May 2017 - galaxy-dev - lists.galaxyproject.org

Shiny in Galaxy
by Mohamed Kassam 26 May '17

26 May '17

Dear all, I have a shiny application working in my RStudio, but I would like to integrate it to Galaxy that the users can call my application via Galaxy . Thanks in Advance, Mohamed

2 1

protein ligand docking
by Matthias Bernt 24 May '17

24 May '17

Dear list, I have recently evaluated the software for protein docking that is available in the toolshed. I could need some help / suggestions. 1. autodock_vina The receptor of my example contains Au atoms which are not understood by autodock_vina. For autodock there is the possibility to add configuration for atoms: http://autodock.scripps.edu/faqs-help/how-to/adding-new-atom-parameters-to-… Does somebody know if this is also possible for autodock_vina in galaxy? In my pdb file there are CONECT lines which cause autodock_vina to abort. If I remove them the program runs (when the Au atoms are also removed). So this is the smaller problem (Maybe this can be solved by extending openbabel). 2. rdock Fails with a memory access failure /gpfs1/data/galaxy_server/galaxy-dev/database/dependencies/_conda/envs/__rDock(a)2013.1/bin/rbcavity: Zeile 7: 104454 Speicherzugriffsfehler (Speicherabzug geschrieben) "$RBT_ROOT/bin/$PROGNAME" "$@" 3. caddsuite_workflows + caddsuite_linux_x86_64 The installation of the workflows works, but I do not see them in galaxy? The installation of the other package fails with: No information is available for the requested repository revision. One or more of the following parameter values is likely invalid: tool_shed_url: https://toolshed.g2.bx.psu.edu/ name: caddsuite_linux_x86_64 owner: marcel changeset_revision: 026f5a483650 err_code: 400008 4. BALL I just tested one tool of the suite: ProteinProtonator. This fails with command not found. Fatal error: Exit code 127 () /gpfs1/data/galaxy_server/galaxy-dev/jobs_dir/000/165/tool_script.sh: Zeile 9: ProteinProtonator: Kommando nicht gefunden. Are there any suggestion on how to solve these problems or other options for docking with galaxy. Cheers, Matthias -- ------------------------------------------- Matthias Bernt Bioinformatics Service Molekulare Systembiologie (MOLSYB) Helmholtz-Zentrum für Umweltforschung GmbH - UFZ/ Helmholtz Centre for Environmental Research GmbH - UFZ Permoserstraße 15, 04318 Leipzig, Germany Phone +49 341 235 482296, m.bernt(a)ufz.de, www.ufz.de Sitz der Gesellschaft/Registered Office: Leipzig Registergericht/Registration Office: Amtsgericht Leipzig Handelsregister Nr./Trade Register Nr.: B 4703 Vorsitzender des Aufsichtsrats/Chairman of the Supervisory Board: MinDirig Wilfried Kraus Wissenschaftlicher Geschäftsführer/Scientific Managing Director: Prof. Dr. Dr. h.c. Georg Teutsch Administrative Geschäftsführerin/ Administrative Managing Director: Prof. Dr. Heike Graßmann -------------------------------------------

1 0

python subprocess OSError when running bwa-mem
by Georgios Nikolis 24 May '17

24 May '17

2 3

Decrease Galaxy polling of slurm?
by Philip Blood 24 May '17

24 May '17

An admin at our center noticed our Galaxy instance is polling slurm every second and asked if the polling frequency can be decreased. Is there an easy way to do this? Phil -- Philip D. Blood, Ph.D. Senior Computational Scientist Voice: (412) 268-9329 Pittsburgh Supercomputing Center Fax: (412) 268-5832 Carnegie Mellon University Email: blood(a)psc.edu

2 2

vcftools - errors running vcf-merge
by Poole, Richard 24 May '17

24 May '17

Hi all, I am trying to run the vcf-merge tool, which depends on the vcftools 0.1.11 package. I have this vcftools package and also the required tabix 0.2.6 both installed via the toolshed (tabix is set in the PATH of the Galaxy startup script). However, I keep getting gunzip error messages such as the following: Log: tool progress gunzip: error writing to output: Broken pipe gunzip: 0.vcf.sorted.gz: uncompress failed Using column name 'mutant' for 0.vcf.sorted.gz:mutant Using column name 'sibling' for 0.vcf.sorted.gz:sibling gunzip: error writing to output: Broken pipe gunzip: 1.vcf.sorted.gz: uncompress failed Using column name '1.vcf.sorted_mutant' for 1.vcf.sorted.gz:mutant Using column name '1.vcf.sorted_sibling' for 1.vcf.sorted.gz:sibling Does anyone have any idea how to solve this? The command that the wrapper is generating is: vcf-sort /Volumes/ngs/database/files/058/dataset_58073.dat > 0.vcf.sorted ; bgzip 0.vcf.sorted ; tabix -p vcf 0.vcf.sorted.gz ; vcf-sort /Volumes/ngs/database/files/058/dataset_58078.dat > 1.vcf.sorted ; bgzip 1.vcf.sorted ; tabix -p vcf 1.vcf.sorted.gz ; vcf-merge 0.vcf.sorted.gz 1.vcf.sorted.gz > /Volumes/ngs/database/files/058/dataset_58489.dat Thanks, Richard

1 0

cluster access
by Matthias Bernt 22 May '17

22 May '17

Dear list, I'm just starting to get jobs submitted to our cluster as real system user. I read in the documentation that the name of the system user is determined by "the Galaxy user's email address (with the @domain stripped off)". But this does not work on our system, rather the username stored in the galaxy_user table is the name of the user (this is correctly generated by the LDAP login). The job runner script seems to get the user id, so I guess I need to dig deeper. So my question is: Where could I change this behavior? Thanks a lot. Cheers, Matthias -- ------------------------------------------- Matthias Bernt Bioinformatics Service Molekulare Systembiologie (MOLSYB) Helmholtz-Zentrum für Umweltforschung GmbH - UFZ/ Helmholtz Centre for Environmental Research GmbH - UFZ Permoserstraße 15, 04318 Leipzig, Germany Phone +49 341 235 482296, m.bernt(a)ufz.de, www.ufz.de Sitz der Gesellschaft/Registered Office: Leipzig Registergericht/Registration Office: Amtsgericht Leipzig Handelsregister Nr./Trade Register Nr.: B 4703 Vorsitzender des Aufsichtsrats/Chairman of the Supervisory Board: MinDirig Wilfried Kraus Wissenschaftlicher Geschäftsführer/Scientific Managing Director: Prof. Dr. Dr. h.c. Georg Teutsch Administrative Geschäftsführerin/ Administrative Managing Director: Prof. Dr. Heike Graßmann -------------------------------------------

2 4

OpenBabel Requirements
by Matthias Bernt 22 May '17

22 May '17

Dear galaxy-dev list, I have problems to install package_openbabel. The problem seems to be that cmake is not found during installation. The documentation also states that: "Compiling OpenBabel requires g++ and CMake 2.4+" My question is: Does this refer to cmake installed on the system or in galaxy (since there is also package_cmake_3_2_3)? Thanks a lot. Cheers, Matthias

2 6

Which ID ('id', 'workflow_id', and 'dataset_id') should be used?
by Aarthi Mohan 22 May '17

22 May '17

Hi all, I will appreciate your help in understanding the 'id' key returned from the API. I am using Galaxy Version 15.03 & bioblend Version 0.8.0. Example: I have highlighted the id and related fields with bold and red. >>> workflowClient.get_invocations('f7bb1edd6b95db62') > [{u'inputs': {u'1': {u'src': u'hda', u'id': u'06d9fe130fbe098e'}}, > u'update_time': u'2017-05-17T03:09:10', u'uuid': > u'fd066a98-3aad-11e7-90e9-1cc1de6d5ef4', u'history_id': > u'b8a0d6158b9961df', u'state': u'scheduled', *u'workflow_id': > u'915ae9a80309f157'*, u'steps': > ... > u'model_class': u'WorkflowInvocation', *u'id': u'8c49be448cfe29bc'*}] Why is the '*workflow_id*' different from the one I passed to the fucntion? And why is that '*workflow_id' *is not found anywhere in the return value? >>> historyClient.show_dataset(hid,'468b2dfe96a5a9a1') > {u'accessible': True, u'resubmitted': False, u'create_time': > u'2017-05-17T03:04:02', u'download_url': > u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1/display', > u'file_size': 545, *u'dataset_id': u'56c890cbef28295c', u'id': > u'468b2dfe96a5a9a1'*, u'misc_info': u'uploaded fastqsanger file', > u'hda_ldda': u'hda', u'metadata_sequences': 5, u'state': u'ok', > u'display_types': [], u'display_apps': [], u'type': u'file', u'file_path': > None, u'misc_blurb': u'5 sequences', u'peek': u'<table cellspacing="0" > cellpadding="3"><tr><td>@1</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr><tr><td>+</td></tr><tr><td>IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII</td></tr><tr><td>@2</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr></table>', > u'update_time': u'2017-05-17T03:04:06', u'data_type': > u'galaxy.datatypes.sequence.FastqSanger', u'tags': [], u'deleted': False, > u'history_id': u'b8a0d6158b9961df', u'meta_files': [], u'genome_build': > u'?', u'hid': 1, u'model_class': u'HistoryDatasetAssociation', > u'metadata_data_lines': 20, u'file_ext': u'fastqsanger', u'annotation': > None, u'metadata_dbkey': u'?', u'history_content_type': u'dataset', *u'name': > u'a_1.fastq'*, u'extension': u'fastqsanger', u'visible': True, u'url': > u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1', u'uuid': > u'aa6dcf49-6fe9-49e0-8064-c8bc275a37d5', u'visualizations': [], u'purged': > False, u'api_type': u'file'} > >>> historyClient.show_dataset(hid,'56c890cbef28295c') > {u'accessible': True, u'resubmitted': False, u'create_time': > u'2017-05-17T02:59:27', u'file_size': 64, *u'dataset_id': > u'9ccf9e6f1cf4d1fa', u'id': u'56c890cbef28295c'*, u'misc_info': > u'##fileformat=VCFv4.1\n##FILTER=<ID=PASS,Description="All filters > passed">\n##fileDate=20170517\n##source=freeBayes > v0.9.20\n##reference=localref.fa\n##phasing=none\n##commandline="freebayes > --bam localbam_0.bam --fasta-reference localref.fa --vcf /home/sphadmi', > u'hda_ldda': u'hda', u'download_url': > u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c/display', > u'state': u'ok', u'display_types': [], u'display_apps': [], u'type': > u'file', u'file_path': None, u'misc_blurb': u'0 lines', u'peek': u'<table > cellspacing="0" cellpadding="3"><tr><td>#Calculation and writing of high > density regions has completed.</td></tr></table>', u'update_time': > u'2017-05-17T02:59:36', u'data_type': u'galaxy.datatypes.data.Text', > u'tags': [], u'deleted': False, u'history_id': u'06ec17aefa2d49dd', > u'meta_files': [], u'genome_build': u'?', u'hid': 44, u'model_class': > u'HistoryDatasetAssociation', u'metadata_data_lines': None, u'file_ext': > u'txt', u'annotation': None, u'metadata_dbkey': u'?', > u'history_content_type': u'dataset', *u'name': u'High density regions',* > u'extension': u'txt', u'visible': False, u'url': > u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c', u'uuid': > u'8b8c70a4-cd2e-43d3-bc77-b06511557c96', u'visualizations': [], u'purged': > False, u'api_type': u'file'} Similarly, here the '*dataset_id' *is different from the one I passed to *show_dataset* method. If I check the '*dataset_id*' from first call, it points to another different file! Please let me know which of these 'id' should be used and what would be the purpose of the other id? Thanks for your help and time! Best, Aarthi

2 2

Problem with dataset not being cleaned.
by C. Ch. 17 May '17

17 May '17

Hi all, I have the problem that there are a lot of files that are not deleted in the database/files dir. Among these files I have failed uploads and duplicated library files. The latter do not correspond to new versions of existing datasets. I have run the cleanup_datasets.py script but I still have files dating back a year that are in this condition. I have no clue as why/how this could have happened. The galaxy instance is installed on a cluster with the filesystem on a NAS. I have been running 16.01 on this instance (will update as soon as I can stop the service). Could anyone suggest a way to identify those files that have to be in database/files so that I can delete all the rest?? Thanks in advance! Cristian

1 0

Project Publication Reference Tracking Tool -- are you interested in?
by Krzysztof Kutt 15 May '17

15 May '17

Hi! We do not know each other yet, so I will briefly introduce myself. I'm Chris, a Polish PhD candidate in Computer Science field at AGH University of Science and Technology in Krakow. In my work I deal with the broad concept of artificial intelligence. In particular the semantic web technologies (RDF, SPARQL, Linked Data) and the ability to support a group of knowledge engineers who create knowledge inside (semantic) wiki systems - in my PhD I propose some methods and prototypical tools for quality management, change management and motivation. I have also finished the Master's degree in Psychology and as a result I also deal with Affective Computing field. I know, I'm quite far away from bioinformatics :) so, what I am doing here? As a part of Google Summer of Code <https://summerofcode.withgoogle.com/> program I will prepare a tool to keep track of publications that reference a specific project (project's papers, tools, etc). I think that at the end it will be a quite good tool that any researcher can use for dealing with the task, regardless of the research field. Specifically, it will be a set of Python scripts + GUI that will do four tasks: 1) performs database search for new projects (search terms), 2) handles alerts for updating the results later, 3) gives the user the possibility to manually annotate results (e.g. as irrelevant), 4) generates citation reports (e.g. list of papers that cite our project during last year). If you are interested in such a tool, do not hesitate to: * read the more detailed description placed in the project's github wiki: https://github.com/kkutt/references-tracking/wiki/Tool-Description * discuss it on the Gitter channel: https://gitter.im/references- tracking/Lobby or simply write me an e-mail We already have interest from members of the Galaxy, Reactome, InterMine, and BioPython communities. I am waiting for your comments :) If you are not interested in a project, maybe your colleagues are? :) Best regards, Chris Kutt

3 2