October 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2861: Fixed bug that prevented copying datasets to a...
by Greg Von Kuster 09 Oct '09

09 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/c7dd346c20d5 changeset: 2861:c7dd346c20d5 user: jeremy goecks <jeremy.goecks at emory.edu> date: Thu Oct 08 22:01:36 2009 -0400 description: Fixed bug that prevented copying datasets to a new history. 1 file(s) affected in this change: lib/galaxy/web/controllers/dataset.py diffs (12 lines): diff -r 682cde08c3d5 -r c7dd346c20d5 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Thu Oct 08 21:02:36 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Thu Oct 08 22:01:36 2009 -0400 @@ -363,7 +363,7 @@ new_history = trans.app.model.History() if new_history_name: new_history.name = new_history_name - new_history_name = user + new_history.user = user new_history.flush() target_history_ids.append( new_history.id ) if user:

1 0

[hg] galaxy 2858: fixed trackster memory leak
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/50e2d1a49815 changeset: 2858:50e2d1a49815 user: Kanwei Li <kanwei(a)gmail.com> date: Thu Oct 08 15:53:11 2009 -0400 description: fixed trackster memory leak 1 file(s) affected in this change: lib/galaxy/visualization/tracks/data/array_tree.py diffs (45 lines): diff -r e1382afd8e41 -r 50e2d1a49815 lib/galaxy/visualization/tracks/data/array_tree.py --- a/lib/galaxy/visualization/tracks/data/array_tree.py Thu Oct 08 14:57:36 2009 -0400 +++ b/lib/galaxy/visualization/tracks/data/array_tree.py Thu Oct 08 15:53:11 2009 -0400 @@ -20,13 +20,15 @@ self.dataset = dataset def get_stats( self, chrom ): - d = FileArrayTreeDict( open( self.dataset.file_name ) ) + f = open( self.dataset.file_name ) + d = FileArrayTreeDict( f ) try: chrom_array_tree = d[chrom] except KeyError: return "no data" root_summary = chrom_array_tree.get_summary( 0, chrom_array_tree.levels ) + f.close() return { 'max': float( max(root_summary.maxs) ), 'min': float( min(root_summary.mins) ) } def get_data( self, chrom, start, end ): @@ -35,7 +37,8 @@ level = int( ceil( log( end - start, BLOCK_SIZE ) ) ) - 1 # Open the file - d = FileArrayTreeDict( open( self.dataset.file_name ) ) + f = open( self.dataset.file_name ) + d = FileArrayTreeDict( f ) # Get the right chromosome try: chrom_array_tree = d[chrom] @@ -51,12 +54,14 @@ # Return either data point or a summary depending on the level if level > 0: s = chrom_array_tree.get_summary( start, level ) + f.close() if s is not None: return zip( indexes, map( float, s.sums / s.counts ) ) else: return None else: v = chrom_array_tree.get_leaf( start ) + f.close() if v is not None: return zip( indexes, map( float, v ) ) else:

1 0

[hg] galaxy 2859: Modified Bowtie wrapper to directly output SAM...
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e02620ad3f41 changeset: 2859:e02620ad3f41 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Oct 08 18:07:02 2009 -0400 description: Modified Bowtie wrapper to directly output SAM format, removing header as necessary 5 file(s) affected in this change: test-data/bowtie_out1.sam test-data/bowtie_out2.sam test-data/bowtie_out3.sam tools/sr_mapping/bowtie_wrapper.py tools/sr_mapping/bowtie_wrapper.xml diffs (317 lines): diff -r 50e2d1a49815 -r e02620ad3f41 test-data/bowtie_out1.sam --- a/test-data/bowtie_out1.sam Thu Oct 08 15:53:11 2009 -0400 +++ b/test-data/bowtie_out1.sam Thu Oct 08 18:07:02 2009 -0400 @@ -1,1 +1,1 @@ -HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1513:715/1 16 chrM 9563 255 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII XA:i:2 MD:Z:27A0G7 NM:i:2 diff -r 50e2d1a49815 -r e02620ad3f41 test-data/bowtie_out2.sam --- a/test-data/bowtie_out2.sam Thu Oct 08 15:53:11 2009 -0400 +++ b/test-data/bowtie_out2.sam Thu Oct 08 18:07:02 2009 -0400 @@ -1,2 +1,2 @@ -HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36 -HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18 +HWI-EAS91_1_30788AAXX:1:2:618:346/1 99 chrM 441 255 36M = 652 247 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 XA:i:0 MD:Z:36 NM:i:0 +HWI-EAS91_1_30788AAXX:1:2:618:346/2 147 chrM 652 255 36M = 441 -247 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII XA:i:1 MD:Z:18C17 NM:i:1 diff -r 50e2d1a49815 -r e02620ad3f41 test-data/bowtie_out3.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_out3.sam Thu Oct 08 18:07:02 2009 -0400 @@ -0,0 +1,2 @@ +HWI-EAS91_1_30788AAXX:1:2:618:346/1 99 chrM 441 255 36M = 652 247 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 XA:i:0 MD:Z:36 NM:i:0 +HWI-EAS91_1_30788AAXX:1:2:618:346/2 147 chrM 652 255 36M = 441 -247 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII XA:i:0 MD:Z:18C17 NM:i:1 diff -r 50e2d1a49815 -r e02620ad3f41 tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Thu Oct 08 15:53:11 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.py Thu Oct 08 18:07:02 2009 -0400 @@ -33,7 +33,6 @@ parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read') parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read') parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist') - parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments') parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions") parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read') parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable') @@ -43,7 +42,6 @@ parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate') parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand') parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand') - parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time') parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n') parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator') parser.add_option('', '--dbkey', dest='dbkey', help='') @@ -61,8 +59,8 @@ parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file') parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator') parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index') - parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8') parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set') + parser.add_option('', '--suppressHeader', dest='suppressHeader', help='Suppress header') (options, args) = parser.parse_args() # index if necessary @@ -72,7 +70,7 @@ indexing_cmds = '' else: try: - indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s' % \ (('','--noauto')[options.iauto_b=='set'], ('','--packed')[options.ipacked=='packed'], ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1], @@ -84,8 +82,7 @@ ('','--ntoa')[options.intoa=='yes'], ('--little','--big')[options.iendian=='big'], ('','--seed %s'%options.iseed)[int(options.iseed)>0], - ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0], - ('','--oldpmap')[options.ioldpmap=='yes']) + ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0]) except ValueError: indexing_cmds = '' @@ -105,11 +102,11 @@ # set up aligning and generate aligning command options # automatically set threads to 8 in both cases if options.params == 'pre_set': - aligning_cmds = '-p %s' % options.threads + aligning_cmds = '-p %s -S' % options.threads else: try: aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \ - '%s %s %s %s %s %s %s %s %s %s %s %s -p %s' % \ + '%s %s %s %s %s %s %s %s %s %s -p %s -S' % \ (('','-s %s'%options.skip)[options.skip!='None'], ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0], ('','-5 %s'%options.trimH)[int(options.trimH)>=0], @@ -132,41 +129,47 @@ ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0], ('','--best')[options.best=='doBest'], ('','--strata')[options.strata=='doStrata'], - ('','-B %s'%options.offbase)[int(options.offbase)>=0], - ('','-z %s'%options.phased)[options.phased!='None'], ('','-o %s'%options.offrate)[int(options.offrate)>=0], ('','--seed %s'%options.seed)[int(options.seed)>=0], options.threads) except ValueError: aligning_cmds = '-p %s' % options.threads - tmp_out = tempfile.NamedTemporaryFile() - # prepare actual aligning commands if options.paired == 'paired': - cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name) + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, options.output) else: - cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name) - # prepare command to convert bowtie output to sam and alternative - cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output) - cmd4 = 'cp %s %s' % (tmp_out.name, options.output) + cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.output) # align try: os.system(cmd2) except Exception, erf: stop_err("Error aligning sequence\n" + str(erf)) - if len(file(tmp_out.name,'r').read()) > 0: - #convert + + # remove header if necessary + if options.suppressHeader == 'true': + tmp_out = tempfile.NamedTemporaryFile() + cmd3 = 'cp %s %s' % (options.output, tmp_out.name) try: os.system(cmd3) except Exception, erf: - stop_err('Error converting output to sam format\n' + str(erf)) - else: - try: - os.system(cmd4) - sys.stdout.write('Alignment file contained no data') - except Exception, erf: - stop_err('Error producing alignment file. File contained no data.\n' + str(erf)) + stop_err("Error copying output file before removing headers\n" + str(erf)) + output = file(tmp_out.name, 'r') + fout = file(options.output, 'w') + header = True + line = output.readline() + while line.strip() != '': + if header: + if line.startswith('@HD') or line.startswith('@SQ') or line.startswith('@RG') or line.startswith('@PG') or line.startswith('@CO'): + pass + else: + header = False + fout.write(line) + else: + fout.write(line) + line = output.readline() + fout.close() + tmp_out.close() if __name__=="__main__": __main__() diff -r 50e2d1a49815 -r e02620ad3f41 tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Thu Oct 08 15:53:11 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.xml Thu Oct 08 18:07:02 2009 -0400 @@ -32,22 +32,15 @@ --valAlign=$singlePaired.params.valAlign --allValAligns=$singlePaired.params.allValAligns --suppressAlign=$singlePaired.params.suppressAlign - --offbase=$singlePaired.params.offbase --offrate=$singlePaired.params.offrate --seed=$singlePaired.params.seed --best=$singlePaired.params.bestOption.best #if $singlePaired.params.bestOption.best == "doBest": --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks --strata=$singlePaired.params.bestOption.strata - --phased="None" #else: --maxBacktracks="None" --strata="None" - #if $singlePaired.sPaired =="single": - --phased=$singlePaired.params.bestOption.phased - #else: - --phased="None" - #end if #end if #if $singlePaired.sPaired == "single": --minInsert="None" @@ -78,7 +71,6 @@ --valAlign="None" --allValAligns="None" --suppressAlign="None" - --offbase="None" --best="None" --maxBacktracks="None" --strata="None" @@ -88,7 +80,6 @@ --maxAlignAttempt="None" --forwardAlign="None" --reverseAlign="None" - --phased="None" --offrate="None" --seed="None" #end if @@ -123,7 +114,6 @@ --iendian=$refGenomeSource.indexParams.endian --iseed=$refGenomeSource.indexParams.seed --icutoff=$refGenomeSource.indexParams.cutoff - --ioldpmap=$refGenomeSource.indexParams.oldpmap #else: --iauto_b="None" --ipacked="None" @@ -138,8 +128,8 @@ --iendian="None" --iseed="None" --icutoff="None" - --ioldpmap="None" #end if + --suppressHeader=$suppressHeader </command> <inputs> <conditional name="refGenomeSource"> @@ -200,10 +190,6 @@ </param> <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> - <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't"> - <option value="no">Use the new scheme</option> - <option value="yes">Use the old scheme</option> - </param> </when>  </conditional> </when> @@ -244,7 +230,6 @@ <option value="doAllValAligns">Report all valid alignments</option> </param> <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> <conditional name="bestOption"> <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> <option value="noBest">Do not use best</option> @@ -252,10 +237,6 @@ </param> <when value="noBest"> <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)"> - <option value="noPhased">Don't alternate</option> - <option value="doPhased">Do alternate</option> - </param> </when> <when value="doBest"> <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> @@ -318,7 +299,6 @@ <option value="doAllValAligns">Report all valid alignments</option> </param> <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> - <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> <conditional name="bestOption"> <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> <option value="noBest">Do not use best</option> @@ -341,6 +321,7 @@ </conditional>  </when>  </conditional>  + <param name="suppressHeader" type="boolean" truevalue="true" falsevalue="false" checked="true" label="Suppress the header in the output SAM file" help="Bowtie produces SAM with several lines of header information" /> </inputs> <outputs> <data format="sam" name="output" /> @@ -352,6 +333,7 @@ <param name="sPaired" value="single" /> <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> <param name="settings_type" value="pre_set" /> + <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out1.sam" /> </test> <test> @@ -362,6 +344,7 @@ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" /> <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" /> <param name="settings_type" value="pre_set" /> + <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out2.sam" /> </test> <test> @@ -381,10 +364,10 @@ <param name="endian" value="little" /> <param name="seed" value="-1" /> <param name="cutoff" value="-1" /> - <param name="oldpmap" value="no" /> <param name="sPaired" value="single" /> <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> <param name="settings_type" value="pre_set" /> + <param name="suppressHeader" value="true" /> <output name="output" ftype="sam" file="bowtie_out1.sam" /> </test> <test> @@ -413,13 +396,13 @@ <param name="valAlign" value="1" /> <param name="allValAligns" value="noAllValAligns" /> <param name="suppressAlign" value="-1" /> - <param name="offbase" value="0" /> <param name="best" value="doBest" /> <param name="maxBacktracks" value="800" /> <param name="strata" value="noStrata" /> <param name="offrate" value="-1" /> <param name="seed" value="403" /> - <output name="output" ftype="sam" file="bowtie_out2.sam" /> + <param name="suppressHeader" value="true" /> + <output name="output" ftype="sam" file="bowtie_out3.sam" /> </test> </tests> <help> @@ -514,7 +497,6 @@ --little Endianness. [--little] --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off] - --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off] For aligning (bowtie):: -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off] @@ -542,10 +524,7 @@ -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit] --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off] --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off] - -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0] - -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off] -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off] - --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off] --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] </help>

1 0

[hg] galaxy 2857: Modified datatypes_conf so fastqsanger type di...
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e1382afd8e41 changeset: 2857:e1382afd8e41 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Oct 08 14:57:36 2009 -0400 description: Modified datatypes_conf so fastqsanger type displays in upload list. 1 file(s) affected in this change: datatypes_conf.xml.sample diffs (12 lines): diff -r 4d5b24d03226 -r e1382afd8e41 datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Thu Oct 08 14:50:28 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Oct 08 14:57:36 2009 -0400 @@ -23,7 +23,7 @@ <converter file="fasta_to_tabular_converter.xml" target_datatype="tabular"/> </datatype> <datatype extension="fastq" type="galaxy.datatypes.sequence:Fastq" display_in_upload="true"/> - <datatype extension="fastqsanger" type="galaxy.datatypes.sequence:FastqSanger"/> + <datatype extension="fastqsanger" type="galaxy.datatypes.sequence:FastqSanger" display_in_upload="true"/> <datatype extension="genetrack" type="galaxy.datatypes.tracks:GeneTrack"/> <datatype extension="gff" type="galaxy.datatypes.interval:Gff" display_in_upload="true"> <converter file="gff_to_bed_converter.xml" target_datatype="bed"/>

1 0

[hg] galaxy 2855: Add missing tag to template for browing library.
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d5a77c9e869e changeset: 2855:d5a77c9e869e user: Greg Von Kuster <greg(a)bx.psu.edu> date: Thu Oct 08 14:09:52 2009 -0400 description: Add missing tag to template for browing library. 1 file(s) affected in this change: templates/library/browse_library.mako diffs (27 lines): diff -r b9873946cada -r d5a77c9e869e templates/library/browse_library.mako --- a/templates/library/browse_library.mako Thu Oct 08 14:08:46 2009 -0400 +++ b/templates/library/browse_library.mako Thu Oct 08 14:09:52 2009 -0400 @@ -290,12 +290,8 @@ <ul class="manage-table-actions"> %if can_add: - <li> - <a class="action-button" href="${h.url_for( controller='library', action='upload_library_dataset', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets</span></a> - </li> - <li> - <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, obj_id=library.root_folder.id, library_id=library.id )}">Add folder</a> - </li> + <li><a class="action-button" href="${h.url_for( controller='library', action='upload_library_dataset', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets</span></a></li> + <li><a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, obj_id=library.root_folder.id, library_id=library.id )}">Add folder</a></li> %endif %if can_modify: <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, obj_id=library.id )}">Edit information</a></li> @@ -303,7 +299,7 @@ <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, obj_id=library.id )}">View information</a></li> %endif %if can_add and not info_association: - <a class="action-button" href="${h.url_for( controller='library_common', action='info_template', cntrller='library', library_id=library.id, response_action='browse_library' )}">Add template</a> + <li><a class="action-button" href="${h.url_for( controller='library_common', action='info_template', cntrller='library', library_id=library.id, response_action='browse_library' )}">Add template</a></li> %endif %if can_manage: <li><a class="action-button" href="${h.url_for( controller='library', action='library', permissions=True, obj_id=library.id )}">Edit permissions</a></li>

1 0

[hg] galaxy 2856: Modified test data and tool conf for fastq stats
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/4d5b24d03226 changeset: 2856:4d5b24d03226 user: Anton Nekrutenko <anton(a)bx.psu.edu> date: Thu Oct 08 14:50:28 2009 -0400 description: Modified test data and tool conf for fastq stats 3 file(s) affected in this change: test-data/fastq_stats1.fastq tools/fastx_toolkit/fastx_quality_statistics.xml tools/metag_tools/split_paired_reads.xml diffs (85 lines): diff -r d5a77c9e869e -r 4d5b24d03226 test-data/fastq_stats1.fastq --- a/test-data/fastq_stats1.fastq Thu Oct 08 14:09:52 2009 -0400 +++ b/test-data/fastq_stats1.fastq Thu Oct 08 14:50:28 2009 -0400 @@ -1,36 +1,36 @@ @CSHL_3_FC042AGLLWW:1:2:7:203 GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT +CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +BBC?7?B6>ABB?B;BBBCC9&;BCBBBBBBBB>>A @CSHL_3_FC042AGLLWW:1:2:7:33 CAATGCCTCCAATTGGTTAATCCCCCTATATATACT +CSHL_3_FC042AGLLWW:1:2:7:33 -Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +8BBB?B;BB8?6(a)9B8BB=8.&1?,&;931&&&(BB @CSHL_3_FC042AGLLWW:1:2:7:169 GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC +CSHL_3_FC042AGLLWW:1:2:7:169 -a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +B@.?B=6BBB@.@BBBBBBBBBBBBBBB7=;6(663 @CSHL_3_FC042AGLLWW:1:2:7:1436 AATTATTTATTAAATTTTAATAATATGGGAGACACT +CSHL_3_FC042AGLLWW:1:2:7:1436 -a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +B?BBBBBBBBBBBBBBB@6ABBBBB@4@BBBBB77< @CSHL_3_FC042AGLLWW:1:2:7:292 GGAGAAATACACACAATTGGTTAATCCCCCTATATA +CSHL_3_FC042AGLLWW:1:2:7:292 -babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +CBCBBBBBBB6.BBBBBBBBBBB=9&66&1@>6&3& @CSHL_3_FC042AGLLWW:1:2:7:1819 AATTCAAACCACCCCAACCCACACACAGAGATACAA +CSHL_3_FC042AGLLWW:1:2:7:1819 -a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +B==2777-BB-0&96866&,66-&.6&66,6-*2.6 @CSHL_3_FC042AGLLWW:1:2:7:1875 GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC +CSHL_3_FC042AGLLWW:1:2:7:1875 -aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +BBBBBBBBB9699&9BBBBBA@;BBBBBBBBB9&96 @CSHL_3_FC042AGLLWW:1:2:8:624 ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG +CSHL_3_FC042AGLLWW:1:2:8:624 -aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +BB<4?A9ABB@>>009.6?@<.6@BBBBBBBBBBBB @CSHL_3_FC042AGLLWW:1:2:8:250 TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA +CSHL_3_FC042AGLLWW:1:2:8:250 -aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE +BBBBBBBB?BBBBBBCCC<,91&6<39;?+6,3,9& diff -r d5a77c9e869e -r 4d5b24d03226 tools/fastx_toolkit/fastx_quality_statistics.xml --- a/tools/fastx_toolkit/fastx_quality_statistics.xml Thu Oct 08 14:09:52 2009 -0400 +++ b/tools/fastx_toolkit/fastx_quality_statistics.xml Thu Oct 08 14:50:28 2009 -0400 @@ -1,16 +1,14 @@ <tool id="cshl_fastx_quality_statistics" name="Compute quality statistics"> <description></description> - <command>zcat -f $input | fastx_quality_stats -o $output -Q $offset</command> + <command>zcat -f $input | fastx_quality_stats -o $output -Q 33</command> <inputs> <param format="fastqsanger" name="input" type="data" label="Library to analyse" /> - <param name="offset" type="hidden" value="33"/> </inputs> <tests> <test> - <param name="input" value="fastq_stats1.fastq" ftype="fastq"/> - <param name="offset" value="64" /> + <param name="input" value="fastq_stats1.fastq" ftype="fastqsanger"/> <output name="output" file="fastq_stats1.out" /> </test> </tests> diff -r d5a77c9e869e -r 4d5b24d03226 tools/metag_tools/split_paired_reads.xml --- a/tools/metag_tools/split_paired_reads.xml Thu Oct 08 14:09:52 2009 -0400 +++ b/tools/metag_tools/split_paired_reads.xml Thu Oct 08 14:50:28 2009 -0400 @@ -7,8 +7,8 @@ <param name="input" type="data" format="fastqsanger" label="Your paired-end file" /> </inputs> <outputs> - <data name="output1" format="input"/> - <data name="output2" format="input"/> + <data name="output1" format="fastqsanger"/> + <data name="output2" format="fastqsanger"/> </outputs> <tests> <test>

1 0

[hg] galaxy 2852: Enables viewing of an importable/sharable hist...
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/8f630db17cf1 changeset: 2852:8f630db17cf1 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Oct 08 13:38:32 2009 -0400 description: Enables viewing of an importable/sharable history. Using the syntax /history/view?id=<encoded_history_id> produces a page that renders a history for viewing. A user need not be logged in to view the history. 11 file(s) affected in this change: lib/galaxy/web/controllers/history.py static/june_2007_style/blue/history.css static/june_2007_style/history.css.tmpl static/scripts/autocomplete_tagging.js templates/base_panels.mako templates/history/sharing.mako templates/history/view.mako templates/root/history.mako templates/root/history_common.mako templates/tagging_common.mako test/functional/test_history_functions.py diffs (819 lines): diff -r d146ca99434f -r 8f630db17cf1 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Oct 08 11:33:43 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Oct 08 13:38:32 2009 -0400 @@ -371,6 +371,7 @@ # Rename history.name = new_name trans.sa_session.flush() + @web.expose def imp( self, trans, id=None, confirm=False, **kwd ): """Import another user's history via a shared URL""" @@ -423,6 +424,38 @@ Warning! If you import this history, you will lose your current history. Click <a href="%s">here</a> to confirm. """ % web.url_for( id=id, confirm=True ) ) + + @web.expose + def view( self, trans, id=None ): + """View a history. If a history is importable, then it is viewable by any user.""" + + # Get history to view. + if not id: + return trans.show_error_message( "You must specify a history you want to view." ) + history_to_view = get_history( trans, id, False) + + # Integrity checks. + if not history_to_view: + return trans.show_error_message( "The specified history does not exist.") + # TODO: Use a new flag to determine if history is viewable? + if not history_to_view.importable: + error( "The owner of this history has not published this history." ) + + # View history. + query = trans.sa_session.query( model.HistoryDatasetAssociation ) \ + .filter( model.HistoryDatasetAssociation.history == history_to_view ) \ + .options( eagerload( "children" ) ) \ + .join( "dataset" ).filter( model.Dataset.purged == False ) \ + .options( eagerload_all( "dataset.actions" ) ) + # Do not show deleted datasets. + query = query.filter( model.HistoryDatasetAssociation.deleted == False ) + user_owns_history = ( trans.get_user() == history_to_view.user ) + return trans.stream_template_mako( "history/view.mako", + history = history_to_view, + datasets = query.all(), + user_owns_history = user_owns_history, + show_deleted = False ) + @web.expose @web.require_login( "share histories with other users" ) def share( self, trans, id=None, email="", **kwd ): @@ -699,6 +732,7 @@ @web.expose @web.require_login( "share histories with other users" ) def sharing( self, trans, histories=[], id=None, **kwd ): + """Performs sharing of histories among users.""" # histories looks like: [ historyX, historyY ] params = util.Params( kwd ) msg = util.restore_text ( params.get( 'msg', '' ) ) diff -r d146ca99434f -r 8f630db17cf1 static/june_2007_style/blue/history.css --- a/static/june_2007_style/blue/history.css Thu Oct 08 11:33:43 2009 -0400 +++ b/static/june_2007_style/blue/history.css Thu Oct 08 13:38:32 2009 -0400 @@ -1,7 +1,7 @@ body{background:#C1C9E5;color:#303030;background-image:url(menu_bg.png);background-repeat:repeat-x;background-position:top;margin:5px;border:0;padding:0;} a{color:#303030;} div.historyLinks{padding:5px;margin:5px 0 5px 0;} -div.historyItem{margin:5px -5px 5px 0px;padding:5px 11px 5px 5px;border:solid #888888 1px;border-left:solid #888888 5px;border-right:none;background:#EEEEEE;} +div.historyItem{margin:5px -5px 5px 0px;padding:5px 11px 5px 5px;border:solid #888888 1px;border-left:solid #888888 5px;border-right:solid #888888 1px;background:#EEEEEE;} div.historyItem .state-icon{display:inline-block;vertical-align:middle;width:16px;height:16px;background-position:0 1px;background-repeat:no-repeat;} div.historyItem .historyItemTitle{line-height:16px;} div.historyItem div.historyItem{margin-right:-11px;} diff -r d146ca99434f -r 8f630db17cf1 static/june_2007_style/history.css.tmpl --- a/static/june_2007_style/history.css.tmpl Thu Oct 08 11:33:43 2009 -0400 +++ b/static/june_2007_style/history.css.tmpl Thu Oct 08 13:38:32 2009 -0400 @@ -25,7 +25,7 @@ padding: 5px 11px 5px 5px; border: solid $history_queued_border 1px; border-left: solid $history_queued_border 5px; - border-right: none; + border-right: solid $history_queued_border 1px; background: $history_queued_bg; .state-icon { display: inline-block; diff -r d146ca99434f -r 8f630db17cf1 static/scripts/autocomplete_tagging.js --- a/static/scripts/autocomplete_tagging.js Thu Oct 08 11:33:43 2009 -0400 +++ b/static/scripts/autocomplete_tagging.js Thu Oct 08 13:38:32 2009 -0400 @@ -12,30 +12,31 @@ // var defaults = { - get_toggle_link_text_fn: function(tags) - { - var text = ""; - var num_tags = array_length(tags); - if (num_tags != 0) - text = num_tags + (num_tags != 0 ? " Tags" : " Tag"); - else - // No tags. - text = "Add tags"; - return text; - }, - tag_click_fn : function (name, value) { }, - input_size: 20, - in_form: false, - tags : {}, - use_toggle_link: true, - item_id: "", - add_tag_img: "", - add_tag_img_rollover: "", - delete_tag_img: "", - ajax_autocomplete_tag_url: "", - ajax_retag_url: "", - ajax_delete_tag_url: "", - ajax_add_tag_url: "" + get_toggle_link_text_fn: function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + text = num_tags + (num_tags != 0 ? " Tags" : " Tag"); + else + // No tags. + text = "Add tags"; + return text; + }, + tag_click_fn : function (name, value) { }, + editable: true, + input_size: 20, + in_form: false, + tags : {}, + use_toggle_link: true, + item_id: "", + add_tag_img: "", + add_tag_img_rollover: "", + delete_tag_img: "", + ajax_autocomplete_tag_url: "", + ajax_retag_url: "", + ajax_delete_tag_url: "", + ajax_add_tag_url: "" }; // @@ -206,32 +207,32 @@ // Delete tag. $.ajax({ - url: settings.ajax_delete_tag_url, - data: { tag_name: tag_name }, - error: function() - { - // Failed. Roll back changes and show alert. - settings.tags[tag_name] = tag_value; - if (prev_button.hasClass("tag-button")) - prev_button.after(tag_button); - else - tag_area.prepend(tag_button); - var new_text = settings.get_toggle_link_text_fn(settings.tags); - alert( "Remove tag failed" ); + url: settings.ajax_delete_tag_url, + data: { tag_name: tag_name }, + error: function() + { + // Failed. Roll back changes and show alert. + settings.tags[tag_name] = tag_value; + if (prev_button.hasClass("tag-button")) + prev_button.after(tag_button); + else + tag_area.prepend(tag_button); + var new_text = settings.get_toggle_link_text_fn(settings.tags); + alert( "Remove tag failed" ); - toggle_link.text(new_text); + toggle_link.text(new_text); - // TODO: no idea why it's necessary to set this up again. - delete_img.mouseenter( function () - { - $(this).attr("src", settings.delete_tag_img_rollover); - }); - delete_img.mouseleave( function () - { - $(this).attr("src", settings.delete_tag_img); - }); - }, - success: function() {} + // TODO: no idea why it's necessary to set this up again. + delete_img.mouseenter( function () + { + $(this).attr("src", settings.delete_tag_img_rollover); + }); + delete_img.mouseleave( function () + { + $(this).attr("src", settings.delete_tag_img); + }); + }, + success: function() {} }); return true; @@ -248,7 +249,9 @@ var tag_button = $("<span></span>").addClass("tag-button"); tag_button.append(tag_name_elt); - tag_button.append(delete_img); + // Allow delete only if element is editable. + if (settings.editable) + tag_button.append(delete_img); return tag_button; }; @@ -411,55 +414,58 @@ } }); - tag_area.append(add_tag_button); - tag_area.append(tag_input_field); - tag_input_field.hide(); + if (settings.editable) + { + tag_area.append(add_tag_button); + tag_area.append(tag_input_field); + tag_input_field.hide(); - // On click, enable user to add tags. - tag_area.click( function(e) - { - var is_active = $(this).hasClass("active-tag-area"); + // On click, enable user to add tags. + tag_area.click( function(e) + { + var is_active = $(this).hasClass("active-tag-area"); - // If a "delete image" object was pressed and area is inactive, do nothing. - if ($(e.target).hasClass("delete-tag-img") && !is_active) - return false; + // If a "delete image" object was pressed and area is inactive, do nothing. + if ($(e.target).hasClass("delete-tag-img") && !is_active) + return false; - // If a "tag name" object was pressed and area is inactive, do nothing. - if ($(e.target).hasClass("tag-name") && !is_active) - return false; + // If a "tag name" object was pressed and area is inactive, do nothing. + if ($(e.target).hasClass("tag-name") && !is_active) + return false; - // Hide add tag button, show tag_input field. Change background to show - // area is active. - $(this).addClass("active-tag-area"); - add_tag_button.hide(); - tag_input_field.show(); - tag_input_field.focus(); + // Hide add tag button, show tag_input field. Change background to show + // area is active. + $(this).addClass("active-tag-area"); + add_tag_button.hide(); + tag_input_field.show(); + tag_input_field.focus(); - // Add handler to document that will call blur when the tag area is blurred; - // a tag area is blurred when a user clicks on an element outside the area. - var handle_document_click = function(e) - { - var tag_area_id = tag_area.attr("id"); - // Blur the tag area if the element clicked on is not in the tag area. - if ( - ($(e.target).attr("id") != tag_area_id) && - ($(e.target).parents().filter(tag_area_id).length == 0) - ) - { - tag_area.blur(); - $(document).unbind("click", handle_document_click); - } - }; - // TODO: we should attach the click handler to all frames in order to capture - // clicks outside the frame that this element is in. - //window.parent.document.onclick = handle_document_click; - //var temp = $(window.parent.document.body).contents().find("iframe").html(); - //alert(temp); - //$(document).parent().click(handle_document_click); - $(window).click(handle_document_click); + // Add handler to document that will call blur when the tag area is blurred; + // a tag area is blurred when a user clicks on an element outside the area. + var handle_document_click = function(e) + { + var tag_area_id = tag_area.attr("id"); + // Blur the tag area if the element clicked on is not in the tag area. + if ( + ($(e.target).attr("id") != tag_area_id) && + ($(e.target).parents().filter(tag_area_id).length == 0) + ) + { + tag_area.blur(); + $(document).unbind("click", handle_document_click); + } + }; + // TODO: we should attach the click handler to all frames in order to capture + // clicks outside the frame that this element is in. + //window.parent.document.onclick = handle_document_click; + //var temp = $(window.parent.document.body).contents().find("iframe").html(); + //alert(temp); + //$(document).parent().click(handle_document_click); + $(window).click(handle_document_click); - return false; - }); + return false; + }); + } // If using toggle link, hide the tag area. Otherwise, if there are no tags, // hide the "add tags" button and show the input field. diff -r d146ca99434f -r 8f630db17cf1 templates/base_panels.mako --- a/templates/base_panels.mako Thu Oct 08 11:33:43 2009 -0400 +++ b/templates/base_panels.mako Thu Oct 08 13:38:32 2009 -0400 @@ -44,13 +44,14 @@  + ${h.js( 'jquery' )} </%def> ## Default late-load javascripts <%def name="late_javascripts()"> ## Scripts can be loaded later since they progressively add features to ## the panels, but do not change layout - ${h.js( 'jquery', 'jquery.event.drag', 'jquery.event.hover', 'jquery.form', 'galaxy.base', 'galaxy.panels' )} + ${h.js( 'jquery.event.drag', 'jquery.event.hover', 'jquery.form', 'galaxy.base', 'galaxy.panels' )} <script type="text/javascript"> ensure_dd_helper(); diff -r d146ca99434f -r 8f630db17cf1 templates/history/sharing.mako --- a/templates/history/sharing.mako Thu Oct 08 11:33:43 2009 -0400 +++ b/templates/history/sharing.mako Thu Oct 08 13:38:32 2009 -0400 @@ -34,10 +34,17 @@ %endif %if history.importable: <div class="form-row"> + <% url = h.url_for( controller='history', action='view', id=trans.security.encode_id(history.id), qualified=True ) %> + <a href="${url}" target="_blank">${url}</a> + <div class="toolParamHelp" style="clear: both;"> + Send the above link to users as an easy way for them to view the history. + </div> + </div> + <div class="form-row"> <% url = h.url_for( controller='history', action='imp', id=trans.security.encode_id(history.id), qualified=True ) %> <a href="${url}">${url}</a> <div class="toolParamHelp" style="clear: both;"> - Send the above URL to users as an easy way for them to import the history, making a copy of their own + Send the above link to users as an easy way for them to import the history, making a copy of their own. </div> </div> <div class="form-row"> diff -r d146ca99434f -r 8f630db17cf1 templates/history/view.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/history/view.mako Thu Oct 08 13:38:32 2009 -0400 @@ -0,0 +1,349 @@ +<%inherit file="/base_panels.mako"/> + +<%def name="javascripts()"> + ${parent.javascripts()} + ${h.js( "jquery", "json2", "jquery.jstore-all", "jquery.autocomplete", "autocomplete_tagging" )} +</%def> + +<%def name="stylesheets()"> + ${parent.stylesheets()} + ${h.css( "history", "autocomplete_tagging" )} +</%def> + +<%namespace file="/root/history_common.mako" import="render_dataset" /> + +<%def name="init()"> +<% + self.has_left_panel=False + self.has_right_panel=False + self.message_box_visible=False +%> +</%def> + +<%def name="center_panel()"> + ## For now, turn off inline editing so that view is external only. + <% + user_owns_history = False + %> + + <div style="overflow: auto; height: 100%;"> + <div style="padding: 10px;"> + ## Render view of history. + <script type="text/javascript"> + $(function() { + // Load jStore for local storage + $.extend(jQuery.jStore.defaults, { project: 'galaxy', flash: '/static/jStore.Flash.html' }) + $.jStore.load(); // Auto-select best storage + + $.jStore.ready(function(engine) { + engine.ready(function() { + // Init stuff that requires the local storage to be running + initShowHide(); + setupHistoryItem( $("div.historyItemWrapper") ); + }); + }); + + // Generate 'collapse all' link + $("#top-links").append( "| " ).append( $("<a href='#'>${_('collapse all')}</a>").click( function() { + $( "div.historyItemBody:visible" ).each( function() { + if ( $.browser.mozilla ) { + $(this).find( "pre.peek" ).css( "overflow", "hidden" ); + } + $(this).slideUp( "fast" ); + }); + $.jStore.remove("history_expand_state"); + })); + + $("#history-rename").click( function() { + var old_name = $("#history-name").text() + var t = $("<input type='text' value='" + old_name + "'></input>" ); + t.blur( function() { + $(this).remove(); + $("#history-name").show(); + }); + t.keyup( function( e ) { + if ( e.keyCode == 27 ) { + // Escape key + $(this).trigger( "blur" ); + } else if ( e.keyCode == 13 ) { + // Enter key + new_value = this.value; + $(this).trigger( "blur" ); + $.ajax({ + url: "${h.url_for( controller='history', action='rename_async', id=history.id )}", + data: { "_": true, new_name: new_value }, + error: function() { alert( "Rename failed" ) }, + success: function() { + $("#history-name").text( new_value ); + } + }); + } + }); + $("#history-name").hide(); + $("#history-name-area").append( t ); + t.focus(); + return false; + }); + // Updater + updater({ + <% updateable = [data for data in reversed( datasets ) if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]] %> + ${ ",".join( map(lambda data: "\"%s\" : \"%s\"" % (data.id, data.state), updateable) ) } + }); + }); + // Functionized so AJAX'd datasets can call them + function initShowHide() { + + // Load saved state and show as necessary + try { + var stored = $.jStore.store("history_expand_state"); + if (stored) { + var st = JSON.parse(stored); + for (var id in st) { + $("#" + id + " div.historyItemBody" ).show(); + } + } + } catch(err) { + // Something was wrong with values in storage, so clear storage + $.jStore.remove("history_expand_state"); + } + + // If Mozilla, hide scrollbars in hidden items since they cause animation bugs + if ( $.browser.mozilla ) { + $( "div.historyItemBody" ).each( function() { + if ( ! $(this).is( ":visible" ) ) $(this).find( "pre.peek" ).css( "overflow", "hidden" ); + }) + } + } + // Add show/hide link and delete link to a history item + function setupHistoryItem( query ) { + query.each( function() { + var id = this.id; + var body = $(this).children( "div.historyItemBody" ); + var peek = body.find( "pre.peek" ) + $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() { + if ( body.is(":visible") ) { + // Hiding stuff here + if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) } + body.slideUp( "fast" ); + + // Save setting + var stored = $.jStore.store("history_expand_state") + var prefs = stored ? JSON.parse(stored) : null + if (prefs) { + delete prefs[id]; + $.jStore.store("history_expand_state", JSON.stringify(prefs)); + } + } else { + // Showing stuff here + body.slideDown( "fast", function() { + if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); } + }); + + // Save setting + var stored = $.jStore.store("history_expand_state") + var prefs = stored ? JSON.parse(stored) : new Object; + prefs[id] = true; + $.jStore.store("history_expand_state", JSON.stringify(prefs)); + } + return false; + }); + // Delete link + $(this).find( "div.historyItemButtons > .delete" ).each( function() { + var data_id = this.id.split( "-" )[1]; + $(this).click( function() { + $( '#historyItem-' + data_id + "> div.historyItemTitleBar" ).addClass( "spinner" ); + $.ajax({ + url: "${h.url_for( action='delete_async', id='XXX' )}".replace( 'XXX', data_id ), + error: function() { alert( "Delete failed" ) }, + success: function() { + %if show_deleted: + var to_update = {}; + to_update[data_id] = "none"; + updater( to_update ); + %else: + $( "#historyItem-" + data_id ).fadeOut( "fast", function() { + $( "#historyItemContainer-" + data_id ).remove(); + if ( $( "div.historyItemContainer" ).length < 1 ) { + $( "#emptyHistoryMessage" ).show(); + } + }); + %endif + } + }); + return false; + }); + }); + // Undelete link + $(this).find( "a.historyItemUndelete" ).each( function() { + var data_id = this.id.split( "-" )[1]; + $(this).click( function() { + $( '#historyItem-' + data_id + " > div.historyItemTitleBar" ).addClass( "spinner" ); + $.ajax({ + url: "${h.url_for( controller='dataset', action='undelete_async', id='XXX' )}".replace( 'XXX', data_id ), + error: function() { alert( "Undelete failed" ) }, + success: function() { + var to_update = {}; + to_update[data_id] = "none"; + updater( to_update ); + } + }); + return false; + }); + }); + }); + }; + // Looks for changes in dataset state using an async request. Keeps + // calling itself (via setTimeout) until all datasets are in a terminal + // state. + var updater = function ( tracked_datasets ) { + // Check if there are any items left to track + var empty = true; + for ( i in tracked_datasets ) { + empty = false; + break; + } + if ( ! empty ) { + // console.log( "Updater running in 3 seconds" ); + setTimeout( function() { updater_callback( tracked_datasets ) }, 3000 ); + } else { + // console.log( "Updater finished" ); + } + }; + var updater_callback = function ( tracked_datasets ) { + // Build request data + var ids = [] + var states = [] + var force_history_refresh = false + $.each( tracked_datasets, function ( id, state ) { + ids.push( id ); + states.push( state ); + }); + // Make ajax call + $.ajax( { + type: "POST", + url: "${h.url_for( controller='root', action='history_item_updates' )}", + dataType: "json", + data: { ids: ids.join( "," ), states: states.join( "," ) }, + success : function ( data ) { + $.each( data, function( id, val ) { + // Replace HTML + var container = $("#historyItemContainer-" + id); + container.html( val.html ); + setupHistoryItem( container.children( ".historyItemWrapper" ) ); + initShowHide(); + // If new state was terminal, stop tracking + if (( val.state == "ok") || ( val.state == "error") || ( val.state == "empty") || ( val.state == "deleted" ) || ( val.state == "discarded" )) { + if ( val.force_history_refresh ){ + force_history_refresh = true; + } + delete tracked_datasets[ parseInt(id) ]; + } else { + tracked_datasets[ parseInt(id) ] = val.state; + } + }); + if ( force_history_refresh ) { + parent.frames.galaxy_history.location.reload(); + } else { + // Keep going (if there are still any items to track) + updater( tracked_datasets ); + } + }, + error: function() { + // Just retry, like the old method, should try to be smarter + updater( tracked_datasets ); + } + }); + }; + + // + // Function provides text for tagging toggle link. + // + var get_toggle_link_text = function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + { + text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); + } + else + { + // No tags. + text = "Add tags to history"; + } + return text; + }; + </script> + + <style> + .historyItemBody { + display: none; + } + </style> + + <noscript> + <style> + .historyItemBody { + display: block; + } + </style> + </noscript> + + <div id="top-links" class="historyLinks" style="padding: 0px 0px 5px 0px"> + %if not user_owns_history: + <a href="${h.url_for( controller='history', action='imp', id=trans.security.encode_id(history.id) )}">${_('import')}</a> | + %endif + <a href="${h.url_for( controller='history', action='view', id=trans.security.encode_id(history.id) )}">${_('refresh')}</a> + %if show_deleted: + | <a href="${h.url_for('history', show_deleted=False)}">${_('hide deleted')}</a> + %endif + </div> + + <div id="history-name-area" class="historyLinks" style="color: gray; font-weight: bold; padding: 0px 0px 5px 0px"> + %if user_owns_history: + <div style="float: right"><a id="history-rename" title="Rename" class="icon-button edit" target="galaxy_main" href="${h.url_for( controller='history', action='rename' )}"></a></div> + %endif + <div id="history-name">${history.get_display_name()}</div> + </div> + + %if history.deleted: + <div class="warningmessagesmall"> + ${_('You are currently viewing a deleted history!')} + </div> + <p></p> + %endif + + <div id="history-tag-area" style="margin-bottom: 1em"> + </div> + + <%namespace file="../tagging_common.mako" import="render_tagging_element" /> + + %if trans.get_user() is not None: + <div id='history-tag-area' class="tag-element"></div> + ${render_tagging_element(history, "history-tag-area", get_toggle_link_text_fn='get_toggle_link_text', editable=user_owns_history)} + %endif + + %if not datasets: + + <div class="infomessagesmall" id="emptyHistoryMessage"> + + %else: + + ## Render requested datasets, ordered from newest to oldest + %for data in reversed( datasets ): + %if data.visible: + <div class="historyItemContainer" id="historyItemContainer-${data.id}"> + ${render_dataset( data, data.hid, show_deleted_on_refresh = show_deleted, user_owns_dataset=user_owns_history )} + </div> + %endif + %endfor + + <div class="infomessagesmall" id="emptyHistoryMessage" style="display:none;"> + %endif + ${_("Your history is empty. Click 'Get Data' on the left pane to start")} + </div> + </div> + </div> + + +</%def> diff -r d146ca99434f -r 8f630db17cf1 templates/root/history.mako --- a/templates/root/history.mako Thu Oct 08 11:33:43 2009 -0400 +++ b/templates/root/history.mako Thu Oct 08 13:38:32 2009 -0400 @@ -321,7 +321,7 @@ %for data in reversed( datasets ): %if data.visible: <div class="historyItemContainer" id="historyItemContainer-${data.id}"> - ${render_dataset( data, data.hid, show_deleted_on_refresh = show_deleted )} + ${render_dataset( data, data.hid, show_deleted_on_refresh = show_deleted, user_owns_dataset = True )} </div> %endif %endfor diff -r d146ca99434f -r 8f630db17cf1 templates/root/history_common.mako --- a/templates/root/history_common.mako Thu Oct 08 11:33:43 2009 -0400 +++ b/templates/root/history_common.mako Thu Oct 08 13:38:32 2009 -0400 @@ -1,6 +1,6 @@ <% _=n_ %> ## Render the dataset `data` as history item, using `hid` as the displayed id -<%def name="render_dataset( data, hid, show_deleted_on_refresh = False )"> +<%def name="render_dataset( data, hid, show_deleted_on_refresh = False, user_owns_dataset = True )"> <% if data.state in ['no state','',None]: data_state = "queued" @@ -19,21 +19,27 @@ <strong>This dataset has been deleted. Click <a href="${h.url_for( controller='dataset', action='undelete', id=data.id )}" class="historyItemUndelete" id="historyItemUndeleter-${data.id}" target="galaxy_history">here</a> to undelete.</strong> </div> %endif - + ## Header row for history items (name, state, action buttons) <div style="overflow: hidden;" class="historyItemTitleBar"> <div class="historyItemButtons"> %if data_state == "upload": - ## TODO: Make these CSS, just adding a "disabled" class to the normal - ## links should be enough. However the number of datasets being uploaded - ## at a time is usually small so the impact of these images is also small. - <img src="${h.url_for('/static/images/eye_icon_grey.png')}" width='16' height='16' alt='display data' title='display data' class='button display' border='0'> - <img src="${h.url_for('/static/images/pencil_icon_grey.png')}" width='16' height='16' alt='edit attributes' title='edit attributes' class='button edit' border='0'> + ## TODO: Make these CSS, just adding a "disabled" class to the normal + ## links should be enough. However the number of datasets being uploaded + ## at a time is usually small so the impact of these images is also small. + <img src="${h.url_for('/static/images/eye_icon_grey.png')}" width='16' height='16' alt='display data' title='display data' class='button display' border='0'> + %if user_owns_dataset: + <img src="${h.url_for('/static/images/pencil_icon_grey.png')}" width='16' height='16' alt='edit attributes' title='edit attributes' class='button edit' border='0'> + %endif %else: - <a class="icon-button display" title="display data" href="${h.url_for( controller='dataset', dataset_id=data.id, action='display', filename='index')}" target="galaxy_main"></a> - <a class="icon-button edit" title="edit attributes" href="${h.url_for( controller='root', action='edit', id=data.id )}" target="galaxy_main"></a> + <a class="icon-button display" title="display data" href="${h.url_for( controller='dataset', dataset_id=data.id, action='display', filename='index')}" target="galaxy_main"></a> + %if user_owns_dataset: + <a class="icon-button edit" title="edit attributes" href="${h.url_for( controller='root', action='edit', id=data.id )}" target="galaxy_main"></a> + %endif %endif - <a class="icon-button delete" title="delete" href="${h.url_for( action='delete', id=data.id, show_deleted_on_refresh=show_deleted_on_refresh )}" id="historyItemDeleter-${data.id}"></a> + %if user_owns_dataset: + <a class="icon-button delete" title="delete" href="${h.url_for( action='delete', id=data.id, show_deleted_on_refresh=show_deleted_on_refresh )}" id="historyItemDeleter-${data.id}"></a> + %endif </div> <span class="state-icon"></span> <span class="historyItemTitle"><b>${hid}: ${data.display_name().decode('utf-8')}</b></span> @@ -80,8 +86,10 @@ <div class="info">${_('Info: ')}${data.display_info()}</div> <div> %if data.has_data: - <a href="${h.url_for( action='display', id=data.id, tofile='yes', toext=data.ext )}" target="_blank">save</a> - | <a href="${h.url_for( controller='tool_runner', action='rerun', id=data.id )}" target="galaxy_main">rerun</a> + <a href="${h.url_for( controller='root', action='display', id=data.id, tofile='yes', toext=data.ext )}" target="_blank">save</a> + %if user_owns_dataset: + | <a href="${h.url_for( controller='tool_runner', action='rerun', id=data.id )}" target="galaxy_main">rerun</a> + %endif %for display_app in data.datatype.get_display_types(): <% target_frame, display_links = data.datatype.get_display_links( data, display_app, app, request.base ) %> %if len( display_links ) > 0: diff -r d146ca99434f -r 8f630db17cf1 templates/tagging_common.mako --- a/templates/tagging_common.mako Thu Oct 08 11:33:43 2009 -0400 +++ b/templates/tagging_common.mako Thu Oct 08 13:38:32 2009 -0400 @@ -4,7 +4,7 @@ %endif ## Render the tags 'tags' as an autocomplete element. -<%def name="render_tagging_element(tagged_item, elt_id, use_toggle_link='true', in_form='false', input_size='15', tag_click_fn='default_tag_click_fn', get_toggle_link_text_fn='default_get_toggle_link_text_fn')"> +<%def name="render_tagging_element(tagged_item, elt_id, use_toggle_link='true', in_form='false', input_size='15', tag_click_fn='default_tag_click_fn', get_toggle_link_text_fn='default_get_toggle_link_text_fn', editable='true')"> <script type="text/javascript"> // // Set up autocomplete tagger. @@ -83,6 +83,7 @@ var options = { tags : ${h.to_json_string(tag_names_and_values)}, + editable : ${str(editable).lower()}, get_toggle_link_text_fn: ${get_toggle_link_text_fn}, tag_click_fn: ${tag_click_fn}, <% tagged_item_id = trans.security.encode_id(tagged_item.id) %> diff -r d146ca99434f -r 8f630db17cf1 test/functional/test_history_functions.py --- a/test/functional/test_history_functions.py Thu Oct 08 11:33:43 2009 -0400 +++ b/test/functional/test_history_functions.py Thu Oct 08 13:38:32 2009 -0400 @@ -164,7 +164,7 @@ # Enable importing history3 via a URL self.enable_import_via_link( self.security.encode_id( history3.id ), check_str='Unshare', - check_str_after_submit='Send the above URL to users' ) + check_str_after_submit='Send the above link to users' ) # Make sure history3 is now import-able history3.refresh() if not history3.importable: @@ -175,7 +175,7 @@ check_str_after_submit='You cannot import your own history.' ) # Disable the import link for history3 self.disable_import_via_link( self.security.encode_id( history3.id ), - check_str='Send the above URL to users', + check_str='Send the above link to users', check_str_after_submit='Enable import via link' ) # Try importing history3 after disabling the URL self.import_history_via_url( self.security.encode_id( history3.id ),

1 0

[hg] galaxy 2853: Merge
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f46f6a26218b changeset: 2853:f46f6a26218b user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Oct 08 13:38:57 2009 -0400 description: Merge 0 file(s) affected in this change: diffs (46 lines): diff -r 8f630db17cf1 -r f46f6a26218b tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Thu Oct 08 13:38:32 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.xml Thu Oct 08 13:38:57 2009 -0400 @@ -426,9 +426,19 @@ **What it does** -Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool. +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. .. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +------ + +**Know what you are doing** + +.. class:: warningmark + +There is no such thing (yet) as automated gearshift in short read mapping. It is all like stick-shift driving in San Francisco. In other words = running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading `documentation`__ and experimenting. Fortunaly, Galaxy makes experimenting easy. + + .. __: http://bowtie-bio.sourceforge.net/index.shtml ------ diff -r 8f630db17cf1 -r f46f6a26218b tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Thu Oct 08 13:38:32 2009 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Thu Oct 08 13:38:57 2009 -0400 @@ -291,7 +291,17 @@ **What it does** -**BWA** is a high performance sequence aligner that succeeds MAQ. It is based on BWT-SW but uses a completely different algorithm and is aimed towards short read alignments. It is fast--it can map the human genome in only 15-25 minutes. Heng Li of the Sanger Institute wrote the majority of the code, with contributions by Chi-Kwong Wong at the University of Hong Kong, Nong Ge at Sun Yat-Sen University, and Yuta Mori. +BWA is a fast light-weighted tool that aligns relatively short sequences (queries) to a sequence database (large), such as the human reference genome. It is developed by Heng Li at the Sanger Insitute. + +------ + +**Know what you are doing** + +.. class:: warningmark + +There is no such thing (yet) as automated gearshift in short read mapping. It is all like stick-shift driving in San Francisco. In other words = running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading `documentation`__ and experimenting. Fortunaly, Galaxy makes experimenting easy. + + .. __: http://bio-bwa.sourceforge.net/ ------

1 0

[hg] galaxy 2854: Back out history style changes for now.
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/b9873946cada changeset: 2854:b9873946cada user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Oct 08 14:08:46 2009 -0400 description: Back out history style changes for now. 2 file(s) affected in this change: static/june_2007_style/blue/history.css static/june_2007_style/history.css.tmpl diffs (24 lines): diff -r f46f6a26218b -r b9873946cada static/june_2007_style/blue/history.css --- a/static/june_2007_style/blue/history.css Thu Oct 08 13:38:57 2009 -0400 +++ b/static/june_2007_style/blue/history.css Thu Oct 08 14:08:46 2009 -0400 @@ -1,7 +1,7 @@ body{background:#C1C9E5;color:#303030;background-image:url(menu_bg.png);background-repeat:repeat-x;background-position:top;margin:5px;border:0;padding:0;} a{color:#303030;} div.historyLinks{padding:5px;margin:5px 0 5px 0;} -div.historyItem{margin:5px -5px 5px 0px;padding:5px 11px 5px 5px;border:solid #888888 1px;border-left:solid #888888 5px;border-right:solid #888888 1px;background:#EEEEEE;} +div.historyItem{margin:5px -5px 5px 0px;padding:5px 11px 5px 5px;border:solid #888888 1px;border-left:solid #888888 5px;border-right:none;background:#EEEEEE;} div.historyItem .state-icon{display:inline-block;vertical-align:middle;width:16px;height:16px;background-position:0 1px;background-repeat:no-repeat;} div.historyItem .historyItemTitle{line-height:16px;} div.historyItem div.historyItem{margin-right:-11px;} diff -r f46f6a26218b -r b9873946cada static/june_2007_style/history.css.tmpl --- a/static/june_2007_style/history.css.tmpl Thu Oct 08 13:38:57 2009 -0400 +++ b/static/june_2007_style/history.css.tmpl Thu Oct 08 14:08:46 2009 -0400 @@ -25,7 +25,7 @@ padding: 5px 11px 5px 5px; border: solid $history_queued_border 1px; border-left: solid $history_queued_border 5px; - border-right: solid $history_queued_border 1px; + border-right: none; background: $history_queued_bg; .state-icon { display: inline-block;

1 0

[hg] galaxy 2846: tiny change to bwa warpper
by Greg Von Kuster 08 Oct '09

08 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f0d565ab7028 changeset: 2846:f0d565ab7028 user: Anton Nekrutenko <anton(a)bx.psu.edu> date: Thu Oct 08 10:07:35 2009 -0400 description: tiny change to bwa warpper 1 file(s) affected in this change: tools/sr_mapping/bwa_wrapper.xml diffs (12 lines): diff -r 1fa410dd1aa1 -r f0d565ab7028 tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Thu Oct 08 09:01:19 2009 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Thu Oct 08 10:07:35 2009 -0400 @@ -66,7 +66,7 @@ <inputs> <conditional name="solidOrSolexa"> <param name="solidSolexa" type="select" label="Select SOLiD or Solexa format for the original dataset"> - <option value="solexa">Solexa</option> + <option value="solexa">Illumina</option> <option value="solid">SOLiD</option> </param> <when value="solid">

1 0