import sys, fileinput + +def stop_err(msg): + sys.stderr.write(msg) + sys.exit() + +if len(sys.argv) < 3: + stop_err("Incorrect number of arguments.") + +inp_file = sys.argv[1] +out_file = sys.argv[2] +fout = open(out_file, 'w') +int_file = sys.argv[3] +if int_file != "None": #The user has specified an interval file + dbkey_i = sys.argv[4] + chr_col_i, start_col_i, end_col_i, strand_col_i = parse_cols_arg( sys.argv[5] ) + + +def rateEstimator(block): + global alignlen, mismatches + + src1 = block.components[0].src + sequence1 = block.components[0].text + start1 = block.components[0].start + end1 = block.components[0].end + len1 = int(end1)-int(start1) + len1_withgap = len(sequence1) + mismatch = 0.0 + + for seq in range (1,len(block.components)): + src2 = block.components[seq].src + sequence2 = block.components[seq].text + start2 = block.components[seq].start + end2 = block.components[seq].end + len2 = int(end2)-int(start2) + for nt in range(len1_withgap): + if sequence1[nt] not in '-#$^*?' and sequence2[nt] not in '-#$^*?': #Not a gap or masked character + if sequence1[nt].upper() != sequence2[nt].upper(): + mismatch += 1 + + if int_file == "None": + p = mismatch/min(len1,len2) + print >>fout, "%s\t%s\t%s\t%s\t%s\t%s\t%d\t%d\t%.4f" %(src1,start1,end1,src2,start2,end2,min(len1,len2),mismatch,p) + else: + mismatches += mismatch + alignlen += min(len1,len2) + +def main(): + skipped = 0 + not_pairwise = 0 + + if int_file == "None": + try: + maf_reader = bx.align.maf.Reader( open(inp_file, 'r') ) + except: + stop_err("Your MAF file appears to be malformed.") + print >>fout, "#Seq1\tStart1\tEnd1\tSeq2\tStart2\tEnd2\tL\tN\tp" + for block in maf_reader: + if len(block.components) != 2: + not_pairwise += 1 + continue + try: + rateEstimator(block) + except: + skipped += 1 + else: + index, index_filename = maf_utilities.build_maf_index( inp_file, species = [dbkey_i] ) + if index is None: + print >> sys.stderr, "Your MAF file appears to be malformed." + sys.exit() + win = NiceReaderWrapper( fileinput.FileInput( int_file ), + chrom_col=chr_col_i, + start_col=start_col_i, + end_col=end_col_i, + strand_col=strand_col_i, + fix_strand=True) + species=None + mincols = 0 + global alignlen, mismatches + + for interval in win: + alignlen = 0 + mismatches = 0.0 + src = "%s.%s" % ( dbkey_i, interval.chrom ) + for block in maf_utilities.get_chopped_blocks_for_region( index, src, interval, species, mincols ): + if len(block.components) != 2: + not_pairwise += 1 + continue + try: + rateEstimator(block) + except: + skipped += 1 + if alignlen: + p = mismatches/alignlen + else: + p = 'NA' + interval.fields.append(str(alignlen)) + interval.fields.append(str(mismatches)) + interval.fields.append(str(p)) + print >>fout, "\t".join(interval.fields) + #num_blocks += 1 + + if not_pairwise: + print "Skipped %d non-pairwise blocks" %(not_pairwise) + if skipped: + print "Skipped %d blocks as invalid" %(skipped) +if __name__ == "__main__": + main() diff -r 05974294cbf1 -r dabed25dfbaf tools/regVariation/substitution_rates.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/regVariation/substitution_rates.xml Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,61 @@ +<tool id="subRate1" name="Estimate substitution rates " version="1.0.0"> + <description> for non-coding regions</description> + <command interpreter="python"> + substitution_rates.py + $input + $out_file1 + #if $region.type == "win": + ${region.input2} ${region.input2.dbkey} ${region.input2.metadata.chromCol},$region.input2.metadata.startCol,$region.input2.metadata.endCol,$region.input2.metadata.strandCol + #else: + "None" + #end if + </command> + <inputs> + <param format="maf" name="input" type="data" label="Select pair-wise alignment data"/> + <conditional name="region"> + <param name="type" type="select" label="Estimate rates corresponding to" multiple="false"> + <option value="align">Alignment block</option> + <option value="win">Intervals in your history</option> + </param> + <when value="win"> + <param format="interval" name="input2" type="data" label="Choose intervals"> + <validator type="unspecified_build" /> + </param> + </when> + <when value="align" /> + </conditional> + </inputs> + <outputs> + <data format="tabular" name="out_file1" metadata_source="input"/> + </outputs> + + <tests> + <test> + <param name="input" value="Interval2Maf_pairwise_out.maf"/> + <param name="type" value="align"/> + <output name="out_file1" file="subRates1.out"/> + </test> + </tests> + + <help> + +.. class:: infomark + +**What it does** + +This tool takes a pairwise MAF file as input and estimates substitution rate according to Jukes-Cantor JC69 model. The 3 new columns appended to the output are explanied below: + +- L: number of nucleotides compared +- N: number of different nucleotides +- p = N/L + +----- + +.. class:: warningmark + +**Note** + +Any block/s not containing exactly two sequences, will be omitted. + + </help> +</tool> \ No newline at end of file diff -r 05974294cbf1 -r dabed25dfbaf tools/regVariation/substitutions.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/regVariation/substitutions.py Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,87 @@ +#! /usr/bin/python +#Guruprasad ANanda +""" +Fetches substitutions from pairwise alignments. +""" + +from galaxy import eggs + +from galaxy.tools.util import maf_utilities + +import bx.align.maf +import sys +import os, fileinput +def stop_err(msg): + sys.stderr.write(msg) + sys.exit() + +if len(sys.argv) < 3: + stop_err("Incorrect number of arguments.") + +inp_file = sys.argv[1] +out_file = sys.argv[2] +fout = open(out_file, 'w') + +def fetchSubs(block): + + src1 = block.components[0].src + sequence1 = block.components[0].text + start1 = block.components[0].start + end1 = block.components[0].end + len1 = int(end1)-int(start1) + len1_withgap = len(sequence1) + + for seq in range (1,len(block.components)): + src2 = block.components[seq].src + sequence2 = block.components[seq].text + start2 = block.components[seq].start + end2 = block.components[seq].end + len2 = int(end2)-int(start2) + sub_begin = None + sub_end = None + begin = False + + for nt in range(len1_withgap): + if sequence1[nt] not in '-#$^*?' and sequence2[nt] not in '-#$^*?': #Not a gap or masked character + if sequence1[nt].upper() != sequence2[nt].upper(): + if not(begin): + sub_begin = nt + begin = True + sub_end = nt + else: + if begin: + print >>fout, "%s\t%s\t%s" %(src1,start1+sub_begin-sequence1[0:sub_begin].count('-'),start1+sub_end-sequence1[0:sub_end].count('-')) + print >>fout, "%s\t%s\t%s" %(src2,start2+sub_begin-sequence2[0:sub_begin].count('-'),start2+sub_end-sequence2[0:sub_end].count('-')) + begin = False + + else: + if begin: + print >>fout, "%s\t%s\t%s" %(src1,start1+sub_begin-sequence1[0:sub_begin].count('-'),end1+sub_end-sequence1[0:sub_end].count('-')) + print >>fout, "%s\t%s\t%s" %(src2,start2+sub_begin-sequence2[0:sub_begin].count('-'),end2+sub_end-sequence2[0:sub_end].count('-')) + begin = False + ended = False + + +def main(): + skipped = 0 + not_pairwise = 0 + try: + maf_reader = bx.align.maf.Reader( open(inp_file, 'r') ) + except: + stop_err("Your MAF file appears to be malformed.") + print >>fout, "#Chr\tStart\tEnd" + for block in maf_reader: + if len(block.components) != 2: + not_pairwise += 1 + continue + try: + fetchSubs(block) + except: + skipped += 1 + + if not_pairwise: + print "Skipped %d non-pairwise blocks" %(not_pairwise) + if skipped: + print "Skipped %d blocks" %(skipped) +if __name__ == "__main__": + main() diff -r 05974294cbf1 -r dabed25dfbaf tools/regVariation/substitutions.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/regVariation/substitutions.xml Sun Sep 21 17:36:28 2008 -0400 @@ -0,0 +1,38 @@ +<tool id="substitutions1" name="Fetch substitutions " version="1.0.0"> + <description> from pairwise alignments</description> + <command interpreter="python"> + substitutions.py + $input + $out_file1 + </command> + <inputs> + <param format="maf" name="input" type="data" label="Select pair-wise alignment data"/> + </inputs> + <outputs> + <data format="tabular" name="out_file1" metadata_source="input"/> + </outputs> + + <tests> + <test> + <param name="input" value="Interval2Maf_pairwise_out.maf"/> + <output name="out_file1" file="subs.out"/> + </test> + </tests> + <help> + +.. class:: infomark + +**What it does** + +This tool takes a pairwise MAF file as input and fetches substitutions per alignment block. + +----- + +.. class:: warningmark + +**Note** + +Any block/s not containing exactly two sequences, will be omitted. + + </help> +</tool> \ No newline at end of file

1 0

[hg] galaxy 1507: add SHRiMP mapper for short reads analysis.
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/842f1883cf53 changeset: 1507:842f1883cf53 user: wychung date: Mon Sep 15 15:04:41 2008 -0400 description: add SHRiMP mapper for short reads analysis. 6 file(s) affected in this change: test-data/shrimp_phix_anc.fa test-data/shrimp_wrapper_test1.fastq test-data/shrimp_wrapper_test1.out1 tool_conf.xml.sample tools/metag_tools/shrimp_wrapper.py tools/metag_tools/shrimp_wrapper.xml diffs (853 lines): diff -r 26825f08d362 -r 842f1883cf53 test-data/shrimp_phix_anc.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shrimp_phix_anc.fa Mon Sep 15 15:04:41 2008 -0400 @@ -0,0 +1,2 @@ +>PHIX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTT GAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCgTGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGGCAACTTGCCGCCG CGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGGCGGTATTGCTTCTGCTC TTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATG CCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTT GTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA diff -r 26825f08d362 -r 842f1883cf53 test-data/shrimp_wrapper_test1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shrimp_wrapper_test1.fastq Mon Sep 15 15:04:41 2008 -0400 @@ -0,0 +1,40 @@ +@HWI-EAS91_1_306UPAAXX:6:1:959:874 +GCGGGCTGCGACATAAAGCATACCGCCTGGGCGGCG ++HWI-EAS91_1_306UPAAXX:6:1:959:874 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:1630:1975 +GAAAGAAAATCAGCAACAGTGGCATCGATTTTACGG ++HWI-EAS91_1_306UPAAXX:6:1:1630:1975 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:770:994 +GCAGGCAGCGTGCTGCGAGTCTTTTCGAATGATAAG ++HWI-EAS91_1_306UPAAXX:6:1:770:994 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:1274:306 +GTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGC ++HWI-EAS91_1_306UPAAXX:6:1:1274:306 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh\h +@HWI-EAS91_1_306UPAAXX:6:1:1339:209 +GTTTGGTCAGTTCCATCAACATCATAGCCAGATGCC ++HWI-EAS91_1_306UPAAXX:6:1:1339:209 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:203:1240 +GATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTA ++HWI-EAS91_1_306UPAAXX:6:1:203:1240 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:869:448 +GCTGGCCATCAGTTCGCGGATACCGGCGGCAAACAT ++HWI-EAS91_1_306UPAAXX:6:1:869:448 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhKhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:939:928 +GGAGGCCTCCAGCAATCTTGAACACTCATCCTTAAT ++HWI-EAS91_1_306UPAAXX:6:1:939:928 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:1756:1476 +GCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGC ++HWI-EAS91_1_306UPAAXX:6:1:1756:1476 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh +@HWI-EAS91_1_306UPAAXX:6:1:1528:181 +GGCTGGTCAGTATTTTACCAATGACCAAATCAAAGA ++HWI-EAS91_1_306UPAAXX:6:1:1528:181 +hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh diff -r 26825f08d362 -r 842f1883cf53 test-data/shrimp_wrapper_test1.out1 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shrimp_wrapper_test1.out1 Mon Sep 15 15:04:41 2008 -0400 @@ -0,0 +1,7 @@ +#FORMAT: readname contigname strand contigstart contigend readstart readend readlength score editstring +>HWI-EAS91_1_306UPAAXX:6:1:1528:181 PHIX174 + 3644 3679 1 36 36 3600 36 +>HWI-EAS91_1_306UPAAXX:6:1:1756:1476 PHIX174 + 4505 4540 1 36 36 3600 36 +>HWI-EAS91_1_306UPAAXX:6:1:203:1240 PHIX174 + 310 345 1 36 36 3600 36 +>HWI-EAS91_1_306UPAAXX:6:1:1274:306 PHIX174 + 933 968 1 36 36 3600 36 +>HWI-EAS91_1_306UPAAXX:6:1:939:928 PHIX174 - 4458 4493 1 36 36 3600 36 +>HWI-EAS91_1_306UPAAXX:6:1:1339:209 PHIX174 - 1732 1767 1 36 36 3600 36 diff -r 26825f08d362 -r 842f1883cf53 tool_conf.xml.sample --- a/tool_conf.xml.sample Sun Sep 14 14:58:50 2008 -0400 +++ b/tool_conf.xml.sample Mon Sep 15 15:04:41 2008 -0400 @@ -276,6 +276,7 @@ <tool file="metag_tools/blat_coverage_report.xml" /> </section> <section name="Short Read Mapping" id="solexa_tools"> + <tool file="metag_tools/shrimp_wrapper.xml" /> <tool file="sr_mapping/lastz_wrapper.xml" /> <tool file="metag_tools/megablast_wrapper.xml" /> <tool file="metag_tools/megablast_xml_parser.xml" /> diff -r 26825f08d362 -r 842f1883cf53 tools/metag_tools/shrimp_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/shrimp_wrapper.py Mon Sep 15 15:04:41 2008 -0400 @@ -0,0 +1,577 @@ +#! /usr/bin/python + +""" +SHRiMP wrapper + +Inputs: + reference seq and reads + +Outputs: + table of 8 columns: + chrom ref_loc read_id read_loc ref_nuc read_nuc quality coverage + SHRiMP output + +Parameters: + -s Spaced Seed (default: 111111011111) + -n Seed Matches per Window (default: 2) + -t Seed Hit Taboo Length (default: 4) + -9 Seed Generation Taboo Length (default: 0) + -w Seed Window Length (default: 115.00%) + -o Maximum Hits per Read (default: 100) + -r Maximum Read Length (default: 1000) + -d Kmer Std. Deviation Limit (default: -1 [None]) + + -m S-W Match Value (default: 100) + -i S-W Mismatch Value (default: -150) + -g S-W Gap Open Penalty (Reference) (default: -400) + -q S-W Gap Open Penalty (Query) (default: -400) + -e S-W Gap Extend Penalty (Reference) (default: -70) + -f S-W Gap Extend Penalty (Query) (default: -70) + -h S-W Hit Threshold (default: 68.00%) + +Command: +%rmapper -s spaced_seed -n seed_matches_per_window -t seed_hit_taboo_length -9 seed_generation_taboo_length -w seed_window_length -o max_hits_per_read -r max_read_length -d kmer -m sw_match_value -i sw_mismatch_value -g sw_gap_open_ref -q sw_gap_open_query -e sw_gap_ext_ref -f sw_gap_ext_query -h sw_hit_threshold <query> <target> > <output> 2> <log> + +SHRiMP output: +>7:2:1147:982/1 chr3 + 36586562 36586595 2 35 36 2900 3G16G13 +>7:2:1147:982/1 chr3 + 95338194 95338225 4 35 36 2700 9T7C14 +>7:2:587:93/1 chr3 + 14913541 14913577 1 35 36 2960 19--16 + +Testing: +%python shrimp_wrapper.py single ~/Desktop/shrimp_wrapper/phix_anc.fa tmp tmp1 ~/Desktop/shrimp_wrapper/phix.10.solexa.fastq +%python shrimp_wrapper.py paired ~/Desktop/shrimp_wrapper/eca_ref_chrMT.fa tmp tmp1 ~/Desktop/shrimp_wrapper/eca.5.solexa_1.fastq ~/Desktop/shrimp_wrapper/eca.5.solexa_2.fastq + +""" + +import os, sys, tempfile, os.path + +assert sys.version_info[:2] >= (2.4) + +def stop_err( msg ): + + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def reverse_complement(s): + + complement_dna = {"A":"T", "T":"A", "C":"G", "G":"C", "a":"t", "t":"a", "c":"g", "g":"c", "N":"N", "n":"n" , ".":".", "-":"-"} + reversed_s = [] + for i in s: + reversed_s.append(complement_dna[i]) + reversed_s.reverse() + return "".join(reversed_s) + +def generate_sub_table(result_file, ref_file, score_files, table_outfile, hit_per_read): + + """ + TODO: the cross-over error has not been addressed yet. + """ + + insertion_size = 600 + + all_score_file = score_files.split('&') + + if len(all_score_file) != hit_per_read: stop_err('Un-equal number of files!') + + temp_table_name = tempfile.NamedTemporaryFile().name + temp_table = open(temp_table_name, 'w') + + outfile = open(table_outfile,'w') + + # reference seq: not a single fasta seq + refseq = {} + chrom_cov = {} + seq = '' + + for i, line in enumerate(file(ref_file)): + line = line.rstrip() + if not line or line.startswith('#'): continue + + if line.startswith('>'): + if seq: + if refseq.has_key(title): + pass + else: + refseq[title] = seq + chrom_cov[title] = {} + seq = '' + title = line[1:] + else: + seq += line + if seq: + if not refseq.has_key(title): + refseq[title] = seq + chrom_cov[title] = {} + + # find hits : one end and/or the other + hits = {} + for i, line in enumerate(file(result_file)): + line = line.rstrip() + if not line or line.startswith('#'): continue + + #FORMAT: readname contigname strand contigstart contigend readstart readend readlength score editstring + fields = line.split('\t') + readname = fields[0][1:] + chrom = fields[1] + strand = fields[2] + chrom_start = int(fields[3]) - 1 + chrom_end = int(fields[4]) + read_start = fields[5] + read_end = fields[6] + read_len = fields[7] + score = fields[8] + editstring = fields[9] + + if hit_per_read == 1: + endindex = '1' + else: + readname, endindex = readname.split('/') + + if hits.has_key(readname): + if hits[readname].has_key(endindex): + hits[readname][endindex].append([strand, editstring, chrom_start, chrom_end, read_start, chrom]) + else: + hits[readname][endindex] = [[strand, editstring, chrom_start, chrom_end, read_start, chrom]] + else: + hits[readname] = {} + hits[readname][endindex] = [[strand, editstring, chrom_start, chrom_end, read_start, chrom]] + + # find score : one end and the other end + hits_score = {} + readname = '' + score = '' + for num_score_file in range(len(all_score_file)): + score_file = all_score_file[num_score_file] + for i, line in enumerate(file(score_file)): + line = line.rstrip() + if not line or line.startswith('#'): continue + + if line.startswith('>'): + if score: + if hits.has_key(readname): + if len(hits[readname]) == hit_per_read: + if hits_score.has_key(readname): + if hits_score[readname].has_key(endindex): + pass + else: + hits_score[readname][endindex] = score + else: + hits_score[readname] = {} + hits_score[readname][endindex] = score + score = '' + if hit_per_read == 1: + readname = line[1:] + endindex = '1' + else: + readname, endindex = line[1:].split('/') + else: + score = line + if score: # the last one + if hits.has_key(readname): + if len(hits[readname]) == hit_per_read: + if hits_score.has_key(readname): + if hits_score[readname].has_key(endindex): + pass + else: + hits_score[readname][endindex] = score + else: + hits_score[readname] = {} + hits_score[readname][endindex] = score + + # mutation call to all mappings + for readkey in hits.keys(): + if len(hits[readkey]) != hit_per_read: continue + + matches = [] + match_count = 0 + + if hit_per_read == 1: + matches = [ hits[readkey]['1'] ] + match_count = 1 + else: + end1_data = hits[readkey]['1'] + end2_data = hits[readkey]['2'] + + for i, end1_hit in enumerate(end1_data): + crin_strand = {'+': False, '-': False} + crin_insertSize = {'+': False, '-': False} + + crin_strand[end1_hit[0]] = True + crin_insertSize[end1_hit[0]] = int(end1_hit[2]) + + for j, end2_hit in enumerate(end2_data): + crin_strand[end2_hit[0]] = True + crin_insertSize[end2_hit[0]] = int(end2_hit[2]) + + if end1_hit[-1] != end2_hit[-1] : continue + + if crin_strand['+'] and crin_strand['-']: + if (crin_insertSize['-'] - crin_insertSize['+']) <= insertion_size: + matches.append([end1_hit, end2_hit]) + match_count += 1 + + if match_count == 1: + for x, end_data in enumerate(matches[0]): + + end_strand, end_editstring, end_chr_start, end_chr_end, end_read_start, end_chrom = end_data + end_read_start = int(end_read_start) - 1 + + if end_strand == '-': + refsegment = reverse_complement(refseq[end_chrom][end_chr_start:end_chr_end]) + else: + refsegment = refseq[end_chrom][end_chr_start:end_chr_end] + + match_len = 0 + editindex = 0 + gap_read = 0 + + while editindex < len(end_editstring): + editchr = end_editstring[editindex] + chrA = '' + chrB = '' + locIndex = [] + if editchr.isdigit(): + editcode = '' + while editchr.isdigit() and editindex < len(end_editstring): + editcode += editchr + editindex += 1 + if editindex < len(end_editstring): editchr = end_editstring[editindex] + for baseIndex in range(int(editcode)): + chrA += refsegment[match_len+baseIndex] + chrB = chrA + match_len += int(editcode) + elif editchr == 'x': + # crossover: inserted between the appropriate two bases + # Two sequencing errors: 4x15x6 (25 matches with 2 crossovers) + # Treated as errors in the reads; Do nothing. + editindex += 1 + + elif editchr.isalpha(): + editcode = editchr + editindex += 1 + chrA = refsegment[match_len] + chrB = editcode + match_len += len(editcode) + + elif editchr == '-': + editcode = editchr + editindex += 1 + chrA = refsegment[match_len] + chrB = editcode + match_len += len(editcode) + gap_read += 1 + + elif editchr == '(': + editcode = '' + while editchr != ')' and editindex < len(end_editstring): + if editindex < len(end_editstring): editchr = end_editstring[editindex] + editcode += editchr + editindex += 1 + editcode = editcode[1:-1] + chrA = '-'*len(editcode) + chrB = editcode + + else: + print 'Warning! Unknown symbols', editchr + + if end_strand == '-': + chrA = reverse_complement(chrA) + chrB = reverse_complement(chrB) + + pos_line = '' + rev_line = '' + + for mappingIndex in range(len(chrA)): + # reference + chrAx = chrA[mappingIndex] + # read + chrBx = chrB[mappingIndex] + + if chrAx and chrBx and chrBx.upper() != 'N': + if end_strand == '+': + chrom_loc = end_chr_start+match_len-len(chrA)+mappingIndex + read_loc = end_read_start+match_len-len(chrA)+mappingIndex-gap_read + if chrAx == '-': chrom_loc -= 1 + + if chrBx == '-': + scoreBx = '-1' + else: + scoreBx = hits_score[readkey][str(x+1)].split()[read_loc] + + # 1-based on chrom_loc and read_loc + pos_line = pos_line + '\t'.join([end_chrom, str(chrom_loc+1), readkey+'/'+str(x+1), str(read_loc+1), chrAx, chrBx, scoreBx]) + '\n' + else: + chrom_loc = end_chr_end-match_len+mappingIndex + read_loc = end_read_start+match_len-1-mappingIndex-gap_read + if chrAx == '-': chrom_loc -= 1 + + if chrBx == '-': + scoreBx = '-1' + else: + scoreBx = hits_score[readkey][str(x+1)].split()[read_loc] + + # 1-based on chrom_loc and read_loc + rev_line = '\t'.join([end_chrom, str(chrom_loc+1), readkey+'/'+str(x+1), str(read_loc+1), chrAx, chrBx, scoreBx]) +'\n' + rev_line + + if chrom_cov.has_key(end_chrom): + if chrom_cov[end_chrom].has_key(chrom_loc): + chrom_cov[end_chrom][chrom_loc] += 1 + else: + chrom_cov[end_chrom][chrom_loc] = 1 + else: + chrom_cov[end_chrom] = {} + chrom_cov[end_chrom][chrom_loc] = 1 + + if pos_line: temp_table.write('%s\n' %(pos_line.rstrip('\r\n'))) + if rev_line: temp_table.write('%s\n' %(rev_line.rstrip('\r\n'))) + + temp_table.close() + + # chrom-wide coverage + for i, line in enumerate(open(temp_table_name)): + line = line.rstrip() + if not line or line.startswith('#'): continue + + fields = line.split() + chrom = fields[0] + eachBp = int(fields[1]) + readname = fields[2] + + if hit_per_read == 1: + fields[2] = readname.split('/')[0] + + if chrom_cov[chrom].has_key(eachBp): + outfile.write('%s\t%d\n' %('\t'.join(fields), chrom_cov[chrom][eachBp])) + else: + outfile.write('%s\t%d\n' %('\t'.join(fields), 0)) + + outfile.close() + + if os.path.exists(temp_table_name): os.remove(temp_table_name) + + return True + +def convert_fastqsolexa_to_fasta_qual(infile_name, query_fasta, query_qual): + + outfile_seq = open( query_fasta, 'w' ) + outfile_score = open( query_qual, 'w' ) + + seq_title_startswith = '' + qual_title_startswith = '' + + default_coding_value = 64 + fastq_block_lines = 0 + + for i, line in enumerate( file( infile_name ) ): + line = line.rstrip() + if not line or line.startswith( '#' ): continue + + fastq_block_lines = ( fastq_block_lines + 1 ) % 4 + line_startswith = line[0:1] + + if fastq_block_lines == 1: + # first line is @title_of_seq + if not seq_title_startswith: + seq_title_startswith = line_startswith + + if line_startswith != seq_title_startswith: + outfile_seq.close() + outfile_score.close() + stop_err( 'Invalid fastqsolexa format at line %d: %s.' % ( i + 1, line ) ) + + read_title = line[1:] + outfile_seq.write( '>%s\n' % line[1:] ) + + elif fastq_block_lines == 2: + # second line is nucleotides + read_length = len( line ) + outfile_seq.write( '%s\n' % line ) + + elif fastq_block_lines == 3: + # third line is +title_of_qualityscore ( might be skipped ) + if not qual_title_startswith: + qual_title_startswith = line_startswith + + if line_startswith != qual_title_startswith: + outfile_seq.close() + outfile_score.close() + stop_err( 'Invalid fastqsolexa format at line %d: %s.' % ( i + 1, line ) ) + + quality_title = line[1:] + if quality_title and read_title != quality_title: + outfile_seq.close() + outfile_score.close() + stop_err( 'Invalid fastqsolexa format at line %d: sequence title "%s" differes from score title "%s".' % ( i + 1, read_title, quality_title ) ) + + if not quality_title: + outfile_score.write( '>%s\n' % read_title ) + else: + outfile_score.write( '>%s\n' % line[1:] ) + + else: + # fourth line is quality scores + qual = '' + fastq_integer = True + # peek: ascii or digits? + val = line.split()[0] + try: + check = int( val ) + fastq_integer = True + except: + fastq_integer = False + + if fastq_integer: + # digits + qual = line + else: + # ascii + quality_score_length = len( line ) + if quality_score_length == read_length + 1: + # first char is qual_score_startswith + qual_score_startswith = ord( line[0:1] ) + line = line[1:] + elif quality_score_length == read_length: + qual_score_startswith = default_coding_value + else: + stop_err( 'Invalid fastqsolexa format at line %d: the number of quality scores ( %d ) is not the same as bases ( %d ).' % ( i + 1, quality_score_length, read_length ) ) + + for j, char in enumerate( line ): + score = ord( char ) - qual_score_startswith # 64 + qual = "%s%s " % ( qual, str( score ) ) + + outfile_score.write( '%s\n' % qual ) + + outfile_seq.close() + outfile_score.close() + + return True + +def __main__(): + + # I/O + type_of_reads = sys.argv[1] # single or paired + input_target = sys.argv[2] # fasta + shrimp_outfile = sys.argv[3] # shrimp output + table_outfile = sys.argv[4] # table output + + # SHRiMP parameters: total = 15 + # TODO: put threshold on each of these parameters + if len(sys.argv) == 21 or len(sys.argv) == 22: + spaced_seed = sys.argv[5] + seed_matches_per_window = sys.argv[6] + seed_hit_taboo_length = sys.argv[7] + seed_generation_taboo_length = sys.argv[8] + seed_window_length = sys.argv[9] + max_hits_per_read = sys.argv[10] + max_read_length = sys.argv[11] + kmer = sys.argv[12] + sw_match_value = sys.argv[13] + sw_mismatch_value = sys.argv[14] + sw_gap_open_ref = sys.argv[15] + sw_gap_open_query = sys.argv[16] + sw_gap_ext_ref = sys.argv[17] + sw_gap_ext_query = sys.argv[18] + sw_hit_threshold = sys.argv[19] + + # Single-end parameters + if type_of_reads == 'single': + input_query = sys.argv[20] # single-end + hit_per_read = 1 + query_fasta = tempfile.NamedTemporaryFile().name + query_qual = tempfile.NamedTemporaryFile().name + else: # Paired-end parameters + input_query_end1 = sys.argv[20] # paired-end + input_query_end2 = sys.argv[21] + hit_per_read = 2 + query_fasta_end1 = tempfile.NamedTemporaryFile().name + query_fasta_end2 = tempfile.NamedTemporaryFile().name + query_qual_end1 = tempfile.NamedTemporaryFile().name + query_qual_end2 = tempfile.NamedTemporaryFile().name + else: + spaced_seed = '111111011111' + seed_matches_per_window = '2' + seed_hit_taboo_length = '4' + seed_generation_taboo_length = '0' + seed_window_length = '115.0' + max_hits_per_read = '100' + max_read_length = '1000' + kmer = '-1' + sw_match_value = '100' + sw_mismatch_value = '-150' + sw_gap_open_ref = '-400' + sw_gap_open_query = '-400' + sw_gap_ext_ref = '-70' + sw_gap_ext_query = '-70' + sw_hit_threshold = '68.0' + + # Single-end parameters + if type_of_reads == 'single': + input_query = sys.argv[5] # single-end + hit_per_read = 1 + query_fasta = tempfile.NamedTemporaryFile().name + query_qual = tempfile.NamedTemporaryFile().name + else: # Paired-end parameters + input_query_end1 = sys.argv[5] # paired-end + input_query_end2 = sys.argv[6] + hit_per_read = 2 + query_fasta_end1 = tempfile.NamedTemporaryFile().name + query_fasta_end2 = tempfile.NamedTemporaryFile().name + query_qual_end1 = tempfile.NamedTemporaryFile().name + query_qual_end2 = tempfile.NamedTemporaryFile().name + + + # temp file for shrimp log file + shrimp_log = tempfile.NamedTemporaryFile().name + + # convert fastq to fasta and quality score files + if type_of_reads == 'single': + return_value = convert_fastqsolexa_to_fasta_qual(input_query, query_fasta, query_qual) + else: + return_value = convert_fastqsolexa_to_fasta_qual(input_query_end1, query_fasta_end1, query_qual_end1) + return_value = convert_fastqsolexa_to_fasta_qual(input_query_end2, query_fasta_end2, query_qual_end2) + + # SHRiMP command + if type_of_reads == 'single': + command = ' '.join(['rmapper-ls', '-s', spaced_seed, '-n', seed_matches_per_window, '-t', seed_hit_taboo_length, '-9', seed_generation_taboo_length, '-w', seed_window_length, '-o', max_hits_per_read, '-r', max_read_length, '-d', kmer, '-m', sw_match_value, '-i', sw_mismatch_value, '-g', sw_gap_open_ref, '-q', sw_gap_open_query, '-e', sw_gap_ext_ref, '-f', sw_gap_ext_query, '-h', sw_hit_threshold, query_fasta, input_target, '>', shrimp_outfile, '2>', shrimp_log]) + + try: + os.system(command) + except Exception, e: + if os.path.exists(query_fasta): os.remove(query_fasta) + if os.path.exists(query_qual): os.remove(query_qual) + stop_err(str(e)) + + else: + command_end1 = ' '.join(['rmapper-ls', '-s', spaced_seed, '-n', seed_matches_per_window, '-t', seed_hit_taboo_length, '-9', seed_generation_taboo_length, '-w', seed_window_length, '-o', max_hits_per_read, '-r', max_read_length, '-d', kmer, '-m', sw_match_value, '-i', sw_mismatch_value, '-g', sw_gap_open_ref, '-q', sw_gap_open_query, '-e', sw_gap_ext_ref, '-f', sw_gap_ext_query, '-h', sw_hit_threshold, query_fasta_end1, input_target, '>', shrimp_outfile, '2>', shrimp_log]) + command_end2 = ' '.join(['rmapper-ls', '-s', spaced_seed, '-n', seed_matches_per_window, '-t', seed_hit_taboo_length, '-9', seed_generation_taboo_length, '-w', seed_window_length, '-o', max_hits_per_read, '-r', max_read_length, '-d', kmer, '-m', sw_match_value, '-i', sw_mismatch_value, '-g', sw_gap_open_ref, '-q', sw_gap_open_query, '-e', sw_gap_ext_ref, '-f', sw_gap_ext_query, '-h', sw_hit_threshold, query_fasta_end2, input_target, '>>', shrimp_outfile, '2>>', shrimp_log]) + + try: + os.system(command_end1) + os.system(command_end2) + except Exception, e: + if os.path.exists(query_fasta_end1): os.remove(query_fasta_end1) + if os.path.exists(query_fasta_end2): os.remove(query_fasta_end2) + if os.path.exists(query_qual_end1): os.remove(query_qual_end1) + if os.path.exists(query_qual_end2): os.remove(query_qual_end2) + stop_err(str(e)) + + # convert to table + if type_of_reads == 'single': + return_value = generate_sub_table(shrimp_outfile, input_target, query_qual, table_outfile, hit_per_read) + else: + return_value = generate_sub_table(shrimp_outfile, input_target, query_qual_end1+'&'+query_qual_end2, table_outfile, hit_per_read) + + # remove temp. files + if type_of_reads == 'single': + if os.path.exists(query_fasta): os.remove(query_fasta) + if os.path.exists(query_qual): os.remove(query_qual) + else: + if os.path.exists(query_fasta_end1): os.remove(query_fasta_end1) + if os.path.exists(query_fasta_end2): os.remove(query_fasta_end2) + if os.path.exists(query_qual_end1): os.remove(query_qual_end1) + if os.path.exists(query_qual_end2): os.remove(query_qual_end2) + + if os.path.exists(shrimp_log): os.remove(shrimp_log) + +if __name__ == '__main__': __main__() + diff -r 26825f08d362 -r 842f1883cf53 tools/metag_tools/shrimp_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/shrimp_wrapper.xml Mon Sep 15 15:04:41 2008 -0400 @@ -0,0 +1,196 @@ +<tool id="shrimp_wrapper" name="SHRiMP" version="1.0.0"> + <description>SHort Read Mapping Package</description> + <command interpreter="python"> + #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $type_of_reads.single_or_paired $input_target $output1 $output2 $input_query + #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $type_of_reads.single_or_paired $input_target $output1 $output2 ${type_of_reads.input1} ${type_of_reads.input2} + #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full"):#shrimp_wrapper.py $type_of_reads.single_or_paired $input_target $output1 $output2 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold $input_query + #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full"):#shrimp_wrapper.py $type_of_reads.single_or_paired $input_target $output1 $output2 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold ${type_of_reads.input1} ${type_of_reads.input2} + #end if + </command> + <inputs> + <page> + <param name="input_target" type="data" format="fasta" label="Reference sequence" /> + <conditional name="type_of_reads"> + <param name="single_or_paired" type="select" label="Single- or Paired-ends"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <param name="input_query" type="data" format="fastqsolexa" label="Sequence file" /> + </when> + <when value="paired"> + <param name="input1" type="data" format="fastqsolexa" label="One end" /> + <param name="input2" type="data" format="fastqsolexa" label="The other end" /> + </when> + </conditional> + <conditional name="param"> + <param name="skip_or_full" type="select" label="SHRiMP parameter selection"> + <option value="skip">Default setting</option> + <option value="full">Full list</option> + </param> + <when value="skip" /> + <when value="full"> + <param name="spaced_seed" type="text" size="30" value="111111011111" label="Spaced Seed" /> + <param name="seed_matches_per_window" type="integer" size="5" value="2" label="Seed Matches per Window" /> + <param name="seed_hit_taboo_length" type="integer" size="5" value="4" label="Seed Hit Taboo Length" /> + <param name="seed_generation_taboo_length" type="integer" size="5" value="0" label="Seed Generation Taboo Length" /> + <param name="seed_window_length" type="float" size="10" value="115.0" label="Seed Window Length" help="in percentage"/> + <param name="max_hits_per_read" type="integer" size="10" value="100" label="Maximum Hits per Read" /> + <param name="max_read_length" type="integer" size="10" value="1000" label="Maximum Read Length" /> + <param name="kmer" type="integer" size="10" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/> + <param name="sw_match_value" type="integer" size="10" value="100" label="S-W Match Value" /> + <param name="sw_mismatch_value" type="integer" size="10" value="-150" label="S-W Mismatch Value" /> + <param name="sw_gap_open_ref" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Reference)" /> + <param name="sw_gap_open_query" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Query)" /> + <param name="sw_gap_ext_ref" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Reference)" /> + <param name="sw_gap_ext_query" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Query)" /> + <param name="sw_hit_threshold" type="float" size="10" value="68.0" label="S-W Hit Threshold" help="in percentage"/> + </when> + </conditional> + </page> + </inputs> + <outputs> + <data name="output1" format="tabular"/> + <data name="output2" format="tabular"/> + </outputs> + <requirements> + <requirement type="binary">SHRiMP_rmapper</requirement> + </requirements> + <tests> + <test> + <param name="single_or_paired" value="single" /> + <param name="skip_or_full" value="skip" /> + <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> + <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> + <output name="output1" file="shrimp_wrapper_test1.out1" /> + </test> +  + </tests> +<help> + +.. class:: warningmark + +Only nucleotide sequences as query. + +----- + +**What it does** + +Run SHRiMP on letter-space reads. + +----- + +**Example** + +- Input a multiple-fastq file like the following:: + + @seq1 + TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT + +seq2 + hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh + +- Use default settings (for detail explanations, please see **Parameters** section) + +- Search against your own uploaded file, result will be in the following format:: + + +-------+-------+--------+----------+----------+---------+--------+--------+-------+------------+ + | id | chrom | strand | t.start | t.end | q.start | q.end | length | score | editstring | + +-------+-------+--------+----------+----------+---------+--------+--------+-------+------------+ + | >seq1 | chrMT | + | 14712 | 14747 | 1 | 36 | 36 | 3350 | 24T11 | + +-------+-------+--------+----------+----------+---------+--------+--------+-------+------------+ + +- The result will be formatted Table:: + + +-------+---------+---------+----------+---------+----------+---------+----------+ + | chrom | ref_loc | read_id | read_loc | ref_nuc | read_nuc | quality | coverage | + +-------+---------+---------+----------+---------+----------+---------+----------+ + | chrMT | 14711 | seq1 | 0 | T | T | 40 | 1 | + | chrMT | 14712 | seq1 | 1 | A | A | 40 | 1 | + | chrMT | 14713 | seq1 | 2 | C | C | 40 | 1 | + +-------+---------+---------+----------+---------+----------+---------+----------+ + +----- + +**Parameters** + +Parameter list with default value settings:: + + -s Spaced Seed (default: 111111011111) + -n Seed Matches per Window (default: 2) + -t Seed Hit Taboo Length (default: 4) + -9 Seed Generation Taboo Length (default: 0) + -w Seed Window Length (default: 115.00%) + -o Maximum Hits per Read (default: 100) + -r Maximum Read Length (default: 1000) + -d Kmer Std. Deviation Limit (default: -1 [None]) + + -m S-W Match Value (default: 100) + -i S-W Mismatch Value (default: -150) + -g S-W Gap Open Penalty (Reference) (default: -400) + -q S-W Gap Open Penalty (Query) (default: -400) + -e S-W Gap Extend Penalty (Reference) (default: -70) + -f S-W Gap Extend Penalty (Query) (default: -70) + -h S-W Hit Threshold (default: 68.00%) + +----- + +**Reference** + + **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu. + +</help> +</tool>

1 0

[hg] galaxy 1509: Rewrote "Compare two queries" tool in Python.
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/eb941905fd70 changeset: 1509:eb941905fd70 user: guru date: Tue Sep 16 14:09:16 2008 -0400 description: Rewrote "Compare two queries" tool in Python. 2 file(s) affected in this change: tools/filters/compare.xml tools/filters/joinWrapper.py diffs (68 lines): diff -r ec547440ec97 -r eb941905fd70 tools/filters/compare.xml --- a/tools/filters/compare.xml Tue Sep 16 13:25:42 2008 -0400 +++ b/tools/filters/compare.xml Tue Sep 16 14:09:16 2008 -0400 @@ -1,6 +1,6 @@ <tool id="comp1" name="Compare two Queries"> <description>to find common or distinct rows</description> - <command interpreter="perl">joinWrapper.pl $input1 $input2 $field1 $field2 $mode "Y" $out_file1</command> + <command interpreter="python">joinWrapper.py $input1 $input2 $field1 $field2 $mode $out_file1</command> <inputs> <param format="tabular" name="input1" type="data" label="Compare"/> <param name="field1" label="Using column" type="data_column" data_ref="input1" /> diff -r ec547440ec97 -r eb941905fd70 tools/filters/joinWrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/filters/joinWrapper.py Tue Sep 16 14:09:16 2008 -0400 @@ -0,0 +1,53 @@ +#!/usr/bin/env python +#Guruprasad Ananda +""" +This tool provides the UNIX "join" functionality. +""" +import sys, os, tempfile + +def stop_err(msg): + sys.stderr.write(msg) + sys.exit() + +def main(): + infile1 = sys.argv[1] + infile2 = sys.argv[2] + field1 = int(sys.argv[3]) + field2 = int(sys.argv[4]) + mode =sys.argv[5] + outfile = sys.argv[6] + + tmpfile1 = tempfile.NamedTemporaryFile() + tmpfile2 = tempfile.NamedTemporaryFile() + + try: + #Sort the two files based on specified fields + os.system("sort -k %d -o %s %s" %(field1, tmpfile1.name, infile1)) + os.system("sort -k %d -o %s %s" %(field2, tmpfile2.name, infile2)) + except Exception, exc: + stop_err( 'Initialization error -> %s' %str(exc) ) + + option = "" + for line in file(tmpfile1.name): + line = line.strip() + if line: + elems = line.split('\t') + for j in range(1,len(elems)+1): + if j == 1: + option = "1.1" + else: + option = option + ",1." + str(j) + break + + if mode == "V": + cmdline = 'join -v 1 -o %s -1 %d -2 %d %s %s | tr " " "\t" > %s' %(option, field1, field2, tmpfile1.name, tmpfile2.name, outfile) + else: + cmdline = 'join -o %s -1 %d -2 %d %s %s | tr " " "\t" > %s' %(option, field1, field2, tmpfile1.name, tmpfile2.name, outfile) + + try: + os.system(cmdline) + except Exception, exj: + stop_err('Error joining the two datasets -> %s' %str(exj)) + +if __name__ == "__main__": + main()

1 0

[hg] galaxy 1508: Small update for maf stats tool.
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/ec547440ec97 changeset: 1508:ec547440ec97 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Tue Sep 16 13:25:42 2008 -0400 description: Small update for maf stats tool. 2 file(s) affected in this change: lib/galaxy/tools/util/maf_utilities.py tools/maf/maf_stats.py diffs (99 lines): diff -r 842f1883cf53 -r ec547440ec97 lib/galaxy/tools/util/maf_utilities.py --- a/lib/galaxy/tools/util/maf_utilities.py Mon Sep 15 15:04:41 2008 -0400 +++ b/lib/galaxy/tools/util/maf_utilities.py Tue Sep 16 13:25:42 2008 -0400 @@ -199,7 +199,7 @@ yield block def get_chopped_blocks_with_index_offset_for_region( index, src, region, species = None, mincols = 0, force_strand = None ): for block, idx, offset in index.get_as_iterator_with_index_and_offset( src, region.start, region.end ): - block = chop_block_by_region( block, src, region, species, mincols ) + block = chop_block_by_region( block, src, region, species, mincols, force_strand ) if block is not None: yield block, idx, offset @@ -209,6 +209,25 @@ else: alignment = RegionAlignment( end - start, primary_species ) return fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand, species, mincols ) +#reduces a block to only positions exisiting in the src provided +def reduce_block_by_primary_genome( block, species, chromosome, region_start ): + #returns ( startIndex, {species:texts} + #where texts' contents are reduced to only positions existing in the primary genome + src = "%s.%s" % ( species, chromosome ) + ref = block.get_component_by_src( src ) + start_offset = ref.start - region_start + species_texts = {} + for c in block.components: + species_texts[ c.src.split( '.' )[0] ] = list( c.text ) + #remove locations which are gaps in the primary species, starting from the downstream end + for i in range( len( species_texts[ species ] ) - 1, -1, -1 ): + if species_texts[ species ][i] == '-': + for text in species_texts.values(): + text.pop( i ) + for spec, text in species_texts.items(): + species_texts[spec] = ''.join( text ) + return ( start_offset, species_texts ) + #fills a region alignment def fill_region_alignment( alignment, index, primary_species, chrom, start, end, strand = '+', species = None, mincols = 0 ): region = bx.intervals.Interval( start, end ) @@ -216,22 +235,7 @@ region.strand = strand primary_src = "%s.%s" % ( primary_species, chrom ) - def reduce_block_by_primary_genome( block ): - #returns ( startIndex, {species:texts} - #where texts' contents are reduced to only positions existing in the primary genome - ref = block.get_component_by_src( primary_src ) - start_offset = ref.start - start - species_texts = {} - for c in block.components: - species_texts[ c.src.split( '.' )[0] ] = list( c.text ) - #remove locations which are gaps in the primary species, starting from the downstream end - for i in range( len( species_texts[ primary_species ] ) - 1, -1, -1 ): - if species_texts[ primary_species ][i] == '-': - for text in species_texts.values(): - text.pop( i ) - for spec, text in species_texts.items(): - species_texts[spec] = ''.join( text ) - return ( start_offset, species_texts ) + #Order blocks overlaping this position by score, lowest first blocks = [] @@ -248,7 +252,7 @@ for block_dict in blocks: block = chop_block_by_region( block_dict[1].get_at_offset( block_dict[2] ), primary_src, region, species, mincols, strand ) if block is None: continue - start_offset, species_texts = reduce_block_by_primary_genome( block ) + start_offset, species_texts = reduce_block_by_primary_genome( block, primary_species, chrom, start ) for spec, text in species_texts.items(): try: alignment.set_range( start_offset, spec, text ) diff -r 842f1883cf53 -r ec547440ec97 tools/maf/maf_stats.py --- a/tools/maf/maf_stats.py Mon Sep 15 15:04:41 2008 -0400 +++ b/tools/maf/maf_stats.py Tue Sep 16 13:25:42 2008 -0400 @@ -64,19 +64,11 @@ for c in block.components: spec = c.src.split( '.' )[0] if spec not in coverage: coverage[spec] = zeros( region.end - region.start, dtype = bool ) - ref = block.get_component_by_src( src ) - #skip gap locations due to insertions in secondary species relative to primary species - start_offset = ref.start - region.start - num_gaps = 0 - for i in range( len( ref.text.rstrip().rstrip( "-" ) ) ): - if ref.text[i] in ["-"]: - num_gaps += 1 - continue - #Toggle base if covered - for comp in block.components: - spec = comp.src.split( '.' )[0] - if comp.text and comp.text[i] not in ['-']: - coverage[spec][start_offset + i - num_gaps] = True + start_offset, alignment = maf_utilities.reduce_block_by_primary_genome( block, dbkey, region.chrom, region.start ) + for i in range( len( alignment[dbkey] ) ): + for spec, text in alignment.items(): + if text[i] != '-': + coverage[spec][start_offset + i] = True if summary: #record summary for key in coverage.keys():

1 0

[hg] galaxy 1510: Strip whitespace from columns in file for data...
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/f8e3770c23f6 changeset: 1510:f8e3770c23f6 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Tue Sep 16 14:10:53 2008 -0400 description: Strip whitespace from columns in file for dataset_metadata_in_file validator. 1 file(s) affected in this change: lib/galaxy/tools/parameters/validation.py diffs (12 lines): diff -r ec547440ec97 -r f8e3770c23f6 lib/galaxy/tools/parameters/validation.py --- a/lib/galaxy/tools/parameters/validation.py Tue Sep 16 13:25:42 2008 -0400 +++ b/lib/galaxy/tools/parameters/validation.py Tue Sep 16 14:10:53 2008 -0400 @@ -247,7 +247,7 @@ if line_startswith is None or line.startswith( line_startswith ): fields = line.split( '\t' ) if metadata_column < len( fields ): - self.valid_values.append( fields[metadata_column] ) + self.valid_values.append( fields[metadata_column].strip() ) def validate( self, value, history = None ): if not value: return if hasattr( value, "metadata" ):

1 0

[hg] galaxy 1511: Merge local heads
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/c3ce08879473 changeset: 1511:c3ce08879473 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Tue Sep 16 14:26:14 2008 -0400 description: Merge local heads 0 file(s) affected in this change: diffs (12 lines): diff -r eb941905fd70 -r c3ce08879473 lib/galaxy/tools/parameters/validation.py --- a/lib/galaxy/tools/parameters/validation.py Tue Sep 16 14:09:16 2008 -0400 +++ b/lib/galaxy/tools/parameters/validation.py Tue Sep 16 14:26:14 2008 -0400 @@ -247,7 +247,7 @@ if line_startswith is None or line.startswith( line_startswith ): fields = line.split( '\t' ) if metadata_column < len( fields ): - self.valid_values.append( fields[metadata_column] ) + self.valid_values.append( fields[metadata_column].strip() ) def validate( self, value, history = None ): if not value: return if hasattr( value, "metadata" ):

1 0

[hg] galaxy 1512: The MetadataCollection object is now created o...
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/1e408bab8941 changeset: 1512:1e408bab8941 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Tue Sep 16 15:23:23 2008 -0400 description: The MetadataCollection object is now created only once per dataset object instance (and when datatype is changed), instead of each time dataset.metadata is called. The 'no_value' attribute for a metadata element's spec is returned when the metadata element's value is None. 2 file(s) affected in this change: lib/galaxy/datatypes/metadata.py lib/galaxy/model/__init__.py diffs (89 lines): diff -r c3ce08879473 -r 1e408bab8941 lib/galaxy/datatypes/metadata.py --- a/lib/galaxy/datatypes/metadata.py Tue Sep 16 14:26:14 2008 -0400 +++ b/lib/galaxy/datatypes/metadata.py Tue Sep 16 15:23:23 2008 -0400 @@ -151,9 +151,16 @@ """ def __init__(self, parent, spec): self.parent = parent - self.bunch = parent._metadata or dict() if spec is None: self.spec = MetadataSpecCollection() else: self.spec = spec + + #set default metadata values + if not self.parent._metadata: + self.parent._metadata = {} + for name, value in self.spec.items(): + if name not in self.bunch: + self.bunch[name] = value.default + def __iter__(self): return self.bunch.__iter__() def get( self, key, default=None ): @@ -168,19 +175,21 @@ def __nonzero__(self): return self.bunch.__nonzero__() def __getattr__(self, name): - if self.bunch.get( name ): - return self.bunch.get( name ) + if name == "bunch": + return self.parent._metadata + rval = self.bunch.get( name ) + if rval is None: + rval = self.spec.get( name, None ) + if rval: + rval = rval.no_value + return rval + def __setattr__(self, name, value): + if name in ["parent","spec"]: + self.__dict__[name] = value + elif name == "bunch": + self.parent._metadata = value else: - if self.spec.get(name, None): - return self.spec[name].default - else: - return None - def __setattr__(self, name, value): - if name in ["parent","bunch","spec"]: - self.__dict__[name] = value - else: - self.__dict__["bunch"][name] = value - self.bunch = self.parent._metadata = dict( self.bunch ) + self.bunch[name] = value MetadataElement = Statement(MetadataElementSpec) diff -r c3ce08879473 -r 1e408bab8941 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Tue Sep 16 14:26:14 2008 -0400 +++ b/lib/galaxy/model/__init__.py Tue Sep 16 15:23:23 2008 -0400 @@ -113,7 +113,7 @@ self.peek = peek self.extension = extension self.designation = designation - self._metadata = metadata or dict() + self.metadata = metadata or dict() self.dbkey = dbkey self.deleted = deleted self.visible = visible @@ -159,9 +159,9 @@ return datatypes_registry.get_datatype_by_extension( self.extension ) def get_metadata( self ): - if not self._metadata: - self._metadata = dict() - return MetadataCollection( self, self.datatype.metadata_spec ) + if not hasattr( self, '_metadata_collection' ): + self._metadata_collection = MetadataCollection( self, self.datatype.metadata_spec ) + return self._metadata_collection def set_metadata( self, bunch ): # Needs to accept a MetadataCollection, a bunch, or a dict self._metadata = dict( bunch.items() ) @@ -191,6 +191,8 @@ def change_datatype( self, new_ext ): self.clear_associated_files() + if hasattr( self, '_metadata_collection' ): + del self._metadata_collection datatypes_registry.change_datatype( self, new_ext ) def get_size( self ): """Returns the size of the data on disk"""

1 0

[hg] galaxy 1513: Quick 'n easy solution to the EMBOSS stage in/...
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/cf17b5a16eff changeset: 1513:cf17b5a16eff user: Nate Coraor <nate(a)bx.psu.edu> date: Wed Sep 17 10:45:20 2008 -0400 description: Quick 'n easy solution to the EMBOSS stage in/out problem: read the outputs from the "real" galaxy path instead of the temp stage path. 1 file(s) affected in this change: lib/galaxy/jobs/runners/pbs.py diffs (31 lines): diff -r 1e408bab8941 -r cf17b5a16eff lib/galaxy/jobs/runners/pbs.py --- a/lib/galaxy/jobs/runners/pbs.py Tue Sep 16 15:23:23 2008 -0400 +++ b/lib/galaxy/jobs/runners/pbs.py Wed Sep 17 10:45:20 2008 -0400 @@ -146,7 +146,7 @@ if self.app.config.pbs_application_server: pbs_ofile = self.app.config.pbs_application_server + ':' + ofile pbs_efile = self.app.config.pbs_application_server + ':' + efile - stagein = self.get_stage_in_out( job_wrapper.get_input_fnames() + job_wrapper.get_output_fnames() ) + stagein = self.get_stage_in_out( job_wrapper.get_input_fnames() + job_wrapper.get_output_fnames(), symlink=True ) stageout = self.get_stage_in_out( job_wrapper.get_output_fnames() ) job_attrs = pbs.new_attropl(5) job_attrs[0].name = pbs.ATTR_o @@ -372,15 +372,15 @@ self.queue.put( self.STOP_SIGNAL ) log.info( "pbs job runner stopped" ) - def get_stage_in_out( self, fnames ): + def get_stage_in_out( self, fnames, symlink=False ): """Convenience function to create a stagein/stageout list""" stage = '' for fname in fnames: if os.access(fname, os.R_OK): - if stage != '': + if stage: stage += ',' # pathnames are now absolute - if self.app.config.pbs_stage_path != '': + if symlink and self.app.config.pbs_stage_path: stage_name = os.path.join(self.app.config.pbs_stage_path, os.path.split(fname)[1]) else: stage_name = fname

1 0

[hg] galaxy 1515: Forgot to update tool_conf.sample with the new...
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/280e8b68f845 changeset: 1515:280e8b68f845 user: guru date: Wed Sep 17 17:14:59 2008 -0400 description: Forgot to update tool_conf.sample with the new tool details. 1 file(s) affected in this change: tool_conf.xml.sample diffs (10 lines): diff -r 33e06a98b6d8 -r 280e8b68f845 tool_conf.xml.sample --- a/tool_conf.xml.sample Wed Sep 17 16:42:08 2008 -0400 +++ b/tool_conf.xml.sample Wed Sep 17 17:14:59 2008 -0400 @@ -281,5 +281,6 @@ <tool file="metag_tools/megablast_wrapper.xml" /> <tool file="metag_tools/megablast_xml_parser.xml" /> <tool file="metag_tools/blat_wrapper.xml" /> + <tool file="metag_tools/mapping_to_ucsc.xml" /> </section> </toolbox>

1 0

[hg] galaxy 1514: New tool to format short read mapping data as ...
by greg＠scofield.bx.psu.edu 22 Sep '08

22 Sep '08

details: http://www.bx.psu.edu/hg/galaxy/rev/33e06a98b6d8 changeset: 1514:33e06a98b6d8 user: guru date: Wed Sep 17 16:42:08 2008 -0400 description: New tool to format short read mapping data as a UCSC custom track,. 2 file(s) affected in this change: tools/metag_tools/mapping_to_ucsc.py tools/metag_tools/mapping_to_ucsc.xml diffs (415 lines): diff -r cf17b5a16eff -r 33e06a98b6d8 tools/metag_tools/mapping_to_ucsc.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/mapping_to_ucsc.py Wed Sep 17 16:42:08 2008 -0400 @@ -0,0 +1,204 @@ +#! /usr/bin/python + +from galaxy import eggs +import sys, tempfile, os + +assert sys.version_info[:2] >= (2.4) + +def stop_err(msg): + sys.stderr.write(msg) + sys.exit() + +def main(): + + out_fname = sys.argv[1] + in_fname = sys.argv[2] + chr_col = int(sys.argv[3])-1 + coord_col = int(sys.argv[4])-1 + track_type = sys.argv[5] + if track_type == 'coverage' or track_type == 'both': + coverage_col = int(sys.argv[6])-1 + cname = sys.argv[7] + cdescription = sys.argv[8] + ccolor = sys.argv[9].replace('-',',') + cvisibility = sys.argv[10] + if track_type == 'snp' or track_type == 'both': + if track_type == 'both': + j = 5 + else: + j = 0 + #sname = sys.argv[7+j] + sdescription = sys.argv[6+j] + svisibility = sys.argv[7+j] + #ref_col = int(sys.argv[10+j])-1 + read_col = int(sys.argv[8+j])-1 + + + # Sort the input file based on chromosome (alphabetically) and start co-ordinates (numerically) + sorted_infile = tempfile.NamedTemporaryFile() + try: + os.system("sort -k %d,%d -k %dn -o %s %s" %(chr_col+1,chr_col+1,coord_col+1,sorted_infile.name,in_fname)) + except Exception, exc: + stop_err( 'Initialization error -> %s' %str(exc) ) + + #generate chr list + sorted_infile.seek(0) + chr_vals = [] + for line in file( sorted_infile.name ): + line = line.strip() + if not(line): + continue + try: + fields = line.split('\t') + chr = fields[chr_col] + if chr not in chr_vals: + chr_vals.append(chr) + except: + pass + if not(chr_vals): + stop_err("Skipped all lines as invalid.") + + if track_type == 'coverage' or track_type == 'both': + if track_type == 'coverage': + fout = open( out_fname, "w" ) + else: + fout = tempfile.NamedTemporaryFile() + fout.write('''track type=wiggle_0 name="%s" description="%s" color=%s visibility=%s\n''' \ + % ( cname, cdescription, ccolor, cvisibility )) + if track_type == 'snp' or track_type == 'both': + fout_a = tempfile.NamedTemporaryFile() + fout_t = tempfile.NamedTemporaryFile() + fout_g = tempfile.NamedTemporaryFile() + fout_c = tempfile.NamedTemporaryFile() + fout_ref = tempfile.NamedTemporaryFile() + + fout_a.write('''track type=wiggle_0 name="%s" description="%s" color=%s visibility=%s\n''' \ + % ( "Track A", sdescription, '255,0,0', svisibility )) + fout_t.write('''track type=wiggle_0 name="%s" description="%s" color=%s visibility=%s\n''' \ + % ( "Track T", sdescription, '0,255,0', svisibility )) + fout_g.write('''track type=wiggle_0 name="%s" description="%s" color=%s visibility=%s\n''' \ + % ( "Track G", sdescription, '0,0,255', svisibility )) + fout_c.write('''track type=wiggle_0 name="%s" description="%s" color=%s visibility=%s\n''' \ + % ( "Track C", sdescription, '255,0,255', svisibility )) + + + sorted_infile.seek(0) + for line in file( sorted_infile.name ): + line = line.strip() + if not(line): + continue + try: + fields = line.split('\t') + chr = fields[chr_col] + start = int(fields[coord_col]) + assert start > 0 + except: + continue + try: + ind = chr_vals.index(chr) #encountered chr for the 1st time + del chr_vals[ind] + prev_start = '' + header = "variableStep chrom=%s\n" %(chr) + if track_type == 'coverage' or track_type == 'both': + coverage = int(fields[coverage_col]) + line1 = "%s\t%s\n" %(start,coverage) + fout.write("%s%s" %(header,line1)) + if track_type == 'snp' or track_type == 'both': + a = t = g = c = 0 + fout_a.write("%s" %(header)) + fout_t.write("%s" %(header)) + fout_g.write("%s" %(header)) + fout_c.write("%s" %(header)) + try: + #ref_nt = fields[ref_col].capitalize() + read_nt = fields[read_col].capitalize() + try: + nt_ind = ['A','T','G','C'].index(read_nt) + if nt_ind == 0: + a+=1 + elif nt_ind == 1: + t+=1 + elif nt_ind == 2: + g+=1 + else: + c+=1 + except ValueError: + pass + except: + pass + prev_start = start + except ValueError: + if start != prev_start: + if track_type == 'coverage' or track_type == 'both': + coverage = int(fields[coverage_col]) + fout.write("%s\t%s\n" %(start,coverage)) + if track_type == 'snp' or track_type == 'both': + if a: + fout_a.write("%s\t%s\n" %(prev_start,a)) + if t: + fout_t.write("%s\t%s\n" %(prev_start,t)) + if g: + fout_g.write("%s\t%s\n" %(prev_start,g)) + if c: + fout_c.write("%s\t%s\n" %(prev_start,c)) + a = t = g = c = 0 + try: + #ref_nt = fields[ref_col].capitalize() + read_nt = fields[read_col].capitalize() + try: + nt_ind = ['A','T','G','C'].index(read_nt) + if nt_ind == 0: + a+=1 + elif nt_ind == 1: + t+=1 + elif nt_ind == 2: + g+=1 + else: + c+=1 + except ValueError: + pass + except: + pass + prev_start = start + else: + if track_type == 'snp' or track_type == 'both': + try: + #ref_nt = fields[ref_col].capitalize() + read_nt = fields[read_col].capitalize() + try: + nt_ind = ['A','T','G','C'].index(read_nt) + if nt_ind == 0: + a+=1 + elif nt_ind == 1: + t+=1 + elif nt_ind == 2: + g+=1 + else: + c+=1 + except ValueError: + pass + except: + pass + + if track_type == 'snp' or track_type == 'both': + if a: + fout_a.write("%s\t%s\n" %(prev_start,a)) + if t: + fout_t.write("%s\t%s\n" %(prev_start,t)) + if g: + fout_g.write("%s\t%s\n" %(prev_start,g)) + if c: + fout_c.write("%s\t%s\n" %(prev_start,c)) + + fout_a.seek(0) + fout_g.seek(0) + fout_t.seek(0) + fout_c.seek(0) + + if track_type == 'snp': + os.system("cat %s %s %s %s >> %s" %(fout_a.name,fout_t.name,fout_g.name,fout_c.name,out_fname)) + elif track_type == 'both': + fout.seek(0) + os.system("cat %s %s %s %s %s | cat > %s" %(fout.name,fout_a.name,fout_t.name,fout_g.name,fout_c.name,out_fname)) +if __name__ == "__main__": + main() \ No newline at end of file diff -r cf17b5a16eff -r 33e06a98b6d8 tools/metag_tools/mapping_to_ucsc.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/mapping_to_ucsc.xml Wed Sep 17 16:42:08 2008 -0400 @@ -0,0 +1,202 @@ +<tool id="mapToUCSC" name="Format mapping data" version="1.0.0"> + <description> as UCSC custom track</description> + <command interpreter="python"> + mapping_to_ucsc.py + $out_file1 + $input + $chr_col + $coord_col + $track.track_type + #if $track.track_type == "coverage" or $track.track_type == "both" + $track.coverage_col + "${track.cname}" + "${track.cdescription}" + "${track.ccolor}" + "${track.cvisibility}" + #end if + #if $track.track_type == "snp" or $track.track_type == "both" + "${track.sdescription}" + "${track.svisibility}" + $track.col2 + #end if + </command> + <inputs> + <param format="tabular" name="input" type="data" label="Select mapping data"/> + <param name="chr_col" type="data_column" data_ref="input" label="Column for reference chromosome" /> + <param name="coord_col" type="data_column" data_ref="input" numerical="True" label="Numerical column for reference co-ordinate" /> + <conditional name="track"> + <param name="track_type" type="select" label="Display"> + <option value="snp" selected="true">SNPs</option> + <option value="coverage">Read coverage</option> + <option value="both">Both</option> + </param> + <when value = "coverage"> + <param name="coverage_col" type="data_column" data_ref="input" numerical="True" label="Numerical column for read coverage" /> + <param name="cname" type="text" size="15" value="User Track" label="Coverage track name"> + <validator type="length" max="15"/> + </param> + <param name="cdescription" type="text" value="User Supplied Coverage Track (from Galaxy)" label="Coverage track description"> + <validator type="length" max="60" size="15"/> + </param> + <param label="Coverage track Color" name="ccolor" type="select"> + <option selected="yes" value="0-0-0">Black</option> + <option value="255-0-0">Red</option> + <option value="0-255-0">Green</option> + <option value="0-0-255">Blue</option> + <option value="255-0-255">Magenta</option> + <option value="0-255-255">Cyan</option> + <option value="255-215-0">Gold</option> + <option value="160-32-240">Purple</option> + <option value="255-140-0">Orange</option> + <option value="255-20-147">Pink</option> + <option value="92-51-23">Dark Chocolate</option> + <option value="85-107-47">Olive green</option> + </param> + <param label="Coverage track Visibility" name="cvisibility" type="select"> + <option selected="yes" value="1">Dense</option> + <option value="2">Full</option> + <option value="3">Pack</option> + <option value="4">Squish</option> + <option value="0">Hide</option> + </param> + </when> + + <when value = "snp"> +  + <param name="col2" type="data_column" data_ref="input" label="Column containing the read nucleotide" /> +  + <param name="sdescription" type="text" value="User Supplied Track (from Galaxy)" label="SNP track description"> + <validator type="length" max="60" size="15"/> + </param> + <param label="SNP track Visibility" name="svisibility" type="select"> + <option selected="yes" value="1">Dense</option> + <option value="2">Full</option> + <option value="3">Pack</option> + <option value="4">Squish</option> + <option value="0">Hide</option> + </param> + </when> + + <when value = "both"> + <param name="coverage_col" type="data_column" data_ref="input" numerical="True" label="Numerical column for read coverage" /> + <param name="cname" type="text" size="15" value="User Track" label="Coverage track name"> + <validator type="length" max="15"/> + </param> + <param name="cdescription" type="text" size="15" value="User Supplied Track (from Galaxy)" label="Coverage track description"> + <validator type="length" max="60"/> + </param> + <param label="Coverage track Color" name="ccolor" type="select"> + <option selected="yes" value="0-0-0">Black</option> + <option value="255-0-0">Red</option> + <option value="0-255-0">Green</option> + <option value="0-0-255">Blue</option> + <option value="255-0-255">Magenta</option> + <option value="0-255-255">Cyan</option> + <option value="255-215-0">Gold</option> + <option value="160-32-240">Purple</option> + <option value="255-140-0">Orange</option> + <option value="255-20-147">Pink</option> + <option value="92-51-23">Dark Chocolate</option> + <option value="85-107-47">Olive green</option> + </param> + <param label="Coverage track Visibility" name="cvisibility" type="select"> + <option selected="yes" value="1">Dense</option> + <option value="2">Full</option> + <option value="3">Pack</option> + <option value="4">Squish</option> + <option value="0">Hide</option> + </param> +  + <param name="col2" type="data_column" data_ref="input" label="Column containing the read nucleotide" /> +  + <param name="sdescription" type="text" size="15" value="User Supplied Track (from Galaxy)" label="SNP track description"> + <validator type="length" max="60"/> + </param> + <param label="SNP track Visibility" name="svisibility" type="select"> + <option selected="yes" value="1">Dense</option> + <option value="2">Full</option> + <option value="3">Pack</option> + <option value="4">Squish</option> + <option value="0">Hide</option> + </param> + </when> + </conditional> + </inputs> + <outputs> + <data format="customtrack" name="out_file1"/> + </outputs> + + + <help> + +.. class:: infomark + +**What it does** + +This tool formats mapping data generated by short read mappers, as a custom track that can be displayed at UCSC genome browser. + +----- + +.. class:: warningmark + +**Note** + +This tool requires the mapping data to contain at least the following information: + +chromosome, genome coordinate, read nucleotide (if option to display is SNPs), read coverage (if option to display is Read coverage). + +----- + +**Example** + +For the following Mapping data:: + + #chr g_start read_id read_coord g_nt read_nt qual read_coverage + chrM 1 1:29:1672:1127/1 11 G G 40 134 + chrM 1 1:32:93:933/1 4 G A 40 134 + chrM 1 1:34:116:2032/1 11 G A 40 134 + chrM 1 1:39:207:964/1 1 G G 40 134 + chrM 2 1:3:359:848/1 1 G C 40 234 + chrM 2 1:40:1435:1013/1 1 G G 40 234 + chrM 3 1:40:730:972/1 9 G G 40 334 + chrM 4 1:42:1712:921/2 31 G T 35 434 + chrM 4 1:44:1649:493/1 4 G G 40 434 + +running this tool to display both SNPs and Read coverage will return the following tracks, containing aggregated data per genome co-ordinate:: + + track type=wiggle_0 name="Coverage Track" description="User Supplied Track (from Galaxy)" color=0,0,0 visibility=1 + variableStep chrom=chrM + 1 134 + 2 234 + 3 334 + 4 434 + track type=wiggle_0 name="Track A" description="User Supplied SNP Track (from Galaxy)" color=255,0,0 visibility=1 + variableStep chrom=chrM + 1 2 + track type=wiggle_0 name="Track T" description="User Supplied SNP Track (from Galaxy)" color=0,255,0 visibility=1 + variableStep chrom=chrM + 4 1 + track type=wiggle_0 name="Track G" description="User Supplied SNP Track (from Galaxy)" color=0,0,255 visibility=1 + variableStep chrom=chrM + 1 2 + 2 1 + 3 1 + 4 1 + track type=wiggle_0 name="Track C" description="User Supplied SNP Track (from Galaxy)" color=255,0,255 visibility=1 + variableStep chrom=chrM + 2 1 + + </help> +</tool>

1 0