- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 3004: Add test for library tarball downloads
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/4f923033e9d0 changeset: 3004:4f923033e9d0 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 15:10:43 2009 -0500 description: Add test for library tarball downloads diffstat: test/base/twilltestcase.py | 60 ++++++++++++++++++++++++++++- test/functional/test_security_and_libraries.py | 9 ++++ 2 files changed, 66 insertions(+), 3 deletions(-) diffs (110 lines): diff -r d5fd27771019 -r 4f923033e9d0 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Tue Nov 10 15:04:03 2009 -0500 +++ b/test/base/twilltestcase.py Tue Nov 10 15:10:43 2009 -0500 @@ -1,7 +1,7 @@ import pkg_resources pkg_resources.require( "twill==0.9" ) -import StringIO, os, sys, random, filecmp, time, unittest, urllib, logging, difflib, zipfile, tempfile, re +import StringIO, os, sys, random, filecmp, time, unittest, urllib, logging, difflib, tarfile, zipfile, tempfile, re, shutil from itertools import * import twill @@ -736,8 +736,8 @@ errmsg = "no match to '%s'\npage content written to '%s'" % ( patt, fname ) raise AssertionError( errmsg ) - def write_temp_file( self, content ): - fd, fname = tempfile.mkstemp( suffix='.html', prefix='twilltestcase-' ) + def write_temp_file( self, content, suffix='.html' ): + fd, fname = tempfile.mkstemp( suffix=suffix, prefix='twilltestcase-' ) f = os.fdopen( fd, "w" ) f.write( content ) f.close() @@ -1616,6 +1616,60 @@ self.check_page_for_string( check_str_after_submit ) self.library_wait( library_id, controller='library' ) self.home() + def download_archive_of_library_files( self, library_id, ldda_ids, format ): + self.home() + self.visit_url( "%s/library/browse_library?obj_id=%s" % ( self.url, library_id ) ) + for ldda_id in ldda_ids: + tc.fv( "1", "ldda_ids", ldda_id ) + tc.fv( "1", "do_action", format ) + tc.submit( "action_on_datasets_button" ) + tc.code( 200 ) + archive = self.write_temp_file( self.last_page(), suffix=format ) + self.home() + return archive + def check_archive_contents( self, archive, lddas ): + def get_ldda_path( ldda ): + path = "" + parent_folder = ldda.library_dataset.folder + while parent_folder is not None: + if parent_folder.parent is None: + path = os.path.join( parent_folder.library_root[0].name, path ) + break + path = os.path.join( parent_folder.name, path ) + parent_folder = parent_folder.parent + path += ldda.name + return path + def mkdir( file ): + dir = os.path.join( tmpd, os.path.dirname( file ) ) + if not os.path.exists( dir ): + os.makedirs( dir ) + tmpd = tempfile.mkdtemp() + if tarfile.is_tarfile( archive ): + t = tarfile.open( archive ) + for n in t.getnames(): + mkdir( n ) + t.extract( n, tmpd ) + t.close() + elif zipfile.is_zipfile( archive ): + z = zipfile.open( archive ) + for n in z.namelist(): + mkdir( n ) + open( os.path.join( tmpd, n ), 'wb' ).write( z.read( n ) ) + z.close() + else: + raise Exception( 'Unable to read archive: %s' % archive ) + for ldda in lddas: + orig_file = self.get_filename( ldda.name ) + downloaded_file = os.path.join( tmpd, get_ldda_path( ldda ) ) + assert os.path.exists( downloaded_file ) + try: + self.files_diff( orig_file, downloaded_file ) + except AssertionError, err: + errmsg = 'Library item %s different than expected, difference:\n' % ldda.name + errmsg += str( err ) + errmsg += 'Unpacked archive remains in: %s\n' % tmpd + raise AssertionError( errmsg ) + shutil.rmtree( tmpd ) def delete_library_item( self, library_id, library_item_id, library_item_name, library_item_type='library_dataset' ): """Mark a library item as deleted""" self.home() diff -r d5fd27771019 -r 4f923033e9d0 test/functional/test_security_and_libraries.py --- a/test/functional/test_security_and_libraries.py Tue Nov 10 15:04:03 2009 -0500 +++ b/test/functional/test_security_and_libraries.py Tue Nov 10 15:10:43 2009 -0500 @@ -6,6 +6,7 @@ not_logged_in_security_msg = 'You must be logged in as an administrator to access this feature.' logged_in_security_msg = 'You must be an administrator to access this feature.' +import sys class TestSecurityAndLibraries( TwillTestCase ): def test_000_admin_features_when_not_logged_in( self ): """Testing admin_features when not logged in""" @@ -1385,6 +1386,14 @@ self.home() self.logout() self.login( email=admin_user.email ) + def test_167_download_archive_of_library_files( self ): + """Testing downloading an archive of files from the library""" + for format in ( 'tbz', 'tgz', 'zip' ): + archive = self.download_archive_of_library_files( str( library_one.id ), + ( str( ldda_one.id ), str( ldda_two.id ) ), + format ) + self.check_archive_contents( archive, ( ldda_one, ldda_two ) ) + os.remove( archive ) def test_170_mark_group_deleted( self ): """Testing marking a group as deleted""" # Logged in as admin_user

1 0

[hg] galaxy 3005: Fix for the broken test I just committed
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/6eddc13b1d3b changeset: 3005:6eddc13b1d3b user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 16:02:49 2009 -0500 description: Fix for the broken test I just committed diffstat: test/base/twilltestcase.py | 2 +- 1 files changed, 1 insertions(+), 1 deletions(-) diffs (12 lines): diff -r 4f923033e9d0 -r 6eddc13b1d3b test/base/twilltestcase.py --- a/test/base/twilltestcase.py Tue Nov 10 15:10:43 2009 -0500 +++ b/test/base/twilltestcase.py Tue Nov 10 16:02:49 2009 -0500 @@ -1651,7 +1651,7 @@ t.extract( n, tmpd ) t.close() elif zipfile.is_zipfile( archive ): - z = zipfile.open( archive ) + z = zipfile.ZipFile( archive, 'r' ) for n in z.namelist(): mkdir( n ) open( os.path.join( tmpd, n ), 'wb' ).write( z.read( n ) )

1 0

[hg] galaxy 3002: Upgrade to Routes 1.11
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/5a9b6c39d173 changeset: 3002:5a9b6c39d173 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 13:49:34 2009 -0500 description: Upgrade to Routes 1.11 diffstat: eggs.ini | 4 ++-- 1 files changed, 2 insertions(+), 2 deletions(-) diffs (21 lines): diff -r c146726d274f -r 5a9b6c39d173 eggs.ini --- a/eggs.ini Tue Nov 10 13:47:34 2009 -0500 +++ b/eggs.ini Tue Nov 10 13:49:34 2009 -0500 @@ -40,7 +40,7 @@ Paste = 1.5.1 PasteDeploy = 1.3.1 PasteScript = 1.3.6 -Routes = 1.6.3 +Routes = 1.11 simplejson = 1.5 SQLAlchemy = 0.5.6 sqlalchemy_migrate = 0.5.4 @@ -90,7 +90,7 @@ PasteDeploy = http://cheeseshop.python.org/packages/source/P/PasteDeploy/PasteDeploy-1.3.… PasteScript = http://cheeseshop.python.org/packages/source/P/PasteScript/PasteScript-1.3.… PSI = http://pypi.python.org/packages/source/P/PSI/PSI-0.3b1.1.tar.gz -Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.6.3.tar.gz +Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.11.tar.gz simplejson = http://cheeseshop.python.org/packages/source/s/simplejson/simplejson-1.5.ta… SQLAlchemy = http://pypi.python.org/packages/source/S/SQLAlchemy/SQLAlchemy-0.5.6.tar.gz sqlalchemy_migrate = http://pypi.python.org/packages/source/s/sqlalchemy-migrate/sqlalchemy-migr…

1 0

[hg] galaxy 3003: Remove the "unknown extension in data factory"...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d5fd27771019 changeset: 3003:d5fd27771019 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 15:04:03 2009 -0500 description: Remove the "unknown extension in data factory" messages diffstat: lib/galaxy/datatypes/registry.py | 2 -- 1 files changed, 0 insertions(+), 2 deletions(-) diffs (12 lines): diff -r 5a9b6c39d173 -r d5fd27771019 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Tue Nov 10 13:49:34 2009 -0500 +++ b/lib/galaxy/datatypes/registry.py Tue Nov 10 15:04:03 2009 -0500 @@ -219,8 +219,6 @@ builder = self.datatypes_by_extension[ext] except KeyError: builder = data.Text() - if ext is not None: - self.log.warning('unknown extension in data factory %s', ext) return builder def change_datatype(self, data, ext ):

1 0

[hg] galaxy 3001: Upgrade to Cheetah 2.2.2
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/c146726d274f changeset: 3001:c146726d274f user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 13:47:34 2009 -0500 description: Upgrade to Cheetah 2.2.2 diffstat: eggs.ini | 4 +- lib/galaxy/eggs/__init__.py | 1 + scripts/scramble/lib/get_platform.py | 18 ++++++ scripts/scramble/scripts/Cheetah-py2.5.py | 55 ------------------ scripts/scramble/scripts/Cheetah.py | 62 ++++++++++++++++++++ scripts/scramble/scripts/DRMAA_python.py | 1 + scripts/scramble/scripts/MySQL_python.py | 1 + scripts/scramble/scripts/generic.py | 1 + scripts/scramble/scripts/pbs_python.py | 1 + scripts/scramble/scripts/psycopg2.py | 1 + scripts/scramble/scripts/pysqlite.py | 1 + scripts/scramble/scripts/python_lzo.py | 1 + tools/filters/joiner.xml | 35 ++++++----- tools/maf/genebed_maf_to_fasta.xml | 7 +- tools/maf/interval2maf.xml | 10 +- tools/maf/interval_maf_to_merged_fasta.xml | 7 +- tools/maf/maf_to_fasta.xml | 6 +- tools/metag_tools/blat_wrapper.xml | 7 +- tools/metag_tools/shrimp_color_wrapper.xml | 6 +- tools/metag_tools/shrimp_wrapper.xml | 10 +- tools/samtools/pileup_parser.xml | 8 +- tools/sr_mapping/lastz_wrapper.xml | 18 +++--- tools/stats/aggregate_binned_scores_in_intervals.xml | 6 +- 23 files changed, 151 insertions(+), 116 deletions(-) diffs (485 lines): diff -r facf315d9e0e -r c146726d274f eggs.ini --- a/eggs.ini Tue Nov 10 13:46:53 2009 -0500 +++ b/eggs.ini Tue Nov 10 13:47:34 2009 -0500 @@ -13,7 +13,7 @@ [eggs:platform] bx_python = 0.5.0 -Cheetah = 1.0 +Cheetah = 2.2.2 DRMAA_python = 0.2 MySQL_python = 1.2.2 pbs_python = 2.9.4 @@ -66,7 +66,7 @@ ; source location, necessary for scrambling [source] bx_python = http://bitbucket.org/james_taylor/bx-python/get/4bf1f32e6b76.bz2 -Cheetah = http://voxel.dl.sourceforge.net/sourceforge/cheetahtemplate/Cheetah-1.0.tar… +Cheetah = http://pypi.python.org/packages/source/C/Cheetah/Cheetah-2.2.2.tar.gz DRMAA_python = http://gridengine.sunsource.net/files/documents/7/36/DRMAA-python-0.2.tar.gz MySQL_python = http://superb-west.dl.sourceforge.net/sourceforge/mysql-python/MySQL-python… http://downloads.mysql.com/archives/mysql-5.0/mysql-5.0.67.tar.gz pbs_python = http://ftp.sara.nl/pub/outgoing/pbs_python-2.9.4.tar.gz diff -r facf315d9e0e -r c146726d274f lib/galaxy/eggs/__init__.py --- a/lib/galaxy/eggs/__init__.py Tue Nov 10 13:46:53 2009 -0500 +++ b/lib/galaxy/eggs/__init__.py Tue Nov 10 13:47:34 2009 -0500 @@ -140,6 +140,7 @@ cmd = "ssh %s 'cd %s; %s -ES %s'" % ( self.build_host, self.buildpath, self.python, "scramble.py" ) else: cmd = "%s -ES %s" % ( self.python, "scramble.py" ) + log.debug( 'Executing: %s' % cmd ) p = subprocess.Popen( args = cmd, shell = True, cwd = self.buildpath ) r = p.wait() if r != 0: diff -r facf315d9e0e -r c146726d274f scripts/scramble/lib/get_platform.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/scripts/scramble/lib/get_platform.py Tue Nov 10 13:47:34 2009 -0500 @@ -0,0 +1,18 @@ +""" +Monkeypatch get_platform since it's broken on OS X versions of Python 2.5 +""" +import os, sys +from distutils.sysconfig import get_config_vars +if sys.platform == 'darwin' and get_config_vars().get('UNIVERSALSDK', '').strip(): + # Has to be before anything imports pkg_resources + def _get_platform_monkeypatch(): + plat = distutils.util._get_platform() + if plat.startswith( 'macosx-' ): + plat = 'macosx-10.3-fat' + return plat + import distutils.util + try: + assert distutils.util._get_platform + except: + distutils.util._get_platform = distutils.util.get_platform + distutils.util.get_platform = _get_platform_monkeypatch diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/Cheetah-py2.5.py --- a/scripts/scramble/scripts/Cheetah-py2.5.py Tue Nov 10 13:46:53 2009 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,55 +0,0 @@ -import os, sys, shutil - -# change back to the build dir -if os.path.dirname( sys.argv[0] ) != "": - os.chdir( os.path.dirname( sys.argv[0] ) ) - -# find setuptools -scramble_lib = os.path.join( "..", "..", "..", "lib" ) -sys.path.append( scramble_lib ) -from ez_setup import use_setuptools -use_setuptools( download_delay=8, to_dir=scramble_lib ) -from setuptools import * - -# get the tag -if os.access( ".galaxy_tag", os.F_OK ): - tagfile = open( ".galaxy_tag", "r" ) - tag = tagfile.readline().strip() -else: - tag = None - -# in case you're running this by hand from a dirty module source dir -for dir in [ "build", "dist" ]: - if os.access( dir, os.F_OK ): - print "scramble_it.py: removing dir:", dir - shutil.rmtree( dir ) - -# patch -for file in [ "src/NameMapper.py", "src/Tests/NameMapper.py" ]: - if not os.access( "%s.orig" %file, os.F_OK ): - print "scramble_it(): Patching", file - shutil.copyfile( file, "%s.orig" %file ) - i = open( "%s.orig" %file, "r" ) - o = open( file, "w" ) - for line in i.readlines(): - if line.startswith("__author__ ="): - print >>o, "from __future__ import generators" - elif line == "from __future__ import generators\n": - continue - print >>o, line, - i.close() - o.close() - -# reset args for distutils -me = sys.argv[0] -sys.argv = [ me ] -sys.argv.append( "egg_info" ) -if tag is not None: - #sys.argv.append( "egg_info" ) - sys.argv.append( "--tag-build=%s" %tag ) -# svn revision (if any) is handled directly in tag-build -sys.argv.append( "--no-svn-revision" ) -sys.argv.append( "bdist_egg" ) - -# do it -execfile( "setup.py", globals(), locals() ) diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/Cheetah.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/scripts/scramble/scripts/Cheetah.py Tue Nov 10 13:47:34 2009 -0500 @@ -0,0 +1,62 @@ +import os, sys, shutil + +# change back to the build dir +if os.path.dirname( sys.argv[0] ) != "": + os.chdir( os.path.dirname( sys.argv[0] ) ) + +# find setuptools +scramble_lib = os.path.join( "..", "..", "..", "lib" ) +sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 +from ez_setup import use_setuptools +use_setuptools( download_delay=8, to_dir=scramble_lib ) +from setuptools import * + +# get the tag +if os.access( ".galaxy_tag", os.F_OK ): + tagfile = open( ".galaxy_tag", "r" ) + tag = tagfile.readline().strip() +else: + tag = None + +# in case you're running this by hand from a dirty module source dir +for dir in [ "build", "dist" ]: + if os.access( dir, os.F_OK ): + print "scramble_it.py: removing dir:", dir + shutil.rmtree( dir ) + +# patch +file = "SetupConfig.py" +if not os.access( "%s.orig" %file, os.F_OK ): + print "scramble.py(): Patching", file + shutil.copyfile( file, "%s.orig" %file ) + i = open( "%s.orig" %file, "r" ) + o = open( file, "w" ) + comment = False + for line in i.readlines(): + if line == " install_requires = [\n": + comment = True + print >>o, "#" + line, + elif comment and line == " ]\n": + comment = False + print >>o, "#" + line, + elif comment: + print >>o, "#" + line, + else: + print >>o, line, + i.close() + o.close() + +# reset args for distutils +me = sys.argv[0] +sys.argv = [ me ] +sys.argv.append( "egg_info" ) +if tag is not None: + #sys.argv.append( "egg_info" ) + sys.argv.append( "--tag-build=%s" %tag ) +# svn revision (if any) is handled directly in tag-build +sys.argv.append( "--no-svn-revision" ) +sys.argv.append( "bdist_egg" ) + +# do it +execfile( "setup.py", globals(), locals() ) diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/DRMAA_python.py --- a/scripts/scramble/scripts/DRMAA_python.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/DRMAA_python.py Tue Nov 10 13:47:34 2009 -0500 @@ -12,6 +12,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 try: from setuptools import * import pkg_resources diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/MySQL_python.py --- a/scripts/scramble/scripts/MySQL_python.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/MySQL_python.py Tue Nov 10 13:47:34 2009 -0500 @@ -57,6 +57,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 from ez_setup import use_setuptools use_setuptools( download_delay=8, to_dir=scramble_lib ) from setuptools import * diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/generic.py --- a/scripts/scramble/scripts/generic.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/generic.py Tue Nov 10 13:47:34 2009 -0500 @@ -7,6 +7,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 from ez_setup import use_setuptools use_setuptools( download_delay=8, to_dir=scramble_lib ) from setuptools import * diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/pbs_python.py --- a/scripts/scramble/scripts/pbs_python.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/pbs_python.py Tue Nov 10 13:47:34 2009 -0500 @@ -12,6 +12,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 try: from setuptools import * import pkg_resources diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/psycopg2.py --- a/scripts/scramble/scripts/psycopg2.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/psycopg2.py Tue Nov 10 13:47:34 2009 -0500 @@ -59,6 +59,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 try: from setuptools import * import pkg_resources diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/pysqlite.py --- a/scripts/scramble/scripts/pysqlite.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/pysqlite.py Tue Nov 10 13:47:34 2009 -0500 @@ -21,6 +21,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 try: from setuptools import * import pkg_resources diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/python_lzo.py --- a/scripts/scramble/scripts/python_lzo.py Tue Nov 10 13:46:53 2009 -0500 +++ b/scripts/scramble/scripts/python_lzo.py Tue Nov 10 13:47:34 2009 -0500 @@ -54,6 +54,7 @@ # find setuptools scramble_lib = os.path.join( "..", "..", "..", "lib" ) sys.path.append( scramble_lib ) +import get_platform # fixes fat python 2.5 try: from setuptools import * import pkg_resources diff -r facf315d9e0e -r c146726d274f tools/filters/joiner.xml --- a/tools/filters/joiner.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/filters/joiner.xml Tue Nov 10 13:47:34 2009 -0500 @@ -52,24 +52,25 @@ <configfiles> <configfile name="fill_options_file"><% import simplejson -%>#set $__fill_options = {} +%> +#set $__fill_options = {} #if $fill_empty_columns['fill_empty_columns_switch'] == 'fill_empty': -#set $__fill_options['fill_unjoined_only'] = $fill_empty_columns['fill_columns_by'].value == 'fill_unjoined_only' -#if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'single_fill_value': -#set $__start_fill = $fill_empty_columns['do_fill_empty_columns']['fill_value'].value -#else: -#set $__start_fill = "" -#end if -#set $__fill_options['file1_columns'] = [ $__start_fill for i in range( int( $input1.metadata.columns ) ) ] -#set $__fill_options['file2_columns'] = [ $__start_fill for i in range( int( $input2.metadata.columns ) ) ] -#if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'fill_value_by_column': -#for column_fill1 in $fill_empty_columns['do_fill_empty_columns']['column_fill1']: -#set $__fill_options['file1_columns'][ int( column_fill1['column_number1'].value ) - 1 ] = column_fill1['fill_value1'].value -#end for -#for column_fill2 in $fill_empty_columns['do_fill_empty_columns']['column_fill2']: -#set $__fill_options['file2_columns'][ int( column_fill2['column_number2'].value ) - 1 ] = column_fill2['fill_value2'].value -#end for -#end if + #set $__fill_options['fill_unjoined_only'] = $fill_empty_columns['fill_columns_by'].value == 'fill_unjoined_only' + #if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'single_fill_value': + #set $__start_fill = $fill_empty_columns['do_fill_empty_columns']['fill_value'].value + #else: + #set $__start_fill = "" + #end if + #set $__fill_options['file1_columns'] = [ __start_fill for i in range( int( $input1.metadata.columns ) ) ] + #set $__fill_options['file2_columns'] = [ __start_fill for i in range( int( $input2.metadata.columns ) ) ] + #if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'fill_value_by_column': + #for column_fill1 in $fill_empty_columns['do_fill_empty_columns']['column_fill1']: + #set $__fill_options['file1_columns'][ int( column_fill1['column_number1'].value ) - 1 ] = column_fill1['fill_value1'].value + #end for + #for column_fill2 in $fill_empty_columns['do_fill_empty_columns']['column_fill2']: + #set $__fill_options['file2_columns'][ int( column_fill2['column_number2'].value ) - 1 ] = column_fill2['fill_value2'].value + #end for + #end if #end if ${simplejson.dumps( __fill_options )} </configfile> diff -r facf315d9e0e -r c146726d274f tools/maf/genebed_maf_to_fasta.xml --- a/tools/maf/genebed_maf_to_fasta.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/maf/genebed_maf_to_fasta.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,8 +1,9 @@ <tool id="GeneBed_Maf_Fasta2" name="Stitch Gene blocks" version="1.0.1"> <description>given a set of coding exon intervals</description> - <command interpreter="python">#if $maf_source_type.maf_source == "user":#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} -#else:#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} -#end if# --overwrite_with_gaps=$overwrite_with_gaps + <command interpreter="python"> + #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} + #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} + #end if# --overwrite_with_gaps=$overwrite_with_gaps </command> <inputs> <param name="input1" type="data" format="bed" label="Gene BED File"> diff -r facf315d9e0e -r c146726d274f tools/maf/interval2maf.xml --- a/tools/maf/interval2maf.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/maf/interval2maf.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,11 +1,11 @@ <tool id="Interval2Maf1" name="Extract MAF blocks" version="1.0.1"> <description>given a set of genomic intervals</description> <command interpreter="python"> - #if $maf_source_type.maf_source == "user":#interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species - #else:#interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species - #end if - --split_blocks_by_species=$split_blocks_by_species_selector.split_blocks_by_species - #if $split_blocks_by_species_selector.split_blocks_by_species == "split_blocks_by_species":# --remove_all_gap_columns=$split_blocks_by_species_selector.remove_all_gap_columns + #if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species + #else #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species + #end if# --split_blocks_by_species=$split_blocks_by_species_selector.split_blocks_by_species + #if $split_blocks_by_species_selector.split_blocks_by_species == "split_blocks_by_species"# + --remove_all_gap_columns=$split_blocks_by_species_selector.remove_all_gap_columns #end if </command> <inputs> diff -r facf315d9e0e -r c146726d274f tools/maf/interval_maf_to_merged_fasta.xml --- a/tools/maf/interval_maf_to_merged_fasta.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/maf/interval_maf_to_merged_fasta.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,8 +1,9 @@ <tool id="Interval_Maf_Merged_Fasta2" name="Stitch MAF blocks" version="1.0.1"> <description>given a set of genomic intervals</description> - <command interpreter="python">#if $maf_source_type.maf_source == "user":#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} -#else:#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} -#end if# --overwrite_with_gaps=$overwrite_with_gaps + <command interpreter="python"> + #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} + #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} + #end if# --overwrite_with_gaps=$overwrite_with_gaps </command> <inputs> <page> diff -r facf315d9e0e -r c146726d274f tools/maf/maf_to_fasta.xml --- a/tools/maf/maf_to_fasta.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/maf/maf_to_fasta.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,9 +1,9 @@ <tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"> <description>Converts a MAF formated file to FASTA format</description> <command interpreter="python"> - #if $fasta_target_type.fasta_type == "multiple":#maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks - #else:#maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 - #end if + #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks + #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 + #end if# </command> <inputs> <param format="maf" name="input1" type="data" label="MAF file to convert"/> diff -r facf315d9e0e -r c146726d274f tools/metag_tools/blat_wrapper.xml --- a/tools/metag_tools/blat_wrapper.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/metag_tools/blat_wrapper.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,10 +1,9 @@ <tool id="blat_wrapper" name="BLAT" version="1.0.0"> <description> compare sequencing reads against UCSC genome builds</description> <command interpreter="python"> - #if $source.source_select=="database":#blat_wrapper.py 0 $source.dbkey $input_query $output1 $iden $tile_size $one_off - #else:#blat_wrapper.py 1 $source.input_target $input_query $output1 $iden $tile_size $one_off - #end if - ${GALAXY_DATA_INDEX_DIR} + #if $source.source_select=="database" #blat_wrapper.py 0 $source.dbkey $input_query $output1 $iden $tile_size $one_off + #else #blat_wrapper.py 1 $source.input_target $input_query $output1 $iden $tile_size $one_off + #end if# ${GALAXY_DATA_INDEX_DIR} </command> <inputs> <conditional name="source"> diff -r facf315d9e0e -r c146726d274f tools/metag_tools/shrimp_color_wrapper.xml --- a/tools/metag_tools/shrimp_color_wrapper.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/metag_tools/shrimp_color_wrapper.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,9 +1,9 @@ <tool id="shrimp_color_wrapper" name="SHRiMP for Color-space" version="1.0.0"> <description>reads mapping against reference sequence </description> <command interpreter="python"> - #if $param.skip_or_full=="skip":#shrimp_color_wrapper.py $input_target $input_query $output1 - #else #shrimp_color_wrapper.py $input_target $input_query $output1 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_crossover_penalty $param.sw_full_hit_threshold $param.sw_vector_hit_threshold - #end if + #if $param.skip_or_full=="skip" #shrimp_color_wrapper.py $input_target $input_query $output1 + #else #shrimp_color_wrapper.py $input_target $input_query $output1 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_crossover_penalty $param.sw_full_hit_threshold $param.sw_vector_hit_threshold + #end if# </command> <inputs> <page> diff -r facf315d9e0e -r c146726d274f tools/metag_tools/shrimp_wrapper.xml --- a/tools/metag_tools/shrimp_wrapper.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/metag_tools/shrimp_wrapper.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,11 +1,11 @@ <tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0"> <description>reads mapping against reference sequence </description> <command interpreter="python"> - #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $input_target $output1 $output2 $input_query - #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size - #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full"):#shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold - #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full"):#shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold - #end if + #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query + #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size + #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold + #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold + #end if# </command> <inputs> <page> diff -r facf315d9e0e -r c146726d274f tools/samtools/pileup_parser.xml --- a/tools/samtools/pileup_parser.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/samtools/pileup_parser.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,10 +1,10 @@ <tool id="pileup_parser" name="Filter pileup"> <description>on coverage and SNPs</description> <command interpreter="perl"> - #if $pileup_type.type_select == "six": #pileup_parser.pl $input "3" "5" "6" "4" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1 - #elif $pileup_type.type_select == "ten": #pileup_parser.pl $input "3" "9" "10" "8" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1 - #elif $pileup_type.type_select == "manual": #pileup_parser.pl $input $pileup_type.ref_base_column $pileup_type.read_bases_column $pileup_type.read_qv_column $pileup_type.cvrg_column $qv_cutoff $cvrg_cutoff $snps_only $interval $pileup_type.coord_column $out_file1 - #end if + #if $pileup_type.type_select == "six" #pileup_parser.pl $input "3" "5" "6" "4" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1 + #elif $pileup_type.type_select == "ten" #pileup_parser.pl $input "3" "9" "10" "8" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1 + #elif $pileup_type.type_select == "manual" #pileup_parser.pl $input $pileup_type.ref_base_column $pileup_type.read_bases_column $pileup_type.read_qv_column $pileup_type.cvrg_column $qv_cutoff $cvrg_cutoff $snps_only $interval $pileup_type.coord_column $out_file1 + #end if# </command> <inputs> <param name="input" type="data" format="tabular" label="Select dataset"/> diff -r facf315d9e0e -r c146726d274f tools/sr_mapping/lastz_wrapper.xml --- a/tools/sr_mapping/lastz_wrapper.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/sr_mapping/lastz_wrapper.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,15 +1,15 @@ <tool id="lastz_wrapper_1" name="Lastz" version="1.0.0"> <description> map short reads against reference sequence</description> <command> - #if ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="diffs"):#lastz $input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs"):#lastz $seq_name.ref_name::$input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="diffs"):#lastz $input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs"):#lastz $seq_name.ref_name::$input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="maf"):#lastz $input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf"):#lastz $seq_name.ref_name::$input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="maf"):#lastz $input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf"):#lastz $seq_name.ref_name::$input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 - #end if + #if ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="diffs") #lastz $input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs") #lastz $seq_name.ref_name::$input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="diffs") #lastz $input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs") #lastz $seq_name.ref_name::$input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="maf") #lastz $input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf") #lastz $seq_name.ref_name::$input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="maf") #lastz $input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf") #lastz $seq_name.ref_name::$input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1 + #end if# </command> <inputs> <param name="input2" format="fasta" type="data" label="Align sequencing reads" /> diff -r facf315d9e0e -r c146726d274f tools/stats/aggregate_binned_scores_in_intervals.xml --- a/tools/stats/aggregate_binned_scores_in_intervals.xml Tue Nov 10 13:46:53 2009 -0500 +++ b/tools/stats/aggregate_binned_scores_in_intervals.xml Tue Nov 10 13:47:34 2009 -0500 @@ -1,9 +1,9 @@ <tool id="aggregate_scores_in_intervals2" description="such as phastCons, GERP, binCons, and others for a set of genomic intervals" name="Aggregate datapoints" version="1.1.2"> <description>Appends the average, min, max of datapoints per interval</description> <command interpreter="python"> - #if $score_source_type.score_source == "user":#aggregate_scores_in_intervals.py $score_source_type.input2 $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 --chrom_buffer=3 - #else:#aggregate_scores_in_intervals.py $score_source_type.datasets $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 -b - #end if + #if $score_source_type.score_source == "user" #aggregate_scores_in_intervals.py $score_source_type.input2 $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 --chrom_buffer=3 + #else #aggregate_scores_in_intervals.py $score_source_type.datasets $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 -b + #end if# </command> <inputs> <param format="interval" name="input1" type="data" label="Interval file">

1 0

[hg] galaxy 3000: More grid-page integation work. Cleaned up cla...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/facf315d9e0e changeset: 3000:facf315d9e0e user: jeremy goecks <jeremy.goecks at emory.edu> date: Tue Nov 10 13:46:53 2009 -0500 description: More grid-page integation work. Cleaned up clause generation in grid columns and finalized search for pages grid. diffstat: lib/galaxy/web/controllers/page.py | 19 ++++++++++--------- lib/galaxy/web/framework/helpers/grids.py | 32 ++++++++++++++++++-------------- templates/grid_common.mako | 17 +++++++++++++++-- 3 files changed, 43 insertions(+), 25 deletions(-) diffs (160 lines): diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/controllers/page.py --- a/lib/galaxy/web/controllers/page.py Tue Nov 10 13:06:20 2009 -0500 +++ b/lib/galaxy/web/controllers/page.py Tue Nov 10 13:46:53 2009 -0500 @@ -12,30 +12,31 @@ else: return "" -class PublicURLColumn( grids.GridColumn ): +class PublicURLColumn( grids.TextColumn ): def get_value( self, trans, grid, item ): - username = trans.user.username or "???" + username = item.user.username or "???" return username + "/" + item.slug def get_link( self, trans, grid, item ): - if trans.user.username: + if item.user.username: return dict( action='display_by_username_and_slug', username=item.user.username, slug=item.slug ) else: return None -class OwnerColumn( grids.GridColumn ): +class OwnerColumn( grids.TextColumn ): def get_value( self, trans, grid, item ): return item.user.username class PageListGrid( grids.Grid ): # Grid definition use_panels = True - title = "Your pages" + title = "Pages" model_class = model.Page + default_filter = { "published" : "All"} default_sort_key = "-create_time" columns = [ grids.TextColumn( "Title", key="title", model_class=model.Page, attach_popup=True, filterable="standard" ), PublicURLColumn( "Public URL" ), - grids.GridColumn( "Published", key="published", format=format_bool, filterable="advanced" ), + grids.GridColumn( "Published", key="published", format=format_bool, filterable="standard" ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), ] @@ -56,13 +57,13 @@ class PageAllPublishedGrid( grids.Grid ): # Grid definition use_panels = True - title = "Published pages from all users" + title = "Published Pages From All Users" model_class = model.Page default_sort_key = "-create_time" columns = [ - grids.GridColumn( "Title", key="title" ), + grids.TextColumn( "Title", model_class=model.Page, key="title", filterable="standard" ), PublicURLColumn( "Public URL" ), - OwnerColumn( "Published by" ), + OwnerColumn( "Published by", model_class=model.User, key="username" ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), ] diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:06:20 2009 -0500 +++ b/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:46:53 2009 -0500 @@ -21,6 +21,7 @@ columns = [] operations = [] standard_filters = [] + # Any columns that are filterable (either standard or advanced) should have a default value set in the default filter. default_filter = {} default_sort_key = None preserve_state = False @@ -320,10 +321,10 @@ if isinstance( column_filter, basestring ): return func.lower( model_class_key_field ).like( "%" + column_filter.lower() + "%" ) elif isinstance( column_filter, list ): - composite_filter = True + clause_list = [] for filter in column_filter: - composite_filter = and_( composite_filter, func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) ) - return composite_filter + clause_list.append( func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) ) + return and_( *clause_list ) # Generic column that supports tagging. class TagsColumn( TextColumn ): @@ -353,15 +354,15 @@ # Collapse list of tags into a single string; this is redundant but effective. TODO: fix this by iterating over tags. column_filter = ",".join( column_filter ) raw_tags = tag_handler.parse_tags( column_filter.encode("utf-8") ) - filter = True + clause_list = [] for name, value in raw_tags.items(): if name: # Search for tag names. - filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) ) + clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) ) if value: # Search for tag values. - filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) ) - return filter + clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) ) + return and_( *clause_list ) # Column that performs multicolumn filtering. class MulticolFilterColumn( TextColumn ): @@ -373,17 +374,20 @@ if column_filter == "All": return query if isinstance( column_filter, list): - composite_filter = True + clause_list = [] for filter in column_filter: - part_composite_filter = False + part_clause_list = [] for column in self.cols_to_filter: - part_composite_filter = or_( part_composite_filter, column.get_filter( filter ) ) - composite_filter = and_( composite_filter, part_composite_filter ) + part_clause_list.append( column.get_filter( filter ) ) + clause_list.append( or_( *part_clause_list ) ) + complete_filter = and_( *clause_list ) else: - composite_filter = False + clause_list = [] for column in self.cols_to_filter: - composite_filter = or_( composite_filter, column.get_filter( column_filter ) ) - return query.filter( composite_filter ) + clause_list.append( column.get_filter( column_filter ) ) + complete_filter = or_( *clause_list ) + + return query.filter( complete_filter ) class GridOperation( object ): def __init__( self, label, key=None, condition=None, allow_multiple=True, allow_popup=True, target=None, url_args=None ): diff -r 7698e2ecca3e -r facf315d9e0e templates/grid_common.mako --- a/templates/grid_common.mako Tue Nov 10 13:06:20 2009 -0500 +++ b/templates/grid_common.mako Tue Nov 10 13:46:53 2009 -0500 @@ -86,10 +86,23 @@ </table> </td> <td> + ## Clear the standard search. ##| ##<% filter_all = GridColumnFilter( "", { column.key : "All" } ) %> - ##<a href="${url( filter_all.get_url_args() )}">Clear All</a> - | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a> + ##<a href="${url( filter_all.get_url_args() )}">Clear All</a> + + ## Only show advanced search if there are filterable columns. + <% + show_advanced_search = False + for column in grid.columns: + if column.filterable == "advanced": + show_advanced_search = True + break + endif + %> + %if show_advanced_search: + | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a> + %endif </td> </tr></table> </div>

1 0

[hg] galaxy 2999: Fixed megablast_wrapper test to use phiX datab...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/7698e2ecca3e changeset: 2999:7698e2ecca3e user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Tue Nov 10 13:06:20 2009 -0500 description: Fixed megablast_wrapper test to use phiX database and modified parameter passing to use named parameters diffstat: test-data/megablast_wrapper_test1.fa | 200 +++------------------------------ test-data/megablast_wrapper_test1.out | 123 +++----------------- tools/metag_tools/megablast_wrapper.py | 35 ++++- tools/metag_tools/megablast_wrapper.xml | 14 ++- 4 files changed, 78 insertions(+), 294 deletions(-) diffs (446 lines): diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.fa --- a/test-data/megablast_wrapper_test1.fa Tue Nov 10 12:35:00 2009 -0500 +++ b/test-data/megablast_wrapper_test1.fa Tue Nov 10 13:06:20 2009 -0500 @@ -1,200 +1,40 @@ >0_0.666667 -CGGACAGCGCCGCCACCAACAAAGCCACCA +GAGTTTTATCGCTTCCATGACGCAGAAGTT >1_0.600000 -AAAACACCGGATGCTCCGGCGCTGGCAGAT +AACACTTTCGGATATTTCTGATGAGTCGAA >2_0.400000 -TTTGCTTTTAGTACACCGGATTCAGAACCA +AGCAGGAATTACTACTGCTTGTTTACGAAT >3_0.566667 -CCGTCCCCATGAATACACCTTTCTGGACGG +TAAATCGAAGTGGACTGCTGGCGGAAAATG >4_0.766667 -CACGCTACGTGCGCCCCCGCCCAGAAGGCG +TCCTTGCGCAGCTCGAGAAGCTCTTACTTT >5_0.533333 -AAACAAAACCCGCCGAAGCGGGTTAAGTGC +GCGACCTTTCGCCATCAACTAACGATTCTG >6_0.533333 -TAAGCCGTTACTGGCAGCAAGTGCAGGCAA +TTGGATGAGGAGAAGTGGCTTAATATGCTT >7_0.400000 -TGAATTTACCGTTATCTATCTTGCCTGCCT +GGCACGTTCGTCAAGGACTGGTTTAGATAT >8_0.500000 -TTAGCGGGAATAAAACAGGCTGTCAGCCAG +CATGGTAGAGATTCTCTTGTTGACATTTTA >9_0.400000 -GCGTTTTGCTAAACTTCTGCCGGAATATAA +AAAGAGCGTGGATTACTATCTGAGTCCGAT >10_0.500000 -AAAGAGGCGAGCAGAGTAAAACGCAGGCAA +ATAGGTAAGAAATCATGAGTCAAGTTACTG >11_0.533333 -CAAAAGCAGAGTCTGTTGACCCATACGCGC +AACAATCCGTACGTTTCCAGACCGCTTTGG >12_0.700000 -GCGGACGATCTTCACGGTCGCCACGCGGAC +TTCAGGCTTCTGCCGTTTTGGATTTAACCG >13_0.533333 -TTCTTGTTGGATGGCATACTCCGGCAGCCA +AAGATGATTTCGATTTTCTGACGAGTAACA >14_0.666667 -ACCCCGATATCGTCGCAGGCGTTGCCGCAC +CTGACCGCTCTCGTGCTCGTCGCTGCGTTG >15_0.666667 -GGCTGCTGTCTCCGCTGGAAGAGGCGCTTC +AGGCTTGCGTTTATGGTACGCTGGACTTTG >16_0.566667 -ATGTCCTGATCGAGCGGCGTTTTACCGACC +TTCCTGCTCCTGTTGAGTTTATTGCTGCCG >17_0.533333 -GGTGTTGAGTGTCCAGGTAATACGCTCTCG +TCATTGCTTATTATGTTCATCCCGTCAACA >18_0.566667 -GTGGTCTCAAGCCCAAAGGAAGAGTGAGGC +TCATCATGGAAGGCGCTGAATTTACGGAAA >19_0.566667 -GTTGTAAGCGTCAGAACCGATGCGGTCGGT ->20_0.566667 -CGACATCCTGTAGGCTGGCTTCAATGCGAC ->21_0.733333 -GGGAAGGCTGACGGGCGTCCACACCACGGC ->22_0.566667 -CGGTATTCCTCAGTTCTCGCTGCATGCCTG ->23_0.600000 -TTGCCGTTACGCACCACGCCTTCAGTAGCG ->24_0.733333 -CGCGGGCGCACCACGTCGCTGCTGCTGTTC ->25_0.266667 -TTTTGGGAAAACTAAATACGCATCAAAAAT ->26_0.566667 -CAACGAGGCGCTACCGAGTTGTTCAATGCG ->27_0.600000 -TTACCGAGGCCAGAACCGATACCACGACCC ->28_0.666667 -CGCTCAATCTGCTCGCGCCTGGCTGGCGTT ->29_0.700000 -CTCGTCCGGCGGGCGGTTTTGCCGACAAGG ->30_0.233333 -GGAAATTGTACAATAGAAAAATTACTGTAT ->31_0.533333 -GTGCTGAACTGTTCCACGACCATGGAGATG ->32_0.600000 -TGAGGATGGTCCTCTGACTCTGCAGGCGCA ->33_0.300000 -TAGTAACCCTTTAATAAGATTGTCGATTAG ->34_0.533333 -TGATGTTAAATGCATGGCACCTGCCGGTGC ->35_0.466667 -ACTGCTTTGCCGAGATATTCGAGGTTAACC ->36_0.433333 -TGTTGGCAACATGGCGAGCGTAATCAATTA ->37_0.366667 -ACTTCGTCAGTAAGGATGAGATTAGCAAAT ->38_0.533333 -GCAGCAGGATCGGATCGAACTCTGGTTTCT ->39_0.400000 -TAATGCGGCATTCTCCTGATTTATTGTCAC ->40_0.400000 -AGCGTAATGATAATCGCTATCACTGCGATT ->41_0.566667 -AGCTGACGGTCAGCAGGGATACTTCCTGCA ->42_0.566667 -GCAGTGACTACATCCGCGAGGTGAATGTGG ->43_0.466667 -GCTTTTTCCAGCATCAACGCCACTGAACAA ->44_0.433333 -AAAGTGGTAGATAACGTGGTGCAGACTATG ->45_0.500000 -TTCCTGATACCGGATGACCTTATCGCGGAT ->46_0.466667 -ACCTGTACCCCAGGACCATGGTACATTTAT ->47_0.533333 -ACAATGCAACCAGACCAGCCCGGATCGATA ->48_0.500000 -GGGTAACCAGCTGATGATGGCCATTAACCT ->49_0.433333 -CGTTATACGGAACAACATTTAACTCCAGCG ->50_0.466667 -TTGCTGTTGCCATCGCTTTTCAGGACATAC ->51_0.533333 -CGACGGTATCGGTACGCAGATTGTGATGGA ->52_0.366667 -ATGAGCATCAACATCGAAATCTCAAACCAA ->53_0.533333 -CCAGGCACTCCGCCATATTTTTGCCATGAC ->54_0.400000 -GTATTCTTCATTGATTTGTAAGCGGGTACC ->55_0.466667 -AAGCGCTGTTCAACATAAATTGGCTGACGG ->56_0.433333 -AACCGTCAGCTCTTTACGCAATATTTTGCC ->57_0.566667 -CGCGAAATCCTCGACGTCCAGGCACGTATT ->58_0.300000 -GTTATCCATTAAAATAGATCGGATCGATAT ->59_0.300000 -AAAATCTGCATATCATGATAAGAGTGGTTA ->60_0.533333 -AATCTGGCGAATGCTGATAGCGTGACCGGT ->61_0.366667 -TCAGTTTGAAAGCTTTGTCAGCCGTTTTTT ->62_0.366667 -AATCCTAAACCTAGGAATGCCAGAATATCT ->63_0.566667 -TCACGCTCGCAGTCAAGCTGGCTTATGCCA ->64_0.500000 -GAGATGACGGTTGCAGAGTCATGCGTTTGA ->65_0.533333 -TCTGGATCACGCGCAAACACTGGCTATCGT ->66_0.466667 -TCTGCTTTAGCAAACAGAGTGTGGTCACGA ->67_0.400000 -GCCTTTTGTCTGATCATCCACAATAATGAC ->68_0.566667 -GAAGGATAGTTGGTCAGCAACACCAGCGGC ->69_0.733333 -GGCGCGCTGTCGGCCACGGCGAAATCGACC ->70_0.466667 -TGGTGTTCAGCATCTCAACGGTAATTCGCT ->71_0.533333 -CAGGATGCAAACTGCCGGGAGATCCAGTTA ->72_0.533333 -AACTGGAAGGGCTTGGGATGACACAACAGC ->73_0.500000 -TTTAAGCGCCAACCAGGCTTCTTTGGTTGC ->74_0.433333 -ACCCTTCTTTCGCCATATCAAACTGATGTC ->75_0.533333 -ATAACCCTCTGCAACCGCCGCTTCAGCAAA ->76_0.600000 -TGAAGCCGTACAACGGGCGCTGGAATTCGC ->77_0.700000 -GAGCTGCAACGCGGTCAGCCAGCTGGCGGT ->78_0.566667 -CGGAGTATCCGTTCCCCAACGACAAGCATC ->79_0.500000 -AATACCGGGAAGAGACAACGGGGTCTCTTT ->80_0.500000 -TAATGACAGGGTTGCGAAGCCCTGATTCTC ->81_0.433333 -ATTAATGTTGCCGGCACAACATAATAGGGC ->82_0.500000 -ACTGGGTTGCTCTGAACAAGAAAGGCGCTA ->83_0.533333 -CGCCAGGGACGTATCGCGTCGATATCTATT ->84_0.533333 -TGCTCGTTCCCGTCGTGATGAAGCTCGAAA ->85_0.500000 -AGGAAAGCAAACAACACGACCACCATCAGC ->86_0.566667 -GGCAACGCAGGCGCATGATTCTGCTTGGAA ->87_0.433333 -CGCTGGATGAAAANCGTGAATATCACACCA ->88_0.533333 -CGTACCGGGCTGAAAGTAGAAGAGCGTTTC ->89_0.466667 -ATTAAAAAACAGGCGGTGCGTTTTCCCTGG ->90_0.466667 -ATCACCGTTTCGCTAACCGGTACGTTTAAC ->91_0.566667 -TTCGCCCGGCAAGCTTACCCAACGCTTATC ->92_0.533333 -TTTTCCCCGCCGTTAGTAGCGACTGCAGTT ->93_0.400000 -TTATTTGCCCGATGAGTCAGTTTATTGCAG ->94_0.466667 -CCACGGTGATATCTGGTGCCATACTGATAA ->95_0.466667 -TCCCCCGTAAGGCCTTTCTTTTTCTTTCGT ->96_0.533333 -TTGCCGGGAAGAGAGATATCAATGGCAGGC ->97_0.566667 -TGCGCCGCCGGATTGTTGCTCAACATGCTT ->98_0.366667 -AACGCGCTAACCGCCAATAATAACAAAATT ->99_0.366667 -TAAGAGTTTATTCATGATGTCATCCTGCGA +ACATTATTAATGGCGTCGAGCGTCCGGTTA \ No newline at end of file diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.out --- a/test-data/megablast_wrapper_test1.out Tue Nov 10 12:35:00 2009 -0500 +++ b/test-data/megablast_wrapper_test1.out Tue Nov 10 13:06:20 2009 -0500 @@ -1,103 +1,20 @@ -0_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5436010 5436039 8e-11 60.0 -1_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 696993 697022 8e-11 60.0 -2_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4100018 4100047 8e-11 60.0 -3_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2305873 2305844 8e-11 60.0 -4_0.766667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3457901 3457930 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1264160 1264131 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1636514 1636485 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2318694 2318723 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2777043 2777072 8e-11 60.0 -6_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1185124 1185153 8e-11 60.0 -7_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2458203 2458232 8e-11 60.0 -9_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5286666 5286695 8e-11 60.0 -10_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2787672 2787701 8e-11 60.0 -12_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4116145 4116174 8e-11 60.0 -13_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5442351 5442380 8e-11 60.0 -14_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4626492 4626521 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 346897 346926 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1466565 1466536 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1750132 1750161 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1908046 1908075 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2279107 2279136 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2813407 2813436 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3939162 3939191 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4656510 4656539 8e-11 60.0 -16_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2595157 2595186 8e-11 60.0 -17_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 717743 717772 8e-11 60.0 -19_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1237938 1237967 8e-11 60.0 -20_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4792054 4792083 8e-11 60.0 -21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 269757 269786 8e-11 60.0 -21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 274007 274036 8e-11 60.0 -22_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2706426 2706455 8e-11 60.0 -23_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1512107 1512136 8e-11 60.0 -24_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2032108 2032137 8e-11 60.0 -25_0.266667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1343811 1343840 8e-11 60.0 -26_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3112551 3112580 8e-11 60.0 -28_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4405442 4405471 8e-11 60.0 -29_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3600547 3600576 8e-11 60.0 -32_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1435670 1435699 8e-11 60.0 -33_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3788178 3788207 8e-11 60.0 -34_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 484499 484528 8e-11 60.0 -35_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2250064 2250093 8e-11 60.0 -36_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3698178 3698207 8e-11 60.0 -38_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4242501 4242530 8e-11 60.0 -39_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3683151 3683180 8e-11 60.0 -41_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 789086 789115 8e-11 60.0 -42_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1714771 1714800 8e-11 60.0 -43_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4272582 4272611 8e-11 60.0 -44_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5481023 5481052 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1271858 1271829 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1357981 1357952 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2310674 2310703 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2769319 2769348 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2991293 2991322 8e-11 60.0 -46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1080570 1080599 8e-11 60.0 -46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1476177 1476206 8e-11 60.0 -47_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2887871 2887900 8e-11 60.0 -49_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4152853 4152882 8e-11 60.0 -50_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3568677 3568706 8e-11 60.0 -51_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3739788 3739817 8e-11 60.0 -52_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3789407 3789436 8e-11 60.0 -54_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3161991 3162020 8e-11 60.0 -55_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4384753 4384782 8e-11 60.0 -56_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2915787 2915816 8e-11 60.0 -57_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 294604 294633 8e-11 60.0 -58_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1553483 1553512 8e-11 60.0 -59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1351506 1351535 8e-11 60.0 -59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2997487 2997458 8e-11 60.0 -61_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1987157 1987186 8e-11 60.0 -62_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1667830 1667859 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 231447 231418 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3516862 3516891 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4226650 4226679 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4808486 4808457 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4904764 4904735 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5048944 5048915 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5089951 5089922 8e-11 60.0 -64_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5440369 5440398 8e-11 60.0 -65_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3963858 3963887 8e-11 60.0 -66_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4142497 4142526 8e-11 60.0 -67_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3532236 3532265 8e-11 60.0 -68_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 779994 780023 8e-11 60.0 -70_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1317239 1317268 8e-11 60.0 -71_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5080463 5080492 8e-11 60.0 -72_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3605409 3605438 8e-11 60.0 -73_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3280815 3280844 8e-11 60.0 -75_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2230266 2230295 8e-11 60.0 -76_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 462631 462660 8e-11 60.0 -77_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2939076 2939105 8e-11 60.0 -78_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5422053 5422082 8e-11 60.0 -79_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4387420 4387449 8e-11 60.0 -81_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1037150 1037179 8e-11 60.0 -82_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1182188 1182217 8e-11 60.0 -83_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5430210 5430239 8e-11 60.0 -84_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 310995 311024 8e-11 60.0 -85_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4174173 4174202 8e-11 60.0 -86_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 163690 163719 8e-11 60.0 -88_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3071785 3071814 8e-11 60.0 -90_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 692131 692160 8e-11 60.0 -91_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3307050 3307079 8e-11 60.0 -94_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1813009 1813038 8e-11 60.0 -96_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 573782 573811 8e-11 60.0 -97_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3570563 3570592 8e-11 60.0 -98_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4545136 4545165 8e-11 60.0 +0_0.666667 PHIX174 100.00 30 0 0 1 30 1 30 1e-13 60.0 +1_0.600000 PHIX174 100.00 30 0 0 1 30 31 60 1e-13 60.0 +2_0.400000 PHIX174 100.00 30 0 0 1 30 76 105 1e-13 60.0 +3_0.566667 PHIX174 100.00 30 0 0 1 30 106 135 1e-13 60.0 +4_0.766667 PHIX174 100.00 30 0 0 1 30 151 180 1e-13 60.0 +5_0.533333 PHIX174 100.00 30 0 0 1 30 181 210 1e-13 60.0 +6_0.533333 PHIX174 100.00 30 0 0 1 30 226 255 1e-13 60.0 +7_0.400000 PHIX174 100.00 30 0 0 1 30 256 285 1e-13 60.0 +8_0.500000 PHIX174 100.00 30 0 0 1 30 301 330 1e-13 60.0 +9_0.400000 PHIX174 100.00 30 0 0 1 30 331 360 1e-13 60.0 +10_0.500000 PHIX174 100.00 30 0 0 1 30 376 405 1e-13 60.0 +11_0.533333 PHIX174 100.00 30 0 0 1 30 406 435 1e-13 60.0 +12_0.700000 PHIX174 100.00 30 0 0 1 30 451 480 1e-13 60.0 +13_0.533333 PHIX174 100.00 30 0 0 1 30 481 510 1e-13 60.0 +14_0.666667 PHIX174 100.00 30 0 0 1 30 526 555 1e-13 60.0 +15_0.666667 PHIX174 100.00 30 0 0 1 30 556 585 1e-13 60.0 +16_0.566667 PHIX174 100.00 30 0 0 1 30 601 630 1e-13 60.0 +17_0.533333 PHIX174 100.00 30 0 0 1 30 631 660 1e-13 60.0 +18_0.566667 PHIX174 100.00 30 0 0 1 30 676 705 1e-13 60.0 +19_0.566667 PHIX174 100.00 30 0 0 1 30 706 735 1e-13 60.0 diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.py --- a/tools/metag_tools/megablast_wrapper.py Tue Nov 10 12:35:00 2009 -0500 +++ b/tools/metag_tools/megablast_wrapper.py Tue Nov 10 13:06:20 2009 -0500 @@ -1,9 +1,24 @@ #! /usr/bin/python """ run megablast for metagenomics data + +usage: %prog [options] + -d, --db_build=d: The database to use + -i, --input=i: Input FASTQ candidate file + -w, --word_size=w: Size of best perfect match + -c, --identity_cutoff=c: Report hits at or above this identity + -e, --eval_cutoff=e: Expectation value cutoff + -f, --filter_query=f: Filter out low complexity regions + -x, --index_dir=x: Data index directory + -o, --output=o: Output file + +usage: %prog db_build input_file word_size identity_cutoff eval_cutoff filter_query index_dir output_file """ import sys, os, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse assert sys.version_info[:2] >= ( 2, 4 ) @@ -12,16 +27,18 @@ sys.exit() def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) - db_build = sys.argv[1] - query_filename = sys.argv[2].strip() - output_filename = sys.argv[3].strip() - mega_word_size = sys.argv[4] # -W - mega_iden_cutoff = sys.argv[5] # -p - mega_evalue_cutoff = sys.argv[6] # -e + db_build = options.db_build + query_filename = options.input.strip() + output_filename = options.output.strip() + mega_word_size = options.word_size # -W + mega_iden_cutoff = options.identity_cutoff # -p + mega_evalue_cutoff = options.eval_cutoff # -e mega_temp_output = tempfile.NamedTemporaryFile().name - mega_filter = sys.argv[7] # -F - GALAXY_DATA_INDEX_DIR = sys.argv[8] + mega_filter = options.filter_query # -F + GALAXY_DATA_INDEX_DIR = options.index_dir DB_LOC = "%s/blastdb.loc" % GALAXY_DATA_INDEX_DIR # megablast parameters @@ -81,7 +98,7 @@ output.write( "%s\n" % new_line ) output.close() - os.unlink( mega_temp_output ) #remove the tempfile that we just reformated the contents of + os.unlink( mega_temp_output ) #remove the tempfile that we just reformatted the contents of if invalid_lines: print "Unable to parse %d lines. Keep the default format." % invalid_lines diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.xml --- a/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 12:35:00 2009 -0500 +++ b/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 13:06:20 2009 -0500 @@ -1,6 +1,16 @@ <tool id="megablast_wrapper" name="Megablast" version="1.0.0"> <description> compare short reads against nt and wgs databases</description> - <command interpreter="python">megablast_wrapper.py $source_select $input_query $output1 $word_size $iden_cutoff $evalue_cutoff $filter_query ${GALAXY_DATA_INDEX_DIR}</command> + <command interpreter="python"> + megablast_wrapper.py + --db_build=$source_select + --input=$input_query + --word_size=$word_size + --identity_cutoff=$iden_cutoff + --eval_cutoff=$evalue_cutoff + --filter_query=$filter_query + --index_dir=${GALAXY_DATA_INDEX_DIR} + --output=$output1 + </command> <inputs> <param name="input_query" type="data" format="fasta" label="Compare these sequences"/> <param name="source_select" type="select" display="radio" label="against target database"> @@ -29,7 +39,7 @@ <tests> <test> <param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/> - <param name="source_select" value="test" /> + <param name="source_select" value="phiX" /> <param name="word_size" value="28" /> <param name="iden_cutoff" value="99.0" /> <param name="evalue_cutoff" value="10.0" />

1 0

[hg] galaxy 2998: Fixed a bug in the view requesttype page.
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e2420f742a0a changeset: 2998:e2420f742a0a user: rc date: Tue Nov 10 12:35:00 2009 -0500 description: Fixed a bug in the view requesttype page. Now barcodes are visible in the request details page itself. diffstat: lib/galaxy/web/controllers/requests_admin.py | 12 ++++++------ templates/admin/requests/show_request.mako | 8 ++++---- templates/admin/requests/view_request_type.mako | 2 +- test/functional/test_forms_and_requests.py | 5 +++-- 4 files changed, 14 insertions(+), 13 deletions(-) diffs (112 lines): diff -r ee382d1c63b7 -r e2420f742a0a lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 11:20:04 2009 -0500 +++ b/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 12:35:00 2009 -0500 @@ -1034,10 +1034,11 @@ event = trans.app.model.SampleEvent(s, new_state, 'Bar code added to this sample') event.flush() return trans.response.send_redirect( web.url_for( controller='requests_admin', - action='bar_codes', - request_id=request.id, - msg='Bar codes have been saved for this request', - messagetype='done')) + action='list', + operation='show_request', + id=trans.security.encode_id(request.id), + message='Bar codes have been saved for this request', + status='done')) def __set_request_state(self, request): # check if all the samples of the current request are in the final state @@ -1183,11 +1184,10 @@ messagetype='done') ) elif params.get('view', False): rt = trans.sa_session.query( trans.app.model.RequestType ).get( int( util.restore_text( params.id ) ) ) - ss_list = trans.sa_session.query( trans.app.model.SampleState ).filter( trans.app.model.SampleState.table.c.request_type_id == rt.id ) return trans.fill_template( '/admin/requests/view_request_type.mako', request_type=rt, forms=get_all_forms( trans ), - states_list=ss_list, + states_list=rt.states, deleted=False, show_deleted=False, msg=msg, diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Tue Nov 10 11:20:04 2009 -0500 +++ b/templates/admin/requests/show_request.mako Tue Nov 10 12:35:00 2009 -0500 @@ -1,12 +1,10 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> - %if msg: ${render_msg( msg, messagetype )} %endif - <div class="grid-header"> <h2>Sequencing Request "${request.name}"</h2> </div> @@ -44,6 +42,8 @@ </td> <td> </td> + <td> + </td> %else: <td> ${sample_name} @@ -80,11 +80,10 @@ ${sample.name} </td> %if grid_index == 0: + <td>${sample.bar_code}</td> <td> %if sample.request.unsubmitted(): Unsubmitted - %elif not sample.current_state(): - New %else: <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> %endif @@ -150,6 +149,7 @@ <th>No.</th> <th>Sample Name</th> %if grid_index == 0: + <th>Barcode</th> <th>State</th> %endif %for index, field in fields_dict.items(): diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/view_request_type.mako --- a/templates/admin/requests/view_request_type.mako Tue Nov 10 11:20:04 2009 -0500 +++ b/templates/admin/requests/view_request_type.mako Tue Nov 10 12:35:00 2009 -0500 @@ -36,7 +36,7 @@ <label> Possible states </label> - %for element_count, state in enumerate(states_list.all()): + %for element_count, state in enumerate(states_list): <div class="form-row"> <label>${1+element_count}. ${state.name}</label> ${state.desc} diff -r ee382d1c63b7 -r e2420f742a0a test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Tue Nov 10 11:20:04 2009 -0500 +++ b/test/functional/test_forms_and_requests.py Tue Nov 10 12:35:00 2009 -0500 @@ -245,7 +245,7 @@ self.check_page_for_string( request_one.name ) assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" \ % ( request_one.name, request_one.states.COMPLETE ) - def test_40_admin_create_request_on_behalf_of_regular_user( self ): + def test_040_admin_create_request_on_behalf_of_regular_user( self ): """Testing creating and submitting a request as an admin on behalf of a regular user""" self.logout() self.login( email='test(a)bx.psu.edu' ) @@ -288,7 +288,8 @@ self.visit_url( '%s/requests_admin/list?show_filter=All' % self.url ) self.check_page_for_string( request_one.name ) self.check_page_for_string( request_two.name ) - def test_45_reject_request( self ): + def test_045_reject_request( self ): + '''Testing rejecting a request''' self.logout() self.login( email='test(a)bx.psu.edu' ) self.reject_request( request_two.id, request_two.name )

1 0

[hg] galaxy 2997: Add env var to set metadata externally during ...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ee382d1c63b7 changeset: 2997:ee382d1c63b7 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 11:20:04 2009 -0500 description: Add env var to set metadata externally during tests diffstat: scripts/functional_tests.py | 4 ++++ 1 files changed, 4 insertions(+), 0 deletions(-) diffs (21 lines): diff -r 461407cd7013 -r ee382d1c63b7 scripts/functional_tests.py --- a/scripts/functional_tests.py Tue Nov 10 10:10:29 2009 -0500 +++ b/scripts/functional_tests.py Tue Nov 10 11:20:04 2009 -0500 @@ -71,6 +71,9 @@ default_cluster_job_runner = os.environ['GALAXY_TEST_DEF_RUNNER'] else: default_cluster_job_runner = 'local:///' + set_metadata_externally = False + if 'GALAXY_SET_METADATA_EXTERNALLY' in os.environ: + set_metadata_externally = True print "Database connection:", database_connection @@ -104,6 +107,7 @@ admin_users = 'test(a)bx.psu.edu', library_import_dir = galaxy_test_file_dir, user_library_import_dir = os.path.join( galaxy_test_file_dir, 'users' ), + set_metadata_externally = set_metadata_externally, global_conf = { "__file__": "universe_wsgi.ini.sample" } ) log.info( "Embedded Universe application started" );

1 0

[hg] galaxy 2996: Don't display diff during tests if it contains...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/461407cd7013 changeset: 2996:461407cd7013 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 10:10:29 2009 -0500 description: Don't display diff during tests if it contains non-ascii characters diffstat: test/base/twilltestcase.py | 4 ++++ 1 files changed, 4 insertions(+), 0 deletions(-) diffs (14 lines): diff -r 9f485a539bfb -r 461407cd7013 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Mon Nov 09 23:00:55 2009 -0500 +++ b/test/base/twilltestcase.py Tue Nov 10 10:10:29 2009 -0500 @@ -59,6 +59,10 @@ diff_slice[6].startswith( '-/CreationDate' ) and diff_slice[7].startswith( '-/ModDate' ) \ and diff_slice[8].startswith( '+/CreationDate' ) and diff_slice[9].startswith( '+/ModDate' ): return True + for line in diff_slice: + for char in line: + if ord( char ) > 128: + raise AssertionError( "Binary data detected, not displaying diff" ) raise AssertionError( "".join( diff_slice ) ) return True

1 0