October 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2874: Corrected Bowtie wrapper's output type (to SAM...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/7fd7bbe91838 changeset: 2874:7fd7bbe91838 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Mon Oct 12 14:40:01 2009 -0400 description: Corrected Bowtie wrapper's output type (to SAM) for one missed condition, and also corrected problem with handling of full parameter list 1 file(s) affected in this change: tools/sr_mapping/bowtie_wrapper.py diffs (21 lines): diff -r 4a3e48e1e8e1 -r 7fd7bbe91838 tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Mon Oct 12 14:04:28 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.py Mon Oct 12 14:40:01 2009 -0400 @@ -119,7 +119,7 @@ ('','-I %s'%options.minInsert)[options.minInsert!='None'], ('','-X %s'%options.maxInsert)[options.maxInsert!='None'], ('','--%s'%options.mateOrient)[options.mateOrient!='None'], - ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0], + ('','--pairtries %s'%options.maxAlignAttempt)[options.maxAlignAttempt!='None' and int(options.maxAlignAttempt)>=0], ('','--nofw')[options.forwardAlign=='noForward'], ('','--norc')[options.reverseAlign=='noReverse'], ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')], @@ -133,7 +133,7 @@ ('','--seed %s'%options.seed)[int(options.seed)>=0], options.threads) except ValueError: - aligning_cmds = '-p %s' % options.threads + aligning_cmds = '-p %s -S' % options.threads # prepare actual aligning commands if options.paired == 'paired':

1 0

[hg] galaxy 2875: Changed Bowtie so that if alignment parameters...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ebc1c19fc2d5 changeset: 2875:ebc1c19fc2d5 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Mon Oct 12 16:14:54 2009 -0400 description: Changed Bowtie so that if alignment parameters cannot be read, it errors out 1 file(s) affected in this change: tools/sr_mapping/bowtie_wrapper.py diffs (14 lines): diff -r 7fd7bbe91838 -r ebc1c19fc2d5 tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Mon Oct 12 14:40:01 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.py Mon Oct 12 16:14:54 2009 -0400 @@ -132,8 +132,8 @@ ('','-o %s'%options.offrate)[int(options.offrate)>=0], ('','--seed %s'%options.seed)[int(options.seed)>=0], options.threads) - except ValueError: - aligning_cmds = '-p %s -S' % options.threads + except ValueError, erf: + stop_err('Something is wrong with the alignment parameters and the alignment could not be run\n' + str(erf)) # prepare actual aligning commands if options.paired == 'paired':

1 0

[hg] galaxy 2876: trackster: caching works, faster loops, displa...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e11e89fd2c82 changeset: 2876:e11e89fd2c82 user: Kanwei Li <kanwei(a)gmail.com> date: Mon Oct 12 19:00:39 2009 -0400 description: trackster: caching works, faster loops, displays exon blocks, passes JSLint 4 file(s) affected in this change: static/scripts/packed/autocomplete_tagging.js static/scripts/packed/trackster.js static/scripts/trackster.js static/trackster.css diffs (513 lines): diff -r ebc1c19fc2d5 -r e11e89fd2c82 static/scripts/packed/autocomplete_tagging.js --- a/static/scripts/packed/autocomplete_tagging.js Mon Oct 12 16:14:54 2009 -0400 +++ b/static/scripts/packed/autocomplete_tagging.js Mon Oct 12 19:00:39 2009 -0400 @@ -1,1 +1,1 @@ -var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u,v){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>").text(u).addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b();if(p. use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var D=$(this).parent();var C=D.find(".tag-name").eq(0);var B=C.text();var z=h(B);var F=z[0];var y=z[1];var E=D.prev();D.remove();delete p.tags[F];var A=p.get_toggle_link_text_fn(p.tags);s.text(A);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:F},error:function(){p.tags[F]=y;if(E.hasClass("tag-button")){E.after(D)}else {m.prepend(D)}var G=p.get_toggle_link_text_fn(p.tags);alert("Remove tag failed");s.text(G);v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)})},success:function(){}});return true});var w=$("<span>").text(u).addClass("tag-name");w.click(function(){tag_name_and_value=u.split(":");p.tag_click_fn(tag_name_and_value[0],tag_name_and_value[1]);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+escape(v)+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+escape(v)+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autoc omplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){this.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();delete p.tags[y[0]];var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,hig hlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClass("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file +var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u,v){},editable:true,input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>").text(u).addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};v ar s=b();if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var D=$(this).parent();var C=D.find(".tag-name").eq(0);var B=C.text();var z=h(B);var F=z[0];var y=z[1];var E=D.prev();D.remove();delete p.tags[F];var A=p.get_toggle_link_text_fn(p.tags);s.text(A);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:F},error:function(){p.tags[F]=y;if(E.hasClass("tag-button")){E .after(D)}else{m.prepend(D)}var G=p.get_toggle_link_text_fn(p.tags);alert("Remove tag failed");s.text(G);v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)})},success:function(){}});return true});var w=$("<span>").text(u).addClass("tag-name");w.click(function(){tag_name_and_value=u.split(":");p.tag_click_fn(tag_name_and_value[0],tag_name_and_value[1]);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);if(p.editable){x.append(v)}return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+escape(v)+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+escape(v)+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true) {return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){this.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();delete p.tags[y[0]];var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,fo rmatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});if(p.editable){m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClass("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false})}if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file diff -r ebc1c19fc2d5 -r e11e89fd2c82 static/scripts/packed/trackster.js --- a/static/scripts/packed/trackster.js Mon Oct 12 16:14:54 2009 -0400 +++ b/static/scripts/packed/trackster.js Mon Oct 12 19:00:39 2009 -0400 @@ -1,1 +1,1 @@ -var DENSITY=1000,DATA_ERROR="There was an error in indexing this dataset.",DATA_NONE="No data for this chrom/contig.";var DataCache=function(b,a){this.type=b;this.track=a;this.cache=Object()};$.extend(DataCache.prototype,{get:function(d,b){var c=this.cache;if(!(c[d]&&c[d][b])){if(!c[d]){c[d]=Object()}var a=b*DENSITY*d;var e=(b+1)*DENSITY*d;c[d][b]={state:"loading"};$.getJSON(data_url,{track_type:this.track.track_type,chrom:this.track.view.chrom,low:a,high:e,dataset_id:this.track.dataset_id},function(f){if(f=="pending"){setTimeout(fetcher,5000)}else{c[d][b]={state:"loaded",values:f}}$(document).trigger("redraw")})}return c[d][b]}});var View=function(a,b){this.chrom=a;this.tracks=[];this.max_low=0;this.max_high=b;this.low=this.max_low;this.high=this.max_high;this.length=this.max_high-this.max_low};$.extend(View.prototype,{add_track:function(a){a.view=this;this.tracks.push(a);if(a.init){a.init()}},redraw:function(){$("#overview-box").css({left:(this.low/this.length)*$("#overvie w-viewport").width(),width:Math.max(4,((this.high-this.low)/this.length)*$("#overview-viewport").width())}).show();$("#low").text(this.low);$("#high").text(this.high);for(var a in this.tracks){this.tracks[a].draw()}$("#bottom-spacer").remove();$("#viewport").append('<div id="bottom-spacer" style="height: 200px;"></div>')},move:function(b,a){this.low=Math.max(this.max_low,Math.floor(b));this.high=Math.min(this.length,Math.ceil(a))},zoom_in:function(d,b){if(this.max_high==0){return}var c=this.high-this.low;var e=c/d/2;if(b==undefined){var a=(this.low+this.high)/2}else{var a=this.low+c*b/$(document).width()}this.low=Math.floor(a-e);this.high=Math.ceil(a+e);if(this.low<this.max_low){this.low=this.max_low;this.high=c/d}else{if(this.high>this.max_high){this.high=this.max_high;this.low=this.max_high-c/d}}if(this.high-this.low<1){this.high=this.low+1}},zoom_out:function(c){if(this.max_high==0){return}var a=(this.low+this.high)/2;var b=this.high-this.low;var d=b*c/2;this.low=Math.flo or(Math.max(0,a-d));this.high=Math.ceil(Math.min(this.length,a+d))},left:function(b){var a=this.high-this.low;var c=Math.floor(a/b);if(this.low-c<0){this.low=0;this.high=this.low+a}else{this.low-=c;this.high-=c}},right:function(b){var a=this.high-this.low;var c=Math.floor(a/b);if(this.high+c>this.length){this.high=this.length;this.low=this.high-a}else{this.low+=c;this.high+=c}}});var Track=function(a,b){this.name=a;this.parent_element=b;this.make_container()};$.extend(Track.prototype,{make_container:function(){this.header_div=$("<div class='track-header'>").text(this.name);this.content_div=$("<div class='track-content'>");this.container_div=$("<div class='track'></div>").append(this.header_div).append(this.content_div);this.parent_element.append(this.container_div)}});var TiledTrack=function(){this.last_resolution=null;this.last_w_scale=null;this.tile_cache={}};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(){var i=this.view.low,c=this.view.high,e=c-i;var b=Mat h.pow(10,Math.ceil(Math.log(e/DENSITY)/Math.log(10)));b=Math.max(b,1);b=Math.min(b,100000);var m=$("<div style='position: relative;'></div>");this.content_div.children(":first").remove();this.content_div.append(m);var k=this.content_div.width(),d=this.content_div.height(),n=k/e,j={},l={};if(this.last_resolution==b&&this.last_w_scale==n){j=this.tile_cache}var g;var a=Math.floor(i/b/DENSITY);while((a*1000*b)<c){if(a in j){g=j[a];var f=a*DENSITY*b;g.css({left:(f-this.view.low)*n});m.append(g)}else{g=this.draw_tile(b,a,m,n,d)}if(g){l[a]=g}a+=1}this.last_resolution=b;this.last_w_scale=n;this.tile_cache=l}});var LabelTrack=function(a){Track.call(this,null,a);this.container_div.addClass("label-track")};$.extend(LabelTrack.prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div style='position: relative; height: 1.3em;'></div>");while(a<c.hig h){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+a+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.append(b)}});var LineTrack=function(c,b,a){Track.call(this,c,$("#viewport"));this.track_type="line";this.height_px=(a?a:100);this.container_div.addClass("line-track");this.content_div.css("height",this.height_px+"px");this.dataset_id=b;this.cache=new DataCache("",this)};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:function(){var a=this;$.getJSON(data_url,{stats:true,track_type:a.track_type,chrom:a.view.chrom,low:null,high:null,dataset_id:a.dataset_id},function(b){if(!b||b=="error"){a.content_div.addClass("error").text(DATA_ERROR)}else{if(b=="no data"){a.content_div.addClass("nodata").text(DATA_NONE)}else{a.min_value=b.min;a.max_value=b.max;a.vertical_range=a.max_value-a.min_value;a.view.redraw()}}})},draw_tile:function(d,a,n,r,o){if(!this.vertical_range){return}var j=a*DENSITY*d,q=(a+1)*DENSITY* d,c=DENSITY*d;var m=this.cache.get(d,a);var h;if(m.state=="loading"){h=$("<div class='loading tile'></div>")}else{h=$("<canvas class='tile'></canvas>")}h.css({position:"absolute",top:0,left:(j-this.view.low)*r,});n.append(h);if(m.state=="loading"){e=false;return null}var b=h;b.get(0).width=Math.ceil(c*r);b.get(0).height=this.height_px;var p=b.get(0).getContext("2d");var e=false;p.beginPath();var g=m.values;if(!g){return}for(var f=0;f<g.length-1;f++){var l=g[f][0]-j;var k=g[f][1];if(isNaN(k)){e=false}else{l=l*r;y_above_min=k-this.min_value;k=y_above_min/this.vertical_range*this.height_px;if(e){p.lineTo(l,k)}else{p.moveTo(l,k);e=true}}}p.stroke();return h}});var FeatureTrack=function(c,b,a){Track.call(this,c,$("#viewport"));this.track_type="feature";this.height_px=(a?a:100);this.container_div.addClass("feature-track");this.content_div.css("height",this.height_px+"px");this.dataset_id=b;this.zo_slots={};this.show_labels_scale=0.01;this.showing_labels=false;this.vertical_gap=10} ;$.extend(FeatureTrack.prototype,TiledTrack.prototype,{calc_slots:function(h){var b=[];var a=this.container_div.width()/(this.view.high-this.view.low);if(h){this.zi_slots={}}var g=$("<canvas></canvas>").get(0).getContext("2d");for(var d in this.values){var k=this.values[d];var e=Math.floor(Math.max(this.view.max_low,(k.start-this.view.max_low)*a));if(h){e-=g.measureText(k.name).width;e-=10}var f=Math.ceil(Math.min(this.view.max_high,(k.end-this.view.max_low)*a));var c=0;while(true){if(b[c]==undefined||b[c]<e){b[c]=f;if(h){this.zi_slots[k.name]=c}else{this.zo_slots[k.name]=c}break}c++}}this.height_px=b.length*this.vertical_gap+15;this.content_div.css("height",this.height_px+"px")},init:function(){var a=this;$.getJSON(data_url,{track_type:a.track_type,low:a.view.max_low,high:a.view.max_high,dataset_id:a.dataset_id,chrom:a.view.chrom},function(b){if(b=="error"){a.content_div.addClass("error").text(DATA_ERROR)}else{if(b.length==0||b=="no data"){a.content_div.addClass("nodata").t ext(DATA_NONE)}else{a.values=b;a.calc_slots();a.slots=a.zo_slots;a.draw()}}})},draw_tile:function(q,t,e,g,f){if(!this.values){return null}if(g>this.show_labels_scale&&!this.showing_labels){this.showing_labels=true;if(!this.zi_slots){this.calc_slots(true)}this.slots=this.zi_slots}else{if(g<=this.show_labels_scale&&this.showing_labels){this.showing_labels=false;this.slots=this.zo_slots}}var u=t*DENSITY*q,c=(t+1)*DENSITY*q,b=DENSITY*q;var k=this.view,m=k.high-k.low,o=Math.ceil(b*g),h=new Array(),n=this.height_px,l=$("<canvas class='tile'></canvas>");l.css({position:"absolute",top:0,left:(u-this.view.low)*g,});l.get(0).width=o;l.get(0).height=n;var p=l.get(0).getContext("2d");var r=0;for(var s in this.values){feature=this.values[s];if(feature.start<=c&&feature.end>=u){f_start=Math.floor(Math.max(0,(feature.start-u)*g));f_end=Math.ceil(Math.min(o,(feature.end-u)*g));p.fillStyle="#000";p.fillRect(f_start,this.slots[feature.name]*this.vertical_gap+5,f_end-f_start,1);if(this.showing _labels&&p.fillText){p.font="10px monospace";p.textAlign="right";p.fillText(feature.name,f_start,this.slots[feature.name]*10+8)}if(feature.exon_start&&feature.exon_end){var d=Math.floor(Math.max(0,(feature.exon_start-u)*g));var w=Math.ceil(Math.min(o,(feature.exon_end-u)*g))}for(var s in feature.blocks){block=feature.blocks[s];block_start=Math.floor(Math.max(0,(block[0]-u)*g));block_end=Math.ceil(Math.min(o,(block[1]-u)*g));var a=3,v=4;if(d&&block_start>=d&&block_end<=w){a=5,v=3}p.fillRect(d,this.slots[feature.name]*this.vertical_gap+v,block_end-block_start,a)}r++}}e.append(l);return l},}); \ No newline at end of file +var DENSITY=1000,DATA_ERROR="There was an error in indexing this dataset.",DATA_NONE="No data for this chrom/contig.",CACHED_TILES=200,CACHED_DATA=20;var View=function(a,b){this.chrom=a;this.tracks=[];this.max_low=0;this.max_high=b;this.low=this.max_low;this.high=this.max_high;this.length=this.max_high-this.max_low};$.extend(View.prototype,{add_track:function(a){a.view=this;this.tracks.push(a);if(a.init){a.init()}},redraw:function(){$("#overview-box").css({left:(this.low/this.length)*$("#overview-viewport").width(),width:Math.max(4,((this.high-this.low)/this.length)*$("#overview-viewport").width())}).show();$("#low").text(this.low);$("#high").text(this.high);for(var b=0,a=this.tracks.length;b<a;b++){this.tracks[b].draw()}$("#bottom-spacer").remove();$("#viewport").append('<div id="bottom-spacer" style="height: 200px;"></div>')},move:function(b,a){this.low=Math.max(this.max_low,Math.floor(b));this.high=Math.min(this.length,Math.ceil(a))},zoom_in:function(d,b){if(this.max_high ===0){return}var c=this.high-this.low;var e=c/d/2;var a;if(b===undefined){a=(this.low+this.high)/2}else{a=this.low+c*b/$(document).width()}this.low=Math.floor(a-e);this.high=Math.ceil(a+e);if(this.low<this.max_low){this.low=this.max_low;this.high=c/d}else{if(this.high>this.max_high){this.high=this.max_high;this.low=this.max_high-c/d}}if(this.high-this.low<1){this.high=this.low+1}},zoom_out:function(c){if(this.max_high===0){return}var a=(this.low+this.high)/2;var b=this.high-this.low;var d=b*c/2;this.low=Math.floor(Math.max(0,a-d));this.high=Math.ceil(Math.min(this.length,a+d))},left:function(b){var a=this.high-this.low;var c=Math.floor(a/b);if(this.low-c<0){this.low=0;this.high=this.low+a}else{this.low-=c;this.high-=c}},right:function(b){var a=this.high-this.low;var c=Math.floor(a/b);if(this.high+c>this.length){this.high=this.length;this.low=this.high-a}else{this.low+=c;this.high+=c}}});var Track=function(a,b){this.name=a;this.parent_element=b;this.make_container()};$.extend (Track.prototype,{make_container:function(){this.header_div=$("<div class='track-header'>").text(this.name);this.content_div=$("<div class='track-content'>");this.container_div=$("<div class='track'></div>").append(this.header_div).append(this.content_div);this.parent_element.append(this.container_div)}});var TiledTrack=function(){this.tile_cache=new Cache(CACHED_TILES)};$.extend(TiledTrack.prototype,Track.prototype,{draw:function(){var i=this.view.low,c=this.view.high,e=c-i;var b=Math.pow(10,Math.ceil(Math.log(e/DENSITY)/Math.log(10)));b=Math.max(b,1);b=Math.min(b,100000);var l=$("<div style='position: relative;'></div>");this.content_div.children(":first").remove();this.content_div.append(l);var j=this.content_div.width(),d=this.content_div.height(),m=j/e;var g;var a=Math.floor(i/b/DENSITY);while((a*DENSITY*b)<c){var k=m+"_"+a;if(this.tile_cache[k]){g=this.tile_cache[k];var f=a*DENSITY*b;g.css({left:(f-this.view.low)*m});l.append(g)}else{g=this.draw_tile(b,a,l,m,d)}if(g){t his.tile_cache[k]=g}a+=1}}});var LabelTrack=function(a){Track.call(this,null,a);this.container_div.addClass("label-track")};$.extend(LabelTrack.prototype,Track.prototype,{draw:function(){var c=this.view,d=c.high-c.low,g=Math.floor(Math.pow(10,Math.floor(Math.log(d)/Math.log(10)))),a=Math.floor(c.low/g)*g,e=this.content_div.width(),b=$("<div style='position: relative; height: 1.3em;'></div>");while(a<c.high){var f=(a-c.low)/d*e;b.append($("<div class='label'>"+a+"</div>").css({position:"absolute",left:f-1}));a+=g}this.content_div.children(":first").remove();this.content_div.append(b)}});var LineTrack=function(c,b,a){Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.track_type="line";this.height_px=(a?a:100);this.container_div.addClass("line-track");this.dataset_id=b;this.cache=new Cache(CACHED_DATA)};$.extend(LineTrack.prototype,TiledTrack.prototype,{init:function(){var a=this;$.getJSON(data_url,{stats:true,track_type:a.track_type,chrom:a.view.chrom,low:null,high:n ull,dataset_id:a.dataset_id},function(b){if(!b||b=="error"){a.content_div.addClass("error").text(DATA_ERROR)}else{if(b=="no data"){a.content_div.addClass("nodata").text(DATA_NONE)}else{a.content_div.css("height",a.height_px+"px");a.min_value=b.min;a.max_value=b.max;a.vertical_range=a.max_value-a.min_value;a.view.redraw()}}})},get_data:function(d,b){var c=this,a=b*DENSITY*d,f=(b+1)*DENSITY*d,e=d+"_"+b;$.getJSON(data_url,{track_type:this.track_type,chrom:this.view.chrom,low:a,high:f,dataset_id:this.dataset_id},function(g){c.cache[e]=g;$(document).trigger("redraw")})},draw_tile:function(d,a,m,p,n){if(!this.vertical_range){return}var h=a*DENSITY*d,b=DENSITY*d,c=$("<canvas class='tile'></canvas>"),l=d+"_"+a;if(!this.cache[l]){this.get_data(d,a);return}var g=this.cache[l];c.css({position:"absolute",top:0,left:(h-this.view.low)*p});c.get(0).width=Math.ceil(b*p);c.get(0).height=this.height_px;var o=c.get(0).getContext("2d");var e=false;o.beginPath();for(var f=0;f<g.length-1;f++){var k=g[f][0]-h;var j=g[f][1];if(isNaN(j)){e=false}else{k=k*p;j=(j-this.min_value)/this.vertical_range*this.height_px;if(e){o.lineTo(k,j)}else{o.moveTo(k,j);e=true}}}o.stroke();m.append(c);return c}});var FeatureTrack=function(c,b,a){Track.call(this,c,$("#viewport"));TiledTrack.call(this);this.track_type="feature";this.height_px=(a?a:100);this.container_div.addClass("feature-track");this.dataset_id=b;this.zo_slots={};this.show_labels_scale=0.001;this.showing_labels=false;this.vertical_gap=10};$.extend(FeatureTrack.prototype,TiledTrack.prototype,{init:function(){var a=this;$.getJSON(data_url,{track_type:a.track_type,low:a.view.max_low,high:a.view.max_high,dataset_id:a.dataset_id,chrom:a.view.chrom},function(b){if(b=="error"){a.content_div.addClass("error").text(DATA_ERROR)}else{if(b.length===0||b=="no data"){a.content_div.addClass("nodata").text(DATA_NONE)}else{a.content_div.css("height",a.height_px+"px");a.values=b;a.calc_slots();a.slots=a.zo_slots;a.draw()}}})},calc_slots:func tion(o){var c=[],b=this.container_div.width()/(this.view.high-this.view.low),g=this.show_labels_scale,a=this.view.max_high,e=this.view.max_low;if(o){this.zi_slots={}}var m=$("<canvas></canvas>").get(0).getContext("2d");for(var f=0,h=this.values.length;f<h;f++){var k,l,n=this.values[f];if(o){k=Math.floor(Math.max(e,(n.start-e)*g));k-=m.measureText(n.name).width;l=Math.ceil(Math.min(a,(n.end-e)*g))}else{k=Math.floor(Math.max(e,(n.start-e)*b));l=Math.ceil(Math.min(a,(n.end-e)*b))}var d=0;while(true){if(c[d]===undefined||c[d]<k){c[d]=l;if(o){this.zi_slots[n.name]=d}else{this.zo_slots[n.name]=d}break}d++}}this.height_px=c.length*this.vertical_gap+15;this.content_div.css("height",this.height_px+"px")},draw_tile:function(u,z,l,p,n){if(!this.values){return null}if(p>this.show_labels_scale&&!this.showing_labels){this.showing_labels=true;if(!this.zi_slots){this.calc_slots(true)}this.slots=this.zi_slots}else{if(p<=this.show_labels_scale&&this.showing_labels){this.showing_labels=false;t his.slots=this.zo_slots}}var A=z*DENSITY*u,c=(z+1)*DENSITY*u,b=DENSITY*u;var s=Math.ceil(b*p),r=this.height_px,q=$("<canvas class='tile'></canvas>");q.css({position:"absolute",top:0,left:(A-this.view.low)*p});q.get(0).width=s;q.get(0).height=r;var t=q.get(0).getContext("2d");t.fillStyle="#000";t.font="10px monospace";t.textAlign="right";var w=0;for(var x=0,y=this.values.length;x<y;x++){var h=this.values[x];if(h.start<=c&&h.end>=A){var f=Math.floor(Math.max(0,(h.start-A)*p)),g=Math.ceil(Math.min(s,(h.end-A)*p)),e=this.slots[h.name]*this.vertical_gap;t.fillRect(f,e+5,g-f,1);if(this.showing_labels&&t.fillText){t.fillText(h.name,f,e+8)}var d,E;if(h.exon_start&&h.exon_end){d=Math.floor(Math.max(0,(h.exon_start-A)*p));E=Math.ceil(Math.min(s,(h.exon_end-A)*p));t.fillRect(d,e+4,E-d,3)}if(h.blocks){for(var v=0,C=h.blocks.length;v<C;v++){var o=h.blocks[v],m=Math.floor(Math.max(0,(o[0]-A)*p)),B=Math.ceil(Math.min(s,(o[1]-A)*p));var a=3,D=4;if(d&&m>=d&&B<=E){a=5;D=3}t.fillRect(m,e+D,B-m ,a)}}w++}}l.append(q);return q}}); \ No newline at end of file diff -r ebc1c19fc2d5 -r e11e89fd2c82 static/scripts/trackster.js --- a/static/scripts/trackster.js Mon Oct 12 16:14:54 2009 -0400 +++ b/static/scripts/trackster.js Mon Oct 12 19:00:39 2009 -0400 @@ -4,7 +4,9 @@ var DENSITY = 1000, DATA_ERROR = "There was an error in indexing this dataset.", - DATA_NONE = "No data for this chrom/contig."; + DATA_NONE = "No data for this chrom/contig.", + CACHED_TILES = 200, + CACHED_DATA = 20; var View = function( chrom, max_length ) { this.chrom = chrom; @@ -29,7 +31,7 @@ }).show(); $("#low").text( this.low ); $("#high").text( this.high ); - for ( var i in this.tracks ) { + for ( var i = 0, len = this.tracks.length; i < len; i++ ) { this.tracks[i].draw(); } $("#bottom-spacer").remove(); @@ -40,18 +42,19 @@ this.high = Math.min( this.length, Math.ceil( new_high ) ); }, zoom_in: function ( factor, point ) { - if (this.max_high == 0) return; + if (this.max_high === 0) { + return; + } var range = this.high - this.low; var diff = range / factor / 2; + var center; - if (point == undefined) { - var center = ( this.low + this.high ) / 2; + if (point === undefined) { + center = ( this.low + this.high ) / 2; } else { - // console.log(100*point/$(document).width()); - var center = this.low + range * point / $(document).width(); + center = this.low + range * point / $(document).width(); } - // console.log(center); this.low = Math.floor( center - diff ); this.high = Math.ceil( center + diff ); if (this.low < this.max_low) { @@ -67,7 +70,9 @@ } }, zoom_out: function ( factor ) { - if (this.max_high == 0) return; + if (this.max_high === 0) { + return; + } var center = ( this.low + this.high ) / 2; var range = this.high - this.low; var diff = range * factor / 2; @@ -105,7 +110,7 @@ }; $.extend( Track.prototype, { make_container: function () { - this.header_div = $("<div class='track-header'>").text( this.name );; + this.header_div = $("<div class='track-header'>").text( this.name ); this.content_div = $("<div class='track-content'>"); this.container_div = $("<div class='track'></div>").append( this.header_div ).append( this.content_div ); this.parent_element.append( this.container_div ); @@ -113,9 +118,7 @@ }); var TiledTrack = function() { - this.last_resolution = null; - this.last_w_scale = null; - this.tile_cache = {}; + this.tile_cache = new Cache(CACHED_TILES); }; $.extend( TiledTrack.prototype, Track.prototype, { draw: function() { @@ -133,23 +136,17 @@ var w = this.content_div.width(), h = this.content_div.height(), - w_scale = w / range, - old_tiles = {}, - new_tiles = {}; - - // If resolution and scale are unchanged, try to reuse tiles - if ( this.last_resolution == resolution && this.last_w_scale == w_scale ) { - old_tiles = this.tile_cache; - } + w_scale = w / range; var tile_element; // Index of first tile that overlaps visible region var tile_index = Math.floor( low / resolution / DENSITY ); - while ( ( tile_index * 1000 * resolution ) < high ) { + while ( ( tile_index * DENSITY * resolution ) < high ) { // Check in cache - if ( tile_index in old_tiles ) { - // console.log( "tile from cache" ); - tile_element = old_tiles[tile_index]; + var key = w_scale + "_" + tile_index; + if ( this.tile_cache[key] ) { + // console.log("cached tile"); + tile_element = this.tile_cache[key]; var tile_low = tile_index * DENSITY * resolution; tile_element.css( { left: ( tile_low - this.view.low ) * w_scale @@ -160,14 +157,10 @@ tile_element = this.draw_tile( resolution, tile_index, parent_element, w_scale, h ); } if ( tile_element ) { - // console.log( typeof(tile_element) ); - new_tiles[tile_index] = tile_element; + this.tile_cache[key] = tile_element; } tile_index += 1; } - this.last_resolution = resolution; - this.last_w_scale = w_scale; - this.tile_cache = new_tiles; } }); @@ -199,70 +192,67 @@ var LineTrack = function ( name, dataset_id, height ) { Track.call( this, name, $("#viewport") ); + TiledTrack.call( this ); this.track_type = "line"; this.height_px = (height ? height : 100); this.container_div.addClass( "line-track" ); - this.content_div.css( "height", this.height_px + "px" ); this.dataset_id = dataset_id; - this.cache = new Cache(50); + this.cache = new Cache(CACHED_DATA); // We need to cache some data because of + // asynchronous calls }; $.extend( LineTrack.prototype, TiledTrack.prototype, { init: function() { var track = this; - $.getJSON( data_url, { stats: true, track_type: track.track_type, chrom: track.view.chrom, - low: null, high: null, dataset_id: track.dataset_id }, function ( data ) { + $.getJSON( data_url, { stats: true, track_type: track.track_type, + chrom: track.view.chrom, low: null, high: null, + dataset_id: track.dataset_id }, function ( data ) { if (!data || data == "error") { track.content_div.addClass("error").text(DATA_ERROR); } else if (data == "no data") { - // console.log(track.content_div); track.content_div.addClass("nodata").text(DATA_NONE); } else { - track.min_value = data['min']; - track.max_value = data['max']; + track.content_div.css( "height", track.height_px + "px" ); + track.min_value = data.min; + track.max_value = data.max; track.vertical_range = track.max_value - track.min_value; track.view.redraw(); } }); }, get_data: function( resolution, position ) { - var key = resolution + '-' + position, - cache = this.cache; - - if ( !cache[key] ) { - var low = position * DENSITY * resolution, - high = ( position + 1 ) * DENSITY * resolution; - - $.getJSON( data_url, { track_type: this.track_type, chrom: this.view.chrom, low: low, high: high, dataset_id: this.dataset_id }, function ( data ) { - cache[key] = data; - $(document).trigger( "redraw" ); - }); - } - return cache[key]; + var track = this, + low = position * DENSITY * resolution, + high = ( position + 1 ) * DENSITY * resolution, + key = resolution + "_" + position; + + $.getJSON( data_url, { track_type: this.track_type, chrom: this.view.chrom, low: low, high: high, dataset_id: this.dataset_id }, function ( data ) { + track.cache[key] = data; + $(document).trigger( "redraw" ); + }); }, draw_tile: function( resolution, tile_index, parent_element, w_scale, h_scale ) { - if (!this.vertical_range) // We don't have the necessary information yet + if (!this.vertical_range) { // We don't have the necessary information yet return; - + } + var tile_low = tile_index * DENSITY * resolution, - tile_high = ( tile_index + 1 ) * DENSITY * resolution, - tile_length = DENSITY * resolution; - var data = this.get_data( resolution, tile_index ); - if ( !data ) { - in_path = false; - return null; + tile_length = DENSITY * resolution, + canvas = $("<canvas class='tile'></canvas>"), + key = resolution + "_" + tile_index; + + if (!this.cache[key]) { + this.get_data( resolution, tile_index ); + return; } - var element = $("<canvas class='tile'></canvas>"); - - element.css( { + + var data = this.cache[key]; + canvas.css( { position: "absolute", top: 0, - left: ( tile_low - this.view.low ) * w_scale, + left: ( tile_low - this.view.low ) * w_scale }); - parent_element.append( element ); - // Chunk is still loading, do nothing - - var canvas = element; + canvas.get(0).width = Math.ceil( tile_length * w_scale ); canvas.get(0).height = this.height_px; var ctx = canvas.get(0).getContext("2d"); @@ -277,8 +267,7 @@ } else { // Translate x = x * w_scale; - y_above_min = y - this.min_value; - y = y_above_min / this.vertical_range * this.height_px; + y = (y - this.min_value) / this.vertical_range * this.height_px; if ( in_path ) { ctx.lineTo( x, y ); } else { @@ -288,44 +277,69 @@ } } ctx.stroke(); - return element; + parent_element.append( canvas ); + return canvas; } }); var FeatureTrack = function ( name, dataset_id, height ) { Track.call( this, name, $("#viewport") ); + TiledTrack.call( this ); + this.track_type = "feature"; this.height_px = (height ? height : 100); this.container_div.addClass( "feature-track" ); - this.content_div.css( "height", this.height_px + "px" ); this.dataset_id = dataset_id; this.zo_slots = {}; - this.show_labels_scale = 0.01; + this.show_labels_scale = 0.001; this.showing_labels = false; this.vertical_gap = 10; }; $.extend( FeatureTrack.prototype, TiledTrack.prototype, { + init: function() { + var track = this; + $.getJSON( data_url, { track_type: track.track_type, low: track.view.max_low, + high: track.view.max_high, dataset_id: track.dataset_id, + chrom: track.view.chrom }, function ( data ) { + if (data == "error") { + track.content_div.addClass("error").text(DATA_ERROR); + } else if (data.length === 0 || data == "no data") { + track.content_div.addClass("nodata").text(DATA_NONE); + } else { + track.content_div.css( "height", track.height_px + "px" ); + track.values = data; + track.calc_slots(); + track.slots = track.zo_slots; + track.draw(); + } + }); + }, calc_slots: function( include_labels ) { // console.log("num vals: " + this.values.length); - var end_ary = []; - var scale = this.container_div.width() / (this.view.high - this.view.low); + var end_ary = [], + scale = this.container_div.width() / (this.view.high - this.view.low), + labels_scale = this.show_labels_scale, + max_high = this.view.max_high, + max_low = this.view.max_low; // console.log(scale, this.view.high, this.view.low); - if (include_labels) this.zi_slots = {}; + if (include_labels) { + this.zi_slots = {}; + } var dummy_canvas = $("<canvas></canvas>").get(0).getContext("2d"); - for (var i in this.values) { - - var feature = this.values[i]; - var f_start = Math.floor( Math.max(this.view.max_low, (feature.start - this.view.max_low) * scale) ); + for (var i = 0, len = this.values.length; i < len; i++) { + var f_start, f_end, feature = this.values[i]; if (include_labels) { + f_start = Math.floor( Math.max(max_low, (feature.start - max_low) * labels_scale) ); f_start -= dummy_canvas.measureText(feature.name).width; - f_start -= 10; // Spacing between text and line + f_end = Math.ceil( Math.min(max_high, (feature.end - max_low) * labels_scale) ); + } else { + f_start = Math.floor( Math.max(max_low, (feature.start - max_low) * scale) ); + f_end = Math.ceil( Math.min(max_high, (feature.end - max_low) * scale) ); } - - var f_end = Math.ceil( Math.min(this.view.max_high, (feature.end - this.view.max_low) * scale) ); // if (include_labels) { console.log(f_start, f_end); } var j = 0; while (true) { - if (end_ary[j] == undefined || end_ary[j] < f_start) { + if (end_ary[j] === undefined || end_ary[j] < f_start) { end_ary[j] = f_end; if (include_labels) { this.zi_slots[feature.name] = j; @@ -340,33 +354,16 @@ this.height_px = end_ary.length * this.vertical_gap + 15; this.content_div.css( "height", this.height_px + "px" ); }, - - init: function() { - var track = this; - $.getJSON( data_url, { track_type: track.track_type, low: track.view.max_low, high: track.view.max_high, - dataset_id: track.dataset_id, chrom: track.view.chrom }, function ( data ) { - if (data == "error") { - track.content_div.addClass("error").text(DATA_ERROR); - } else if (data.length == 0 || data == "no data") { - // console.log(track.content_div); - track.content_div.addClass("nodata").text(DATA_NONE); - } else { - track.values = data; - track.calc_slots(); - track.slots = track.zo_slots; - // console.log(track.zo_slots); - track.draw(); - } - }); - }, - draw_tile: function( resolution, tile_index, parent_element, w_scale, h_scale ) { - if (!this.values) // Still loading + if (!this.values) { // Still loading return null; - + } + // Once we zoom in enough, show name labels if (w_scale > this.show_labels_scale && !this.showing_labels) { this.showing_labels = true; - if (!this.zi_slots) this.calc_slots(true); // Once we zoom in enough, show name labels + if (!this.zi_slots) { + this.calc_slots(true); + } this.slots = this.zi_slots; } else if (w_scale <= this.show_labels_scale && this.showing_labels) { this.showing_labels = false; @@ -378,63 +375,64 @@ tile_high = ( tile_index + 1 ) * DENSITY * resolution, tile_length = DENSITY * resolution; // console.log(tile_low, tile_high, tile_length, w_scale); - var view = this.view, - range = view.high - view.low, - width = Math.ceil( tile_length * w_scale ), - slots = new Array(), + var width = Math.ceil( tile_length * w_scale ), height = this.height_px, new_canvas = $("<canvas class='tile'></canvas>"); new_canvas.css({ position: "absolute", top: 0, - left: ( tile_low - this.view.low ) * w_scale, + left: ( tile_low - this.view.low ) * w_scale }); new_canvas.get(0).width = width; new_canvas.get(0).height = height; // console.log(( tile_low - this.view.low ) * w_scale, tile_index, w_scale); var ctx = new_canvas.get(0).getContext("2d"); + ctx.fillStyle = "#000"; + ctx.font = "10px monospace"; + ctx.textAlign = "right"; var j = 0; - for (var i in this.values) { - feature = this.values[i]; + for (var i = 0, len = this.values.length; i < len; i++) { + var feature = this.values[i]; if (feature.start <= tile_high && feature.end >= tile_low) { - f_start = Math.floor( Math.max(0, (feature.start - tile_low) * w_scale) ); - f_end = Math.ceil( Math.min(width, (feature.end - tile_low) * w_scale) ); + var f_start = Math.floor( Math.max(0, (feature.start - tile_low) * w_scale) ), + f_end = Math.ceil( Math.min(width, (feature.end - tile_low) * w_scale) ), + y_center = this.slots[feature.name] * this.vertical_gap; + // console.log(feature.start, feature.end, f_start, f_end, j); - ctx.fillStyle = "#000"; - ctx.fillRect(f_start, this.slots[feature.name] * this.vertical_gap + 5, f_end - f_start, 1); + ctx.fillRect(f_start, y_center + 5, f_end - f_start, 1); if (this.showing_labels && ctx.fillText) { - ctx.font = "10px monospace"; - ctx.textAlign = "right"; - ctx.fillText(feature.name, f_start, this.slots[feature.name] * 10 + 8); + ctx.fillText(feature.name, f_start, y_center + 8); } + var exon_start, exon_end; if (feature.exon_start && feature.exon_end) { - var exon_start = Math.floor( Math.max(0, (feature.exon_start - tile_low) * w_scale) ); - var exon_end = Math.ceil( Math.min(width, (feature.exon_end - tile_low) * w_scale) ); - // ctx.fillRect(exon_start, j * 10 + 3, exon_end - exon_start, 5); - // ctx.fillRect(exon_start, this.slots[feature.name] * 10 + 3, exon_end - exon_start, 3); + exon_start = Math.floor( Math.max(0, (feature.exon_start - tile_low) * w_scale) ); + exon_end = Math.ceil( Math.min(width, (feature.exon_end - tile_low) * w_scale) ); + ctx.fillRect(exon_start, y_center + 4, exon_end - exon_start, 3); } - for (var i in feature.blocks) { - block = feature.blocks[i]; - block_start = Math.floor( Math.max(0, (block[0] - tile_low) * w_scale) ); - block_end = Math.ceil( Math.min(width, (block[1] - tile_low) * w_scale) ); - var thickness = 3, y_start = 4; - if (exon_start && block_start >= exon_start && block_end <= exon_end) { - thickness = 5, y_start = 3; - } - ctx.fillRect(exon_start, this.slots[feature.name] * this.vertical_gap + y_start, block_end - block_start, thickness); - // console.log(block_start, block_end); + if (feature.blocks) { + for (var k = 0, k_len = feature.blocks.length; k < k_len; k++) { + var block = feature.blocks[k], + block_start = Math.floor( Math.max(0, (block[0] - tile_low) * w_scale) ), + block_end = Math.ceil( Math.min(width, (block[1] - tile_low) * w_scale) ); + var thickness = 3, y_start = 4; + if (exon_start && block_start >= exon_start && block_end <= exon_end) { + thickness = 5; + y_start = 3; + } + ctx.fillRect(block_start, y_center + y_start, block_end - block_start, thickness); + // console.log(block_start, block_end); + } } - j++; } } parent_element.append( new_canvas ); return new_canvas; - }, + } }); diff -r ebc1c19fc2d5 -r e11e89fd2c82 static/trackster.css --- a/static/trackster.css Mon Oct 12 16:14:54 2009 -0400 +++ b/static/trackster.css Mon Oct 12 19:00:39 2009 -0400 @@ -85,13 +85,15 @@ .track-content.error { text-align: center; - padding-top: 30px; + padding-top: 10px; background-color: #ECB4AF; + height: 30px; } .track-content.nodata { text-align: center; - padding-top: 30px; + padding-top: 10px; background-color: #ddd; + height: 30px; } .loading { @@ -102,15 +104,3 @@ border-left: solid gray 1px; padding-left: 2px; } - -.feature-track .feature { - -} - -.feature-track .feature .forward { - -} - -.feature-track .feature .reverse { - -} \ No newline at end of file

1 0

[hg] galaxy 2870: symlinks are not very useful
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/1a0bb7d6897c changeset: 2870:1a0bb7d6897c user: Ross Lazarus <ross.lazarus(a)gmail.com> date: Sun Oct 11 15:07:11 2009 -0400 description: symlinks are not very useful 6 file(s) affected in this change: lib/galaxy/datatypes/converters/lped_to_fped_converter.py lib/galaxy/datatypes/converters/lped_to_fped_converter.xml lib/galaxy/datatypes/converters/lped_to_pbed_converter.py lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml lib/galaxy/datatypes/converters/pbed_to_lped_converter.py lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml diffs (383 lines): diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/lped_to_fped_converter.py --- a/lib/galaxy/datatypes/converters/lped_to_fped_converter.py Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/lped_to_fped_converter.py Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,110 @@ -/opt/galaxy/tools/rgenetics/converters/lped_to_fped_converter.py \ No newline at end of file +# for rgenetics - lped to fbat +# recode to numeric fbat version +# much slower so best to always +# use numeric alleles internally + +import sys,os,time + + +prog = os.path.split(sys.argv[0])[-1] +myversion = 'Oct 10 2009' + +galhtmlprefix = """<?xml version="1.0" encoding="utf-8" ?> +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> +<head> +<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> +<meta name="generator" content="Galaxy %s tool output - see http://g2.trac.bx.psu.edu/" /> +<title></title> +<link rel="stylesheet" href="/static/style/base.css" type="text/css" /> +</head> +<body> +<div class="document"> +""" + +def timenow(): + """return current time as a string + """ + return time.strftime('%d/%m/%Y %H:%M:%S', time.localtime(time.time())) + + +def rgConv(inpedfilepath,outhtmlname,outfilepath): + """convert linkage ped/map to fbat""" + recode={'A':'1','C':'2','G':'3','T':'4','N':'0','0':'0','1':'1','2':'2','3':'3','4':'4'} + basename = os.path.split(inpedfilepath)[-1] # get basename + inmap = '%s.map' % inpedfilepath + inped = '%s.ped' % inpedfilepath + outf = '%s.ped' % basename # note the fbat exe insists that this is the extension for the ped data + outfpath = os.path.join(outfilepath,outf) # where to write the fbat format file to + try: + mf = file(inmap,'r') + except: + sys.stderr.write('%s cannot open inmap file %s - do you have permission?\n' % (prog,inmap)) + sys.exit(1) + try: + rsl = [x.split()[1] for x in mf] + except: + sys.stderr.write('## cannot parse %s' % inmap) + sys.exit(1) + try: + os.makedirs(outfilepath) + except: + pass # already exists + head = ' '.join(rsl) # list of rs numbers + # TODO add anno to rs but fbat will prolly barf? + pedf = file(inped,'r') + o = file(outfpath,'w',2**20) + o.write(head) + o.write('\n') + for i,row in enumerate(pedf): + if i == 0: + lrow = row.split() + try: + x = [int(x) for x in lrow[10:50]] # look for non numeric codes + except: + dorecode = 1 + if dorecode: + lrow = row.strip().split() + p = lrow[:6] + g = lrow[6:] + gc = [recode.get(x,'0') for x in g] + lrow = p+gc + row = '%s\n' % ' '.join(lrow) + o.write(row) + o.close() + + +def main(): + """call fbater + need to work with rgenetics composite datatypes + so in and out are html files with data in extrafiles path + <command interpreter="python">rg_convert_lped_fped.py '$input1/$input1.metadata.base_name' + '$output1' '$output1.extra_files_path' + </command> + """ + nparm = 3 + if len(sys.argv) < nparm: + sys.stderr.write('## %s called with %s - needs %d parameters \n' % (prog,sys.argv,nparm)) + sys.exit(1) + inpedfilepath = sys.argv[1] + outhtmlname = sys.argv[2] + outfilepath = sys.argv[3] + try: + os.makedirs(outfilepath) + except: + pass + rgConv(inpedfilepath,outhtmlname,outfilepath) + f = file(outhtmlname,'w') + f.write(galhtmlprefix % prog) + flist = os.listdir(outfilepath) + print '## Rgenetics: http://rgenetics.org Galaxy Tools %s %s' % (prog,timenow()) # becomes info + f.write('<div>## Rgenetics: http://rgenetics.org Galaxy Tools %s %s\n<ol>' % (prog,timenow())) + for i, data in enumerate( flist ): + f.write('<li><a href="%s">%s</a></li>\n' % (os.path.split(data)[-1],os.path.split(data)[-1])) + f.write("</div></body></html>") + f.close() + + + +if __name__ == "__main__": + main() diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/lped_to_fped_converter.xml --- a/lib/galaxy/datatypes/converters/lped_to_fped_converter.xml Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/lped_to_fped_converter.xml Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,15 @@ -/opt/galaxy/tools/rgenetics/converters/lped_to_fped_converter.xml \ No newline at end of file +<tool id="lped2fpedconvert" name="Convert lped to fped" version="0.01"> +  +  + <command interpreter="python"> + lped_to_fped_converter.py '$input1.extra_files_path/$input1.metadata.base_name' '$output1' '$output1.extra_files_path' + </command> + <inputs> + <param format="lped" name="input1" type="data" label="Choose linkage pedigree file"/> + </inputs> + <outputs> + <data format="fped" name="output1" metadata_source="input1"/> + </outputs> + <help> + </help> +</tool> diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/lped_to_pbed_converter.py --- a/lib/galaxy/datatypes/converters/lped_to_pbed_converter.py Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/lped_to_pbed_converter.py Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,110 @@ -/opt/galaxy/tools/rgenetics/converters/lped_to_pbed_converter.py \ No newline at end of file +# for rgenetics - lped to pbed +# where to stop with converters +# pbed might be central +# eg lped/eigen/fbat/snpmatrix all to pbed +# and pbed to lped/eigen/fbat/snpmatrix ? +# that's a lot of converters +import sys,os,time,subprocess + + +prog = os.path.split(sys.argv[0])[-1] +myversion = 'Oct 10 2009' + +galhtmlprefix = """<?xml version="1.0" encoding="utf-8" ?> +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> +<head> +<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> +<meta name="generator" content="Galaxy %s tool output - see http://g2.trac.bx.psu.edu/" /> +<title></title> +<link rel="stylesheet" href="/static/style/base.css" type="text/css" /> +</head> +<body> +<div class="document"> +""" + +def timenow(): + """return current time as a string + """ + return time.strftime('%d/%m/%Y %H:%M:%S', time.localtime(time.time())) + +def getMissval(inped=''): + """ + read some lines...ugly hack - try to guess missing value + should be N or 0 but might be . or - + """ + commonmissvals = {'N':'N','0':'0','n':'n','9':'9','-':'-','.':'.'} + try: + f = file(inped,'r') + except: + return None # signal no in file + missval = None + while missval == None: # doggedly continue until we solve the mystery + try: + l = f.readline() + except: + break + ll = l.split()[6:] # ignore pedigree stuff + for c in ll: + if commonmissvals.get(c,None): + missval = c + f.close() + return missval + if not missval: + missval = 'N' # punt + close(f) + return missval + +def rgConv(inpedfilepath,outhtmlname,outfilepath,plink): + """ + """ + pedf = '%s.ped' % inpedfilepath + basename = os.path.split(inpedfilepath)[-1] # get basename + outroot = os.path.join(outfilepath,basename) + missval = getMissval(inped = pedf) + if not missval: + print '### lped_to_pbed_converter.py cannot identify missing value in %s' % pedf + missval = '0' + cl = '%s --noweb --file %s --make-bed --out %s --missing-genotype %s' % (plink,inpedfilepath,outroot,missval) + p = subprocess.Popen(cl,shell=True,cwd=outfilepath) + retval = p.wait() # run plink + + + + +def main(): + """ + need to work with rgenetics composite datatypes + so in and out are html files with data in extrafiles path + <command interpreter="python">lped_to_pbed_converter.py '$input1/$input1.metadata.base_name' + '$output1' '$output1.extra_files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + </command> + """ + nparm = 4 + if len(sys.argv) < nparm: + sys.stderr.write('## %s called with %s - needs %d parameters \n' % (prog,sys.argv,nparm)) + sys.exit(1) + inpedfilepath = sys.argv[1] + outhtmlname = sys.argv[2] + outfilepath = sys.argv[3] + try: + os.makedirs(outfilepath) + except: + pass + plink = sys.argv[4] + rgConv(inpedfilepath,outhtmlname,outfilepath,plink) + f = file(outhtmlname,'w') + f.write(galhtmlprefix % prog) + flist = os.listdir(outfilepath) + s = '## Rgenetics: http://rgenetics.org Galaxy Tools %s %s' % (prog,timenow()) # becomes info + print s + f.write('<div>%s\n<ol>' % (s)) + for i, data in enumerate( flist ): + f.write('<li><a href="%s">%s</a></li>\n' % (os.path.split(data)[-1],os.path.split(data)[-1])) + f.write("</div></body></html>") + f.close() + + + +if __name__ == "__main__": + main() diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml --- a/lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,16 @@ -/opt/galaxy/tools/rgenetics/converters/lped_to_pbed_converter.xml \ No newline at end of file +<tool id="lped2pbedconvert" name="Convert lped to plink pbed" version="0.01"> +  +  + <command interpreter="python"> + lped_to_pbed_converter.py '$input1.extra_files_path/$input1.metadata.base_name' + '$output1' '$output1.extra_files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + </command> + <inputs> + <param format="lped" name="input1" type="data" label="Choose linkage pedigree file"/> + </inputs> + <outputs> + <data format="pbed" name="output1" metadata_source="input1"/> + </outputs> + <help> + </help> +</tool> diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/pbed_to_lped_converter.py --- a/lib/galaxy/datatypes/converters/pbed_to_lped_converter.py Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/pbed_to_lped_converter.py Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,80 @@ -/opt/galaxy/tools/rgenetics/converters/pbed_to_lped_converter.py \ No newline at end of file +# for rgenetics - lped to pbed +# where to stop with converters +# pbed might be central +# eg lped/eigen/fbat/snpmatrix all to pbed +# and pbed to lped/eigen/fbat/snpmatrix ? +# that's a lot of converters +import sys,os,time,subprocess + + +prog = os.path.split(sys.argv[0])[-1] +myversion = 'Oct 10 2009' + +galhtmlprefix = """<?xml version="1.0" encoding="utf-8" ?> +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> +<head> +<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> +<meta name="generator" content="Galaxy %s tool output - see http://g2.trac.bx.psu.edu/" /> +<title></title> +<link rel="stylesheet" href="/static/style/base.css" type="text/css" /> +</head> +<body> +<div class="document"> +""" + +def timenow(): + """return current time as a string + """ + return time.strftime('%d/%m/%Y %H:%M:%S', time.localtime(time.time())) + + +def rgConv(inpedfilepath,outhtmlname,outfilepath,plink): + """ + """ + + basename = os.path.split(inpedfilepath)[-1] # get basename + outroot = os.path.join(outfilepath,basename) + cl = '%s --noweb --bfile %s --recode --out %s ' % (plink,inpedfilepath,outroot) + p = subprocess.Popen(cl,shell=True,cwd=outfilepath) + retval = p.wait() # run plink + + + + +def main(): + """ + need to work with rgenetics composite datatypes + so in and out are html files with data in extrafiles path + <command interpreter="python">pbed_to_lped_converter.py '$input1/$input1.metadata.base_name' + '$output1' '$output1.extra_files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + </command> + """ + nparm = 4 + if len(sys.argv) < nparm: + sys.stderr.write('## %s called with %s - needs %d parameters \n' % (myname,sys.argv,nparm)) + sys.exit(1) + inpedfilepath = sys.argv[1] + outhtmlname = sys.argv[2] + outfilepath = sys.argv[3] + try: + os.makedirs(outfilepath) + except: + pass + plink = sys.argv[4] + rgConv(inpedfilepath,outhtmlname,outfilepath,plink) + f = file(outhtmlname,'w') + f.write(galhtmlprefix % prog) + flist = os.listdir(outfilepath) + s = '## Rgenetics: http://rgenetics.org Galaxy Tools %s %s' % (prog,timenow()) # becomes info + print s + f.write('<div>%s\n<ol>' % (s)) + for i, data in enumerate( flist ): + f.write('<li><a href="%s">%s</a></li>\n' % (os.path.split(data)[-1],os.path.split(data)[-1])) + f.write("</div></body></html>") + f.close() + + + +if __name__ == "__main__": + main() diff -r 639c6b5e0073 -r 1a0bb7d6897c lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml --- a/lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml Sun Oct 11 15:00:40 2009 -0400 +++ b/lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml Sun Oct 11 15:07:11 2009 -0400 @@ -1,1 +1,16 @@ -/opt/galaxy/tools/rgenetics/converters/pbed_to_lped_converter.xml \ No newline at end of file +<tool id="pbed2lpedconvert" name="Convert plink pbed to linkage lped" version="0.01"> +  +  + <command interpreter="python"> + pbed_to_lped_converter.py '$input1.extra_files_path/$input1.metadata.base_name' + '$output1' '$output1.extra_files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + </command> + <inputs> + <param format="pbed" name="input1" type="data" label="Choose compressed Plink binary format genotype file"/> + </inputs> + <outputs> + <data format="lped" name="output1" metadata_source="input1"/> + </outputs> + <help> + </help> +</tool>

1 0

[hg] galaxy 2871: Removing another not very useful symlink
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/75a488a0cbc9 changeset: 2871:75a488a0cbc9 user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Oct 12 12:48:37 2009 -0400 description: Removing another not very useful symlink 1 file(s) affected in this change: lib/galaxy/datatypes/genetics.py diffs (6 lines): diff -r 1a0bb7d6897c -r 75a488a0cbc9 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Sun Oct 11 15:07:11 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Mon Oct 12 12:48:37 2009 -0400 @@ -1,1 +0,0 @@ -/opt/galaxy/tools/rgenetics/genetics.py \ No newline at end of file

1 0

[hg] galaxy 2872: real replacement for stoopid symlink
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/9d67ae5ecda7 changeset: 2872:9d67ae5ecda7 user: Ross Lazarus <ross.lazarus(a)gmail.com> date: Mon Oct 12 13:19:31 2009 -0400 description: real replacement for stoopid symlink 1 file(s) affected in this change: lib/galaxy/datatypes/genetics.py diffs (671 lines): diff -r 75a488a0cbc9 -r 9d67ae5ecda7 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Mon Oct 12 12:48:37 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Mon Oct 12 13:19:31 2009 -0400 @@ -0,0 +1,667 @@ +""" +rgenetics datatypes +Use at your peril +Ross Lazarus +for the rgenetics and galaxy projects + +genome graphs datatypes derived from Interval datatypes +genome graphs datasets have a header row with appropriate columnames +The first column is always the marker - eg columname = rs, first row= rs12345 if the rows are snps +subsequent row values are all numeric ! Will fail if any non numeric (eg '+' or 'NA') values +ross lazarus for rgenetics +august 20 2007 +""" + +import logging, os, sys, time, tempfile, shutil, string, glob +import data +from galaxy import util +from cgi import escape +import urllib +from galaxy.web import url_for +from galaxy.datatypes import metadata +from galaxy.datatypes.metadata import MetadataElement +from galaxy.datatypes.data import Text +from galaxy.datatypes.tabular import Tabular +from galaxy.datatypes.images import Html + +gal_Log = logging.getLogger(__name__) + +class GenomeGraphs( Tabular ): + """Tab delimited data containing a marker id and any number of numeric values""" + + """Add metadata elements""" + MetadataElement( name="markerCol", default=1, desc="Marker ID column", param=metadata.ColumnParameter ) + MetadataElement( name="columns", default=3, desc="Number of columns", readonly=True ) + MetadataElement( name="column_types", default=[], desc="Column types", readonly=True, visible=False ) + file_ext = 'gg' + + def __init__(self, **kwd): + """Initialize gg datatype, by adding UCSC display apps""" + Tabular.__init__(self, **kwd) + self.add_display_app ( 'ucsc', 'Genome Graph', 'as_ucsc_display_file', 'ucsc_links' ) + + def set_peek( self, dataset ): + """Set the peek and blurb text""" + if not dataset.dataset.purged: + dataset.peek = data.get_file_peek( dataset.file_name ) + dataset.blurb = util.commaify( str( data.get_line_count( dataset.file_name ) ) ) + " rows" + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def get_mime(self): + """Returns the mime type of the datatype""" + return 'application/vnd.msexcel' + + def get_estimated_display_viewport( self, dataset ): + """Return a chrom, start, stop tuple for viewing a file.""" + raise notImplemented + + def as_ucsc_display_file( self, dataset, **kwd ): + """Returns file""" + return file(dataset.file_name,'r') + + def ucsc_links( self, dataset, type, app, base_url ): + """ from the ever-helpful angie hinrichs angie(a)soe.ucsc.edu + a genome graphs call looks like this + http://genome.ucsc.edu/cgi-bin/hgGenome?clade=mammal&org=Human&db=hg18&hgGe… + &hgGenome_dataSetDescription=test&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess + &hgGenome_columnLabels=best%20guess&hgGenome_maxVal=&hgGenome_labelVals= + &hgGenome_maxGapToFill=25000000&hgGenome_uploadFile=http://galaxy.esphealth.org/datasets/333/display/index + &hgGenome_doSubmitUpload=submit + Galaxy gives this for an interval file + http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg18&position=chr1:1-1000&hgt.cu… + http%3A%2F%2Fgalaxy.esphealth.org%2Fdisplay_as%3Fid%3D339%26display_app%3Ducsc + """ + ret_val = [] + ggtail = '&hgGenome_doSubmitUpload=submit' + if not dataset.dbkey: + dataset.dbkey = 'hg18' # punt! + ret_val = [] + ggtail = '&hgGenome_doSubmitUpload=submit' + if not dataset.dbkey: + dataset.dbkey = 'hg18' # punt! + if dataset.has_data: + for site_name, site_url in util.get_ucsc_by_build(dataset.dbkey): + if site_name in app.config.ucsc_display_sites: + site_url = site_url.replace('/hgTracks?','/hgGenome?') # for genome graphs + display_url = urllib.quote_plus( "%s/display_as?id=%i&display_app=%s" % (base_url, dataset.id, type) ) + sl = ["%sdb=%s" % (site_url,dataset.dbkey ),] + sl.append("&hgGenome_dataSetName=%s&hgGenome_dataSetDescription=%s" % (dataset.name, 'GalaxyGG_data')) + sl.append("&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess") + sl.append("&hgGenome_columnLabels=first%20row&hgGenome_maxVal=&hgGenome_labelVals=") + sl.append("&hgGenome_maxGapToFill=25000000&hgGenome_uploadFile=") + s = urllib.quote_plus( ''.join(sl) ) + link = "%s%s%s" % (s, display_url, ggtail ) + ret_val.append( (site_name, link) ) + return ret_val + + + def validate( self, dataset ): + """Validate a gg file - all numeric after header row""" + errors = list() + infile = open(dataset.file_name, "r") + for i,row in enumerate(infile): #drop header + badvals = [] + if i > 0: + ll = row.strip().split('\t') + for j,x in enumerate(ll): + try: + x = float(x) + except: + badval.append('col%d:%s' % (j+1,x)) + if len(badvals) > 0: + errors.append('row %d, %s' % (' '.join(badvals))) + return errors + + def repair_methods( self, dataset ): + """Return options for removing errors along with a description""" + return [("lines","Remove erroneous lines")] + + def sniff(self,filename): + """ + """ + infile = open(dataset.file_name, "r") + header= infile.next() # header + badvals = [] + for i,row in enumerate(infile[:10]): # sample first 10 rows + ll = row.strip().split('\t') + for j,x in enumerate(ll[1:]): # ignore first identifier col + try: + x = float(x) + except: + badval.append('col%d:%s' % (j+1,x)) + if len(badvals) > 0: + return False + else: + return True + +class rgTabList(Tabular): + """ for sampleid and for featureid lists of exclusions or inclusions in the clean tool + featureid subsets on statistical criteria -> specialized display such as gg + """ + file_ext = "rgTList" + + + def __init__(self, **kwd): + """Initialize featurelistt datatype""" + Tabular.__init__( self, **kwd ) + self.column_names = [] + + def make_html_table( self, dataset, skipchars=[] ): + """Create HTML table, used for displaying peek""" + out = ['<table cellspacing="0" cellpadding="3">'] + comments = [] + try: + # Generate column header + out.append( '<tr>' ) + for i, name in enumerate( self.column_names ): + out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) ) + if dataset.metadata.columns - len( self.column_names ) > 0: + for i in range( len( self.column_names ), dataset.metadata.columns ): + out.append( '<th>%s</th>' % str( i+1 ) ) + out.append( '</tr>' ) + out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) ) + out.append( '</table>' ) + out = "".join( out ) + except Exception, exc: + out = "Can't create peek %s" % exc + return out + + +class rgSampleList(rgTabList): + """ for sampleid exclusions or inclusions in the clean tool + output from QC eg excess het, gender error, ibd pair member,eigen outlier,excess mendel errors,... + since they can be uploaded, should be flexible + but they are persistent at least + same infrastructure for expression? + """ + file_ext = "rgSList" + + def __init__(self, **kwd): + """Initialize samplelist datatype""" + rgTabList.__init__( self, **kwd ) + self.column_names[0] = 'FID' + self.column_names[1] = 'IID' + # this is what Plink wants as at 2009 + + def sniff(self,filename): + """ + """ + infile = open(dataset.file_name, "r") + header= infile.next() # header + if header[0] == 'FID' and header[1] == 'IID': + return True + else: + return False + +class rgFeatureList( rgTabList ): + """ for featureid lists of exclusions or inclusions in the clean tool + output from QC eg low maf, high missingness, bad hwe in controls, excess mendel errors,... + featureid subsets on statistical criteria -> specialized display such as gg + same infrastructure for expression? + """ + file_ext = "rgFList" + + def __init__(self, **kwd): + """Initialize featurelist datatype""" + rgTabList.__init__( self, **kwd ) + for i,s in enumerate(['#FeatureId', 'Chr', 'Genpos', 'Mappos']): + self.column_names[i] = s + + +class Rgenetics(Html): + """class to use for rgenetics""" + + MetadataElement( name="base_name", desc="base name for all transformed versions of this genetic dataset", default="rgenetics", + readonly=True, set_in_upload=True) + + composite_type = 'auto_primary_file' + allow_datatype_change = False + file_ext = 'rgenetics' + + + def missing_meta( self, dataset=None, **kwargs): + """Checks for empty meta values""" + for key, value in dataset.metadata.items(): + if not value: + return True + return False + + def generate_primary_file( self, dataset = None ): + rval = ['<html><head><title>Rgenetics Galaxy Composite Dataset </title></head><p/>'] + rval.append('<div>This composite dataset is composed of the following files:<p/><ul>') + for composite_name, composite_file in self.get_composite_files( dataset = dataset ).iteritems(): + opt_text = '' + if composite_file.optional: + opt_text = ' (optional)' + rval.append( '<li><a href="%s" type="application/binary">%s</a>%s' % ( composite_name, composite_name, opt_text ) ) + rval.append( '</ul></div></html>' ) + return "\n".join( rval ) + +class SNPMatrix(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="snpmatrix" + + def set_peek( self, dataset ): + if not dataset.dataset.purged: + dataset.peek = "Binary RGenetics file" + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def sniff(self,filename): + """ need to check the file header hex code + """ + infile = open(dataset.file_name, "b") + head = infile.read(16) + head = [hex(x) for x in head] + if head <> '': + return False + else: + return True + + +class Lped(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="lped" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.ped', description = 'Pedigree File', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.map', description = 'Map File', substitute_name_with_metadata = 'base_name', is_binary = True ) + + +class Pphe(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="pphe" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.pphe', description = 'Plink Phenotype File', substitute_name_with_metadata = 'base_name' ) + + +class Lmap(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="lmap" + +class Fphe(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="fphe" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.fphe', description = 'FBAT Phenotype File', substitute_name_with_metadata = 'base_name' ) + +class Phe(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="phe" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.phe', description = 'Phenotype File', substitute_name_with_metadata = 'base_name' ) + + + +class Fped(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="fped" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.fped', description = 'FBAT format pedfile', substitute_name_with_metadata = 'base_name' ) + + +class Pbed(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="pbed" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.bim', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.bed', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.fam', substitute_name_with_metadata = 'base_name', is_binary = True ) + +class Eigenstratgeno(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="eigenstratgeno" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.eigenstratgeno', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.ind', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name', is_binary = True ) + + + +class Eigenstratpca(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="eigenstratpca" + + def __init__( self, **kwd ): + Rgenetics.__init__(self, **kwd) + self.add_composite_file( '%s.eigenstratpca', description = 'Eigenstrat PCA file', substitute_name_with_metadata = 'base_name' ) + + +class Snptest(Rgenetics): + """fake class to distinguish different species of Rgenetics data collections + """ + file_ext="snptest" + + +class Pheno(Tabular): + """ + base class for pheno files + """ + file_ext = 'pheno' + + +class RexpBase( Html ): + """base class for BioC data structures in Galaxy + must be constructed with the pheno data in place since that + goes into the metadata for each instance + """ + MetadataElement( name="columns", default=0, desc="Number of columns", visible=True ) + MetadataElement( name="column_names", default=[], desc="Column names", visible=True ) + MetadataElement(name="pheCols",default=[],desc="Select list for potentially interesting variables",visible=True) + MetadataElement( name="base_name", + desc="base name for all transformed versions of this expression dataset", default='rexpression', set_in_upload=True) + MetadataElement( name="pheno_path", desc="Path to phenotype data for this experiment", default="rexpression.pheno", visible=True) + file_ext = 'rexpbase' + html_table = None + is_binary = True + composite_type = 'auto_primary_file' + allow_datatype_change = False + + + def __init__( self, **kwd ): + Html.__init__(self,**kwd) + self.add_composite_file( '%s.pheno', description = 'Phenodata tab text file', + substitute_name_with_metadata = 'base_name', is_binary=True) + + def generate_primary_file( self, dataset = None ): + """ This is called only at upload to write the html file + cannot rename the datasets here - they come with the default unfortunately + """ + return '<html><head></head><body>AutoGenerated Primary File for Composite Dataset</body></html>' + + def get_phecols(self, phenolist=[], maxConc=20): + """ + sept 2009: cannot use whitespace to split - make a more complex structure here + and adjust the methods that rely on this structure + return interesting phenotype column names for an rexpression eset or affybatch + to use in array subsetting and so on. Returns a data structure for a + dynamic Galaxy select parameter. + A column with only 1 value doesn't change, so is not interesting for + analysis. A column with a different value in every row is equivalent to a unique + identifier so is also not interesting for anova or limma analysis - both these + are removed after the concordance (count of unique terms) is constructed for each + column. Then a complication - each remaining pair of columns is tested for + redundancy - if two columns are always paired, then only one is needed :) + """ + for nrows,row in enumerate(phenolist): # construct concordance + if len(row.strip()) == 0: + break + row = row.strip().split('\t') + if nrows == 0: # set up from header + head = row + totcols = len(row) + concordance = [{} for x in head] # list of dicts + else: + for col,code in enumerate(row): # keep column order correct + if col >= totcols: + gal_Log.warning('### get_phecols error in pheno file - row %d col %d (%s) longer than header %s' % (nrows, col, row, head)) + else: + concordance[col].setdefault(code,0) # first one is zero + concordance[col][code] += 1 + useCols = [] + useConc = [] # columns of interest to keep + nrows = len(phenolist) + nrows -= 1 # drop head from count + for c,conc in enumerate(concordance): # c is column number + if (len(conc) > 1) and (len(conc) < min(nrows,maxConc)): # not all same and not all different!! + useConc.append(conc) # keep concordance + useCols.append(c) # keep column + nuse = len(useCols) + # now to check for pairs of concordant columns - drop one of these. + delme = [] + p = phenolist[1:] # drop header + plist = [x.strip().split('\t') for x in p] # list of lists + phe = [[x[i] for i in useCols] for x in plist if len(x) >= totcols] # strip unused data + for i in range(0,(nuse-1)): # for each interesting column + for j in range(i+1,nuse): + kdict = {} + for row in phe: # row is a list of lists + k = '%s%s' % (row[i],row[j]) # composite key + kdict[k] = k + if (len(kdict.keys()) == len(concordance[useCols[j]])): # i and j are always matched + delme.append(j) + delme = list(set(delme)) # remove dupes + listCol = [] + delme.sort() + delme.reverse() # must delete from far end! + for i in delme: + del useConc[i] # get rid of concordance + del useCols[i] # and usecols entry + for i,conc in enumerate(useConc): # these are all unique columns for the design matrix + ccounts = [(conc.get(code,0),code) for code in conc.keys()] # decorate + ccounts.sort() + cc = [(x[1],x[0]) for x in ccounts] # list of code count tuples + codeDetails = (head[useCols[i]],cc) # ('foo',[('a',3),('b',11),..]) + listCol.append(codeDetails) + if len(listCol) > 0: + res = listCol + # metadata.pheCols becomes [('bar;22,zot;113','foo'), ...] + else: + res = [('no usable phenotype columns found',[('?',0),]),] + return res + + + + def get_pheno(self,dataset): + """expects a .pheno file in the extra_files_dir - ugh + note that R is wierd and adds the row.name in + the header so the columns are all wrong - unless you tell it not to. + A file can be written as + write.table(file='foo.pheno',pData(foo),sep='\t',quote=F,row.names=F) + """ + p = file(dataset.metadata.pheno_path,'r').readlines() + if len(p) > 0: # should only need to fix an R pheno file once + head = p[0].strip().split('\t') + line1 = p[1].strip().split('\t') + if len(head) < len(line1): + head.insert(0,'ChipFileName') # fix R write.table b0rken-ness + p[0] = '\t'.join(head) + else: + p = [] + return '\n'.join(p) + + def set_peek( self, dataset ): + """expects a .pheno file in the extra_files_dir - ugh + note that R is wierd and does not include the row.name in + the header. why?""" + if not dataset.dataset.purged: + pp = os.path.join(dataset.extra_files_path,'%s.pheno' % dataset.metadata.base_name) + try: + p = file(pp,'r').readlines() + except: + p = ['##failed to find %s' % pp,] + gal_Log.debug('@@@rexpression set_peek, dataset.name=%s,\npp=%s,\np=%s' % (dataset.name,pp,p[:3])) + dataset.peek = ''.join(p[:5]) + dataset.blurb = 'Galaxy Rexpression composite file' + else: + dataset.peek = 'file does not exist\n' + dataset.blurb = 'file purged from disk' + + def get_peek( self, dataset ): + """expects a .pheno file in the extra_files_dir - ugh + """ + pp = os.path.join(dataset.extra_files_path,'%s.pheno' % dataset.metadata.base_name) + try: + p = file(pp,'r').readlines() + except: + p = ['##failed to find %s' % pp] + gal_Log.debug('@@@rexpression get_peek, dataset.file_name=%s,\npp=%s,\np=%s' % (dataset.file_name,pp,p[:3])) + return ''.join(p[:5]) + + def get_file_peek(self,filename): + """ + can't really peek at a filename - need the extra_files_path and such? + """ + h = '## rexpression get_file_peek: no file found' + try: + h = file(filename,'r').readlines() + except: + pass + return ''.join(h[:5]) + + def regenerate_primary_file(self,dataset): + """cannot do this until we are setting metadata + """ + bn = dataset.metadata.base_name + flist = os.listdir(dataset.extra_files_path) + rval = ['<html><head><title>Files for Composite Dataset %s</title></head><p/>Comprises the following files:<p/><ul>' % (bn)] + for i,fname in enumerate(flist): + sfname = os.path.split(fname)[-1] + rval.append( '<li><a href="%s">%s</a>' % ( sfname, sfname ) ) + rval.append( '</ul></html>' ) + gal_Log.debug('rexpression regenerate primary file, writing %s' % rval) + f = file(dataset.file_name,'w') + f.write("\n".join( rval )) + f.write('\n') + f.close() + + """Add metadata elements""" + def init_meta( self, dataset, copy_from=None ): + if copy_from: + dataset.metadata = copy_from.metadata + + def set_meta( self, dataset, **kwd ): + + """ + NOTE we apply the tabular machinary to the phenodata extracted + from a BioC eSet or affybatch. + + """ + try: + flist = os.listdir(dataset.extra_files_path) + except: + gal_Log.debug('@@@rexpression set_meta failed - no dataset?') + return + bn = None + for f in flist: + n = os.path.splitext(f)[0] + if not bn: + bn = n + dataset.metadata.base_name = bn + if not bn: + bn = '?' + pn = '%s.pheno' % (bn) + pp = os.path.join(dataset.extra_files_path,pn) + dataset.metadata.pheno_path=pp + try: + pf = file(pp,'r').readlines() # read the basename.phenodata in the extra_files_path + except: + pf = None + if pf: + h = pf[0].strip() + h = h.split('\t') # hope is header + h = [escape(x) for x in h] + dataset.metadata.column_names = h + dataset.metadata.columns = len(h) + dataset.peek = ''.join(pf[:5]) + else: + dataset.metadata.column_names = [] + dataset.metadata.columns = 0 + dataset.peek = 'No pheno file found' + if len(pf) > 1: + dataset.metadata.pheCols = self.get_phecols(phenolist=pf) + else: + dataset.metadata.pheCols = [('','No useable phenotypes found',False),] + #self.regenerate_primary_file(dataset) + if not dataset.info: + dataset.info = 'Galaxy Expression datatype object' + if not dataset.blurb: + dataset.blurb = 'R loadable BioC expression object for the Rexpression Galaxy toolkit' + gal_Log.debug('@@@rexpression set_meta on dsn=%s, pf=%s, peek=%s' % (dataset.file_name,''.join(pf[:5]),dataset.peek)) + return True + + def make_html_table( self, pp='nothing supplied from peek\n'): + """Create HTML table, used for displaying peek""" + out = ['<table cellspacing="0" cellpadding="3">',] + p = pp.split('\n') + try: + # Generate column header + for i,row in enumerate(p): + lrow = row.strip().split('\t') + if i == 0: + orow = ['<th>%s</th>' % escape(x) for x in lrow] + orow.insert(0,'<tr>') + orow.append('</tr>') + else: + orow = ['<td>%s</td>' % escape(x) for x in lrow] + orow.insert(0,'<tr>') + orow.append('</tr>') + out.append(''.join(orow)) + out.append( '</table>' ) + out = "\n".join( out ) + except Exception, exc: + out = "Can't create html table %s" % str( exc ) + return out + + def display_peek( self, dataset ): + """Returns formatted html of peek""" + out=self.make_html_table(dataset.peek) + return out + + def get_mime(self): + """Returns the mime type of the datatype""" + return 'text/html' + + +class Affybatch( RexpBase ): + """derived class for BioC data structures in Galaxy """ + + file_ext = "affybatch" + + def __init__( self, **kwd ): + RexpBase.__init__(self, **kwd) + self.add_composite_file( '%s.affybatch', description = 'AffyBatch R object saved to file', + substitute_name_with_metadata = 'base_name', is_binary=True ) + +class Eset( RexpBase ): + """derived class for BioC data structures in Galaxy """ + file_ext = "eset" + + def __init__( self, **kwd ): + RexpBase.__init__(self, **kwd) + self.add_composite_file( '%s.eset', description = 'ESet R object saved to file', + substitute_name_with_metadata = 'base_name', is_binary = True ) + + +class MAlist( RexpBase ): + """derived class for BioC data structures in Galaxy """ + file_ext = "malist" + + def __init__( self, **kwd ): + RexpBase.__init__(self, **kwd) + self.add_composite_file( '%s.malist', description = 'MAlist R object saved to file', + substitute_name_with_metadata = 'base_name', is_binary = True ) + + +if __name__ == '__main__': + import doctest, sys + doctest.testmod(sys.modules[__name__]) + +

1 0

[hg] galaxy 2873: Changed FASTQ Groomer's handling of Sanger dat...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/4a3e48e1e8e1 changeset: 2873:4a3e48e1e8e1 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Mon Oct 12 14:04:28 2009 -0400 description: Changed FASTQ Groomer's handling of Sanger data to output all lines even if only first n are validated 3 file(s) affected in this change: test-data/fastq_gen_conv_in2.fastq test-data/fastq_gen_conv_out2.fastqsanger tools/next_gen_conversion/fastq_gen_conv.py diffs (74 lines): diff -r 9d67ae5ecda7 -r 4a3e48e1e8e1 test-data/fastq_gen_conv_in2.fastq --- a/test-data/fastq_gen_conv_in2.fastq Mon Oct 12 13:19:31 2009 -0400 +++ b/test-data/fastq_gen_conv_in2.fastq Mon Oct 12 14:04:28 2009 -0400 @@ -5,7 +5,7 @@ @seq2 GGGTCTCCCAGAATGATTAGAGCCGTATAGGA + -?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\] +?@ABCDEFGHIJK MNOPQRSTUVWXYZ[\\] @seq3 GCGGTTCAATACGATTACCACCATGATAAATA + diff -r 9d67ae5ecda7 -r 4a3e48e1e8e1 test-data/fastq_gen_conv_out2.fastqsanger --- a/test-data/fastq_gen_conv_out2.fastqsanger Mon Oct 12 13:19:31 2009 -0400 +++ b/test-data/fastq_gen_conv_out2.fastqsanger Mon Oct 12 14:04:28 2009 -0400 @@ -2,11 +2,19 @@ AAAGGTTTCTCTTTTGGAAATATCTAAATCCC + !"#$%&\'()*+,-./0123456789:;<=>. -@seq2 -GGGTCTCCCAGAATGATTAGAGCCGTATAGGA -+ -?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\] @seq3 GCGGTTCAATACGATTACCACCATGATAAATA + ?Aa.1ghB2K!#lk(02GY[[II])Kwl+,5M +@seq4 +AGTCTTTTCCTCTAAAATAACATAGGATACTA ++ +ghY)N375Nh.,Ol>==/<:2#i&d%#KdNII +@seq5 +GAGGACTCATGGTAGGTATTTTACATGACATT ++ +IIgy%hf6#394bd&hNMWL$OPB63II*,+- +@seq6 +GGCCTACATTCATTTACGAGACTAATTAGGGA ++ +IIIIIgd6#5%jKO&.,D+s3aW=cdGB#a1$ \ No newline at end of file diff -r 9d67ae5ecda7 -r 4a3e48e1e8e1 tools/next_gen_conversion/fastq_gen_conv.py --- a/tools/next_gen_conversion/fastq_gen_conv.py Mon Oct 12 13:19:31 2009 -0400 +++ b/tools/next_gen_conversion/fastq_gen_conv.py Mon Oct 12 14:04:28 2009 -0400 @@ -47,14 +47,15 @@ lines = [] line = fin.readline() while line: - if max_blocks >= 0 and block_num > 0 and orig_type == 'sanger' and max_blocks < block_num: - print 'break' - break - if line.strip(): - # the line that starts of a block, with a name + if line.strip() and max_blocks >= 0 and block_num > 0 and orig_type == 'sanger' and block_num >= max_blocks: + fout.write(line) + if line_count % 4 == 0: + block_num += 1 + line_count += 1 + elif line.strip(): + # the line that starts a block, with a name if line_count % 4 == 0 and line.startswith('@'): lines.append(line) - block_num += 1 else: # if we expect a sequence of bases if line_count % 4 == 1 and all_bases_valid(line.strip()): @@ -154,6 +155,8 @@ bad_blocks += 1 base_len = -1 lines = [] + # mark the successful end of a block + block_num += 1 line_count += 1 line = fin.readline() fout.close()

1 0

[hg] galaxy 2868: added 2 valid chars ; | and patch for empty url...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/109e94372abb changeset: 2868:109e94372abb user: Ross Lazarus <ross.lazarus(a)gmail.com> date: Sun Oct 11 09:45:38 2009 -0400 description: added 2 valid chars ;| and patch for empty url_paste in composite upload 2 file(s) affected in this change: lib/galaxy/tools/parameters/grouping.py lib/galaxy/util/__init__.py diffs (24 lines): diff -r 5391edcf618d -r 109e94372abb lib/galaxy/tools/parameters/grouping.py --- a/lib/galaxy/tools/parameters/grouping.py Sun Oct 11 09:37:43 2009 -0400 +++ b/lib/galaxy/tools/parameters/grouping.py Sun Oct 11 09:45:38 2009 -0400 @@ -226,7 +226,7 @@ if context.get( 'space_to_tab', None ) not in ["None", None]: space_to_tab = True file_bunch = get_data_file_filename( data_file, override_name = name, override_info = info ) - if file_bunch.path: + if file_bunch.path and url_paste: if url_paste.strip(): warnings.append( "All file contents specified in the paste box were ignored." ) else: #we need to use url_paste diff -r 5391edcf618d -r 109e94372abb lib/galaxy/util/__init__.py --- a/lib/galaxy/util/__init__.py Sun Oct 11 09:37:43 2009 -0400 +++ b/lib/galaxy/util/__init__.py Sun Oct 11 09:45:38 2009 -0400 @@ -109,7 +109,7 @@ return text # characters that are valid -valid_chars = set(string.letters + string.digits + " -=_.()/+*^,:?!") +valid_chars = set(string.letters + string.digits + " -=_.()/+*^,:?!;|") # characters that are allowed but need to be escaped mapped_chars = { '>' :'__gt__',

1 0

[hg] galaxy 2869: adding rgenetics converters
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/639c6b5e0073 changeset: 2869:639c6b5e0073 user: Ross Lazarus <ross.lazarus(a)gmail.com> date: Sun Oct 11 15:00:40 2009 -0400 description: adding rgenetics converters 6 file(s) affected in this change: lib/galaxy/datatypes/converters/lped_to_fped_converter.py lib/galaxy/datatypes/converters/lped_to_fped_converter.xml lib/galaxy/datatypes/converters/lped_to_pbed_converter.py lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml lib/galaxy/datatypes/converters/pbed_to_lped_converter.py lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml diffs (36 lines): diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/lped_to_fped_converter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/lped_to_fped_converter.py Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/lped_to_fped_converter.py \ No newline at end of file diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/lped_to_fped_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/lped_to_fped_converter.xml Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/lped_to_fped_converter.xml \ No newline at end of file diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/lped_to_pbed_converter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/lped_to_pbed_converter.py Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/lped_to_pbed_converter.py \ No newline at end of file diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/lped_to_pbed_converter.xml \ No newline at end of file diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/pbed_to_lped_converter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/pbed_to_lped_converter.py Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/pbed_to_lped_converter.py \ No newline at end of file diff -r 109e94372abb -r 639c6b5e0073 lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml Sun Oct 11 15:00:40 2009 -0400 @@ -0,0 +1,1 @@ +/opt/galaxy/tools/rgenetics/converters/pbed_to_lped_converter.xml \ No newline at end of file

1 0

[hg] galaxy 2867: rexpression datatypes and fixes for rgenetics ...
by Greg Von Kuster 13 Oct '09

13 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/5391edcf618d changeset: 2867:5391edcf618d user: Ross Lazarus <ross.lazarus(a)gmail.com> date: Sun Oct 11 09:37:43 2009 -0400 description: rexpression datatypes and fixes for rgenetics datatypes 1 file(s) affected in this change: lib/galaxy/datatypes/genetics.py diffs (376 lines): diff -r 080b3c44963e -r 5391edcf618d lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Sat Oct 10 16:18:08 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Sun Oct 11 09:37:43 2009 -0400 @@ -1,370 +1,1 @@ -""" -rgenetics datatypes -Use at your peril -Ross Lazarus -for the rgenetics and galaxy projects - -genome graphs datatypes derived from Interval datatypes -genome graphs datasets have a header row with appropriate columnames -The first column is always the marker - eg columname = rs, first row= rs12345 if the rows are snps -subsequent row values are all numeric ! Will fail if any non numeric (eg '+' or 'NA') values -ross lazarus for rgenetics -august 20 2007 -""" - -import logging, os, sys, time, tempfile, shutil -import data -from galaxy import util -from cgi import escape -import urllib -from galaxy.web import url_for -from galaxy.datatypes import metadata -from galaxy.datatypes.metadata import MetadataElement -#from galaxy.datatypes.data import Text -from galaxy.datatypes.tabular import Tabular -from galaxy.datatypes.images import Html - -log = logging.getLogger(__name__) - - - -class GenomeGraphs( Tabular ): - """Tab delimited data containing a marker id and any number of numeric values""" - - """Add metadata elements""" - MetadataElement( name="markerCol", default=1, desc="Marker ID column", param=metadata.ColumnParameter ) - MetadataElement( name="columns", default=3, desc="Number of columns", readonly=True ) - MetadataElement( name="column_types", default=[], desc="Column types", readonly=True, visible=False ) - file_ext = 'gg' - - def __init__(self, **kwd): - """Initialize gg datatype, by adding UCSC display apps""" - Tabular.__init__(self, **kwd) - self.add_display_app ( 'ucsc', 'Genome Graph', 'as_ucsc_display_file', 'ucsc_links' ) - - def set_peek( self, dataset ): - """Set the peek and blurb text""" - if not dataset.dataset.purged: - dataset.peek = data.get_file_peek( dataset.file_name ) - dataset.blurb = util.commaify( str( data.get_line_count( dataset.file_name ) ) ) + " rows" - #i don't think set_meta should not be called here, it should be called separately - self.set_meta( dataset ) - else: - dataset.peek = 'file does not exist' - dataset.blurb = 'file purged from disk' - - def get_estimated_display_viewport( self, dataset ): - """Return a chrom, start, stop tuple for viewing a file.""" - raise notImplemented - - def ucsc_links( self, dataset, type, app, base_url ): - """ from the ever-helpful angie hinrichs angie(a)soe.ucsc.edu - a genome graphs call looks like this - http://genome.ucsc.edu/cgi-bin/hgGenome?clade=mammal&org=Human&db=hg18&hgGe… - &hgGenome_dataSetDescription=test&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess - &hgGenome_columnLabels=best%20guess&hgGenome_maxVal=&hgGenome_labelVals= - &hgGenome_maxGapToFill=25000000&hgGenome_uploadFile=http://galaxy.esphealth.org/datasets/333/display/index - &hgGenome_doSubmitUpload=submit - Galaxy gives this for an interval file - http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg18&position=chr1:1-1000&hgt.cu… - http%3A%2F%2Fgalaxy.esphealth.org%2Fdisplay_as%3Fid%3D339%26display_app%3Ducsc - """ - ret_val = [] - ggtail = '&hgGenome_doSubmitUpload=submit' - if not dataset.dbkey: - dataset.dbkey = 'hg18' # punt! - if dataset.has_data: - for site_name, site_url in util.get_ucsc_by_build(dataset.dbkey): - if site_name in app.config.ucsc_display_sites: - site_url = site_url.replace('/hgTracks?','/hgGenome?') # for genome graphs - display_url = urllib.quote_plus( "%s%s/display_as?id=%i&display_app=%s" % (base_url, url_for( controller='root' ), dataset.id, type)) - sl = ["%sdb=%s" % (site_url,dataset.dbkey ),] - sl.append("&hgGenome_dataSetName=%s&hgGenome_dataSetDescription=%s" % (dataset.name, 'GalaxyGG_data')) - sl.append("&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess") - sl.append("&hgGenome_columnLabels=first%20row&hgGenome_maxVal=&hgGenome_labelVals=") - sl.append("&hgGenome_maxGapToFill=25000000&hgGenome_uploadFile=%%s") - sl.append(ggtail) - s = urllib.quote_plus( ''.join(sl) ) - link = '%s?redirect_url=%s&display_url=%s' % ( internal_url, s, display_url ) - ret_val.append( (site_name, link) ) - return ret_val - - def validate( self, dataset ): - """Validate a gg file - all numeric after header row""" - errors = list() - infile = open(dataset.file_name, "r") - header= infile.next() # header - for i,row in enumerate(infile): - ll = row.strip().split('\t') - badvals = [] - for j,x in enumerate(ll): - try: - x = float(x) - except: - badval.append('col%d:%s' % (j+1,x)) - if len(badvals) > 0: - errors.append('row %d, %s' % (' '.join(badvals))) - return errors - - def repair_methods( self, dataset ): - """Return options for removing errors along with a description""" - return [("lines","Remove erroneous lines")] - - -class Rgenetics(Html): - """class to use for rgenetics""" - """Add metadata elements""" - MetadataElement( name="base_name", desc="base name for all transformed versions of this genetic dataset", default="galaxy", readonly=True, set_in_upload=True) - - file_ext="html" - composite_type = 'auto_primary_file' - allow_datatype_change = False - - def missing_meta( self, dataset ): - """Checks for empty meta values""" - for key, value in dataset.metadata.items(): - if not value: - return True - return False - - def generate_primary_file( self, dataset = None ): - rval = ['<html><head><title>Files for Composite Dataset (%s)</title></head><p/>This composite dataset is composed of the following files:<p/><ul>' % ( self.file_ext ) ] - for composite_name, composite_file in self.get_composite_files( dataset = dataset ).iteritems(): - opt_text = '' - if composite_file.optional: - opt_text = ' (optional)' - rval.append( '<li><a href="%s">%s</a>%s' % ( composite_name, composite_name, opt_text ) ) - rval.append( '</ul></html>' ) - return "\n".join( rval ) - -class SNPMatrix(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="snpmatrix" - - def set_peek( self, dataset ): - if not dataset.dataset.purged: - dataset.peek = "Binary RGenetics file" - dataset.blurb = data.nice_size( dataset.get_size() ) - else: - dataset.peek = 'file does not exist' - dataset.blurb = 'file purged from disk' - - -class Lped(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="lped" - - def __init__( self, **kwd ): - Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.ped', description = 'Pedigree File', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.map', description = 'Map File', substitute_name_with_metadata = 'base_name', is_binary = True ) - - -class Pphe(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="pphe" - -class Lmap(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="lmap" - -class Fphe(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="fphe" - -class Phe(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="phe" - - -class Fped(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="fped" - - -class Pbed(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="pbed" - - def __init__( self, **kwd ): - Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.bim', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.bed', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.fam', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name', is_binary = True ) - - -class Eigenstratgeno(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="eigenstratgeno" - - def __init__( self, **kwd ): - Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.eigenstratgeno', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.ind', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name', is_binary = True ) - self.add_composite_file( '%s_fo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - self.add_composite_file( '%s_fo.ind', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - self.add_composite_file( '%s_fo.map', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - self.add_composite_file( '%s_oo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - self.add_composite_file( '%s_oo.ind', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - self.add_composite_file( '%s_oo.map', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) - - - -class Eigenstratpca(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="eigenstratpca" - -class Snptest(Rgenetics): - """fake class to distinguish different species of Rgenetics data collections - """ - file_ext="snptest" - -class RexpBase( Html ): - """base class for BioC data structures in Galaxy - must be constructed with the pheno data in place since that - goes into the metadata for each instance""" - - """Add metadata elements""" - MetadataElement( name="columns", default=0, desc="Number of columns", readonly=True, visible=False ) - MetadataElement( name="column_names", default=[], desc="Column names", readonly=True,visible=True ) - MetadataElement( name="base_name", - desc="base name for all transformed versions of this genetic dataset", readonly=True, default='galaxy', set_in_upload=True) - ### Do we really need these below? can we rely on dataset.extra_files_path: os.path.join( dataset.extra_files_path, '%s.phenodata' % dataset.metadata.base_name ) ? - ### Do these have a different purpose? Ross will need to clarify - ### Uploading these datatypes will not work until this is sorted out (set_peek fails)... - MetadataElement( name="pheno_path", - desc="Path to phenotype data for this experiment", readonly=True) - MetadataElement( name="pheno", - desc="Phenotype data for this experiment", readonly=True) - - file_ext = None - - is_binary = True - - allow_datatype_change = False - - composite_type = 'basic' - - def __init__( self, **kwd ): - Html.__init__( self, **kwd ) - self.add_composite_file( '%s.phenodata', substitute_name_with_metadata = 'base_name', is_binary = True ) - - def set_peek( self, dataset ): - """expects a .pheno file in the extra_files_dir - ugh - note that R is wierd and does not include the row.name in - the header. why?""" - p = file(dataset.metadata.pheno_path,'r').readlines() #this fails - head = p[0].strip().split('\t') - head.insert(0,'ChipFileName') # fix R write.table b0rken-ness - p[0] = '\t'.join(head) - p = '\n'.join(p) - dataset.peek = p - dataset.metadata.pheno = p - dataset.blurb = 'R loadable BioC expression object for the Rexpression Galaxy toolkit' - - # stolen from Tabular - # class Tabular( data.Text ): - """Tab delimited data""" - - """Add metadata elements""" - def init_meta( self, dataset, copy_from=None ): - if copy_from: - dataset.metadata = copy_from.metadata - - - #def set_readonly_meta( self, dataset, skip=0, **kwd ): - # """Resets the values of readonly metadata elements.""" - # RexpBase.set_meta( self, dataset, skip=skip ) - - def set_readonly_meta( self, dataset, **kwd ): - """Resets the values of readonly metadata elements.""" - RexpBase.set_meta( self, dataset ) - - #def set_meta( self, dataset, skip=0, **kwd ): - def set_meta( self, dataset, **kwd ): - - """ - NOTE we apply the tabular machinary to the phenodata extracted - from a BioC eSet or affybatch. - - """ - if not dataset.peek: - dataset.set_peek() - pk = dataset.peek # use the peek which is the pheno data insead of dataset (!) - ###this is probably not the best source, can we just access the raw data directly? - if pk: - p = pk.split('\n') - h = p[0].strip().split('\t') # hope is header - h = [escape(x) for x in h] - dataset.metadata.column_names = h - dataset.metadata.columns = len(h) - else: - dataset.metadata.column_names = [] - dataset.metadata.columns = 0 - - def make_html_table( self, dataset): - """Create HTML table, used for displaying peek""" - out = ['<table cellspacing="0" cellpadding="3">',] - try: - # Generate column header - pk = dataset.peek - p = pk.split('\n') - for i,row in enumerate(p): - lrow = row.strip().split('\t') - if i == 0: - orow = ['<th>%s</th>' % escape(x) for x in lrow] - orow.insert(0,'<tr>') - orow.append('</tr>') - else: - orow = ['<td>%s</td>' % escape(x) for x in lrow] - orow.insert(0,'<tr>') - orow.append('</tr>') - out.append(''.join(orow)) - out.append( '</table>' ) - out = "\n".join( out ) - except Exception, exc: - out = "Can't create peek %s" % str( exc ) - return out - - def display_peek( self, dataset ): - """Returns formatted html of peek""" - if not dataset.peek: - dataset.set_peek() - return self.make_html_table( dataset ) - - def get_mime(self): - """Returns the mime type of the datatype""" - return 'application/gzip' - - -class AffyBatch( RexpBase ): - """derived class for BioC data structures in Galaxy """ - file_ext = "affybatch" - - -class ESet( RexpBase ): - """derived class for BioC data structures in Galaxy """ - file_ext = "eset" - - -class MAList( RexpBase ): - """derived class for BioC data structures in Galaxy """ - file_ext = "malist" - - -if __name__ == '__main__': - import doctest, sys - doctest.testmod(sys.modules[__name__]) - +/opt/galaxy/tools/rgenetics/genetics.py \ No newline at end of file

1 0