galaxy-dev March 2013

galaxy-dev@lists.galaxyproject.org

108 participants
185 discussions

Re: [galaxy-dev] [galaxy-announce] GalaxyAdmins meetup on March 20th at 10 AM Central US
by Dave Clements 19 Mar '13

19 Mar '13

Hello all, Just a reminder about the GalaxyAdmins web meetup is going on tomorrow, Wednesday, March 20 at 10am central US time<http://wiki.galaxyproject.org/Community/GalaxyAdmins/Meetups/2013_03_20>. (See http://bit.ly/XnqpUY.) Hailiang (Leon) Mei will discuss the recent deployment of NBIC's Andromeda Galaxy Server <http://galaxy.nbic.nl/> using CloudMan and the SURFsara cloud infrastructure. Dan Blankenberg will also give an update on recent and future goings on in the Galaxy project. We will be using Blackboard Collaborate for the conference call. *This takes a few minutes to setup, and will take a few more minutes if you are running on a Mac.* See http://bit.ly/XnqpUY for call links and details Thanks, Dave C On Mon, Mar 4, 2013 at 12:42 PM, IIHG Galaxy Administrator < iihg-galaxy-admin(a)uiowa.edu> wrote: > Hello, > > The next GalaxyAdmins Meetup will be held on Wednesday, March 20, 2013 > from 10 AM to 11 AM US Central time at > https://globalcampus.uiowa.edu:443/join_meeting.html?meetingId=1262344508128. > Hailiang (Leon) Mei and David van Enckevort will present on "NBIC Galaxy > at SURFsara's HPC cloud". There will also be a Galaxy Project Update by > a Galaxy Team member. > > We encourage and look forward to your participation in the meetup. > > Downloading the required Blackboard Collaborate web conferencing > system applet in advance, and using a headphone with a microphone to > prevent audio feedback during the call is recommended. > > Thank you. > > -- > Srinivas Maddhi > Senior Systems Administrator > Iowa Institute for Human Genetics > ITS Research Services, The University of Iowa > > _______________________________________________ > galaxy-announce mailing list > galaxy-announce(a)lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-announce > To manage your subscriptions to this > and other Galaxy lists, please use the interface at: > > http://lists.bx.psu.edu/ > -- http://galaxyproject.org/GCC2013 http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ http://wiki.galaxyproject.org/

1 0

Local data for encode tools
by julie dubois 19 Mar '13

19 Mar '13

Hi all, I want to use the encode tools as "random intervals" in my local instance of galaxy cistrome. I have the xml file and the py file which can run the tool, but it required any local data. These data are referenced in tool-data/regions.loc but I've not found where can I procure the bed which are referenced in this file. Have you any idea to find them or to build them ? Or just any example of their format, may be I can reproduce them with other data. And for the future, is there a precise web page for admin which references all ways to transfer useful local data? Thanks a lot. Julie

1 0

These tool dependencies are considered orphans
by Peter Cock 19 Mar '13

19 Mar '13

Hi all, I noticed today that there is a new yellow warning on the NCBI BLAST+ repository in the main Galaxy Tool Shed, http://toolshed.g2.bx.psu.edu/view/devteam/ncbi_blast_plus Quote: > The settings for name, version and type from a contained tool > configuration file's requirement tag does not match the > information for the following tool dependency definitions in the > tool_dependencies.xml file, so these tool dependencies are > considered orphans within this repository. > * name: blast+, type: package, version: 2.2.26+ Is this complaining that none of the individual wrapper XML files reference the tool_dependencies.xml's package: <package name="blast+" version="2.2.26+"> Instead, the tool XML files just declare a simple binary dependency at the moment, e.g. <requirements> <requirement type="binary">blastp</requirement> </requirements> Although it seems like unnecessary bookkeeping to me, is this new yellow warning suggesting each tool's XML should reference the package somehow? If so, then the wiki needs updating as it only describes python-module and binary as requirement types: http://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax Thanks, Peter

2 4

Same Problems with Galaxy-Project since 3/14/2013 update
by Zain A Alvi 19 Mar '13

19 Mar '13

Dear Sir or Madam, I hope this reaches you well. Unfortunately, I am still experiencing the same problem as stated in my previous attached email. After a Galaxy-project's moderator stopped my old runs. I was able to run 1 cufflinks set. Then any subsequent tests are running into the same problem of "job is waiting to run", but it is not processing. Also, I am having trouble uploading files from NCBI's FTP onto Galaxy-project. I was not experiencing any of these troubles prior to the update to the servers for galaxy-project. Thank you again for looking into this. Sincerely, Zain Alvi --- PhD Student in Molecular BioSciences Seton Hall University email: zain.alvi(a)student.shu.edu Ph: (973) 710-7149 ________________________________ From: Zain A Alvi Sent: Sunday, March 17, 2013 10:05 PM To: galaxy-dev(a)bx.psu.edu Subject: Problems with Galaxy-Project since 3/14/2013 update Dear Sir or Madam, I hope this reaches you well. I am a graduate student at Seton Hall University and it has been a wonderful experience using Galaxy Project's main server (https://main.g2.bx.psu.edu/) for the past few months. Unfortunately, I am experiencing trouble since the update to the servers on Thursday 3/14/2013. I am facing the following problems: 1) Only the http addresses only work for uploading any file from NCBI. In the past, I could use the NCBI FTP addresses to upload the file without any trouble. 2) Unfortunately, none of the online tools seem to run. All of my tasks state that they are "waiting to run." This message has been there since yesterday. The tools that I used since the update are cufflinks and cuffdiff. These tools were working before the update. I was wondering, if you could kindly look into this. I would really appreciate it. Sincerely, Zain Alvi --- PhD Student in Molecular BioSciences Seton Hall University email: zain.alvi(a)student.shu.edu Ph: (973) 710-7149

1 0

Galaxy LinkedIn Group
by Dave Clements 19 Mar '13

19 Mar '13

Hello all, A Galaxy Group now exists on LinkedIn <http://bit.ly/gxyLinkedIn> ( http://bit.ly/gxyLinkedIn). The group is open to anyone and is a forum to post announcements, discussions <http://bit.ly/gxyLinkedIn>, and jobs of interest<https://www.linkedin.com/groups?jobs=&gid=4907635&trk=anet_ug_jobs> to the Galaxy community. *Note that this is not an official support forum for the Galaxy Project. Please continue to use the mailing lists<http://wiki.galaxyproject.org/MailingLists> for that purpose.* If you are on LinkedIn, please consider joining the group<http://bit.ly/gxyLinkedIn> today. Dave Clements <http://wiki.galaxyproject.org/DaveClements> and the Galaxy Team <http://wiki.galaxyproject.org/GalaxyTeam> -- http://galaxyproject.org/GCC2013 http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ http://wiki.galaxyproject.org/

1 0

FW: ALIGNMENT BCM GENOMICS 2013 - Yassine Rechoum
by Ritter, Deborah I 18 Mar '13

18 Mar '13

I don't know where to report this, because it is (1) not so much an error as requesting a more informative fail message and (2) this is from a student's galaxy history, so I don't have access to the bug icon from her shared history. But the gist of the request is when running Emboss tools water and needle on very large (300kb) sequences, the Galaxy fail message is segmentation fault. I ran the same sequences on command line water and needle from EMBOSS installation here at Baylor college of medicine, and the fail message was "Died: Sequences too big. Try 'matcher' or 'super matcher'". Matcher and Super matcher are also available to use in galaxy under emboss tools, but most users will not know to try those. Is it possible to have the emboss fail message be the galaxy fail message? Thanks so much, Deb 1. Where you are using Galaxy (Main<http://wiki.galaxyproject.org/Main>, local, or cloud instance). MAIN 2. The date/time the bug was detected 3/18/13 3. Exact steps to reproduce the issue -- load 2 sequences about 300kb each into needle and/or water EMBOSS tools 4. What troubleshooting steps (if any) you have tested out -- saw segmentation fault error message from galaxy and tried running on command line emboss installation. Fail message from command line emboss tools was helpful, pointing user to matcher and super matcher programs that handle larger sequences. 5. IMPORTANT: If data is involved, leave all of the related datasets in the analysis thread leading up to the bug in your history undeleteduntil we have written you back. Use Options → Show Deleted Datasets and click dataset links to undelete to recover error datasets before reporting a bug if necessary. THE HISTORY IS HERE: https://main.g2.bx.psu.edu/history/list_shared?sort=-update_time&operation=… ~~~~~~~~~~~~~~~~~~ Dr. Deborah Ritter Postdoctoral Associate, IRACDA Fellow Human Genome Sequencing Center Baylor College of Medicine 713-798-4076

1 0

two versions of show datasets API call?
by Clare Sloggett 18 Mar '13

18 Mar '13

Hi all, This is a using-the-API question; not sure if it belongs in galaxy-dev or galaxy-user ! There seem to be two ways to retrieve metadata for a dataset, one in the Histories API and one in the Datasets API. They return different information. So for instance if I call http://galaxy-vic.genome.edu.au/api/datasets/cb5d3b9eef2b9275?key=myapikey I see { "data_type": "fastqsanger", "deleted": false, "file_size": 16439610, "genome_build": "?", "id": 397, "metadata_data_lines": null, "metadata_dbkey": "?", "metadata_sequences": null, "misc_blurb": "15.7 MB", "misc_info": "uploaded fastqsanger file", "model_class": "HistoryDatasetAssociation", "name": "https://bioblend.s3.amazonaws.com/C1_R1_1.chr4.fq", "purged": false, "state": "ok", "visible": true } But if I call http://galaxy-vic.genome.edu.au/api/histories/fb4122d2ca33443e/contents/cb5… I see { "accessible": true, "api_type": "file", "data_type": "fastqsanger", "deleted": false, "display_apps": [], "download_url": "/datasets/cb5d3b9eef2b9275/display?to_ext=fastqsanger", "file_ext": "fastqsanger", "file_name": "/mnt/all/cloudman/galaxy/clare/files/000/dataset_375.dat", "file_size": 16439610, "genome_build": "?", "hid": 1, "history_id": "fb4122d2ca33443e", "id": "cb5d3b9eef2b9275", "metadata_data_lines": null, "metadata_dbkey": "?", "metadata_sequences": null, "misc_blurb": "15.7 MB", "misc_info": "uploaded fastqsanger file", "model_class": "HistoryDatasetAssociation", "name": "https://bioblend.s3.amazonaws.com/C1_R1_1.chr4.fq", "peek": "<table cellspacing=\"0\" cellpadding=\"3\"><tr><td>@9453842/1</td></tr><tr><td>CAGATTATGGAATCACTTGAAACTGATATTAATTGCCGAAAGATGCATCTTTCACGAAAATTAGGAAATGTTGCT</td></tr><tr><td>+</td></tr><tr><td>IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII</td></tr><tr><td>@9454359/1</td></tr><tr><td>GGAAATGAGTACAGCTATGCAACAGCTATCAGTAAGGCAAAACGAAGAGTTTGATACTATTTCTGCATTAAAAGA</td></tr></table>", "purged": false, "state": "ok", "visible": true, "visualizations": [] } The second version gives me much more information, including the History ID (but ironically requires the History ID to make the call in the first place). What I would ideally like is an API call which only requires knowledge of the Dataset ID but provides all the information in the second call. I am also a bit confused by the existence of the two different methods in the first place. Is it necessary for it to be this way, or are they just there for historical reasons? If it would be desirable to either only have one show-dataset REST method or to make the behaviour of the two identical, should I add a Trello card for this? Thanks, Clare -- Clare Sloggett Research Fellow / Bioinformatician Life Sciences Computation Centre Victorian Life Sciences Computation Initiative University of Melbourne, Parkville Campus 187 Grattan Street, Carlton, Melbourne Victoria 3010, Australia Ph: 03 903 53357 M: 0414 854 759

2 2

Is parallelism not working with galaxy-central?
by Björn Grüning 18 Mar '13

18 Mar '13

Hi all, can anyone confirm that the parallelism features is not working in galaxy-central? Parallelism is among others used by the blast+ wrappers. The only error message I get is: galaxy.jobs DEBUG 2013-03-17 16:08:27,729 (64174) Working directory for job is: /media/data/web/galaxy-central/database/job_working_directory/064/64174 galaxy.jobs.handler DEBUG 2013-03-17 16:08:27,750 (64174) Dispatching to tasks runner galaxy.jobs.handler ERROR 2013-03-17 16:08:27,750 put(): (64174) Invalid job runner: tasks galaxy.datatypes.metadata DEBUG 2013-03-17 16:08:28,079 Cleaning up external metadata files galaxy.jobs.handler INFO 2013-03-17 16:08:28,120 (64174) Job dispatched It's working fine for me with galaxy-dist. Thanks! Bjoern

5 9

SciPy Bioinformatics symposium: abstracts due Wednesday Mar 20th
by Brad Chapman 18 Mar '13

18 Mar '13

Hi all; I'm helping organize a bioinformatics mini-symposium as part of SciPy 2013: Bioinformatics mini-symposia: http://j.mp/Z4xxXB SciPy info: http://conference.scipy.org/scipy2013/about.php This is a great chance for the Python bioinformatics community to connect with the wider Python scientific computing world. SciPy will feature programmers working on IPython reproducible research, scikit-learn machine learning approaches, large scale computing problems with NumPy and lots more relevant to bioinformatics work. This year there will a special symposium track dedicated to bioinformatics and I'd like to encourage everyone to submit abstracts. The deadline is this Wednesday, March 20th: http://conference.scipy.org/scipy2013/speaking_overview.php http://conference.scipy.org/scipy2013/speaking_submission.php SciPy takes place June 24-29th in Austin, TX. I'm looking forward to seeing lots of bioinformatics people there. Please feel free to write me if you have any questions, Brad

1 0

Count characters in column
by Thyssen, Gregory - ARS 18 Mar '13

18 Mar '13

Dear Galaxy Community I frequently use pileup files in galaxy. The sequence read column contains characters like .,AaCcTtGgNn$* etc. I would like to be able to add a column to my tables that represents the number of instances of a given character in the read column. I can do this in excel with this type of formula: =len(I2)-len(substitute(I2,"A","") But of course, Excel can only handle a limited number of total lines. Do we have this functionality in Galaxy? If so how? If not..... please? Thank you, Gregory Thyssen, PhD Molecular Biologist Cotton Fiber Bioscience USDA-ARS-Southern Regional Research Center 1100 Robert E Lee Blvd New Orleans, LA 70124 gregory.thyssen(a)ars.usda.gov 504-286-4280 This electronic message contains information generated by the USDA solely for the intended recipients. Any unauthorized interception of this message or the use or disclosure of the information it contains may violate the law and subject the violator to civil or criminal penalties. If you believe you have received this message in error, please notify the sender and delete the email immediately.

2 1

← Newer
1
...
7
8
9
10
11
12
13
...
19
Older →

Jump to page:

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

galaxy-dev March 2013