April 2016 - galaxy-dev - lists.galaxyproject.org

Re: [galaxy-dev] probleme tool galaxy
by navratil 08 Apr '16

08 Apr '16

Salut, je te laisse envoyer ta question sur la liste galaxy-user(a)listes.univ-lyon1.fr. Je répondrais à ta question directement (tes séquences doivent être d'une longeur de 30 nt minimum) sur la liste histoire que tout le monde puisse bénéficier du retour d'expérience, Par ailleurs est tu inscrite sur cette liste de diffusion ? Merci pour ta contribution, A+ Vincent Le 08/04/16 14:37, Rita Rebollo a écrit : > > > Bonjour, > > J'essaye d utiliser cd-hit-dup avec une trentaines de sequences en > format fasta ou fastq et ça ne marche pas. Il me donne une erreur. J > ai aussi essayé sur le galaxy.edu et ça ne marche pas non plus. > Saurais tu dire pourquoi s il te plait? > > Mon petit fichier: > > @HWI-ST132:549:C0FYUACXX:5:1101:1213:1910_1:N:0:TGGTTT > TGGTCGATGGTTATTCTGGATAACG > + > ?@@DDDFFHH<DFHHIHIIAHIIFG > @HWI-ST132:549:C0FYUACXX:5:1101:1106:1958_1:N:0:TGGTTT > AAAGATGAATCGGTAGATCGAAAT > + > ;??DDBDFFFFFFBEHGBHFF;EH > @HWI-ST132:549:C0FYUACXX:5:1101:1944:1926_1:N:0:TGGTTT > ATAACAGTGAATTTTGGACAGTG > + > ?@?D;AD=CAD<,A:,8A<CA3C > @HWI-ST132:549:C0FYUACXX:5:1101:1981:1949_1:N:0:TGGTTT > TATTGCACATTCACCGGCCTGA > + > @@@FDFFFHH4DFGHHIGGHIG > @HWI-ST132:549:C0FYUACXX:5:1101:1943:1970_1:N:0:TGGTTT > GAGGTTCCGCAAATCTGCATATAGGG > + > =@@DADBDHHDHHGIIIIIAHIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:1752:1987_1:N:0:TGGTTT > AGATATGTTTGATATTCTTGGTTG > + > @@@FDDFFHGDHHIJGJJJGEIII > @HWI-ST132:549:C0FYUACXX:5:1101:1995:1987_1:N:0:TGGTTT > GGAACCTCGATGGACGTGGAGTGC > + > ;<?DDDDDH<AF:?A?EHFBFEF> > @HWI-ST132:549:C0FYUACXX:5:1101:2027:1925_1:N:0:TGGTTT > TGTATGCATTGCTTTCACTTCACAGA > + > @@@FFFDFHFDBHIJIIIJFHHGGEI > @HWI-ST132:549:C0FYUACXX:5:1101:2449:1910_1:N:0:TGGTTT > TGAAATGACTTATTGCCCAATGAATTGC > + > CCCFFFFFHHHHHJJJJJJIJIIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2306:1925_1:N:0:TGGTTT > CGGAGAACGCAGAAAGGTGAGCT > + > BCCFFFEFHHFHHJJJJFHJIJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2470:1932_1:N:0:TGGTTT > TGGATAGCTGCACAACCCGTGGTACC > + > @@@FFFDDHHHHHHI@HHHHGIEH9E > @HWI-ST132:549:C0FYUACXX:5:1101:2332:1938_1:N:0:TGGTTT > CCCCCTTAAGGTGAAGTAGGACCTGTC > + > CCCFFFFFGHDACFGIHJIGIIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2327:1996_1:N:0:TGGTTT > TTGCCTGTCTGTATCTCAATTGAAGT > + > @@@DDDBDDDHFBBEHGHBHEHCEFH > @HWI-ST132:549:C0FYUACXX:5:1101:2539:1874_1:N:0:TGGTTT > CTTCTGTAGTTTGTAATTCTTTTAAA > + > 1=DDFFFFHFHHIIIIIIEHIIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:2585:1888_1:N:0:TGGTTT > TCTTTGGTGATTTTAGCTGTAT > + > CCCFFFFDHHHHHJJJJJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2506:1903_1:N:0:TGGTTT > TTGGATCGGAGTCTAAACTTTCGGAGC > + > CBCFFFFFHGHHHJIIJIJJJHIHGHG > @HWI-ST132:549:C0FYUACXX:5:1101:2534:1932_1:N:0:TGGTTT > TGCATGGATTCCAGAGCAGACTCGGC > + > @C@FFFFFGGBHDBGIIIGGHII?FB > @HWI-ST132:549:C0FYUACXX:5:1101:2629:1937_1:N:0:TGGTTT > TGCTTGGACTACATATGGTTGAGGGTTGTA > + > CCCFFFFFHHHHHJJJJJHGGGIJJJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2808:1935_1:N:0:TGGTTT > TGGATGTTTTCGAGAAAAAGAGAGA > + > CCCFFFFFHHHHGJJIJJIJIJIJI > @HWI-ST132:549:C0FYUACXX:5:1101:3230:1884_1:N:0:TGGTTT > CGGGTTCAATTCCCGGTATGGGAACCA > + > @BCFDDFFHHHHHJJJFHIJJJJJJJI > @HWI-ST132:549:C0FYUACXX:5:1101:3201:1901_1:N:0:TGGTTT > TTCCCTTTGGCTTGAGAAATGCTGC > + > BBBFFFFFHHGHHJJJIJJJIIJFI > @HWI-ST132:549:C0FYUACXX:5:1101:3202:1980_1:N:0:TGGTTT > AGAGTATTGCCAGCAAACTAATCGGTC > + > ??@DADFFHGDHGICHGGHGGIIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:3183:1994_1:N:0:TGGTTT > TCACTGGGCTTTGTTTATCTCA > + > @@@FFDABFAHHGHGIJIIGHI > @HWI-ST132:549:C0FYUACXX:5:1101:3490:1888_1:N:0:TGGTTT > AGGTTGAACAGGCGTTCTGAAATGAA > + > ==?ADDFFHHHHHJGIHJJIIIJJIJ > @HWI-ST132:549:C0FYUACXX:5:1101:3286:1900_1:N:0:TGGTTT > TAGTACATCGGAACACAAGAGTCAAAAAAA > + > B@BFFFFFHHHHHIJJJIJIIDHHIIJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3389:1907_1:N:0:TGGTTT > TTATTTCGCTCGCTACTGATTGCAG > + > ???DDD4A@D;@CEEC+22AA+ACE > @HWI-ST132:549:C0FYUACXX:5:1101:3323:1917_1:N:0:TGGTTT > TTTGGATTGGCTACCTCTGGGATTGGGA > + > 111==2AB3CD<C;F@HDGEGBGEAD?C > @HWI-ST132:549:C0FYUACXX:5:1101:3398:1919_1:N:0:TGGTTT > TTCGTCGAAGATACAGAACTGTTATT > + > ?@?DDDDFHGHGFEHIGGGIGHJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3538:1907_1:N:0:TGGTTT > CGTTACTCTGCCCTTTCGCGACCCAGAA > + > @@@FFFFFHHHHHJJJJJJJIJJJIJGG > @HWI-ST132:549:C0FYUACXX:5:1101:3531:1929_1:N:0:TGGTTT > AAAAGAGTCGGACTCCTATTGTG > + > ??@DDDFFHHFFHIHEGIHI@BH > @HWI-ST132:549:C0FYUACXX:5:1101:3648:1970_1:N:0:TGGTTT > TGGAAGACTAGTGATTTTGTTGTT > + > CCCFFFFFHHHHHEHJJJIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3662:1998_1:N:0:TGGTTT > ATGGACTGAGAACCGGAATTTTT > + > CCCFFFFFHHHHHJJJIJIIJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3752:1916_1:N:0:TGGTTT > AGGACGAGATTCGCTAATGCAATGCC > + > CCCFFFFFHHHHHJJJJJJJJJIHIJ > @HWI-ST132:549:C0FYUACXX:5:1101:3864:1924_1:N:0:TGGTTT > TGCTTGGACTACATATGGTTGAGGGTTGTA > + > CCCFFFFFHHHHHJIJJJHIIJJJJIJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3786:1958_1:N:0:TGGTTT > TGGAAAATAAAACCTTCTCGAAGGG > + > @C@FFFFFHHFHHJJJJJJJJJJII > @HWI-ST132:549:C0FYUACXX:5:1101:3793:1988_1:N:0:TGGTTT > GAATTCGTAGAAGGAAGATTTTTCGCGGT > + > =@@?DDDEHHHFBGGGGGHIIJIDGEFE? > @HWI-ST132:549:C0FYUACXX:5:1101:4123:1921_1:N:0:TGGTTT > GCATGGATTCCAGAGCAGACTCGGC > + > CCCFFFFFHHHHHIJJJJJJJJCGG > @HWI-ST132:549:C0FYUACXX:5:1101:4030:1974_1:N:0:TGGTTT > GAAGATATTAATTCGCGAGTCTTA > + > CCCFFFFFHHHHHJJJJJJGHIII > @HWI-ST132:549:C0FYUACXX:5:1101:4468:1880_1:N:0:TGGTTT > ATGATGATAGAGACGGCTTGGTAA > + > 1=DFFFFHHHHHGIJJJJJJJCGH > > > > Les parametres > > Input Parameter Value Note for rerun > Single or Paired-end reads single > Select reads 11: FASTQ Groomer on data 10 > Filter out chimeric clusters false > Length of prefix to be used in the analysis 0 > Match length True > Maximum number/percent of mismatches allowed None > Description length 0 > > Les erreurs: > Fatal error: Exit code 134 () > cd-hit-dup: cdhit-dup.cxx:159: int HashingDepth(int, int): Assertion `len >= min' failed. > Aborted > From input: /data/galaxy.prabi.fr/database/files/025/dataset_25721.dat > Total number of sequences: 39 > Longest: 30 > Shortest: 22 > Sorted by length ... > Start clustering duplicated sequences ... > primer = 0

2 1

2016 Galaxy Community Conference: June 25-29, Bloomington, Indiana
by Dave Clements 08 Apr '16

08 Apr '16

Hello all, Here's the official email announcement for the 2016 Galaxy Community Conference. Please redistribute to any of your communities that would benefit from attending. Also please note: * 1. Oral presentation abstracts are due March 25.* 2. The June 2016 GMOD Meeting <https://www.eventbrite.com/e/gmod-2016-community-meeting-tickets-22224544210> will be held immediately after GCC2016. Thanks, Dave C --------------- The *2016 Galaxy Community Conference *(*GCC2016*, *gcc2016.iu.edu <http://gcc2016.iu.edu/>*) features two days of presentations, discussions, poster sessions, lightning talks, computer demos, keynotes, and birds-of-a-feather meetups, *all about data-intensive biology and the tools that support it*. Keynote speaker Yoav Gilad <http://genes.uchicago.edu/directory/yoav-gilad-phd/>, a professor of human genetics at the University of Chicago, will kick-start the main conference with a discussion on the analysis of large gene regulatory data sets. Preconference events include data <https://gcc2016.iu.edu/hacks/hacks-data.php> and coding <https://gcc2016.iu.edu/hacks/hacks-coding.php> hackathons <https://gcc2016.iu.edu/hacks/index.php>, and *two days of training* <https://gcc16.sched.org/overview/type/Training+%E2%80%94+Any> in five concurrent tracks covering 26 topics. *GCC2016* will be held at *Indiana University* in Bloomington, Indiana, June 25-29, 2016. Since it started seven years ago, GCC has been a well-attended gathering of biologists, genome researchers, bioinformaticians, and others in data-intensive biomedical research around the world. Galaxy <https://galaxyproject.org/> is an open, web-based platform for data-intensive biomedical research and enables easy interactive analysis through the web on arbitrarily large data sets. The Galaxy framework is a major resource in achieving key research goals within the biological field. It provides next-generation sequencing (NGS) tools and workflows for short-read mapping, ChIP-seq, RNA-seq, metagenomics, variant analysis, visualization, and support for Galaxy in the cloud. There are hundreds of local installs, and *over 80 publicly accessible servers* around the world. *Abstract submission** for oral presentations closes March 25. *Abstract submission for posters and computer demonstrations closes May 20. *Early registration* is now open. Registration starts at less than $45/day for post-docs and students. Registering early assures you a place at the conference and also a spot in the training workshops <https://gcc16.sched.org/overview/type/Training+%E2%80%94+Any> you want to attend. You can also *book conference housing* when you register. *Registration and lodging scholarships* are available for attendees from underrepresented groups and developing countries. Thanks, and we hope to see you in Bloomington! The *GCC2016 Exec* -- http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ https://wiki.galaxyproject.org/

1 2

"\${GALAXY_SLOTS:-4}" usage help
by Poole, Richard 08 Apr '16

08 Apr '16

Could somebody point me to a good explanation of how to setup and use GALAXY_SLOTS correctly on my server? A basic explanation is good but I also make use of Pulsar to stage some jobs on our cluster here (my machine is 4-core and cluster I use is 12-core) so I am wondering if GALAXY_SLOTS can handle this (so I don't need to specify exact thread numbers in e.g. tool wrappers) Thanks, Richard

2 3

Problem with LDAP authentication
by Scott Szakonyi 08 Apr '16

08 Apr '16

Hi all, I'm having some difficulties with logging into my production website. I get the following error message in the logs: galaxy.web.framework.webapp WARNING 2016-04-06 18:47:41,852 User logged in as 'userID' externally, but has a cookie as 'userID(a)vectorbase.org' invalidating session This started rather suddenly today after there was a space crisis on our hard drive, which is the subject of my other recent email to this list. We are using LDAP for external authentication. The same LDAP server is being used by my "Pre" server, and logins are working fine. I've compared both galaxy.ini and httpd.conf and can't find any discrepancies. If someone has suggestions to offer, I would surely appreciate them. Thanks! -- Scott B. Szakonyi Research Programmer *Center for Research Computing* 107 Information Technology Center Notre Dame, IN 46556 http://crc.nd.edu

2 2

File_path setting not working
by Scott Szakonyi 07 Apr '16

07 Apr '16

Hello, I'm trying to set our Galaxy instance to put Dataset and Temporary files on a Symlinked drive, as there isn't sufficient room on the Galaxy server to handle those files. However, I can't get it to work. Even though I've changed these settings, Galaxy still seems to be creating large numbers of files in our local database directory. Am I missing something here? I'm including the relevant section of my galaxy.ini: # -- Files and directories # Dataset files are stored in this directory. #file_path = database/files file_path = /data/galaxy/database/files # Temporary files are stored in this directory. #new_file_path = database/tmp new_file_path = /data/galaxy/tmp Thanks! -- Scott B. Szakonyi Research Programmer *Center for Research Computing* 107 Information Technology Center Notre Dame, IN 46556 http://crc.nd.edu

2 1

dbkeys_list.yaml
by William Ge 05 Apr '16

05 Apr '16

Hi, Just wonder where I can download the full sample file of dbkeys_list.yaml, which contents all the dbkeys and all DMs from the main tool shed. I'd appreciate if you would send me a copy. The sample file that comes with the ansible role only has a few lines. Thanks, Bill

1 0

Galaxy Bare/Core and custom upload tool
by Suderman Keith 05 Apr '16

05 Apr '16

Dear Galaxy Team, Two questions. 1) Is there a bare-bones version of Galaxy available somewhere? That is, Galaxy with no tools pre-installed? We are creating Ansible play books for configuring Docker/Galaxy instances with our NLP tools installed. Currently we are using a fork of the Galaxy project with the bio tools removed, but this is less than ideal when we try to update to new versions of Galaxy. Alternatively, does anyone have an automated process to delete unwanted tools that we could run immediately after cloning the main Galaxy repo? 2) Is is possible to either a) modify the existing upload tool, or b) implement a new upload tool? Several options in the upload tool do not make sense in our domain (e.g. selecting a genome) and we would also like to do some post-processing to files after they have been uploaded. I've looked at the code for the existing upload tool and it seems quite tightly coupled to the Galaxy code base. I was hoping the "Downgrade upload tool" thread from a few weeks ago was going to help, but unfortunately for me (and good for the user) they found a solution that didn't involve installing a new upload tool. However, could I follow the approach suggested in that thread? I.E. go back in time and find an old upload.[py | xml] and use that as a starting point for my own custom upload tool? How far back in time would I have to go to find an upload.py that was a standalone tool? Cheers, Keith ------------------------------ Research Associate Department of Computer Science Vassar College Poughkeepsie, NY

5 9

(no subject)
by Jager, Victor de 04 Apr '16

04 Apr '16

Dear Galaxy Team, I'm trying to install the repeatexplorer tool https://bitbucket.org/repeatexplorer/ I get the following message that I cannot solve. it does not seem to be releated to the repeatexplorer tool itself since it is not using MPI as far as I can tell although it does not seem to happen with other tools at the galaxy instance. ERROR: ld.so: object '/usr/lib/openmpi/lib/libmpi.so' from LD_PRELOAD cannot be preloaded (wrong ELF class: ELFCLASS64): ignored. note: /usr/lib/openmpi/lib/libmpi.so exists and is a 64 bits lib I've tried unsetting the LD_PRELOAD library for the galaxy user but that did not help,. According to the logs it looks like this error occurs after the job finishes. I would appreciate any clues on how to debug this and to find out where this message comes from. below the snippet from the logfiles: galaxy.jobs DEBUG 2016-04-04 11:22:40,544 (1829) Working directory for job is: /mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829 galaxy.jobs.handler DEBUG 2016-04-04 11:22:40,556 (1829) Dispatching to drmaa runner galaxy.jobs DEBUG 2016-04-04 11:22:40,760 (1829) Persisting job destination (destination id: sge_default) galaxy.jobs.runners DEBUG 2016-04-04 11:22:40,765 Job [1829] queued (207.994 ms) galaxy.jobs.handler INFO 2016-04-04 11:22:40,808 (1829) Job dispatched galaxy.jobs.runners DEBUG 2016-04-04 11:22:41,841 (1829) command is: bash /mnt/data/home/NIOO/galaxy/galaxy-dist/tools/umbr_programs/seqclust/seqclust-main.sh -s /mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3137.dat -m 0.01 -o 40 -d Viridiplantae -v /mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3173.dat -w /mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3174.dat -y /mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3175.dat -z RMSKtable -r /mnt/data/home/NIOO/galaxy/galaxy-dist -t /mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3176.dat -u '/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/dataset_3176_files' -p false -f 0 -a True -l 55 -x " " -K 10; return_code=$?; python "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/set_metadata_VcdaXP.py" "/tmp/tmpOOJhc4" "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/galaxy.json" "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_in_HistoryDatasetAssociation_2937_ivd_QV,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_kwds_HistoryDatasetAssociation_2937__9U8lt,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_out_HistoryDatasetAssociation_2937_zmXF2T,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_results_HistoryDatasetAssociation_2937_XHZd2p,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3176.dat,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_override_HistoryDatasetAssociation_2937_0_rQHI" "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_in_HistoryDatasetAssociation_2936_2FIF61,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_kwds_HistoryDatasetAssociation_2936__PZplz,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_out_HistoryDatasetAssociation_2936_ImcuR2,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_results_HistoryDatasetAssociation_2936_Jm3zxC,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3175.dat,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_override_HistoryDatasetAssociation_2936_qkgfR7" "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_in_HistoryDatasetAssociation_2935_5Ozbvu,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_kwds_HistoryDatasetAssociation_2935_H_7TWw,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_out_HistoryDatasetAssociation_2935_Rp42fp,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_results_HistoryDatasetAssociation_2935_ycng_Q,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3174.dat,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_override_HistoryDatasetAssociation_2935_gbk6Im" "/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_in_HistoryDatasetAssociation_2934_wM1GtU,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_kwds_HistoryDatasetAssociation_2934_pUrJqr,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_out_HistoryDatasetAssociation_2934__8Jvh6,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_results_HistoryDatasetAssociation_2934_n_AZt2,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/files/003/dataset_3173.dat,/mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/metadata_override_HistoryDatasetAssociation_2934_ovKSAZ" 5242880; sh -c "exit $return_code" galaxy.jobs.runners.drmaa DEBUG 2016-04-04 11:22:41,890 (1829) submitting file /mnt/data/home/NIOO/galaxy/galaxy-dist/database/job_working_directory/001/1829/galaxy_1829.sh galaxy.jobs.runners.drmaa INFO 2016-04-04 11:22:41,900 (1829) queued as 9507 galaxy.jobs DEBUG 2016-04-04 11:22:41,950 (1829) Persisting job destination (destination id: sge_default) galaxy.jobs.runners.drmaa DEBUG 2016-04-04 11:22:42,159 (1829/9507) state change: job is queued and active galaxy.jobs.runners.drmaa DEBUG 2016-04-04 11:22:44,286 (1829/9507) state change: job is running galaxy.jobs.runners.drmaa DEBUG 2016-04-04 11:47:59,005 (1829/9507) state change: job finished normally galaxy.jobs DEBUG 2016-04-04 11:47:59,500 setting dataset state to ERROR galaxy.jobs DEBUG 2016-04-04 11:47:59,527 setting dataset state to ERROR galaxy.jobs DEBUG 2016-04-04 11:47:59,559 setting dataset state to ERROR galaxy.jobs DEBUG 2016-04-04 11:47:59,602 setting dataset state to ERROR galaxy.jobs INFO 2016-04-04 11:47:59,779 Collecting job metrics for <galaxy.model.Job object at 0x7f3f346d89d0> galaxy.jobs DEBUG 2016-04-04 11:47:59,798 job 1829 ended (finish() executed in (595.557 ms))

2 1

MySQL & ToolShed installs: 'latin-1' codec can't encode character
by Peter Cock 04 Apr '16

04 Apr '16

Hello all, We just ran into a Tool Shed installation problem under a test installation of Galaxy v16.01, while trying to install the meme_fimo tool. Clicking through the GUI takes me to the failed install of the perl_xml_parser_expat version 2.41 package (under package_perl_xml_parser_expat_2_41), https://toolshed.g2.bx.psu.edu/view/iuc/package_perl_xml_parser_expat_2_41v… https://github.com/galaxyproject/tools-iuc/blob/master/packages/package_per… The Admin GUI shows this long stack trace error: File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/galaxy_install/install_manager.py", line 123, in install_and_build_package_via_fabric tool_dependency = self.install_and_build_package( install_environment, tool_dependency, actions_dict ) File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/galaxy_install/install_manager.py", line 81, in install_and_build_package initial_download=True ) File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/galaxy_install/tool_dependencies/recipe/recipe_manager.py", line 31, in execute_step initial_download=initial_download ) File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/galaxy_install/tool_dependencies/recipe/step_handler.py", line 1253, in execute_step job_name=package_name) File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/galaxy_install/tool_dependencies/recipe/install_environment.py", line 140, in handle_command error_message=error_message) File "/mnt/qnap/galaxy/galaxy-dist/lib/tool_shed/util/tool_dependency_util.py", line 390, in set_tool_dependency_attributes sa_session.flush() File "/mnt/shared/galaxy/galaxy-dist/.venv/lib/python2.7/site-packages/sqlalchemy/orm/scoping.py", line 150, in do return getattr(self.registry(), name)(*args, **kwargs) ... File "/mnt/shared/galaxy/galaxy-dist/.venv/lib/python2.7/site-packages/MySQLdb/cursors.py", line 187, in execute query = query % tuple([db.literal(item) for item in args]) File "/mnt/shared/galaxy/galaxy-dist/.venv/lib/python2.7/site-packages/MySQLdb/connections.py", line 278, in literal return self.escape(o, self.encoders) File "/mnt/shared/galaxy/galaxy-dist/.venv/lib/python2.7/site-packages/MySQLdb/connections.py", line 208, in unicode_literal return db.literal(u.encode(unicode_literal.charset)) 'latin-1' codec can't encode character u'\u2018' in position 1070: ordinal not in range(256) This is the left single quotation mark (U+2018), which I think comes from the failed installation log: $ tail /mnt/shared/galaxy/tool_dependency_dir/perl_xml_parser_expat/2.41/iuc/package_perl_xml_parser_expat_2_41/1ce3818a8eb9/INSTALLATION.log Expat.xs:2179: error: ‘parser’ undeclared (first use in this function) Expat.xs:2180: error: ‘CallbackVector’ has no member named ‘st_serial’ Expat.xs:2182: error: ‘CallbackVector’ has no member named ‘skip_until’ Expat.c: In function ‘XS_XML__Parser__Expat_Do_External_Parse’: Expat.c:2904: error: ‘XML_Parser’ undeclared (first use in this function) Expat.c:2904: error: expected ‘;’ before ‘parser’ Expat.xs:2194: error: ‘parser’ undeclared (first use in this function) make[1]: *** [Expat.o] Error 1 make: *** [subdirs] Error 2 ############################################# Note those fancy quote characters? Yep: $ hexdump -C /mnt/shared/galaxy/tool_dependency_dir/perl_xml_parser_expat/2.41/iuc/package_perl_xml_parser_expat_2_41/1ce3818a8eb9/INSTALLATION.log | tail -n 15 00022e90 6f 72 3a 20 65 78 70 65 63 74 65 64 20 e2 80 98 |or: expected ...| 00022ea0 3b e2 80 99 20 62 65 66 6f 72 65 20 e2 80 98 70 |;... before ...p| 00022eb0 61 72 73 65 72 e2 80 99 0a 45 78 70 61 74 2e 78 |arser....Expat.x| 00022ec0 73 3a 32 31 39 34 3a 20 65 72 72 6f 72 3a 20 e2 |s:2194: error: .| 00022ed0 80 98 70 61 72 73 65 72 e2 80 99 20 75 6e 64 65 |..parser... unde| 00022ee0 63 6c 61 72 65 64 20 28 66 69 72 73 74 20 75 73 |clared (first us| 00022ef0 65 20 69 6e 20 74 68 69 73 20 66 75 6e 63 74 69 |e in this functi| 00022f00 6f 6e 29 0a 6d 61 6b 65 5b 31 5d 3a 20 2a 2a 2a |on).make[1]: ***| 00022f10 20 5b 45 78 70 61 74 2e 6f 5d 20 45 72 72 6f 72 | [Expat.o] Error| 00022f20 20 31 0a 6d 61 6b 65 3a 20 2a 2a 2a 20 5b 73 75 | 1.make: *** [su| 00022f30 62 64 69 72 73 5d 20 45 72 72 6f 72 20 32 0a 23 |bdirs] Error 2.#| 00022f40 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 |################| * 00022f60 23 23 23 23 23 23 23 23 23 23 23 23 0a |############.| 00022f6d Notice the sequence in hex of e2 80 98, that's the UTF-8 (hex) for the problem character. We also have e2 80 99 which is the matching right single quote. While I can go over the full INSTALLATION.log to work out what might be wrong, there is clearly a Galaxy problem with the UTF-8 encoded character. Going over the Galaxy mailing list there have been similar problems (although not ToolShed related) reported in the past (2013) with MySQL and the table encodings: http://dev.list.galaxyproject.org/error-with-unicode-output-td4662783.html Are there still known issues with encodings and the MySQL galaxy schema? Are we likely to run into other corner cases with MySQL where we would be better off switching to PostgreSQL? Regards, Peter

1 1

init scripts version 16.01
by Eric Kuyt 02 Apr '16

02 Apr '16

Hey guys, today I updated to the latest version of galaxy. No I noticed that because of the new virtualenv/wheel startup procedure, the init scripts as mentioned here https://wiki.galaxyproject.org/Events/GCC2012/TrainingDay/WS5?highlight=%28… are not working anymore. Whet is the new startup procedure? Thanks Eric Kuijt -- Central Veterinary Institute of Wageningen UR (CVI) Department of Infection Biology PO box 65, 8200 AB Lelystad, NL Visiting address: ASG, Edelhertweg 15, 8219 PH Lelystad Tel: +31-(0)320-293391 Fax: +31-(0)320-238153 E-mail: eric.kuijt(a)wur.nl Web: http://www.cvi.wur.nl

2 2