galaxy-dev
Threads by month
- ----- 2026 -----
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
- 10009 discussions
details: http://www.bx.psu.edu/hg/galaxy/rev/3c64aa0a0f85
changeset: 2571:3c64aa0a0f85
user: Kanwei Li <kanwei(a)gmail.com>
date: Thu Aug 06 16:11:40 2009 -0400
description:
Documentation for dragging change
1 file(s) affected in this change:
static/scripts/galaxy.workflow_editor.canvas.js
diffs (12 lines):
diff -r e1f9132aebe0 -r 3c64aa0a0f85 static/scripts/galaxy.workflow_editor.canvas.js
--- a/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 06 16:07:53 2009 -0400
+++ b/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 06 16:11:40 2009 -0400
@@ -805,6 +805,8 @@
self.draw_overview();
});
+ /* Disable dragging for child elements of the panel so that resizing can
+ only be done with the border panels */
$("#overview-border>*").bind("drag", function(e) { });
},
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/a6be5c3955e9
changeset: 2572:a6be5c3955e9
user: Kanwei Li <kanwei(a)gmail.com>
date: Mon Aug 10 12:09:50 2009 -0400
description:
Allows storing of multiple preferences in one cookie using JSON. Use this to store workflow overview settings
3 file(s) affected in this change:
static/scripts/json2.js
static/scripts/json_cookie.js
templates/workflow/editor.mako
diffs (641 lines):
diff -r 3c64aa0a0f85 -r a6be5c3955e9 static/scripts/json2.js
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/scripts/json2.js Mon Aug 10 12:09:50 2009 -0400
@@ -0,0 +1,476 @@
+/*
+ http://www.JSON.org/json2.js
+ 2009-06-29
+
+ Public Domain.
+
+ NO WARRANTY EXPRESSED OR IMPLIED. USE AT YOUR OWN RISK.
+
+ See http://www.JSON.org/js.html
+
+ This file creates a global JSON object containing two methods: stringify
+ and parse.
+
+ JSON.stringify(value, replacer, space)
+ value any JavaScript value, usually an object or array.
+
+ replacer an optional parameter that determines how object
+ values are stringified for objects. It can be a
+ function or an array of strings.
+
+ space an optional parameter that specifies the indentation
+ of nested structures. If it is omitted, the text will
+ be packed without extra whitespace. If it is a number,
+ it will specify the number of spaces to indent at each
+ level. If it is a string (such as '\t' or ' '),
+ it contains the characters used to indent at each level.
+
+ This method produces a JSON text from a JavaScript value.
+
+ When an object value is found, if the object contains a toJSON
+ method, its toJSON method will be called and the result will be
+ stringified. A toJSON method does not serialize: it returns the
+ value represented by the name/value pair that should be serialized,
+ or undefined if nothing should be serialized. The toJSON method
+ will be passed the key associated with the value, and this will be
+ bound to the object holding the key.
+
+ For example, this would serialize Dates as ISO strings.
+
+ Date.prototype.toJSON = function (key) {
+ function f(n) {
+ // Format integers to have at least two digits.
+ return n < 10 ? '0' + n : n;
+ }
+
+ return this.getUTCFullYear() + '-' +
+ f(this.getUTCMonth() + 1) + '-' +
+ f(this.getUTCDate()) + 'T' +
+ f(this.getUTCHours()) + ':' +
+ f(this.getUTCMinutes()) + ':' +
+ f(this.getUTCSeconds()) + 'Z';
+ };
+
+ You can provide an optional replacer method. It will be passed the
+ key and value of each member, with this bound to the containing
+ object. The value that is returned from your method will be
+ serialized. If your method returns undefined, then the member will
+ be excluded from the serialization.
+
+ If the replacer parameter is an array of strings, then it will be
+ used to select the members to be serialized. It filters the results
+ such that only members with keys listed in the replacer array are
+ stringified.
+
+ Values that do not have JSON representations, such as undefined or
+ functions, will not be serialized. Such values in objects will be
+ dropped; in arrays they will be replaced with null. You can use
+ a replacer function to replace those with JSON values.
+ JSON.stringify(undefined) returns undefined.
+
+ The optional space parameter produces a stringification of the
+ value that is filled with line breaks and indentation to make it
+ easier to read.
+
+ If the space parameter is a non-empty string, then that string will
+ be used for indentation. If the space parameter is a number, then
+ the indentation will be that many spaces.
+
+ Example:
+
+ text = JSON.stringify(['e', {pluribus: 'unum'}]);
+ // text is '["e",{"pluribus":"unum"}]'
+
+
+ text = JSON.stringify(['e', {pluribus: 'unum'}], null, '\t');
+ // text is '[\n\t"e",\n\t{\n\t\t"pluribus": "unum"\n\t}\n]'
+
+ text = JSON.stringify([new Date()], function (key, value) {
+ return this[key] instanceof Date ?
+ 'Date(' + this[key] + ')' : value;
+ });
+ // text is '["Date(---current time---)"]'
+
+
+ JSON.parse(text, reviver)
+ This method parses a JSON text to produce an object or array.
+ It can throw a SyntaxError exception.
+
+ The optional reviver parameter is a function that can filter and
+ transform the results. It receives each of the keys and values,
+ and its return value is used instead of the original value.
+ If it returns what it received, then the structure is not modified.
+ If it returns undefined then the member is deleted.
+
+ Example:
+
+ // Parse the text. Values that look like ISO date strings will
+ // be converted to Date objects.
+
+ myData = JSON.parse(text, function (key, value) {
+ var a;
+ if (typeof value === 'string') {
+ a =
+/^(\d{4})-(\d{2})-(\d{2})T(\d{2}):(\d{2}):(\d{2}(?:\.\d*)?)Z$/.exec(value);
+ if (a) {
+ return new Date(Date.UTC(+a[1], +a[2] - 1, +a[3], +a[4],
+ +a[5], +a[6]));
+ }
+ }
+ return value;
+ });
+
+ myData = JSON.parse('["Date(09/09/2001)"]', function (key, value) {
+ var d;
+ if (typeof value === 'string' &&
+ value.slice(0, 5) === 'Date(' &&
+ value.slice(-1) === ')') {
+ d = new Date(value.slice(5, -1));
+ if (d) {
+ return d;
+ }
+ }
+ return value;
+ });
+
+
+ This is a reference implementation. You are free to copy, modify, or
+ redistribute.
+
+ This code should be minified before deployment.
+ See http://javascript.crockford.com/jsmin.html
+
+ USE YOUR OWN COPY. IT IS EXTREMELY UNWISE TO LOAD CODE FROM SERVERS YOU DO
+ NOT CONTROL.
+*/
+
+/*jslint evil: true */
+
+/*members "", "\b", "\t", "\n", "\f", "\r", "\"", JSON, "\\", apply,
+ call, charCodeAt, getUTCDate, getUTCFullYear, getUTCHours,
+ getUTCMinutes, getUTCMonth, getUTCSeconds, hasOwnProperty, join,
+ lastIndex, length, parse, prototype, push, replace, slice, stringify,
+ test, toJSON, toString, valueOf
+*/
+
+// Create a JSON object only if one does not already exist. We create the
+// methods in a closure to avoid creating global variables.
+
+var JSON = JSON || {};
+
+(function () {
+
+ function f(n) {
+ // Format integers to have at least two digits.
+ return n < 10 ? '0' + n : n;
+ }
+
+ if (typeof Date.prototype.toJSON !== 'function') {
+
+ Date.prototype.toJSON = function (key) {
+
+ return isFinite(this.valueOf()) ?
+ this.getUTCFullYear() + '-' +
+ f(this.getUTCMonth() + 1) + '-' +
+ f(this.getUTCDate()) + 'T' +
+ f(this.getUTCHours()) + ':' +
+ f(this.getUTCMinutes()) + ':' +
+ f(this.getUTCSeconds()) + 'Z' : null;
+ };
+
+ String.prototype.toJSON =
+ Number.prototype.toJSON =
+ Boolean.prototype.toJSON = function (key) {
+ return this.valueOf();
+ };
+ }
+
+ var cx = /[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,
+ escapable = /[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,
+ gap,
+ indent,
+ meta = { // table of character substitutions
+ '\b': '\\b',
+ '\t': '\\t',
+ '\n': '\\n',
+ '\f': '\\f',
+ '\r': '\\r',
+ '"' : '\\"',
+ '\\': '\\\\'
+ },
+ rep;
+
+
+ function quote(string) {
+
+// If the string contains no control characters, no quote characters, and no
+// backslash characters, then we can safely slap some quotes around it.
+// Otherwise we must also replace the offending characters with safe escape
+// sequences.
+
+ escapable.lastIndex = 0;
+ return escapable.test(string) ?
+ '"' + string.replace(escapable, function (a) {
+ var c = meta[a];
+ return typeof c === 'string' ? c :
+ '\\u' + ('0000' + a.charCodeAt(0).toString(16)).slice(-4);
+ }) + '"' :
+ '"' + string + '"';
+ }
+
+
+ function str(key, holder) {
+
+// Produce a string from holder[key].
+
+ var i, // The loop counter.
+ k, // The member key.
+ v, // The member value.
+ length,
+ mind = gap,
+ partial,
+ value = holder[key];
+
+// If the value has a toJSON method, call it to obtain a replacement value.
+
+ if (value && typeof value === 'object' &&
+ typeof value.toJSON === 'function') {
+ value = value.toJSON(key);
+ }
+
+// If we were called with a replacer function, then call the replacer to
+// obtain a replacement value.
+
+ if (typeof rep === 'function') {
+ value = rep.call(holder, key, value);
+ }
+
+// What happens next depends on the value's type.
+
+ switch (typeof value) {
+ case 'string':
+ return quote(value);
+
+ case 'number':
+
+// JSON numbers must be finite. Encode non-finite numbers as null.
+
+ return isFinite(value) ? String(value) : 'null';
+
+ case 'boolean':
+ case 'null':
+
+// If the value is a boolean or null, convert it to a string. Note:
+// typeof null does not produce 'null'. The case is included here in
+// the remote chance that this gets fixed someday.
+
+ return String(value);
+
+// If the type is 'object', we might be dealing with an object or an array or
+// null.
+
+ case 'object':
+
+// Due to a specification blunder in ECMAScript, typeof null is 'object',
+// so watch out for that case.
+
+ if (!value) {
+ return 'null';
+ }
+
+// Make an array to hold the partial results of stringifying this object value.
+
+ gap += indent;
+ partial = [];
+
+// Is the value an array?
+
+ if (Object.prototype.toString.apply(value) === '[object Array]') {
+
+// The value is an array. Stringify every element. Use null as a placeholder
+// for non-JSON values.
+
+ length = value.length;
+ for (i = 0; i < length; i += 1) {
+ partial[i] = str(i, value) || 'null';
+ }
+
+// Join all of the elements together, separated with commas, and wrap them in
+// brackets.
+
+ v = partial.length === 0 ? '[]' :
+ gap ? '[\n' + gap +
+ partial.join(',\n' + gap) + '\n' +
+ mind + ']' :
+ '[' + partial.join(',') + ']';
+ gap = mind;
+ return v;
+ }
+
+// If the replacer is an array, use it to select the members to be stringified.
+
+ if (rep && typeof rep === 'object') {
+ length = rep.length;
+ for (i = 0; i < length; i += 1) {
+ k = rep[i];
+ if (typeof k === 'string') {
+ v = str(k, value);
+ if (v) {
+ partial.push(quote(k) + (gap ? ': ' : ':') + v);
+ }
+ }
+ }
+ } else {
+
+// Otherwise, iterate through all of the keys in the object.
+
+ for (k in value) {
+ if (Object.hasOwnProperty.call(value, k)) {
+ v = str(k, value);
+ if (v) {
+ partial.push(quote(k) + (gap ? ': ' : ':') + v);
+ }
+ }
+ }
+ }
+
+// Join all of the member texts together, separated with commas,
+// and wrap them in braces.
+
+ v = partial.length === 0 ? '{}' :
+ gap ? '{\n' + gap + partial.join(',\n' + gap) + '\n' +
+ mind + '}' : '{' + partial.join(',') + '}';
+ gap = mind;
+ return v;
+ }
+ }
+
+// If the JSON object does not yet have a stringify method, give it one.
+
+ if (typeof JSON.stringify !== 'function') {
+ JSON.stringify = function (value, replacer, space) {
+
+// The stringify method takes a value and an optional replacer, and an optional
+// space parameter, and returns a JSON text. The replacer can be a function
+// that can replace values, or an array of strings that will select the keys.
+// A default replacer method can be provided. Use of the space parameter can
+// produce text that is more easily readable.
+
+ var i;
+ gap = '';
+ indent = '';
+
+// If the space parameter is a number, make an indent string containing that
+// many spaces.
+
+ if (typeof space === 'number') {
+ for (i = 0; i < space; i += 1) {
+ indent += ' ';
+ }
+
+// If the space parameter is a string, it will be used as the indent string.
+
+ } else if (typeof space === 'string') {
+ indent = space;
+ }
+
+// If there is a replacer, it must be a function or an array.
+// Otherwise, throw an error.
+
+ rep = replacer;
+ if (replacer && typeof replacer !== 'function' &&
+ (typeof replacer !== 'object' ||
+ typeof replacer.length !== 'number')) {
+ throw new Error('JSON.stringify');
+ }
+
+// Make a fake root object containing our value under the key of ''.
+// Return the result of stringifying the value.
+
+ return str('', {'': value});
+ };
+ }
+
+
+// If the JSON object does not yet have a parse method, give it one.
+
+ if (typeof JSON.parse !== 'function') {
+ JSON.parse = function (text, reviver) {
+
+// The parse method takes a text and an optional reviver function, and returns
+// a JavaScript value if the text is a valid JSON text.
+
+ var j;
+
+ function walk(holder, key) {
+
+// The walk method is used to recursively walk the resulting structure so
+// that modifications can be made.
+
+ var k, v, value = holder[key];
+ if (value && typeof value === 'object') {
+ for (k in value) {
+ if (Object.hasOwnProperty.call(value, k)) {
+ v = walk(value, k);
+ if (v !== undefined) {
+ value[k] = v;
+ } else {
+ delete value[k];
+ }
+ }
+ }
+ }
+ return reviver.call(holder, key, value);
+ }
+
+
+// Parsing happens in four stages. In the first stage, we replace certain
+// Unicode characters with escape sequences. JavaScript handles many characters
+// incorrectly, either silently deleting them, or treating them as line endings.
+
+ cx.lastIndex = 0;
+ if (cx.test(text)) {
+ text = text.replace(cx, function (a) {
+ return '\\u' +
+ ('0000' + a.charCodeAt(0).toString(16)).slice(-4);
+ });
+ }
+
+// In the second stage, we run the text against regular expressions that look
+// for non-JSON patterns. We are especially concerned with '()' and 'new'
+// because they can cause invocation, and '=' because it can cause mutation.
+// But just to be safe, we want to reject all unexpected forms.
+
+// We split the second stage into 4 regexp operations in order to work around
+// crippling inefficiencies in IE's and Safari's regexp engines. First we
+// replace the JSON backslash pairs with '@' (a non-JSON character). Second, we
+// replace all simple value tokens with ']' characters. Third, we delete all
+// open brackets that follow a colon or comma or that begin the text. Finally,
+// we look to see that the remaining characters are only whitespace or ']' or
+// ',' or ':' or '{' or '}'. If that is so, then the text is safe for eval.
+
+ if (/^[\],:{}\s]*$/.
+test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g, '@').
+replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g, ']').
+replace(/(?:^|:|,)(?:\s*\[)+/g, ''))) {
+
+// In the third stage we use the eval function to compile the text into a
+// JavaScript structure. The '{' operator is subject to a syntactic ambiguity
+// in JavaScript: it can begin a block or an object literal. We wrap the text
+// in parens to eliminate the ambiguity.
+
+ j = eval('(' + text + ')');
+
+// In the optional fourth stage, we recursively walk the new structure, passing
+// each name/value pair to a reviver function for possible transformation.
+
+ return typeof reviver === 'function' ?
+ walk({'': j}, '') : j;
+ }
+
+// If the text is not JSON parseable, then a SyntaxError is thrown.
+
+ throw new SyntaxError('JSON.parse');
+ };
+ }
+}());
diff -r 3c64aa0a0f85 -r a6be5c3955e9 static/scripts/json_cookie.js
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/scripts/json_cookie.js Mon Aug 10 12:09:50 2009 -0400
@@ -0,0 +1,61 @@
+/*
+ JSONCookie: Uses JSON to allow the settings of multiple preferences in one cookie.
+ Kanwei Li, 2009
+
+ cookie = new JSONCookie("cookie_name"); // Pass in the name of the cookie
+
+ // Gets the value of a preference, returns optional second argument if pref not found
+ cookie.get("pref", "val_if_not_found");
+
+ cookie.set("pref", "val"); // Sets a value for the preference and saves cookie
+ cookie.unset("pref"); // Unsets the preference and saves cookie
+ cookie.clear() // Deletes the cookie
+
+*/
+
+function JSONCookie(name) {
+ this.cookie_name = name;
+
+}
+
+JSONCookie.prototype = {
+ json_data : function() {
+ cookie = $.cookie(this.cookie_name);
+ return cookie ? JSON.parse(cookie) : null;
+ },
+
+ save : function(data) {
+ $.cookie(this.cookie_name, JSON.stringify(data));
+ },
+
+ get : function(attr, else_val) {
+ data = this.json_data();
+ if (data && data[attr]) { return data[attr];
+ } else if (else_val) { return else_val;
+ } else { return null;
+ }
+ },
+
+ set : function(attr, val) {
+ data = this.json_data();
+ if (data) {
+ data[attr] = val;
+ } else {
+ data = { attr : val }
+ }
+ this.save(data);
+ },
+
+ unset : function(attr) {
+ data = this.json_data();
+ if (data) {
+ delete data[attr];
+ }
+ this.save(data);
+ },
+
+ clear : function() {
+ this.save(null);
+ }
+
+};
\ No newline at end of file
diff -r 3c64aa0a0f85 -r a6be5c3955e9 templates/workflow/editor.mako
--- a/templates/workflow/editor.mako Thu Aug 06 16:11:40 2009 -0400
+++ b/templates/workflow/editor.mako Mon Aug 10 12:09:50 2009 -0400
@@ -31,6 +31,9 @@
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.event.hover.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.form.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.json.js')}"> </script>
+ <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.cookie.js')}"> </script>
+ <script type='text/javascript' src="${h.url_for('/static/scripts/json2.js')}"> </script>
+ <script type='text/javascript' src="${h.url_for('/static/scripts/json_cookie.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.base.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.workflow_editor.canvas.js')}"> </script>
@@ -56,6 +59,10 @@
}
// Canvas overview management
canvas_manager = new CanvasManager( $("#canvas-viewport"), $("#overview") );
+
+ // Preferences cookie stored as JSON so that only one cookie is needed for multiple settings
+ var prefs_cookie = new JSONCookie("galaxy.workflow");
+
// Initialize workflow state
reset();
// Load the datatype info
@@ -121,17 +128,42 @@
canvas_manager.draw_overview();
});
- /* Lets the viewport be toggled visible and invisible, adjusting the arrows accordingly */
+ // Stores the size of the overview in a cookie when it's resized
+ $("#overview-border").bind( "dragend", function( e ) {
+ var op = $(this).offsetParent();
+ var opo = op.offset();
+ var new_size = Math.max( op.width() - ( e.offsetX - opo.left ),
+ op.height() - ( e.offsetY - opo.top ) );
+ prefs_cookie.set("overview-size", new_size);
+ });
+
+ // On load, set the size to the pref stored in cookie if it exists
+ overview_size = prefs_cookie.get("overview-size");
+ if (overview_size) {
+ $("#overview-border").css( {
+ width: overview_size,
+ height: overview_size
+ });
+ }
+
+ function show_overview() {
+ prefs_cookie.unset("overview-off");
+ $("#overview-border").css("right", "0px");
+ $("#close-viewport").css("background-position", "0px 0px");
+ }
+
+ function hide_overview() {
+ prefs_cookie.set("overview-off", true);
+ $("#overview-border").css("right", "20000px");
+ $("#close-viewport").css("background-position", "12px 0px");
+ }
+
+ // Show viewport on load unless pref says it's off
+ prefs_cookie.get("overview-off") == true ? hide_overview() : show_overview()
+
+ // Lets the overview be toggled visible and invisible, adjusting the arrows accordingly
$("#close-viewport").click( function() {
- if ( $("#overview-border").css("right") == "0px" ) {
- $("#overview-border").css("right", "20000px");
- $("#close-viewport").css("background-position", "12px 0px");
-
- } else {
- $("#overview-border").css("right", "0px");
- $("#close-viewport").css("background-position", "0px 0px");
- }
-
+ $("#overview-border").css("right") == "0px" ? hide_overview() : show_overview();
});
// Unload handler
@@ -642,7 +674,7 @@
<div id="canvas-viewport" style="width: 100%; height: 100%; position: absolute; overflow: hidden; background: #EEEEEE; background: white url(${h.url_for('/static/images/light_gray_grid.gif')}) repeat;">
<div id="canvas-container" style="position: absolute; width: 100%; height: 100%;"></div>
</div>
- <div id="overview-border" style="position: absolute; width: 150px; height: 150px; right: 0px; bottom: 0px; border-top: solid gray 1px; border-left: solid grey 1px; padding: 7px 0 0 7px; background: #EEEEEE no-repeat url(${h.url_for('/static/images/resizable.png')}); z-index: 20000; overflow: hidden; max-width: 300px; max-height: 300px; min-width: 50px; min-height: 50px">
+ <div id="overview-border" style="position: absolute; width: 150px; height: 150px; right: 20000px; bottom: 0px; border-top: solid gray 1px; border-left: solid grey 1px; padding: 7px 0 0 7px; background: #EEEEEE no-repeat url(${h.url_for('/static/images/resizable.png')}); z-index: 20000; overflow: hidden; max-width: 300px; max-height: 300px; min-width: 50px; min-height: 50px">
<div style="position: relative; overflow: hidden; width: 100%; height: 100%; border-top: solid gray 1px; border-left: solid grey 1px;">
<div id="overview" style="position: absolute;">
<canvas width="0" height="0" style="background: white; width: 100%; height: 100%;" id="overview-canvas"></canvas>
@@ -650,7 +682,7 @@
</div>
</div>
</div>
- <div id="close-viewport" style="border-left: 1px solid #999; border-top: 1px solid #999; background: #ddd url(${h.url_for('/static/images/overview_arrows.png')}); position: absolute; right: 0px; bottom: 0px; width: 12px; height: 12px; z-index: 25000;"></div>
+ <div id="close-viewport" style="border-left: 1px solid #999; border-top: 1px solid #999; background: #ddd url(${h.url_for('/static/images/overview_arrows.png')}) 12px 0px; position: absolute; right: 0px; bottom: 0px; width: 12px; height: 12px; z-index: 25000;"></div>
</div>
</%def>
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/55c0eb35fad7
changeset: 2575:55c0eb35fad7
user: Kanwei Li <kanwei(a)gmail.com>
date: Thu Aug 13 13:16:58 2009 -0400
description:
Implemented local storage for preferences, obsoleting cookies that were used for this purpose
7 file(s) affected in this change:
static/jStore.Flash.html
static/jStore.swf
static/scripts/jquery.jstore-all.js
static/scripts/packed/jquery.jstore-all.js
static/scripts/packed/json2.js
templates/root/history.mako
templates/workflow/editor.mako
diffs (1380 lines):
diff -r 7df41ad788de -r 55c0eb35fad7 static/jStore.Flash.html
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/jStore.Flash.html Thu Aug 13 13:16:58 2009 -0400
@@ -0,0 +1,19 @@
+<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd">
+<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en">
+ <head>
+ <title>Flash External Object</title>
+ <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
+ <script type="text/javascript">
+ /**
+ * This function captures the flash_ready event. We need to relay this
+ * back to the parent so it knows flash is ready.
+ */
+ function flash_ready(){
+ parent.flash_ready();
+ }
+ </script>
+ </head>
+ <body>
+ <object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#versi…" width="1" height="1" id="jStoreFlash"><param name="allowScriptAccess" value="always" /><param name="movie" value="jStore.swf" /><param name="quality" value="high" /><param name="bgcolor" value="#ffcc00" /><embed src="jStore.swf" quality="high" bgcolor="#ffcc00" width="1" height="1" name="jStoreFlash" align="middle" allowScriptAccess="always" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /></object>
+ </body>
+</html>
\ No newline at end of file
diff -r 7df41ad788de -r 55c0eb35fad7 static/jStore.swf
Binary file static/jStore.swf has changed
diff -r 7df41ad788de -r 55c0eb35fad7 static/scripts/jquery.jstore-all.js
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/scripts/jquery.jstore-all.js Thu Aug 13 13:16:58 2009 -0400
@@ -0,0 +1,748 @@
+/*!
+ * jStore - Persistent Client-Side Storage
+ *
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ *
+ * Dual licensed under:
+ * MIT: http://www.opensource.org/licenses/mit-license.php
+ * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html
+ *//**
+ * Javascript Class Framework
+ *
+ * Copyright (c) 2008 John Resig (http://ejohn.org/blog/simple-javascript-inheritance/)
+ * Inspired by base2 and Prototype
+ */
+(function(){
+ var initializing = false, fnTest = /xyz/.test(function(){xyz;}) ? /\b_super\b/ : /.*/;
+
+ // The base Class implementation (does nothing)
+ this.Class = function(){};
+
+ // Create a new Class that inherits from this class
+ Class.extend = function(prop) {
+ var _super = this.prototype;
+
+ // Instantiate a base class (but only create the instance,
+ // don't run the init constructor)
+ initializing = true;
+ var prototype = new this();
+ initializing = false;
+
+ // Copy the properties over onto the new prototype
+ for (var name in prop) {
+ // Check if we're overwriting an existing function
+ prototype[name] = typeof prop[name] == "function" &&
+ typeof _super[name] == "function" && fnTest.test(prop[name]) ?
+ (function(name, fn){
+ return function() {
+ var tmp = this._super;
+
+ // Add a new ._super() method that is the same method
+ // but on the super-class
+ this._super = _super[name];
+
+ // The method only need to be bound temporarily, so we
+ // remove it when we're done executing
+ var ret = fn.apply(this, arguments);
+ this._super = tmp;
+
+ return ret;
+ };
+ })(name, prop[name]) :
+ prop[name];
+ }
+
+ // The dummy class constructor
+ function Class() {
+ // All construction is actually done in the init method
+ if ( !initializing && this.init )
+ this.init.apply(this, arguments);
+ }
+
+ // Populate our constructed prototype object
+ Class.prototype = prototype;
+
+ // Enforce the constructor to be what we expect
+ Class.constructor = Class;
+
+ // And make this class extendable
+ Class.extend = arguments.callee;
+
+ return Class;
+ };
+})();
+/*!
+ * jStore Delegate Framework
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ this.jStoreDelegate = Class.extend({
+ init: function(parent){
+ // The Object this delgate operates for
+ this.parent = parent;
+ // Container for callbacks to dispatch.
+ // eventType => [ callback, callback, ... ]
+ this.callbacks = {};
+ },
+ bind: function(event, callback){
+ if ( !$.isFunction(callback) ) return this;
+ if ( !this.callbacks[ event ] ) this.callbacks[ event ] = [];
+
+ this.callbacks[ event ].push(callback);
+
+ return this;
+ },
+ trigger: function(){
+ var parent = this.parent,
+ args = [].slice.call(arguments),
+ event = args.shift(),
+ handlers = this.callbacks[ event ];
+
+ if ( !handlers ) return false;
+
+ $.each(handlers, function(){ this.apply(parent, args) });
+ return this;
+ }
+ });
+
+})(jQuery);/**
+ * jStore-jQuery Interface
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ // Setup the jStore namespace in jQuery for options storage
+ $.jStore = {};
+
+ // Seed the options in
+ $.extend($.jStore, {
+ EngineOrder: [],
+ // Engines should put their availability tests within jStore.Availability
+ Availability: {},
+ // Defined engines should enter themselves into the jStore.Engines
+ Engines: {},
+ // Instanciated engines should exist within jStore.Instances
+ Instances: {},
+ // The current engine to use for storage
+ CurrentEngine: null,
+ // Provide global settings for overwriting
+ defaults: {
+ project: null,
+ engine: null,
+ autoload: true,
+ flash: 'jStore.Flash.html'
+ },
+ // Boolean for ready state handling
+ isReady: false,
+ // Boolean for flash ready state handling
+ isFlashReady: false,
+ // An event delegate
+ delegate: new jStoreDelegate($.jStore)
+ .bind('jStore-ready', function(engine){
+ $.jStore.isReady = true;
+ if ($.jStore.defaults.autoload) engine.connect();
+ })
+ .bind('flash-ready', function(){
+ $.jStore.isFlashReady = true;
+ })
+ });
+
+ // Enable ready callback for jStore
+ $.jStore.ready = function(callback){
+ if ($.jStore.isReady) callback.apply($.jStore, [$.jStore.CurrentEngine]);
+ else $.jStore.delegate.bind('jStore-ready', callback);
+ }
+
+ // Enable failure callback registration for jStore
+ $.jStore.fail = function(callback){
+ $.jStore.delegate.bind('jStore-failure', callback);
+ }
+
+ // Enable ready callback for Flash
+ $.jStore.flashReady = function(callback){
+ if ($.jStore.isFlashReady) callback.apply($.jStore, [$.jStore.CurrentEngine]);
+ else $.jStore.delegate.bind('flash-ready', callback);
+ }
+
+ // Enable and test an engine
+ $.jStore.use = function(engine, project, identifier){
+ project = project || $.jStore.defaults.project || location.hostname.replace(/\./g, '-') || 'unknown';
+
+ var e = $.jStore.Engines[engine.toLowerCase()] || null,
+ name = (identifier ? identifier + '.' : '') + project + '.' + engine;
+
+ if ( !e ) throw 'JSTORE_ENGINE_UNDEFINED';
+
+ // Instanciate the engine
+ e = new e(project, name);
+
+ // Prevent against naming conflicts
+ if ($.jStore.Instances[name]) throw 'JSTORE_JRI_CONFLICT';
+
+ // Test the engine
+ if (e.isAvailable()){
+ $.jStore.Instances[name] = e; // The Easy Way
+ if (!$.jStore.CurrentEngine){
+ $.jStore.CurrentEngine = e;
+ }
+ $.jStore.delegate.trigger('jStore-ready', e);
+ } else {
+ if (!e.autoload) // Not available
+ throw 'JSTORE_ENGINE_UNAVILABLE';
+ else { // The hard way
+ e.included(function(){
+ if (this.isAvailable()) { // Worked out
+ $.jStore.Instances[name] = this;
+ // If there is no current engine, use this one
+ if (!$.jStore.CurrentEngine){
+ $.jStore.CurrentEngine = this;
+ }
+ $.jStore.delegate.trigger('jStore-ready', this);
+ }
+ else $.jStore.delegate.trigger('jStore-failure', this);
+ }).include();
+ }
+ }
+ }
+
+ // Set the current storage engine
+ $.jStore.setCurrentEngine = function(name){
+ if (!$.jStore.Instances.length ) // If no instances exist, attempt to load one
+ return $.jStore.FindEngine();
+
+ if (!name && $.jStore.Instances.length >= 1) { // If no name is specified, use the first engine
+ $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[0]);
+ return $.jStore.CurrentEngine = $.jStore.Instances[0];
+ }
+
+ if (name && $.jStore.Instances[name]) { // If a name is specified and exists, use it
+ $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[name]);
+ return $.jStore.CurrentEngine = $.jStore.Instances[name];
+ }
+
+ throw 'JSTORE_JRI_NO_MATCH';
+ }
+
+ // Test all possible engines for straightforward useability
+ $.jStore.FindEngine = function(){
+ $.each($.jStore.EngineOrder, function(k){
+ if ($.jStore.Availability[this]()){ // Find the first, easiest option and use it.
+ $.jStore.use(this, $.jStore.defaults.project, 'default');
+ return false;
+ }
+ })
+ }
+
+ // Provide a simple interface for storing/getting values
+ $.jStore.store = function(key, value){
+ if (!$.jStore.CurrentEngine) return false;
+
+ if ( !value ) // Executing a get command
+ return $.jStore.CurrentEngine.get(key);
+ // Executing a set command
+ return $.jStore.CurrentEngine.set(key, value);
+ }
+ // Provide a simple interface for storing/getting values
+ $.jStore.remove = function(key){
+ if (!$.jStore.CurrentEngine) return false;
+
+ return $.jStore.CurrentEngine.rem(key);
+ }
+
+ // Provide a chainable interface for storing values/getting a value at the end of a chain
+ $.fn.store = function(key, value){
+ if (!$.jStore.CurrentEngine) return this;
+
+ var result = $.jStore.store(key, value);
+
+ return !value ? result : this;
+ }
+
+ // Provide a chainable interface for removing values
+ $.fn.removeStore = function(key){
+ $.jStore.remove(key);
+
+ return this;
+ }
+
+ // Provide a way for users to call for auto-loading
+ $.jStore.load = function(){
+ if ($.jStore.defaults.engine)
+ return $.jStore.use($.jStore.defaults.engine, $.jStore.defaults.project, 'default');
+
+ // Attempt to find a valid engine, and catch any exceptions if we can't
+ try {
+ $.jStore.FindEngine();
+ } catch (e) {}
+ }
+
+})(jQuery);
+/**
+ * jStore Engine Core
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ this.StorageEngine = Class.extend({
+ init: function(project, name){
+ // Configure the project name
+ this.project = project;
+ // The JRI name given by the manager
+ this.jri = name;
+ // Cache the data so we can work synchronously
+ this.data = {};
+ // The maximum limit of the storage engine
+ this.limit = -1;
+ // Third party script includes
+ this.includes = [];
+ // Create an event delegate for users to subscribe to event triggers
+ this.delegate = new jStoreDelegate(this)
+ .bind('engine-ready', function(){
+ this.isReady = true;
+ })
+ .bind('engine-included', function(){
+ this.hasIncluded = true;
+ });
+ // If enabled, the manager will check availability, then run include(), then check again
+ this.autoload = false; // This should be changed by the engines, if they have required includes
+ // When set, we're ready to transact data
+ this.isReady = false;
+ // When the includer is finished, it will set this to true
+ this.hasIncluded = false;
+ },
+ // Performs all necessary script includes
+ include: function(){
+ var self = this,
+ total = this.includes.length,
+ count = 0;
+
+ $.each(this.includes, function(){
+ $.ajax({type: 'get', url: this, dataType: 'script', cache: true,
+ success: function(){
+ count++;
+ if (count == total) self.delegate.trigger('engine-included');
+ }
+ })
+ });
+ },
+ // This should be overloaded with an actual functionality presence check
+ isAvailable: function(){
+ return false;
+ },
+ /** Event Subscription Shortcuts **/
+ ready: function(callback){
+ if (this.isReady) callback.apply(this);
+ else this.delegate.bind('engine-ready', callback);
+ return this;
+ },
+ included: function(callback){
+ if (this.hasIncluded) callback.apply(this);
+ else this.delegate.bind('engine-included', callback);
+ return this;
+ },
+ /** Cache Data Access **/
+ get: function(key){
+ return this.data[key] || null;
+ },
+ set: function(key, value){
+ this.data[key] = value;
+ return value;
+ },
+ rem: function(key){
+ var beforeDelete = this.data[key];
+ this.data[key] = null;
+ return beforeDelete;
+ }
+ });
+
+})(jQuery);
+/*!
+ * jStore DOM Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ // Set up a static test function for this instance
+ var sessionAvailability = $.jStore.Availability.session = function(){
+ return !!window.sessionStorage;
+ },
+ localAvailability = $.jStore.Availability.local = function(){
+ return !!(window.localStorage || window.globalStorage);
+ };
+
+ this.jStoreDom = StorageEngine.extend({
+ init: function(project, name){
+ // Call the parental init object
+ this._super(project, name);
+
+ // The type of storage engine
+ this.type = 'DOM';
+
+ // Set the Database limit
+ this.limit = 5 * 1024 * 1024;
+ },
+ connect: function(){
+ // Fire our delegate to indicate we're ready for data transactions
+ this.delegate.trigger('engine-ready');
+ },
+ get: function(key){
+ var out = this.db.getItem(key);
+ // Gecko's getItem returns {value: 'the value'}, WebKit returns 'the value'
+ return out && out.value ? out.value : out
+ },
+ set: function(key, value){
+ this.db.setItem(key,value);
+ return value;
+ },
+ rem: function(key){
+ var out = this.get(key);
+ this.db.removeItem(key);
+ return out
+ }
+ })
+
+ this.jStoreLocal = jStoreDom.extend({
+ connect: function(){
+ // Gecko uses a non-standard globalStorage[ www.example.com ] DOM access object for persistant storage.
+ this.db = !window.globalStorage ? window.localStorage : window.globalStorage[location.hostname];
+ this._super();
+ },
+ isAvailable: localAvailability
+ })
+
+ this.jStoreSession = jStoreDom.extend({
+ connect: function(){
+ this.db = sessionStorage;
+ this._super();
+ },
+ isAvailable: sessionAvailability
+ })
+
+ $.jStore.Engines.local = jStoreLocal;
+ $.jStore.Engines.session = jStoreSession;
+
+ // Store the ordering preference
+ $.jStore.EngineOrder[ 1 ] = 'local';
+
+})(jQuery);
+/*!
+ * jStore Flash Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com)
+ */
+(function($){
+
+ // Set up a static test function for this instance
+ var avilability = $.jStore.Availability.flash = function(){
+ return !!($.jStore.hasFlash('8.0.0'));
+ }
+
+ this.jStoreFlash = StorageEngine.extend({
+ init: function(project, name){
+ // Call the parental init object
+ this._super(project, name);
+
+ // The type of storage engine
+ this.type = 'Flash';
+
+ // Bind our flashReady function to the jStore Delegate
+ var self = this;
+ $.jStore.flashReady(function(){ self.flashReady() });
+ },
+ connect: function(){
+ var name = 'jstore-flash-embed-' + this.project;
+
+ // To make Flash Storage work on IE, we have to load up an iFrame
+ // which contains an HTML page that embeds the object using an
+ // object tag wrapping an embed tag. Of course, this is unnecessary for
+ // all browsers except for IE, which, to my knowledge, is the only browser
+ // in existance where you need to complicate your code to fix bugs. Goddamnit. :(
+ $(document.body)
+ .append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" ' +
+ 'id="jStoreFlashFrame" src="' +$.jStore.defaults.flash + '"></iframe>');
+ },
+ flashReady: function(e){
+ var iFrame = $('#jStoreFlashFrame')[0];
+
+ // IE
+ if (iFrame.Document && $.isFunction(iFrame.Document['jStoreFlash'].f_get_cookie)) this.db = iFrame.Document['jStoreFlash'];
+ // Safari && Firefox
+ else if (iFrame.contentWindow && iFrame.contentWindow.document){
+ var doc = iFrame.contentWindow.document;
+ // Safari
+ if ($.isFunction($('object', $(doc))[0].f_get_cookie)) this.db = $('object', $(doc))[0];
+ // Firefox
+ else if ($.isFunction($('embed', $(doc))[0].f_get_cookie)) this.db = $('embed', $(doc))[0];
+ }
+
+ // We're ready to process data
+ if (this.db) this.delegate.trigger('engine-ready');
+ },
+ isAvailable: avilability,
+ get: function(key){
+ var out = this.db.f_get_cookie(key);
+ return out == 'null' ? null : out;
+ },
+ set: function(key, value){
+ this.db.f_set_cookie(key, value);
+ return value;
+ },
+ rem: function(key){
+ var beforeDelete = this.get(key);
+ this.db.f_delete_cookie(key);
+ return beforeDelete;
+ }
+ })
+
+ $.jStore.Engines.flash = jStoreFlash;
+
+ // Store the ordering preference
+ $.jStore.EngineOrder[ 2 ] = 'flash';
+
+ /**
+ * Flash Detection functions copied from the jQuery Flash Plugin
+ * Copyright (c) 2006 Luke Lutman (http://jquery.lukelutman.com/plugins/flash)
+ * Dual licensed under the MIT and GPL licenses.
+ * http://www.opensource.org/licenses/mit-license.php
+ * http://www.opensource.org/licenses/gpl-license.php
+ */
+ $.jStore.hasFlash = function(version){
+ var pv = $.jStore.flashVersion().match(/\d+/g),
+ rv = version.match(/\d+/g);
+
+ for(var i = 0; i < 3; i++) {
+ pv[i] = parseInt(pv[i] || 0);
+ rv[i] = parseInt(rv[i] || 0);
+ // player is less than required
+ if(pv[i] < rv[i]) return false;
+ // player is greater than required
+ if(pv[i] > rv[i]) return true;
+ }
+ // major version, minor version and revision match exactly
+ return true;
+ }
+
+ $.jStore.flashVersion = function(){
+ // ie
+ try {
+ try {
+ // avoid fp6 minor version lookup issues
+ // see: http://blog.deconcept.com/2006/01/11/getvariable-setvariable-crash-internet…
+ var axo = new ActiveXObject('ShockwaveFlash.ShockwaveFlash.6');
+ try { axo.AllowScriptAccess = 'always'; }
+ catch(e) { return '6,0,0'; }
+ } catch(e) {}
+ return new ActiveXObject('ShockwaveFlash.ShockwaveFlash').GetVariable('$version').replace(/\D+/g, ',').match(/^,?(.+),?$/)[1];
+ // other browsers
+ } catch(e) {
+ try {
+ if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){
+ return (navigator.plugins["Shockwave Flash 2.0"] || navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g, ",").match(/^,?(.+),?$/)[1];
+ }
+ } catch(e) {}
+ }
+ return '0,0,0';
+ }
+
+})(jQuery);
+
+// Callback fired when ExternalInterface is established
+function flash_ready(){
+ $.jStore.delegate.trigger('flash-ready');
+}
+/*!
+ * jStore Google Gears Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ // Set up a static test function for this instance
+ var avilability = $.jStore.Availability.gears = function(){
+ return !!(window.google && window.google.gears)
+ }
+
+ this.jStoreGears = StorageEngine.extend({
+ init: function(project, name){
+ // Call the parental init object
+ this._super(project, name);
+
+ // The type of storage engine
+ this.type = 'Google Gears';
+
+ // Add required third-party scripts
+ this.includes.push('http://code.google.com/apis/gears/gears_init.js');
+
+ // Allow Autoloading on fail
+ this.autoload = true;
+ },
+ connect: function(){
+ // Create our database connection
+ var db = this.db = google.gears.factory.create('beta.database');
+ db.open( 'jstore-' + this.project );
+ db.execute( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' );
+
+ // Cache the data from the table
+ this.updateCache();
+ },
+ updateCache: function(){
+ // Read the database into our cache object
+ var result = this.db.execute( 'SELECT k,v FROM jstore' );
+ while (result.isValidRow()){
+ this.data[result.field(0)] = result.field(1);
+ result.next();
+ } result.close();
+
+ // Fire our delegate to indicate we're ready for data transactions
+ this.delegate.trigger('engine-ready');
+ },
+ isAvailable: avilability,
+ set: function(key, value){
+ // Update the database
+ var db = this.db;
+ db.execute( 'BEGIN' );
+ db.execute( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value] );
+ db.execute( 'COMMIT' );
+ return this._super(key, value);
+ },
+ rem: function(key){
+ // Update the database
+ var db = this.db;
+ db.execute( 'BEGIN' );
+ db.execute( 'DELETE FROM jstore WHERE k = ?', [key] );
+ db.execute( 'COMMIT' );
+ return this._super(key);
+ }
+ })
+
+ $.jStore.Engines.gears = jStoreGears;
+
+ // Store the ordering preference
+ $.jStore.EngineOrder[ 3 ] = 'gears';
+
+})(jQuery);
+/*!
+ * jStore HTML5 Specification Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ // Set up a static test function for this instance
+ var avilability = $.jStore.Availability.html5 = function(){
+ return !!window.openDatabase
+ }
+
+ this.jStoreHtml5 = StorageEngine.extend({
+ init: function(project, name){
+ // Call the parental init object
+ this._super(project, name);
+
+ // The type of storage engine
+ this.type = 'HTML5';
+
+ // Set the Database limit
+ this.limit = 1024 * 200;
+ },
+ connect: function(){
+ // Create our database connection
+ var db = this.db = openDatabase('jstore-' + this.project, '1.0', this.project, this.limit);
+ if (!db) throw 'JSTORE_ENGINE_HTML5_NODB';
+ db.transaction(function(db){
+ db.executeSql( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' );
+ });
+
+ // Cache the data from the table
+ this.updateCache();
+ },
+ updateCache: function(){
+ var self = this;
+ // Read the database into our cache object
+ this.db.transaction(function(db){
+ db.executeSql( 'SELECT k,v FROM jstore', [], function(db, result){
+ var rows = result.rows, i = 0, row;
+ for (; i < rows.length; ++i){
+ row = rows.item(i);
+ self.data[row.k] = row.v;
+ }
+
+ // Fire our delegate to indicate we're ready for data transactions
+ self.delegate.trigger('engine-ready');
+ });
+ });
+ },
+ isAvailable: avilability,
+ set: function(key, value){
+ // Update the database
+ this.db.transaction(function(db){
+ db.executeSql( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value]);
+ });
+ return this._super(key, value);
+ },
+ rem: function(key){
+ // Update the database
+ this.db.transaction(function(db){
+ db.executeSql( 'DELETE FROM jstore WHERE k = ?', [key] )
+ })
+ return this._super(key);
+ }
+ })
+
+ $.jStore.Engines.html5 = jStoreHtml5;
+
+ // Store the ordering preference
+ $.jStore.EngineOrder[ 0 ] = 'html5';
+
+})(jQuery);
+/*!*
+ * jStore IE Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function($){
+
+ // Set up a static test function for this instance
+ var avilability = $.jStore.Availability.ie = function(){
+ return !!window.ActiveXObject;
+ }
+
+ this.jStoreIE = StorageEngine.extend({
+ init: function(project, name){
+ // Call the parental init object
+ this._super(project, name);
+
+ // The type of storage engine
+ this.type = 'IE';
+
+ // Allow Autoloading on fail
+ this.limit = 64 * 1024;
+ },
+ connect: function(){
+ // Create a hidden div to store attributes in
+ this.db = $('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-' + this.project + '"></div>')
+ .appendTo(document.body).get(0);
+ // Fire our delegate to indicate we're ready for data transactions
+ this.delegate.trigger('engine-ready');
+ },
+ isAvailable: avilability,
+ get: function(key){
+ this.db.load(this.project);
+ return this.db.getAttribute(key);
+ },
+ set: function(key, value){
+ this.db.setAttribute(key, value);
+ this.db.save(this.project);
+ return value;
+ },
+ rem: function(key){
+ var beforeDelete = this.get(key);
+ this.db.removeAttribute(key);
+ this.db.save(this.project);
+ return beforeDelete;
+ }
+ })
+
+ $.jStore.Engines.ie = jStoreIE;
+
+ // Store the ordering preference
+ $.jStore.EngineOrder[ 4 ] = 'ie';
+
+})(jQuery);
\ No newline at end of file
diff -r 7df41ad788de -r 55c0eb35fad7 static/scripts/packed/jquery.jstore-all.js
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/scripts/packed/jquery.jstore-all.js Thu Aug 13 13:16:58 2009 -0400
@@ -0,0 +1,41 @@
+/*
+ * jStore - Persistent Client-Side Storage
+ *
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ *
+ * Dual licensed under:
+ * MIT: http://www.opensource.org/licenses/mit-license.php
+ * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html
+ */
+(function(){var a=false,b=/xyz/.test(function(){xyz})?/\b_super\b/:/.*/;this.Class=function(){};Class.extend=function(g){var f=this.prototype;a=true;var e=new this();a=false;for(var d in g){e[d]=typeof g[d]=="function"&&typeof f[d]=="function"&&b.test(g[d])?(function(h,i){return function(){var k=this._super;this._super=f[h];var j=i.apply(this,arguments);this._super=k;return j}})(d,g[d]):g[d]}function c(){if(!a&&this.init){this.init.apply(this,arguments)}}c.prototype=e;c.constructor=c;c.extend=arguments.callee;return c}})();
+/*
+ * jStore Delegate Framework
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function(a){this.jStoreDelegate=Class.extend({init:function(b){this.parent=b;this.callbacks={}},bind:function(b,c){if(!a.isFunction(c)){return this}if(!this.callbacks[b]){this.callbacks[b]=[]}this.callbacks[b].push(c);return this},trigger:function(){var d=this.parent,c=[].slice.call(arguments),e=c.shift(),b=this.callbacks[e];if(!b){return false}a.each(b,function(){this.apply(d,c)});return this}})})(jQuery);(function(a){a.jStore={};a.extend(a.jStore,{EngineOrder:[],Availability:{},Engines:{},Instances:{},CurrentEngine:null,defaults:{project:null,engine:null,autoload:true,flash:"jStore.Flash.html"},isReady:false,isFlashReady:false,delegate:new jStoreDelegate(a.jStore).bind("jStore-ready",function(b){a.jStore.isReady=true;if(a.jStore.defaults.autoload){b.connect()}}).bind("flash-ready",function(){a.jStore.isFlashReady=true})});a.jStore.ready=function(b){if(a.jStore.isReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("jStore-ready",b)}};a.jStore.fail
=function(b){a.jStore.delegate.bind("jStore-failure",b)};a.jStore.flashReady=function(b){if(a.jStore.isFlashReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("flash-ready",b)}};a.jStore.use=function(d,g,c){g=g||a.jStore.defaults.project||location.hostname.replace(/\./g,"-")||"unknown";var f=a.jStore.Engines[d.toLowerCase()]||null,b=(c?c+".":"")+g+"."+d;if(!f){throw"JSTORE_ENGINE_UNDEFINED"}f=new f(g,b);if(a.jStore.Instances[b]){throw"JSTORE_JRI_CONFLICT"}if(f.isAvailable()){a.jStore.Instances[b]=f;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=f}a.jStore.delegate.trigger("jStore-ready",f)}else{if(!f.autoload){throw"JSTORE_ENGINE_UNAVILABLE"}else{f.included(function(){if(this.isAvailable()){a.jStore.Instances[b]=this;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=this}a.jStore.delegate.trigger("jStore-ready",this)}else{a.jStore.delegate.trigger("jStore-failure",this)}}).include()}}};a.jStore.setCurrentEngine=function(b){if(!a.jStore.Instanc
es.length){return a.jStore.FindEngine()}if(!b&&a.jStore.Instances.length>=1){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[0]);return a.jStore.CurrentEngine=a.jStore.Instances[0]}if(b&&a.jStore.Instances[b]){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[b]);return a.jStore.CurrentEngine=a.jStore.Instances[b]}throw"JSTORE_JRI_NO_MATCH"};a.jStore.FindEngine=function(){a.each(a.jStore.EngineOrder,function(b){if(a.jStore.Availability[this]()){a.jStore.use(this,a.jStore.defaults.project,"default");return false}})};a.jStore.store=function(b,c){if(!a.jStore.CurrentEngine){return false}if(!c){return a.jStore.CurrentEngine.get(b)}return a.jStore.CurrentEngine.set(b,c)};a.jStore.remove=function(b){if(!a.jStore.CurrentEngine){return false}return a.jStore.CurrentEngine.rem(b)};a.fn.store=function(c,d){if(!a.jStore.CurrentEngine){return this}var b=a.jStore.store(c,d);return !d?b:this};a.fn.removeStore=function(b){a.jStore.remove(b);return this};a.jStore.load=f
unction(){if(a.jStore.defaults.engine){return a.jStore.use(a.jStore.defaults.engine,a.jStore.defaults.project,"default")}try{a.jStore.FindEngine()}catch(b){}}})(jQuery);(function(a){this.StorageEngine=Class.extend({init:function(c,b){this.project=c;this.jri=b;this.data={};this.limit=-1;this.includes=[];this.delegate=new jStoreDelegate(this).bind("engine-ready",function(){this.isReady=true}).bind("engine-included",function(){this.hasIncluded=true});this.autoload=false;this.isReady=false;this.hasIncluded=false},include:function(){var b=this,d=this.includes.length,c=0;a.each(this.includes,function(){a.ajax({type:"get",url:this,dataType:"script",cache:true,success:function(){c++;if(c==d){b.delegate.trigger("engine-included")}}})})},isAvailable:function(){return false},ready:function(b){if(this.isReady){b.apply(this)}else{this.delegate.bind("engine-ready",b)}return this},included:function(b){if(this.hasIncluded){b.apply(this)}else{this.delegate.bind("engine-included",b)}return th
is},get:function(b){return this.data[b]||null},set:function(b,c){this.data[b]=c;return c},rem:function(b){var c=this.data[b];this.data[b]=null;return c}})})(jQuery);
+/*
+ * jStore DOM Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function(c){var b=c.jStore.Availability.session=function(){return !!window.sessionStorage},a=c.jStore.Availability.local=function(){return !!(window.localStorage||window.globalStorage)};this.jStoreDom=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="DOM";this.limit=5*1024*1024},connect:function(){this.delegate.trigger("engine-ready")},get:function(e){var d=this.db.getItem(e);return d&&d.value?d.value:d},set:function(d,e){this.db.setItem(d,e);return e},rem:function(e){var d=this.get(e);this.db.removeItem(e);return d}});this.jStoreLocal=jStoreDom.extend({connect:function(){this.db=!window.globalStorage?window.localStorage:window.globalStorage[location.hostname];this._super()},isAvailable:a});this.jStoreSession=jStoreDom.extend({connect:function(){this.db=sessionStorage;this._super()},isAvailable:b});c.jStore.Engines.local=jStoreLocal;c.jStore.Engines.session=jStoreSession;c.jStore.EngineOrder[1]="local"})(jQuery);
+/*
+ * jStore Flash Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com)
+ */
+(function(b){var a=b.jStore.Availability.flash=function(){return !!(b.jStore.hasFlash("8.0.0"))};this.jStoreFlash=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="Flash";var c=this;b.jStore.flashReady(function(){c.flashReady()})},connect:function(){var c="jstore-flash-embed-"+this.project;b(document.body).append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" id="jStoreFlashFrame" src="'+b.jStore.defaults.flash+'"></iframe>')},flashReady:function(f){var c=b("#jStoreFlashFrame")[0];if(c.Document&&b.isFunction(c.Document.jStoreFlash.f_get_cookie)){this.db=c.Document.jStoreFlash}else{if(c.contentWindow&&c.contentWindow.document){var d=c.contentWindow.document;if(b.isFunction(b("object",b(d))[0].f_get_cookie)){this.db=b("object",b(d))[0]}else{if(b.isFunction(b("embed",b(d))[0].f_get_cookie)){this.db=b("embed",b(d))[0]}}}}if(this.db){this.delegate.trigger("engine-ready")}},isAvailable:a,get:function(d){var c=this.db.f_g
et_cookie(d);return c=="null"?null:c},set:function(c,d){this.db.f_set_cookie(c,d);return d},rem:function(c){var d=this.get(c);this.db.f_delete_cookie(c);return d}});b.jStore.Engines.flash=jStoreFlash;b.jStore.EngineOrder[2]="flash";b.jStore.hasFlash=function(c){var e=b.jStore.flashVersion().match(/\d+/g),f=c.match(/\d+/g);for(var d=0;d<3;d++){e[d]=parseInt(e[d]||0);f[d]=parseInt(f[d]||0);if(e[d]<f[d]){return false}if(e[d]>f[d]){return true}}return true};b.jStore.flashVersion=function(){try{try{var c=new ActiveXObject("ShockwaveFlash.ShockwaveFlash.6");try{c.AllowScriptAccess="always"}catch(d){return"6,0,0"}}catch(d){}return new ActiveXObject("ShockwaveFlash.ShockwaveFlash").GetVariable("$version").replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}catch(d){try{if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){return(navigator.plugins["Shockwave Flash 2.0"]||navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}}catch(d){}}r
eturn"0,0,0"}})(jQuery);function flash_ready(){$.jStore.delegate.trigger("flash-ready")}
+/*
+ * jStore Google Gears Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function(b){var a=b.jStore.Availability.gears=function(){return !!(window.google&&window.google.gears)};this.jStoreGears=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="Google Gears";this.includes.push("http://code.google.com/apis/gears/gears_init.js");this.autoload=true},connect:function(){var c=this.db=google.gears.factory.create("beta.database");c.open("jstore-"+this.project);c.execute("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)");this.updateCache()},updateCache:function(){var c=this.db.execute("SELECT k,v FROM jstore");while(c.isValidRow()){this.data[c.field(0)]=c.field(1);c.next()}c.close();this.delegate.trigger("engine-ready")},isAvailable:a,set:function(d,e){var c=this.db;c.execute("BEGIN");c.execute("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[d,e]);c.execute("COMMIT");return this._super(d,e)},rem:function(d){var c=this.db;c.execute("BEGIN");c.execute("DELETE FROM jstore WHERE k = ?",[d]);c.ex
ecute("COMMIT");return this._super(d)}});b.jStore.Engines.gears=jStoreGears;b.jStore.EngineOrder[3]="gears"})(jQuery);
+/*
+ * jStore HTML5 Specification Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function(b){var a=b.jStore.Availability.html5=function(){return !!window.openDatabase};this.jStoreHtml5=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="HTML5";this.limit=1024*200},connect:function(){var c=this.db=openDatabase("jstore-"+this.project,"1.0",this.project,this.limit);if(!c){throw"JSTORE_ENGINE_HTML5_NODB"}c.transaction(function(d){d.executeSql("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)")});this.updateCache()},updateCache:function(){var c=this;this.db.transaction(function(d){d.executeSql("SELECT k,v FROM jstore",[],function(f,e){var h=e.rows,g=0,j;for(;g<h.length;++g){j=h.item(g);c.data[j.k]=j.v}c.delegate.trigger("engine-ready")})})},isAvailable:a,set:function(c,d){this.db.transaction(function(e){e.executeSql("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[c,d])});return this._super(c,d)},rem:function(c){this.db.transaction(function(d){d.executeSql("DELETE FROM jstore WHERE k = ?",[c])});ret
urn this._super(c)}});b.jStore.Engines.html5=jStoreHtml5;b.jStore.EngineOrder[0]="html5"})(jQuery);
+/**
+ * jStore IE Storage Engine
+ * Copyright (c) 2009 Eric Garside (http://eric.garside.name)
+ */
+(function(b){var a=b.jStore.Availability.ie=function(){return !!window.ActiveXObject};this.jStoreIE=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="IE";this.limit=64*1024},connect:function(){this.db=b('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-'+this.project+'"></div>').appendTo(document.body).get(0);this.delegate.trigger("engine-ready")},isAvailable:a,get:function(c){this.db.load(this.project);return this.db.getAttribute(c)},set:function(c,d){this.db.setAttribute(c,d);this.db.save(this.project);return d},rem:function(c){var d=this.get(c);this.db.removeAttribute(c);this.db.save(this.project);return d}});b.jStore.Engines.ie=jStoreIE;b.jStore.EngineOrder[4]="ie"})(jQuery);
\ No newline at end of file
diff -r 7df41ad788de -r 55c0eb35fad7 static/scripts/packed/json2.js
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/static/scripts/packed/json2.js Thu Aug 13 13:16:58 2009 -0400
@@ -0,0 +1,1 @@
+var JSON=JSON||{};(function(){function f(n){return n<10?"0"+n:n}if(typeof Date.prototype.toJSON!=="function"){Date.prototype.toJSON=function(key){return isFinite(this.valueOf())?this.getUTCFullYear()+"-"+f(this.getUTCMonth()+1)+"-"+f(this.getUTCDate())+"T"+f(this.getUTCHours())+":"+f(this.getUTCMinutes())+":"+f(this.getUTCSeconds())+"Z":null};String.prototype.toJSON=Number.prototype.toJSON=Boolean.prototype.toJSON=function(key){return this.valueOf()}}var cx=/[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,escapable=/[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,gap,indent,meta={"\b":"\\b","\t":"\\t","\n":"\\n","\f":"\\f","\r":"\\r",'"':'\\"',"\\":"\\\\"},rep;function quote(string){escapable.lastIndex=0;return escapable.test(string)?'"'+string.replace(escapable,function(a){var c=meta[a];return typeof c==="string"?c:"\\u"+("0000"+a.charCodeAt(0)
.toString(16)).slice(-4)})+'"':'"'+string+'"'}function str(key,holder){var i,k,v,length,mind=gap,partial,value=holder[key];if(value&&typeof value==="object"&&typeof value.toJSON==="function"){value=value.toJSON(key)}if(typeof rep==="function"){value=rep.call(holder,key,value)}switch(typeof value){case"string":return quote(value);case"number":return isFinite(value)?String(value):"null";case"boolean":case"null":return String(value);case"object":if(!value){return"null"}gap+=indent;partial=[];if(Object.prototype.toString.apply(value)==="[object Array]"){length=value.length;for(i=0;i<length;i+=1){partial[i]=str(i,value)||"null"}v=partial.length===0?"[]":gap?"[\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"]":"["+partial.join(",")+"]";gap=mind;return v}if(rep&&typeof rep==="object"){length=rep.length;for(i=0;i<length;i+=1){k=rep[i];if(typeof k==="string"){v=str(k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}else{for(k in value){if(Object.hasOwnProperty.call(value,k)){v=str(
k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}v=partial.length===0?"{}":gap?"{\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"}":"{"+partial.join(",")+"}";gap=mind;return v}}if(typeof JSON.stringify!=="function"){JSON.stringify=function(value,replacer,space){var i;gap="";indent="";if(typeof space==="number"){for(i=0;i<space;i+=1){indent+=" "}}else{if(typeof space==="string"){indent=space}}rep=replacer;if(replacer&&typeof replacer!=="function"&&(typeof replacer!=="object"||typeof replacer.length!=="number")){throw new Error("JSON.stringify")}return str("",{"":value})}}if(typeof JSON.parse!=="function"){JSON.parse=function(text,reviver){var j;function walk(holder,key){var k,v,value=holder[key];if(value&&typeof value==="object"){for(k in value){if(Object.hasOwnProperty.call(value,k)){v=walk(value,k);if(v!==undefined){value[k]=v}else{delete value[k]}}}}return reviver.call(holder,key,value)}cx.lastIndex=0;if(cx.test(text)){text=text.replace(cx,function(a){return"\\u"+("000
0"+a.charCodeAt(0).toString(16)).slice(-4)})}if(/^[\],:{}\s]*$/.test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g,"@").replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g,"]").replace(/(?:^|:|,)(?:\s*\[)+/g,""))){j=eval("("+text+")");return typeof reviver==="function"?walk({"":j},""):j}throw new SyntaxError("JSON.parse")}}}());
\ No newline at end of file
diff -r 7df41ad788de -r 55c0eb35fad7 templates/root/history.mako
--- a/templates/root/history.mako Tue Aug 11 15:46:23 2009 -0400
+++ b/templates/root/history.mako Thu Aug 13 13:16:58 2009 -0400
@@ -15,219 +15,242 @@
<meta http-equiv="Pragma" content="no-cache">
${h.css( "base", "history" )}
-${h.js( "jquery", "jquery.cookie", "cookie_set" )}
-
+${h.js( "jquery", "json2", "jquery.jstore-all" )}
+
<script type="text/javascript">
- $( document ).ready( function() {
- initShowHide();
- setupHistoryItem( $("div.historyItemWrapper") );
- // Collapse all
- $("#top-links").append( "| " ).append( $("<a href='#'>${_('collapse all')}</a>").click( function() {
- $( "div.historyItemBody:visible" ).each( function() {
- if ( $.browser.mozilla )
- {
- $(this).find( "pre.peek" ).css( "overflow", "hidden" );
+$(function() {
+ // Load jStore for local storage
+ $.extend(jQuery.jStore.defaults, { project: 'galaxy', flash: '/static/jStore.Flash.html' })
+ $.jStore.load(); // Auto-select best storage
+
+ $.jStore.ready(function(engine) {
+ engine.ready(function() {
+ // Init stuff that requires the local storage to be running
+ initShowHide();
+ setupHistoryItem( $("div.historyItemWrapper") );
+ });
+ });
+
+ // Generate 'collapse all' link
+ $("#top-links").append( "| " ).append( $("<a href='#'>${_('collapse all')}</a>").click( function() {
+ $( "div.historyItemBody:visible" ).each( function() {
+ if ( $.browser.mozilla ) {
+ $(this).find( "pre.peek" ).css( "overflow", "hidden" );
+ }
+ $(this).slideUp( "fast" );
+ });
+ $.jStore.remove("history_expand_state");
+ }));
+
+ $("#history-rename").click( function() {
+ var old_name = $("#history-name").text()
+ var t = $("<input type='text' value='" + old_name + "'></input>" );
+ t.blur( function() {
+ $(this).remove();
+ $("#history-name").show();
+ });
+ t.keyup( function( e ) {
+ if ( e.keyCode == 27 ) {
+ // Escape key
+ $(this).trigger( "blur" );
+ } else if ( e.keyCode == 13 ) {
+ // Enter key
+ new_value = this.value;
+ $(this).trigger( "blur" );
+ $.ajax({
+ url: "${h.url_for( controller='history', action='rename_async', id=history.id )}",
+ data: { "_": true, new_name: new_value },
+ error: function() { alert( "Rename failed" ) },
+ success: function() {
+ $("#history-name").text( new_value );
+ }
+ });
+ }
+ });
+ $("#history-name").hide();
+ $("#history-name-area").append( t );
+ t.focus();
+ return false;
+ });
+ // Updater
+ updater({
+ %for i, data in enumerate( reversed( datasets ) ):
+ %if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]:
+ %if i > 0:
+ ,
+ %endif
+ "${data.id}": "${data.state}"
+ %endif
+ %endfor
+ });
+});
+// Functionized so AJAX'd datasets can call them
+// Get shown/hidden state from cookie
+function initShowHide() {
+
+ // Load saved state and show as neccesary
+ try {
+ var stored = $.jStore.store("history_expand_state");
+ if (stored) {
+ var st = JSON.parse(stored);
+ for (var id in st) {
+ $("#" + id + " div.historyItemBody" ).show();
+ }
+ }
+ } catch(err) {
+ // Something was wrong with values in storage, so clear storage
+ $.jStore.remove("history_expand_state");
+ }
+
+ // If Mozilla, hide scrollbars in hidden items since they cause animation bugs
+ if ( $.browser.mozilla ) {
+ $( "div.historyItemBody" ).each( function() {
+ if ( ! $(this).is( ":visible" ) ) $(this).find( "pre.peek" ).css( "overflow", "hidden" );
+ })
+ }
+}
+// Add show/hide link and delete link to a history item
+function setupHistoryItem( query ) {
+ query.each( function() {
+ var id = this.id;
+ var body = $(this).children( "div.historyItemBody" );
+ var peek = body.find( "pre.peek" )
+ $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() {
+ if ( body.is(":visible") ) {
+ // Hiding stuff here
+ if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) }
+ body.slideUp( "fast" );
+
+ // Save setting
+ var stored = $.jStore.store("history_expand_state")
+ var prefs = stored ? JSON.parse(stored) : null
+ if (prefs) {
+ delete prefs[id];
+ $.jStore.store("history_expand_state", JSON.stringify(prefs));
}
- $(this).slideUp( "fast" );
- })
- var state = new CookieSet( "galaxy.history.expand_state" );
- state.removeAll().save();
- return false;
- }));
- $("#history-rename").click( function() {
- var old_name = $("#history-name").text()
- var t = $("<input type='text' value='" + old_name + "'></input>" );
- t.blur( function() {
- $(this).remove();
- $("#history-name").show();
- });
- t.keyup( function( e ) {
- if ( e.keyCode == 27 ) {
- // Escape key
- $(this).trigger( "blur" );
- } else if ( e.keyCode == 13 ) {
- // Enter key
- new_value = this.value;
- $(this).trigger( "blur" );
- $.ajax({
- url: "${h.url_for( controller='history', action='rename_async', id=history.id )}",
- data: { "_": true, new_name: new_value },
- error: function() { alert( "Rename failed" ) },
- success: function() {
- $("#history-name").text( new_value );
- }
- });
- }
- });
- $("#history-name").hide();
- $("#history-name-area").append( t );
- t.focus();
- return false;
- });
- // Updater
- updater({
- %for i, data in enumerate( reversed( datasets ) ):
- %if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]:
- %if i > 0:
- ,
- %endif
- "${data.id}": "${data.state}"
- %endif
- %endfor
+ }
+ else {
+ // Showing stuff here
+ body.slideDown( "fast", function() {
+ if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); }
+ });
+
+ // Save setting
+ var stored = $.jStore.store("history_expand_state")
+ var prefs = stored ? JSON.parse(stored) : new Object;
+ prefs[id] = true;
+ $.jStore.store("history_expand_state", JSON.stringify(prefs));
+ }
+ return false;
});
- })
- //' Functionized so AJAX'd datasets can call them
- // Get shown/hidden state from cookie
- function initShowHide() {
- // $( "div.historyItemBody" ).hide();
- // Load saved state and show as neccesary
- var state = new CookieSet( "galaxy.history.expand_state" );
- for ( id in state.store ) {
- if ( id ) {
- $( "#" + id + " div.historyItemBody" ).show();
- }
- }
- // If Mozilla, hide scrollbars in hidden items since they cause animation bugs
- if ( $.browser.mozilla ) {
- $( "div.historyItemBody" ).each( function() {
- if ( ! $(this).is( ":visible" ) ) $(this).find( "pre.peek" ).css( "overflow", "hidden" );
- })
- }
- delete state;
- }
- // Add show/hide link and delete link to a history item
- function setupHistoryItem( query ) {
- query.each( function() {
- var id = this.id;
- var body = $(this).children( "div.historyItemBody" );
- var peek = body.find( "pre.peek" )
- $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() {
- if ( body.is(":visible") ) {
- if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) }
- body.slideUp( "fast" );
- ## other instances of this could be editing the cookie, refetch
- var state = new CookieSet( "galaxy.history.expand_state" );
- state.remove( id ); state.save();
- delete state;
- }
- else {
- body.slideDown( "fast", function() {
- if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); }
- });
- var state = new CookieSet( "galaxy.history.expand_state" );
- state.add( id ); state.save();
- delete state;
- }
+ // Delete link
+ $(this).find( "div.historyItemButtons > .delete" ).each( function() {
+ var data_id = this.id.split( "-" )[1];
+ $(this).click( function() {
+ $( '#historyItem-' + data_id + "> div.historyItemTitleBar" ).addClass( "spinner" );
+ $.ajax({
+ url: "${h.url_for( action='delete_async', id='XXX' )}".replace( 'XXX', data_id ),
+ error: function() { alert( "Delete failed" ) },
+ success: function() {
+ %if show_deleted:
+ var to_update = {};
+ to_update[data_id] = "none";
+ updater( to_update );
+ %else:
+ $( "#historyItem-" + data_id ).fadeOut( "fast", function() {
+ $( "#historyItemContainer-" + data_id ).remove();
+ if ( $( "div.historyItemContainer" ).length < 1 ) {
+ $( "#emptyHistoryMessage" ).show();
+ }
+ });
+ %endif
+ }
+ });
return false;
});
- // Delete link
- $(this).find( "div.historyItemButtons > .delete" ).each( function() {
- var data_id = this.id.split( "-" )[1];
- $(this).click( function() {
- $( '#historyItem-' + data_id + "> div.historyItemTitleBar" ).addClass( "spinner" );
- $.ajax({
- url: "${h.url_for( action='delete_async', id='XXX' )}".replace( 'XXX', data_id ),
- error: function() { alert( "Delete failed" ) },
- success: function() {
- %if show_deleted:
- var to_update = {};
- to_update[data_id] = "none";
- updater( to_update );
- %else:
- $( "#historyItem-" + data_id ).fadeOut( "fast", function() {
- $( "#historyItemContainer-" + data_id ).remove();
- if ( $( "div.historyItemContainer" ).length < 1 ) {
- $( "#emptyHistoryMessage" ).show();
- }
- });
- %endif
- }
- });
- return false;
+ });
+ // Undelete link
+ $(this).find( "a.historyItemUndelete" ).each( function() {
+ var data_id = this.id.split( "-" )[1];
+ $(this).click( function() {
+ $( '#historyItem-' + data_id + " > div.historyItemTitleBar" ).addClass( "spinner" );
+ $.ajax({
+ url: "${h.url_for( controller='dataset', action='undelete_async', id='XXX' )}".replace( 'XXX', data_id ),
+ error: function() { alert( "Undelete failed" ) },
+ success: function() {
+ var to_update = {};
+ to_update[data_id] = "none";
+ updater( to_update );
+ }
});
- });
- // Undelete link
- $(this).find( "a.historyItemUndelete" ).each( function() {
- var data_id = this.id.split( "-" )[1];
- $(this).click( function() {
- $( '#historyItem-' + data_id + " > div.historyItemTitleBar" ).addClass( "spinner" );
- $.ajax({
- url: "${h.url_for( controller='dataset', action='undelete_async', id='XXX' )}".replace( 'XXX', data_id ),
- error: function() { alert( "Undelete failed" ) },
- success: function() {
- var to_update = {};
- to_update[data_id] = "none";
- updater( to_update );
- }
- });
- return false;
- });
+ return false;
});
});
- };
- // Looks for changes in dataset state using an async request. Keeps
- // calling itself (via setTimeout) until all datasets are in a terminal
- // state.
- var updater = function ( tracked_datasets ) {
- // Check if there are any items left to track
- var empty = true;
- for ( i in tracked_datasets ) {
- empty = false;
- break;
+ });
+};
+// Looks for changes in dataset state using an async request. Keeps
+// calling itself (via setTimeout) until all datasets are in a terminal
+// state.
+var updater = function ( tracked_datasets ) {
+ // Check if there are any items left to track
+ var empty = true;
+ for ( i in tracked_datasets ) {
+ empty = false;
+ break;
+ }
+ if ( ! empty ) {
+ // console.log( "Updater running in 3 seconds" );
+ setTimeout( function() { updater_callback( tracked_datasets ) }, 3000 );
+ } else {
+ // console.log( "Updater finished" );
+ }
+};
+var updater_callback = function ( tracked_datasets ) {
+ // Build request data
+ var ids = []
+ var states = []
+ var force_history_refresh = false
+ $.each( tracked_datasets, function ( id, state ) {
+ ids.push( id );
+ states.push( state );
+ });
+ // Make ajax call
+ $.ajax( {
+ type: "POST",
+ url: "${h.url_for( controller='root', action='history_item_updates' )}",
+ dataType: "json",
+ data: { ids: ids.join( "," ), states: states.join( "," ) },
+ success : function ( data ) {
+ $.each( data, function( id, val ) {
+ // Replace HTML
+ var container = $("#historyItemContainer-" + id);
+ container.html( val.html );
+ setupHistoryItem( container.children( ".historyItemWrapper" ) );
+ initShowHide();
+ // If new state was terminal, stop tracking
+ if (( val.state == "ok") || ( val.state == "error") || ( val.state == "empty") || ( val.state == "deleted" ) || ( val.state == "discarded" )) {
+ if ( val.force_history_refresh ){
+ force_history_refresh = true;
+ }
+ delete tracked_datasets[ parseInt(id) ];
+ } else {
+ tracked_datasets[ parseInt(id) ] = val.state;
+ }
+ });
+ if ( force_history_refresh ) {
+ parent.frames.galaxy_history.location.reload();
+ }
+ else {
+ // Keep going (if there are still any items to track)
+ updater( tracked_datasets );
+ }
+ },
+ error: function() {
+ // Just retry, like the old method, should try to be smarter
+ updater( tracked_datasets );
}
- if ( ! empty ) {
- // console.log( "Updater running in 3 seconds" );
- setTimeout( function() { updater_callback( tracked_datasets ) }, 3000 );
- } else {
- // console.log( "Updater finished" );
- }
- };
- var updater_callback = function ( tracked_datasets ) {
- // Build request data
- var ids = []
- var states = []
- var force_history_refresh = false
- $.each( tracked_datasets, function ( id, state ) {
- ids.push( id );
- states.push( state );
- });
- // Make ajax call
- $.ajax( {
- type: "POST",
- url: "${h.url_for( controller='root', action='history_item_updates' )}",
- dataType: "json",
- data: { ids: ids.join( "," ), states: states.join( "," ) },
- success : function ( data ) {
- $.each( data, function( id, val ) {
- // Replace HTML
- var container = $("#historyItemContainer-" + id);
- container.html( val.html );
- setupHistoryItem( container.children( ".historyItemWrapper" ) );
- initShowHide();
- // If new state was terminal, stop tracking
- if (( val.state == "ok") || ( val.state == "error") || ( val.state == "empty") || ( val.state == "deleted" ) || ( val.state == "discarded" )) {
- if ( val.force_history_refresh ){
- force_history_refresh = true;
- }
- delete tracked_datasets[ parseInt(id) ];
- } else {
- tracked_datasets[ parseInt(id) ] = val.state;
- }
- });
- if ( force_history_refresh ) {
- parent.frames.galaxy_history.location.reload();
- }
- else {
- // Keep going (if there are still any items to track)
- updater( tracked_datasets );
- }
- },
- error: function() {
- // Just retry, like the old method, should try to be smarter
- updater( tracked_datasets );
- }
- });
- };
+ });
+};
</script>
<style>
diff -r 7df41ad788de -r 55c0eb35fad7 templates/workflow/editor.mako
--- a/templates/workflow/editor.mako Tue Aug 11 15:46:23 2009 -0400
+++ b/templates/workflow/editor.mako Thu Aug 13 13:16:58 2009 -0400
@@ -31,9 +31,7 @@
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.event.hover.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.form.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/jquery.json.js')}"> </script>
- <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.cookie.js')}"> </script>
- <script type='text/javascript' src="${h.url_for('/static/scripts/json2.js')}"> </script>
- <script type='text/javascript' src="${h.url_for('/static/scripts/json_cookie.js')}"> </script>
+ <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.jstore-all.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.base.js')}"> </script>
<script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.workflow_editor.canvas.js')}"> </script>
@@ -50,6 +48,7 @@
canvas_manager = null;
// jQuery onReady
$( function() {
+
if ( window.lt_ie_7 ) {
show_modal(
"Browser not supported",
@@ -57,11 +56,13 @@
);
return;
}
+
+ // Load jStore for local storage
+ $.extend(jQuery.jStore.defaults, { project: 'galaxy', flash: '/static/jStore.Flash.html' })
+ $.jStore.load(); // Auto-select best storage
+
// Canvas overview management
canvas_manager = new CanvasManager( $("#canvas-viewport"), $("#overview") );
-
- // Preferences cookie stored as JSON so that only one cookie is needed for multiple settings
- var prefs_cookie = new JSONCookie("galaxy.workflow");
// Initialize workflow state
reset();
@@ -128,39 +129,43 @@
canvas_manager.draw_overview();
});
- // Stores the size of the overview in a cookie when it's resized
+ $.jStore.ready(function(engine) {
+ engine.ready(function() {
+ // On load, set the size to the pref stored in local storage if it exists
+ overview_size = $.jStore.store("overview-size");
+ if (overview_size) {
+ $("#overview-border").css( {
+ width: overview_size,
+ height: overview_size
+ });
+ }
+
+ // Show viewport on load unless pref says it's off
+ $.jStore.store("overview-off") ? hide_overview() : show_overview()
+ });
+ });
+
+ // Stores the size of the overview into local storage when it's resized
$("#overview-border").bind( "dragend", function( e ) {
var op = $(this).offsetParent();
var opo = op.offset();
var new_size = Math.max( op.width() - ( e.offsetX - opo.left ),
op.height() - ( e.offsetY - opo.top ) );
- prefs_cookie.set("overview-size", new_size);
+ $.jStore.store("overview-size", new_size + "px");
});
- // On load, set the size to the pref stored in cookie if it exists
- overview_size = prefs_cookie.get("overview-size");
- if (overview_size) {
- $("#overview-border").css( {
- width: overview_size,
- height: overview_size
- });
- }
-
function show_overview() {
- prefs_cookie.unset("overview-off");
+ $.jStore.remove("overview-off");
$("#overview-border").css("right", "0px");
$("#close-viewport").css("background-position", "0px 0px");
}
function hide_overview() {
- prefs_cookie.set("overview-off", true);
+ $.jStore.store("overview-off", true);
$("#overview-border").css("right", "20000px");
$("#close-viewport").css("background-position", "12px 0px");
}
- // Show viewport on load unless pref says it's off
- prefs_cookie.get("overview-off") == true ? hide_overview() : show_overview()
-
// Lets the overview be toggled visible and invisible, adjusting the arrows accordingly
$("#close-viewport").click( function() {
$("#overview-border").css("right") == "0px" ? hide_overview() : show_overview();
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/7d48dc7e60b4
changeset: 2569:7d48dc7e60b4
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Wed Aug 19 11:08:58 2009 -0400
description:
Added sniff import statement to tabular.py so sam tests will pass
1 file(s) affected in this change:
lib/galaxy/datatypes/tabular.py
diffs (11 lines):
diff -r 670f8800a2bf -r 7d48dc7e60b4 lib/galaxy/datatypes/tabular.py
--- a/lib/galaxy/datatypes/tabular.py Wed Aug 19 09:13:21 2009 -0400
+++ b/lib/galaxy/datatypes/tabular.py Wed Aug 19 11:08:58 2009 -0400
@@ -11,6 +11,7 @@
from cgi import escape
from galaxy.datatypes import metadata
from galaxy.datatypes.metadata import MetadataElement
+from sniff import *
log = logging.getLogger(__name__)
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/6b8e1ff3141a
changeset: 2573:6b8e1ff3141a
user: Kanwei Li <kanwei(a)gmail.com>
date: Mon Aug 10 13:27:04 2009 -0400
description:
Made workflow's "Input Dataset" name text field smaller to fit default size
1 file(s) affected in this change:
templates/workflow/editor_generic_form.mako
diffs (12 lines):
diff -r a6be5c3955e9 -r 6b8e1ff3141a templates/workflow/editor_generic_form.mako
--- a/templates/workflow/editor_generic_form.mako Mon Aug 10 12:09:50 2009 -0400
+++ b/templates/workflow/editor_generic_form.mako Mon Aug 10 13:27:04 2009 -0400
@@ -15,7 +15,7 @@
${input.label}:
</label>
<div style="float: left; width: 250px; margin-right: 10px;">
- <input type="${input.type}" name="${input.name}" value="${input.value}" size="40">
+ <input type="${input.type}" name="${input.name}" value="${input.value}" size="30">
</div>
%if input.error:
<div style="float: left; color: red; font-weight: bold; padding-top: 1px; padding-bottom: 3px;">
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/32c76fdcacd2
changeset: 2566:32c76fdcacd2
user: Greg Von Kuster <greg(a)bx.psu.edu>
date: Sat Aug 15 16:26:37 2009 -0400
description:
Provide better bi-directional Python version compatibility for encryption.
5 file(s) affected in this change:
lib/galaxy/model/__init__.py
lib/galaxy/tools/__init__.py
lib/galaxy/util/hash_util.py
lib/galaxy/web/controllers/async.py
lib/galaxy/web/controllers/genetrack.py
diffs (189 lines):
diff -r 2ae19c12114c -r 32c76fdcacd2 lib/galaxy/model/__init__.py
--- a/lib/galaxy/model/__init__.py Fri Aug 14 15:37:31 2009 -0400
+++ b/lib/galaxy/model/__init__.py Sat Aug 15 16:26:37 2009 -0400
@@ -13,11 +13,7 @@
import galaxy.datatypes.registry
from galaxy.datatypes.metadata import MetadataCollection
from galaxy.security import RBACAgent, get_permitted_actions
-using_24 = sys.version_info[:2] < ( 2, 5 )
-if using_24:
- import sha
-else:
- import hashlib
+from galaxy.util.hash_util import *
import logging
log = logging.getLogger( __name__ )
@@ -42,16 +38,10 @@
def set_password_cleartext( self, cleartext ):
"""Set 'self.password' to the digest of 'cleartext'."""
- if using_24:
- self.password = sha.new( cleartext ).hexdigest()
- else:
- self.password = hashlib.sha1( cleartext ).hexdigest()
+ self.password = new_secure_hash( text_type=cleartext )
def check_password( self, cleartext ):
"""Check if 'cleartext' matches 'self.password' when hashed."""
- if using_24:
- return self.password == sha.new( cleartext ).hexdigest()
- else:
- return self.password == hashlib.sha1( cleartext ).hexdigest()
+ return self.password == new_secure_hash( text_type=cleartext )
def all_roles( self ):
roles = [ ura.role for ura in self.roles ]
for group in [ uga.group for uga in self.groups ]:
diff -r 2ae19c12114c -r 32c76fdcacd2 lib/galaxy/tools/__init__.py
--- a/lib/galaxy/tools/__init__.py Fri Aug 14 15:37:31 2009 -0400
+++ b/lib/galaxy/tools/__init__.py Sat Aug 15 16:26:37 2009 -0400
@@ -7,7 +7,7 @@
import logging, os, string, sys, tempfile, glob, shutil
import simplejson
-import hmac, binascii
+import binascii
from UserDict import DictMixin
from galaxy.util.odict import odict
from galaxy.util.bunch import Bunch
@@ -24,12 +24,7 @@
from galaxy.util.none_like import NoneDataset
from galaxy.datatypes import sniff
from cgi import FieldStorage
-
-using_24 = sys.version_info[:2] < ( 2, 5 )
-if using_24:
- import sha
-else:
- import hashlib
+from galaxy.util.hash_util import *
log = logging.getLogger( __name__ )
@@ -215,10 +210,7 @@
value["__page__"] = self.page
value = simplejson.dumps( value )
# Make it secure
- if using_24:
- a = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
- else:
- a = hmac.new( app.config.tool_secret, value, hashlib.sha1 ).hexdigest()
+ a = hmac_new( app.config.tool_secret, value )
b = binascii.hexlify( value )
return "%s:%s" % ( a, b )
def decode( self, value, tool, app ):
@@ -228,10 +220,7 @@
# Extract and verify hash
a, b = value.split( ":" )
value = binascii.unhexlify( b )
- if using_24:
- test = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
- else:
- test = hmac.new( app.config.tool_secret, value, hashlib.sha1 ).hexdigest()
+ test = hmac_new( app.config.tool_secret, value )
assert a == test
# Restore from string
values = json_fix( simplejson.loads( value ) )
diff -r 2ae19c12114c -r 32c76fdcacd2 lib/galaxy/util/hash_util.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/util/hash_util.py Sat Aug 15 16:26:37 2009 -0400
@@ -0,0 +1,28 @@
+import sys, logging
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
+import hmac
+
+log = logging.getLogger( __name__ )
+
+"""
+Utility functions for bi-directional Python version compatibility. Python 2.5
+introduced hashlib which replaced sha in Python 2.4 and previous versions.
+"""
+def new_secure_hash( text_type=None ):
+ if using_24:
+ if text_type:
+ return sha.new( text_type ).hexdigest()
+ return sha.new()
+ else:
+ if text_type:
+ return hashlib.sha1( text_type ).hexdigest()
+ return hashlib.sha1()
+def hmac_new( key, value ):
+ if using_24:
+ return hmac.new( key, value, sha ).hexdigest()
+ else:
+ return hmac.new( key, value, hashlib.sha1 ).hexdigest()
diff -r 2ae19c12114c -r 32c76fdcacd2 lib/galaxy/web/controllers/async.py
--- a/lib/galaxy/web/controllers/async.py Fri Aug 14 15:37:31 2009 -0400
+++ b/lib/galaxy/web/controllers/async.py Sat Aug 15 16:26:37 2009 -0400
@@ -6,13 +6,8 @@
from galaxy import jobs, util, datatypes, web
-import logging, urllib, hmac, sys
-
-using_24 = sys.version_info[:2] < ( 2, 5 )
-if using_24:
- import sha
-else:
- import hashlib
+import logging, urllib, sys
+from galaxy.util.hash_util import *
log = logging.getLogger( __name__ )
@@ -63,10 +58,7 @@
return "Data %s does not exist or has already been deleted" % data_id
if STATUS == 'OK':
- if using_24:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
- else:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), hashlib.sha1 ).hexdigest()
+ key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) )
if key != data_secret:
return "You do not have permission to alter data %s." % data_id
# push the job into the queue
@@ -124,10 +116,7 @@
trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id )
try:
- if using_24:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
- else:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), hashlib.sha1 ).hexdigest()
+ key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) )
galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key )
params.update( { 'GALAXY_URL' :galaxy_url } )
params.update( { 'data_id' :data.id } )
diff -r 2ae19c12114c -r 32c76fdcacd2 lib/galaxy/web/controllers/genetrack.py
--- a/lib/galaxy/web/controllers/genetrack.py Fri Aug 14 15:37:31 2009 -0400
+++ b/lib/galaxy/web/controllers/genetrack.py Sat Aug 15 16:26:37 2009 -0400
@@ -4,12 +4,7 @@
from mako.template import Template
from mako.lookup import TemplateLookup
from galaxy.web.base.controller import *
-
-using_24 = sys.version_info[:2] < ( 2, 5 )
-if using_24:
- import sha
-else:
- import hashlib
+from galaxy.util.hash_util import *
try:
import pkg_resources
@@ -269,10 +264,7 @@
tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot]
# check against a hash, display an image that already exists if it was previously created.
- if using_24:
- hash = sha.new()
- else:
- hash = hashlib.sha1()
+ hash = new_secure_hash()
hash.update(str(dataset_id))
for key in sorted(kwds.keys()):
hash.update(str(kwds[key]))
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/2ae19c12114c
changeset: 2565:2ae19c12114c
user: Greg Von Kuster <greg(a)bx.psu.edu>
date: Fri Aug 14 15:37:31 2009 -0400
description:
Deprecated code corrections for supporting Python 2.6. Many of the Python 2.6 eggs are still throwing DeprecationWarning messages, so some things still won't work. Eggs for 2.6 need to be re-scrambled after corrections are made.
26 file(s) affected in this change:
lib/galaxy/datatypes/coverage.py
lib/galaxy/datatypes/data.py
lib/galaxy/datatypes/genetics.py
lib/galaxy/datatypes/interval.py
lib/galaxy/model/__init__.py
lib/galaxy/tools/__init__.py
lib/galaxy/web/controllers/admin.py
lib/galaxy/web/controllers/async.py
lib/galaxy/web/controllers/dataset.py
lib/galaxy/web/controllers/genetrack.py
lib/galaxy/web/controllers/root.py
lib/galaxy/web/controllers/tool_runner.py
lib/galaxy/web/framework/__init__.py
lib/galaxy/webapps/reports/controllers/root.py
tools/data_source/genbank.py
tools/data_source/ucsc_proxy.py
tools/new_operations/get_flanks.py
tools/new_operations/operation_filter.py
tools/new_operations/subtract_query.py
tools/regVariation/windowSplitter.py
tools/stats/column_maker.py
tools/stats/filtering.py
tools/stats/grouping.py
tools/stats/gsummary.py
tools/visualization/build_ucsc_custom_track_code.py
tools/visualization/genetrack_code.py
diffs (587 lines):
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/datatypes/coverage.py
--- a/lib/galaxy/datatypes/coverage.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/datatypes/coverage.py Fri Aug 14 15:37:31 2009 -0400
@@ -5,7 +5,7 @@
import pkg_resources
pkg_resources.require( "bx-python" )
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from galaxy.datatypes.sniff import *
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/datatypes/data.py
--- a/lib/galaxy/datatypes/data.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/datatypes/data.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,4 +1,4 @@
-import logging, os, sys, time, sets, tempfile
+import logging, os, sys, time, tempfile
from galaxy import util
from galaxy.util.odict import odict
from galaxy.util.bunch import Bunch
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/datatypes/genetics.py
--- a/lib/galaxy/datatypes/genetics.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/datatypes/genetics.py Fri Aug 14 15:37:31 2009 -0400
@@ -12,7 +12,7 @@
august 20 2007
"""
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from cgi import escape
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/datatypes/interval.py
--- a/lib/galaxy/datatypes/interval.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/datatypes/interval.py Fri Aug 14 15:37:31 2009 -0400
@@ -5,7 +5,7 @@
import pkg_resources
pkg_resources.require( "bx-python" )
-import logging, os, sys, time, sets, tempfile, shutil
+import logging, os, sys, time, tempfile, shutil
import data
from galaxy import util
from galaxy.datatypes.sniff import *
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/model/__init__.py
--- a/lib/galaxy/model/__init__.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/model/__init__.py Fri Aug 14 15:37:31 2009 -0400
@@ -5,8 +5,7 @@
the relationship cardinalities are obvious (e.g. prefer Dataset to Data)
"""
-import os.path, os, errno
-import sha
+import os.path, os, errno, sys
import galaxy.datatypes
from galaxy.util.bunch import Bunch
from galaxy import util
@@ -14,8 +13,11 @@
import galaxy.datatypes.registry
from galaxy.datatypes.metadata import MetadataCollection
from galaxy.security import RBACAgent, get_permitted_actions
-
-
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
import logging
log = logging.getLogger( __name__ )
@@ -40,10 +42,16 @@
def set_password_cleartext( self, cleartext ):
"""Set 'self.password' to the digest of 'cleartext'."""
- self.password = sha.new( cleartext ).hexdigest()
+ if using_24:
+ self.password = sha.new( cleartext ).hexdigest()
+ else:
+ self.password = hashlib.sha1( cleartext ).hexdigest()
def check_password( self, cleartext ):
"""Check if 'cleartext' matches 'self.password' when hashed."""
- return self.password == sha.new( cleartext ).hexdigest()
+ if using_24:
+ return self.password == sha.new( cleartext ).hexdigest()
+ else:
+ return self.password == hashlib.sha1( cleartext ).hexdigest()
def all_roles( self ):
roles = [ ura.role for ura in self.roles ]
for group in [ uga.group for uga in self.groups ]:
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/tools/__init__.py
--- a/lib/galaxy/tools/__init__.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/tools/__init__.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,15 +1,13 @@
"""
Classes encapsulating galaxy tools and tool configuration.
"""
-
import pkg_resources;
pkg_resources.require( "simplejson" )
import logging, os, string, sys, tempfile, glob, shutil
import simplejson
-import sha, hmac, binascii
-
+import hmac, binascii
from UserDict import DictMixin
from galaxy.util.odict import odict
from galaxy.util.bunch import Bunch
@@ -26,6 +24,12 @@
from galaxy.util.none_like import NoneDataset
from galaxy.datatypes import sniff
from cgi import FieldStorage
+
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
log = logging.getLogger( __name__ )
@@ -211,7 +215,10 @@
value["__page__"] = self.page
value = simplejson.dumps( value )
# Make it secure
- a = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ if using_24:
+ a = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ else:
+ a = hmac.new( app.config.tool_secret, value, hashlib.sha1 ).hexdigest()
b = binascii.hexlify( value )
return "%s:%s" % ( a, b )
def decode( self, value, tool, app ):
@@ -221,7 +228,10 @@
# Extract and verify hash
a, b = value.split( ":" )
value = binascii.unhexlify( b )
- test = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ if using_24:
+ test = hmac.new( app.config.tool_secret, value, sha ).hexdigest()
+ else:
+ test = hmac.new( app.config.tool_secret, value, hashlib.sha1 ).hexdigest()
assert a == test
# Restore from string
values = json_fix( simplejson.loads( value ) )
@@ -453,7 +463,6 @@
self.tests = None
# Determine if this tool can be used in workflows
self.is_workflow_compatible = self.check_workflow_compatible()
-
def parse_inputs( self, root ):
"""
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,9 +1,14 @@
-import shutil, StringIO, operator, urllib, gzip, tempfile, sets, string, sys
+import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys
from datetime import datetime, timedelta
from galaxy import util, datatypes
from galaxy.web.base.controller import *
from galaxy.model.orm import *
from galaxy.web.controllers.forms import get_all_forms, get_form_widgets
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
import logging
log = logging.getLogger( __name__ )
@@ -1236,16 +1241,16 @@
if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
if len( in_roles ) > 1:
# Get the set of all users that are being associated with the dataset
- in_roles_set = sets.Set()
+ in_roles_set = set()
for role in in_roles:
in_roles_set.add( role )
- users_set = sets.Set()
+ users_set = set()
for role in in_roles:
for ura in role.users:
users_set.add( ura.user )
# Make sure that at least 1 user has every role being associated with the dataset
for user in users_set:
- user_roles_set = sets.Set()
+ user_roles_set = set()
for ura in user.roles:
user_roles_set.add( ura.role )
if in_roles_set.issubset( user_roles_set ):
@@ -1421,16 +1426,16 @@
if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
if len( in_roles ) > 1:
# Get the set of all users that are being associated with the dataset
- in_roles_set = sets.Set()
+ in_roles_set = set()
for role in in_roles:
in_roles_set.add( role )
- users_set = sets.Set()
+ users_set = set()
for role in in_roles:
for ura in role.users:
users_set.add( ura.user )
# Make sure that at least 1 user has every role being associated with the dataset
for user in users_set:
- user_roles_set = sets.Set()
+ user_roles_set = set()
for ura in user.roles:
user_roles_set.add( ura.role )
if in_roles_set.issubset( user_roles_set ):
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/async.py
--- a/lib/galaxy/web/controllers/async.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/async.py Fri Aug 14 15:37:31 2009 -0400
@@ -6,8 +6,13 @@
from galaxy import jobs, util, datatypes, web
-import logging, urllib
-import sha, hmac
+import logging, urllib, hmac, sys
+
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
log = logging.getLogger( __name__ )
@@ -58,7 +63,10 @@
return "Data %s does not exist or has already been deleted" % data_id
if STATUS == 'OK':
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ if using_24:
+ key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ else:
+ key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), hashlib.sha1 ).hexdigest()
if key != data_secret:
return "You do not have permission to alter data %s." % data_id
# push the job into the queue
@@ -116,7 +124,10 @@
trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id )
try:
- key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ if using_24:
+ key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest()
+ else:
+ key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), hashlib.sha1 ).hexdigest()
galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key )
params.update( { 'GALAXY_URL' :galaxy_url } )
params.update( { 'data_id' :data.id } )
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/dataset.py
--- a/lib/galaxy/web/controllers/dataset.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/dataset.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,4 +1,4 @@
-import logging, os, sets, string, shutil, re, socket, mimetypes, smtplib, urllib
+import logging, os, string, shutil, re, socket, mimetypes, smtplib, urllib
from galaxy.web.base.controller import *
from galaxy import util, datatypes, jobs, web, model
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/genetrack.py
--- a/lib/galaxy/web/controllers/genetrack.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/genetrack.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,11 +1,15 @@
-import time, glob, os
+import time, glob, os, sys
from itertools import cycle
-import sha
-
from mako import exceptions
from mako.template import Template
from mako.lookup import TemplateLookup
from galaxy.web.base.controller import *
+
+using_24 = sys.version_info[:2] < ( 2, 5 )
+if using_24:
+ import sha
+else:
+ import hashlib
try:
import pkg_resources
@@ -265,7 +269,10 @@
tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot]
# check against a hash, display an image that already exists if it was previously created.
- hash = sha.new()
+ if using_24:
+ hash = sha.new()
+ else:
+ hash = hashlib.sha1()
hash.update(str(dataset_id))
for key in sorted(kwds.keys()):
hash.update(str(kwds[key]))
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/root.py
--- a/lib/galaxy/web/controllers/root.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/root.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,7 +1,7 @@
"""
Contains the main interface in the Universe class
"""
-import logging, os, sets, string, shutil, urllib, re, socket
+import logging, os, string, shutil, urllib, re, socket
from cgi import escape, FieldStorage
from galaxy import util, datatypes, jobs, web, util
from galaxy.web.base.controller import *
@@ -60,7 +60,6 @@
trans.response.set_content_type('text/xml')
return trans.fill_template_mako( "root/history_as_xml.mako", history=history, show_deleted=util.string_as_bool( show_deleted ) )
else:
- template = "root/history.mako"
show_deleted = util.string_as_bool( show_deleted )
query = trans.sa_session.query( model.HistoryDatasetAssociation ) \
.filter( model.HistoryDatasetAssociation.history == history ) \
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/controllers/tool_runner.py
--- a/lib/galaxy/web/controllers/tool_runner.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/controllers/tool_runner.py Fri Aug 14 15:37:31 2009 -0400
@@ -117,7 +117,6 @@
tool_state_string = util.object_to_string(state.encode(tool, trans.app))
# Setup context for template
history = trans.get_history()
- template = "tool_form.mako"
vars = dict( tool_state=state, errors = {} )
# Is the "add frame" stuff neccesary here?
add_frame = AddFrameData()
@@ -125,17 +124,13 @@
if from_noframe is not None:
add_frame.wiki_url = trans.app.config.wiki_url
add_frame.from_noframe = True
- return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars )
-
-
+ return trans.fill_template( "tool_form.mako", history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars )
@web.expose
def redirect( self, trans, redirect_url=None, **kwd ):
if not redirect_url:
return trans.show_error_message( "Required URL for redirection missing" )
trans.log_event( "Redirecting to: %s" % redirect_url )
return trans.fill_template( 'root/redirect.mako', redirect_url=redirect_url )
-
-
@web.json
def upload_async_create( self, trans, tool_id=None, **kwd ):
"""
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/web/framework/__init__.py
--- a/lib/galaxy/web/framework/__init__.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/web/framework/__init__.py Fri Aug 14 15:37:31 2009 -0400
@@ -93,8 +93,8 @@
"""
Exception to make throwing errors from deep in controllers easier
"""
- def __init__( self, message, type="info" ):
- self.message = message
+ def __init__( self, err_msg, type="info" ):
+ self.err_msg = err_msg
self.type = type
def error( message ):
@@ -117,7 +117,7 @@
self.security = galaxy_app.security
def handle_controller_exception( self, e, trans, **kwargs ):
if isinstance( e, MessageException ):
- return trans.show_message( e.message, e.type )
+ return trans.show_message( e.err_msg, e.type )
def make_body_iterable( self, trans, body ):
if isinstance( body, FormBuilder ):
body = trans.show_form( body )
diff -r eb1244477b90 -r 2ae19c12114c lib/galaxy/webapps/reports/controllers/root.py
--- a/lib/galaxy/webapps/reports/controllers/root.py Fri Aug 14 12:17:45 2009 -0400
+++ b/lib/galaxy/webapps/reports/controllers/root.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,8 +1,8 @@
-import sys, os, operator, sets, string, shutil, re, socket, urllib
+import sys, os, operator, string, shutil, re, socket, urllib, time
from galaxy import web
from cgi import escape, FieldStorage
from galaxy.webapps.reports.base.controller import *
-import logging, sets, time
+import logging
log = logging.getLogger( __name__ )
class Report( BaseController ):
diff -r eb1244477b90 -r 2ae19c12114c tools/data_source/genbank.py
--- a/tools/data_source/genbank.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/data_source/genbank.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,6 +1,6 @@
#!/usr/bin/env python
from Bio import GenBank
-import sys, os, sets, textwrap
+import sys, os, textwrap
assert sys.version_info[:2] >= ( 2, 4 )
diff -r eb1244477b90 -r 2ae19c12114c tools/data_source/ucsc_proxy.py
--- a/tools/data_source/ucsc_proxy.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/data_source/ucsc_proxy.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,6 +1,6 @@
#!/usr/bin/env python
import urllib
-import sys, os, sets
+import sys, os
assert sys.version_info[:2] >= ( 2, 4 )
diff -r eb1244477b90 -r 2ae19c12114c tools/new_operations/get_flanks.py
--- a/tools/new_operations/get_flanks.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/new_operations/get_flanks.py Fri Aug 14 15:37:31 2009 -0400
@@ -9,7 +9,7 @@
-o, --off=N: Offset
"""
-import sys, sets, re, os
+import sys, re, os
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
from bx.cookbook import doc_optparse
diff -r eb1244477b90 -r 2ae19c12114c tools/new_operations/operation_filter.py
--- a/tools/new_operations/operation_filter.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/new_operations/operation_filter.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,8 +1,13 @@
# runs after the job (and after the default post-filter)
-import sets, os
+import os
from galaxy import eggs
from galaxy import jobs
from galaxy.tools.parameters import DataToolParameter
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
#def exec_before_process(app, inp_data, out_data, param_dict, tool=None):
# """Sets the name of the data"""
@@ -11,8 +16,8 @@
# raise Exception, '<p><font color="yellow">Both Queries must be from the same genome build</font></p>'
def validate_input( trans, error_map, param_values, page_param_map ):
- dbkeys = sets.Set()
- data_param_names = sets.Set()
+ dbkeys = set()
+ data_param_names = set()
data_params = 0
for name, param in page_param_map.iteritems():
if isinstance( param, DataToolParameter ):
diff -r eb1244477b90 -r 2ae19c12114c tools/new_operations/subtract_query.py
--- a/tools/new_operations/subtract_query.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/new_operations/subtract_query.py Fri Aug 14 15:37:31 2009 -0400
@@ -5,12 +5,16 @@
Subtract an entire query from another query
usage: %prog in_file_1 in_file_2 begin_col end_col output
"""
-
-import sys, sets, re
-
+import sys, re
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
from bx.cookbook import doc_optparse
+
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
diff -r eb1244477b90 -r 2ae19c12114c tools/regVariation/windowSplitter.py
--- a/tools/regVariation/windowSplitter.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/regVariation/windowSplitter.py Fri Aug 14 15:37:31 2009 -0400
@@ -7,7 +7,7 @@
-l, --cols=N,N,N,N: Columns for chrom, start, end, strand in file
"""
-import sys, sets, re, os
+import sys, re, os
from galaxy import eggs
import pkg_resources; pkg_resources.require( "bx-python" )
diff -r eb1244477b90 -r 2ae19c12114c tools/stats/column_maker.py
--- a/tools/stats/column_maker.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/stats/column_maker.py Fri Aug 14 15:37:31 2009 -0400
@@ -2,7 +2,7 @@
# This tool takes a tab-delimited textfile as input and creates another column in the file which is the result of
# a computation performed on every row in the original file. The tool will skip over invalid lines within the file,
# informing the user about the number of lines skipped.
-import sys, sets, re, os.path
+import sys, re, os.path
from galaxy import eggs
from galaxy.tools import validation
from galaxy.datatypes import metadata
diff -r eb1244477b90 -r 2ae19c12114c tools/stats/filtering.py
--- a/tools/stats/filtering.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/stats/filtering.py Fri Aug 14 15:37:31 2009 -0400
@@ -2,8 +2,13 @@
# This tool takes a tab-delimited text file as input and creates filters on columns based on certain properties.
# The tool will skip over invalid lines within the file, informing the user about the number of lines skipped.
-import sys, sets, re, os.path
+import sys, re, os.path
from galaxy import eggs
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
@@ -13,7 +18,7 @@
for item in items_to_strip:
if filter_condition.find( item ) >= 0:
filter_condition = filter_condition.replace( item, ' ' )
- operands = sets.Set( filter_condition.split( ' ' ) )
+ operands = set( filter_condition.split( ' ' ) )
return operands
def stop_err( msg ):
diff -r eb1244477b90 -r 2ae19c12114c tools/stats/grouping.py
--- a/tools/stats/grouping.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/stats/grouping.py Fri Aug 14 15:37:31 2009 -0400
@@ -3,7 +3,7 @@
"""
This tool provides the SQL "group by" functionality.
"""
-import sys, string, re, commands, tempfile, random, sets
+import sys, string, re, commands, tempfile, random
from rpy import *
def stop_err(msg):
diff -r eb1244477b90 -r 2ae19c12114c tools/stats/gsummary.py
--- a/tools/stats/gsummary.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/stats/gsummary.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,7 +1,12 @@
#!/usr/bin/python
-import sys, sets, re, tempfile
+import sys, re, tempfile
from rpy import *
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
assert sys.version_info[:2] >= ( 2, 4 )
@@ -33,7 +38,7 @@
for word in re.compile( '[a-zA-Z]+' ).findall( expression ):
if word and not word in math_allowed:
stop_err( "Invalid expression '%s': term '%s' is not recognized or allowed" %( expression, word ) )
- symbols = sets.Set()
+ symbols = set()
for symbol in re.compile( '[^a-z0-9\s]+' ).findall( expression ):
if symbol and not symbol in ops_allowed:
stop_err( "Invalid expression '%s': operator '%s' is not recognized or allowed" % ( expression, symbol ) )
diff -r eb1244477b90 -r 2ae19c12114c tools/visualization/build_ucsc_custom_track_code.py
--- a/tools/visualization/build_ucsc_custom_track_code.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/visualization/build_ucsc_custom_track_code.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,6 +1,10 @@
# runs after the job (and after the default post-filter)
-from sets import Set as set
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
def validate_input( trans, error_map, param_values, page_param_map ):
dbkeys = set()
diff -r eb1244477b90 -r 2ae19c12114c tools/visualization/genetrack_code.py
--- a/tools/visualization/genetrack_code.py Fri Aug 14 12:17:45 2009 -0400
+++ b/tools/visualization/genetrack_code.py Fri Aug 14 15:37:31 2009 -0400
@@ -1,4 +1,4 @@
-import sets, os
+import os
from galaxy import eggs
from galaxy import jobs
from galaxy.tools.parameters import DataToolParameter
1
0
24 Aug '09
details: http://www.bx.psu.edu/hg/galaxy/rev/670f8800a2bf
changeset: 2568:670f8800a2bf
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Wed Aug 19 09:13:21 2009 -0400
description:
Added two new datatypes (sam and bam) and an associated test
7 file(s) affected in this change:
datatypes_conf.xml.sample
lib/galaxy/datatypes/images.py
lib/galaxy/datatypes/registry.py
lib/galaxy/datatypes/tabular.py
lib/galaxy/datatypes/test/1.sam
test-data/1.sam
test/functional/test_sniffing_and_metadata_settings.py
diffs (362 lines):
diff -r b56291fad13d -r 670f8800a2bf datatypes_conf.xml.sample
--- a/datatypes_conf.xml.sample Mon Aug 17 09:54:57 2009 -0400
+++ b/datatypes_conf.xml.sample Wed Aug 19 09:13:21 2009 -0400
@@ -3,6 +3,7 @@
<registration converters_path="lib/galaxy/datatypes/converters">
<datatype extension="ab1" type="galaxy.datatypes.images:Ab1" mimetype="application/octet-stream" display_in_upload="true"/>
<datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/>
+ <datatype extension="bam" type="galaxy.datatypes.images:Bam" mimetype="application/octet-stream"/>
<datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true">
<converter file="bed_to_gff_converter.xml" target_datatype="gff"/>
<converter file="interval_to_coverage.xml" target_datatype="coverage"/>
@@ -49,6 +50,7 @@
<datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/>
<datatype extension="qualsolid" type="galaxy.datatypes.qualityscore:QualityScoreSOLiD" display_in_upload="true"/>
<datatype extension="qual454" type="galaxy.datatypes.qualityscore:QualityScore454" display_in_upload="true"/>
+ <datatype extension="sam" type="galaxy.datatypes.tabular:Sam" display_in_upload="true"/>
<datatype extension="scf" type="galaxy.datatypes.images:Scf" mimetype="application/octet-stream" display_in_upload="true"/>
<datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/>
<datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/>
@@ -205,5 +207,6 @@
<sniffer type="galaxy.datatypes.interval:Gff"/>
<sniffer type="galaxy.datatypes.interval:Gff3"/>
<sniffer type="galaxy.datatypes.interval:Interval"/>
+ <sniffer type="galaxy.datatypes.tabular:Sam"/>
</sniffers>
</datatypes>
diff -r b56291fad13d -r 670f8800a2bf lib/galaxy/datatypes/images.py
--- a/lib/galaxy/datatypes/images.py Mon Aug 17 09:54:57 2009 -0400
+++ b/lib/galaxy/datatypes/images.py Wed Aug 19 09:13:21 2009 -0400
@@ -4,6 +4,8 @@
import data
import logging
+from galaxy.datatypes.metadata import MetadataElement
+from galaxy.datatypes import metadata
from galaxy.datatypes.sniff import *
from urllib import urlencode, quote_plus
import zipfile
@@ -187,7 +189,7 @@
return 'text/html'
def sniff( self, filename ):
"""
- Determines wether the file is in html format
+ Determines whether the file is in html format
>>> fname = get_test_fname( 'complete.bed' )
>>> Html().sniff( fname )
@@ -233,3 +235,25 @@
return dataset.peek
except:
return "peek unavailable"
+
+class Bam( data.Binary ):
+ """Class describing a BAM binary file"""
+ file_ext = "bam"
+ MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True )
+ def set_peek( self, dataset ):
+ if not dataset.dataset.purged:
+ export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey})
+ dataset.peek = "Binary bam alignments file"
+ dataset.blurb = data.nice_size( dataset.get_size() )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+ def display_peek(self, dataset):
+ try:
+ return dataset.peek
+ except:
+ return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) )
+ def get_mime(self):
+ """Returns the mime type of the datatype"""
+ return 'application/octet-stream'
+
\ No newline at end of file
diff -r b56291fad13d -r 670f8800a2bf lib/galaxy/datatypes/registry.py
--- a/lib/galaxy/datatypes/registry.py Mon Aug 17 09:54:57 2009 -0400
+++ b/lib/galaxy/datatypes/registry.py Wed Aug 19 09:13:21 2009 -0400
@@ -111,6 +111,7 @@
self.datatypes_by_extension = {
'ab1' : images.Ab1(),
'axt' : sequence.Axt(),
+ 'bam' : images.Bam(),
'bed' : interval.Bed(),
'binseq.zip' : images.Binseq(),
'blastxml' : xml.BlastXml(),
@@ -130,6 +131,7 @@
'qualsolid' : qualityscore.QualityScoreSOLiD(),
'qualsolexa' : qualityscore.QualityScoreSolexa(),
'qual454' : qualityscore.QualityScore454(),
+ 'sam' : tabular.Sam(),
'scf' : images.Scf(),
'tabular' : tabular.Tabular(),
'taxonomy' : tabular.Taxonomy(),
@@ -140,6 +142,7 @@
self.mimetypes_by_extension = {
'ab1' : 'application/octet-stream',
'axt' : 'text/plain',
+ 'bam' : 'application/octet-stream',
'bed' : 'text/plain',
'binseq.zip' : 'application/zip',
'blastxml' : 'text/plain',
@@ -157,6 +160,7 @@
'qualsolid' : 'text/plain',
'qualsolexa' : 'text/plain',
'qual454' : 'text/plain',
+ 'sam' : 'text/plain',
'scf' : 'application/octet-stream',
'tabular' : 'text/plain',
'taxonomy' : 'text/plain',
@@ -184,7 +188,8 @@
interval.CustomTrack(),
interval.Gff(),
interval.Gff3(),
- interval.Interval()
+ interval.Interval(),
+ tabular.Sam()
]
def append_to_sniff_order():
# Just in case any supported data types are not included in the config's sniff_order section.
diff -r b56291fad13d -r 670f8800a2bf lib/galaxy/datatypes/tabular.py
--- a/lib/galaxy/datatypes/tabular.py Mon Aug 17 09:54:57 2009 -0400
+++ b/lib/galaxy/datatypes/tabular.py Wed Aug 19 09:13:21 2009 -0400
@@ -236,3 +236,84 @@
out = "Can't create peek %s" % exc
return out
+class Sam( Tabular ):
+ file_ext = 'sam'
+ def __init__(self, **kwd):
+ """Initialize taxonomy datatype"""
+ Tabular.__init__( self, **kwd )
+ self.column_names = ['QNAME', 'FLAG', 'RNAME', 'POS', 'MAPQ', 'CIGAR',
+ 'MRNM', 'MPOS', 'ISIZE', 'SEQ', 'QUAL', 'OPT'
+ ]
+ def make_html_table( self, dataset, skipchars=[] ):
+ """Create HTML table, used for displaying peek"""
+ out = ['<table cellspacing="0" cellpadding="3">']
+ try:
+ # Generate column header
+ out.append( '<tr>' )
+ for i, name in enumerate( self.column_names ):
+ out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) )
+ # This data type requires at least 11 columns in the data
+ if dataset.metadata.columns - len( self.column_names ) > 0:
+ for i in range( len( self.column_names ), dataset.metadata.columns ):
+ out.append( '<th>%s</th>' % str( i+1 ) )
+ out.append( '</tr>' )
+ out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) )
+ out.append( '</table>' )
+ out = "".join( out )
+ except Exception, exc:
+ out = "Can't create peek %s" % exc
+ return out
+ def sniff( self, filename ):
+ """
+ Determines whether the file is in SAM format
+
+ A file in SAM format consists of lines of tab-separated data.
+ The following header line may be the first line:
+ @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL
+ or
+ @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+ Data in the OPT column is optional and can consist of tab-separated data
+
+ For complete details see http://samtools.sourceforge.net/SAM1.pdf
+
+ Rules for sniffing as True:
+ There must be 11 or more columns of data on each line
+ Columns 2 (FLAG), 4(POS), 5 (MAPQ), 8 (MPOS), and 9 (ISIZE) must be numbers (9 can be negative)
+ We will only check that up to the first 5 alignments are correctly formatted.
+
+ >>> fname = get_test_fname( 'sequence.maf' )
+ >>> Sam().sniff( fname )
+ False
+ >>> fname = get_test_fname( '1.sam' )
+ >>> Sam().sniff( fname )
+ True
+ """
+ try:
+ fh = open( filename )
+ count = 0
+ while True:
+ line = fh.readline()
+ line = line.strip()
+ if not line:
+ break #EOF
+ if line:
+ if line[0] != '@':
+ linePieces = line.split('\t')
+ if len(linePieces) < 11:
+ return False
+ try:
+ check = int(linePieces[1])
+ check = int(linePieces[3])
+ check = int(linePieces[4])
+ check = int(linePieces[7])
+ check = int(linePieces[8])
+ except ValueError:
+ return False
+ count += 1
+ if count == 5:
+ return True
+ if count < 5 and count > 0:
+ return True
+ except:
+ pass
+ return False
diff -r b56291fad13d -r 670f8800a2bf lib/galaxy/datatypes/test/1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/1.sam Wed Aug 19 09:13:21 2009 -0400
@@ -0,0 +1,97 @@
+@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(#
+1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$
+1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$######
+1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$####
+1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'#
+1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&%
+1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$###
+1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$
+1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#&
+1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$#
+1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#'
+1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$##
+1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/
+1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$
+1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$
+1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'#
+1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&#
+1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$###
+1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%#
+1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_68_466 69 * 0 0 * * 0 0 GTGATCGTCGGTGCCAGTCCCTGT #(%)+##$#$#%#+$%##$#####
+1378_68_466 133 * 0 0 * * 0 0 GTGTCATCTGAGGTAAAGCATTGT /##$09#$#.=$#$76+$%1'###
+1378_68_1692 117 chr13.nib:1-114142980 36365609 0 24M = 36365609 0 TTGAACCGGGCACGGGTCTTCTGG #$#######%###$##%&'%)###
+1378_68_1692 153 chr13.nib:1-114142980 36365609 37 10M1D13M = 36365609 0 CTGCACATACAGAATATTCATAG 0010/!"0/!!021/132231// XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:10^T13
+1378_80_664 69 * 0 0 * * 0 0 CTGCTTTGATCCCCGGTGGAGCAC 7#%###$$6#######$##$$$##
+1378_80_664 133 * 0 0 * * 0 0 TGTCTGCGTTGTATCTCTGGTGTA %##%,%$$#&$$###$#$%##'%#
+1378_85_1786 69 * 0 0 * * 0 0 ATACTATGTCGATCTGTAAAAAAA )&.)#3%(a)$&%-,2#&+.-%0&./
+1378_85_1786 133 * 0 0 * * 0 0 CCCTAGGAGCGTATACCGGACGAG ,'&/%/@,&1,&'/)&,6&&1)((
+1378_86_1011 69 * 0 0 * * 0 0 CTACGTTATTGCTCTGTTTGTCCT ######$%##$$$%###%#$####
+1378_86_1011 133 * 0 0 * * 0 0 AGGCGATGGGATATTATTTTACTT :$###)%##$9$###1$$#$2###
+1378_86_1789 89 chr12.nib:1-132349534 39007065 37 23M = 39007065 0 GCTTTCCATAGATGTGTAATTTC J2K]]Z5!GN?@U]]]VX]UYYP XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_86_1789 181 chr12.nib:1-132349534 39007065 0 24M = 39007065 0 ACAACTTAAATAATCATGGACCGG 02,5$$0&6#%?*,$'#%&/15.1
+1378_91_1596 69 * 0 0 * * 0 0 TTAGCGGTTGACTATCTGCTGACA *&+'#9'(%*'#//,&<),/)'*#
+1378_91_1596 133 * 0 0 * * 0 0 GCTTTTTCATTCGGTGCCTTTGGA '>%/3%=()8'#.%?50$&5>%)%
+1378_94_1595 69 chr7.nib:1-158821424 127518258 0 24M = 127518258 0 CGTGCGACAGCCCATGTTTTCAGA -=..5,3826&*+.+#+#%%6;%#
+1378_94_1595 137 chr7.nib:1-158821424 127518258 37 23M = 127518258 0 TGAGATAAACACCTAACATGCTC M]]FN]]\V]]]Q>T]KIG:LVN XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_95_1039 69 * 0 0 * * 0 0 CGGCGTCCATCTTCGCCTTGAGAT $##.#$##$$#%$#$%%$###$)$
+1378_95_1039 133 * 0 0 * * 0 0 GTTCTGTGCCAGGTGAGGTACGGA &##,./#$&)6##+,'#$$0(##$
+1378_95_1767 65 chr11.nib:1-134452384 65333552 25 23M chr3.nib:1-199501827 123725482 0 CAACTGGTGGCATCTGGACAAAC W[[TZYY]]RO<BI7!!:!!>@2 XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_95_1767 129 chr3.nib:1-199501827 123725482 37 6M1I16M chr11.nib:1-134452384 65333552 0 ATTTATCTGTCTCATTCATTATT <AGB8B"!V]]UO/&JB4DE88E XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_96_1037 69 * 0 0 * * 0 0 ATCCCCCAAGATGCCTGTTGATTG $#$'##$$$#%$$#%###+##$#$
+1378_96_1037 133 * 0 0 * * 0 0 CTGCTGGGCCATTTGACTTACTCA '$#+#(##-%5##+*&###-.$$$
+1378_96_1764 81 chr15.nib:1-100338915 89251272 25 23M chr7.nib:1-158821424 19412615 0 AGAAATGGTCGCACCCTCTGGTT E*2ZEHX\SN]O>SYRL):LIOL XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_96_1764 161 chr7.nib:1-158821424 19412615 37 23M chr15.nib:1-100338915 89251272 0 GTATAGCCCACAACGCCTAATAT ZMBS]UW]UYR\]QPZ[SMYL7C XT:A:U CM:i:0 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_98_1574 69 * 0 0 * * 0 0 GTTCTGCCGGTGTCTGTGGCGGGC $$#+&$$####%$$$###$%#%%#
+1378_98_1574 133 * 0 0 * * 0 0 AGGCGAGTGTGGGGGTTGTTTGAG +%%$#)##%##$####%###$%$#
+1378_107_1647 69 * 0 0 * * 0 0 AGGCCTACTACGCGTCATTGATAG &#$$#$(.#%#$$####&$%##($
+1378_107_1647 133 * 0 0 * * 0 0 GGTCTGGTTCTATGTTGGTCGACT ###'$$#$$$(#%###(#$##$%#
+1378_111_829 69 chr9.nib:1-140273252 82506894 0 24M = 82506894 0 TGCGGCACTTGCTTCTTCGTATTT %#%##%#$%#$#%###$$##&#$$
+1378_111_829 137 chr9.nib:1-140273252 82506894 37 4M1I18M = 82506894 0 GATGCGTAATCTAGTAAAATAAG 0/362//00/5516500210451 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_111_1900 69 * 0 0 * * 0 0 TCCCCTCGCTCGGCTCTGTGCTGT $&%*$#(#)##$#'##%(##$#$%
+1378_111_1900 133 * 0 0 * * 0 0 GCACGCCTTTGGGCTAAGCCGTAA )$)'#%$########$'#&%$#(#
+1378_112_1483 69 * 0 0 * * 0 0 TGTCCAGCTATGCGGCTTCCTCCT %#$+#%#&#$#####%####%$##
+1378_112_1483 133 * 0 0 * * 0 0 TGGAGTGGTGTGTTTGCTGAGCCA #$#)#############$#%#%'%
+1378_125_1287 69 * 0 0 * * 0 0 TGTCTCTGGGGGGCCTGGTTAGGT $##13$'%#$###$$###$$$#&#
+1378_125_1287 133 * 0 0 * * 0 0 TGACGTGGGTTGTCCCGTGAGATT ##$%%#$###$##$$#&%##$(%%
+1378_126_468 117 chr11.nib:1-134452384 72541052 0 24M = 72541052 0 TGCCTCTATACAGATTAGTCCTCT )7,7..?97594@8=,=?813@>7
+1378_126_468 153 chr11.nib:1-134452384 72541052 0 23M = 72541052 0 AGGCAAGACTCTGTCTCAAAAAA PK5G]]PDT\]SEXY[]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:15713 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_127_664 69 * 0 0 * * 0 0 AGAGGTTGGTGTCTTGTCGCAGCT ##'#$######$$%######$$$#
+1378_127_664 133 * 0 0 * * 0 0 TCGCTTTGCCTATGTTTGTTCGGA #%$%#&##$%#%%###$$###)-'
+1378_129_463 97 chr8.nib:1-146274826 29931771 37 23M chr19.nib:1-63811651 5702213 0 GTAGCTCTGTTTCACATTAGGGG J>AQ[G>C?NM:GD=)*PLORIF XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_129_463 145 chr19.nib:1-63811651 5702213 0 23M chr8.nib:1-146274826 29931771 0 AAAAAAAAAAAAAAAAAAAAAAA JOI:AHGD==@KQB78HF>KA8> XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:583698 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_129_875 69 * 0 0 * * 0 0 TTTCTATGGCTTACGCTGTCTGCC #$($##%####%$#$#####$###
+1378_129_875 133 * 0 0 * * 0 0 GACCTTTACGTATTGGGGGTTGGC ###)###+###$##$#&%##$,#$
+1378_140_1251 69 * 0 0 * * 0 0 ATCCTAGCGCGGTGTCTTGGGGAC #$%1#$$$##$##$#$#$##$%$$
+1378_140_1251 133 * 0 0 * * 0 0 TTTCCTTCGTGTGCGTGCGGAGTG #%#%$##$$$######.$$$%#%(
+1378_141_809 69 * 0 0 * * 0 0 TGTCCTCCAGTGTCTGTTGGGTGT %&,-##$$#(%###$#$$'###'#
+1378_141_809 133 * 0 0 * * 0 0 TCTCGTGGTTTCTTTTTTATGTGT ##%)##$$#####%$#$#%%#'##
+1378_144_983 69 * 0 0 * * 0 0 AGCGCCCGGTTGGTGCGGCTCGTC -$(&%*$#*#))#$$$#%%$#$##
+1378_144_983 133 * 0 0 * * 0 0 GTTCGTTCGTGGTGTACGAGGGTG #(#%#####($#%##$$#%##%#)
+1378_153_270 69 * 0 0 * * 0 0 AGTCCTTGTCCCCTGGGTTTTCCC +''$#&%$%#$##&$$($#&#$$#
+1378_153_270 133 * 0 0 * * 0 0 GGCCGTGTGCGGGTGTAGATTGGA %$##($######&##$&$$$$%##
+1378_155_1689 65 chrX.nib:1-154913754 106941539 37 23M = 106940385 -1154 ATCTCCTCTTCCTTCCATTCCAC \]]]Y]]]]]UV]]]ZYZZ]]RV XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_155_1689 129 chrX.nib:1-154913754 106940385 37 23M = 106941539 1154 GACTATGAGGTTTTCATTCAACA ]]]]\\]]]YW]]]WRZ]]WIOK XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_157_1580 69 * 0 0 * * 0 0 TGGGCCTCGGTGCCCTTGGTCTGT #%)$##'#$$$&#####%#$#$##
+1378_157_1580 133 * 0 0 * * 0 0 GGGATTGAAGGGATGTATGCTAGG #%$&%#$$'%$%#$##*#%$$$$#
+1378_161_317 69 * 0 0 * * 0 0 TTGGCCGGCAACCCCGGTACCTAA 7<,<'@)@>.)2@/')'&(?/-<(
+1378_161_317 133 * 0 0 * * 0 0 AATCCATACCCACAAAAGCAGGCC .&%','(@''?7//+&)+2.+)0)
+1378_177_735 113 chr2.nib:1-242951149 222173182 25 23M = 222173882 700 TTGTTCAGCGCCGATTGTCAATC KPNICFMS]]]Z]]]]Y]]]]]] XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:1G21
+1378_177_735 177 chr2.nib:1-242951149 222173882 37 23M = 222173182 -700 AGAATTCCTAACAAAATGTGAAG ES6-]]]]]]]]]]]]]]]]]]] XT:A:U CM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23
+1378_181_1684 69 * 0 0 * * 0 0 CGACTCCCGCATTCACGGTCAAGT &*#,##$#&$*$$#$#$$$#%$##
+1378_181_1684 133 * 0 0 * * 0 0 TTTCTGTTGTGGTTTTGTTGGGGT $##'$%'##%##$%$#$$####$*
+1378_187_1407 69 * 0 0 * * 0 0 TGGCGTCCACTCGTGGGTCTATCG $#$'%#$%$%&$%#####$#$#%#
+1378_187_1407 133 * 0 0 * * 0 0 TTGGGTGAAATCTTGTCGAGTGGA ####&##$$###$#####%##%%)
+1378_203_721 97 chr1.nib:1-247249719 245680524 25 23M chr2.nib:1-242951149 213173999 0 GTAAAATTTGTGGAGATTTAAGT ]VEFFEZ]XPW]TOVINQ,;T!! XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_203_721 145 chr2.nib:1-242951149 213173999 37 4M1I18M chr1.nib:1-247249719 245680524 0 ACCTAACAAAATTGTTCAATATG F>8AWT<AV]Q9B"+]O@IF=K] XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_206_2039 113 chr4.nib:1-191273063 103793427 0 23M chr18.nib:1-76117153 57165542 0 ACACACACACACACACACACACA NKWZVWZ]]XV[]]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_206_2039 177 chr18.nib:1-76117153 57165542 0 23M chr4.nib:1-191273063 103793427 0 CACACACACACACACACACACAC NAJ[SPT[]]]W[]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
diff -r b56291fad13d -r 670f8800a2bf test-data/1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.sam Wed Aug 19 09:13:21 2009 -0400
@@ -0,0 +1,29 @@
+@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
+1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(#
+1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$
+1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$######
+1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$####
+1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'#
+1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&%
+1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$###
+1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$
+1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#&
+1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
+1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$#
+1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#'
+1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$##
+1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/
+1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
+1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$
+1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$
+1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'#
+1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&#
+1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$###
+1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%#
+1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
+1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
\ No newline at end of file
diff -r b56291fad13d -r 670f8800a2bf test/functional/test_sniffing_and_metadata_settings.py
--- a/test/functional/test_sniffing_and_metadata_settings.py Mon Aug 17 09:54:57 2009 -0400
+++ b/test/functional/test_sniffing_and_metadata_settings.py Wed Aug 19 09:13:21 2009 -0400
@@ -226,6 +226,16 @@
assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database"
if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger':
raise AssertionError, "fastqsanger data type was not correctly sniffed."
+ def test_090_sam_datatype( self ):
+ """Testing correctly sniffing sam format upon upload"""
+ self.upload_file( '1.sam' )
+ self.verify_dataset_correctness( '1.sam' )
+ self.check_history_for_string( '1.sam format: <span class="sam">sam</span>, database: \? Info: uploaded sam file' )
+ latest_hda = galaxy.model.HistoryDatasetAssociation.query() \
+ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first()
+ assert latest_hda is not None, "Problem retrieving sam hda from the database"
+ if not latest_hda.name == '1.sam' and not latest_hda.extension == 'sam':
+ raise AssertionError, "sam data type was not correctly sniffed."
def test_9999_clean_up( self ):
self.delete_history( id=self.security.encode_id( history1.id ) )
self.logout()
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/b56291fad13d
changeset: 2567:b56291fad13d
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Mon Aug 17 09:54:57 2009 -0400
description:
Change import from . to __init__.
2 file(s) affected in this change:
lib/galaxy/tools/actions/metadata.py
lib/galaxy/tools/actions/upload.py
diffs (19 lines):
diff -r 32c76fdcacd2 -r b56291fad13d lib/galaxy/tools/actions/metadata.py
--- a/lib/galaxy/tools/actions/metadata.py Sat Aug 15 16:26:37 2009 -0400
+++ b/lib/galaxy/tools/actions/metadata.py Mon Aug 17 09:54:57 2009 -0400
@@ -1,4 +1,4 @@
-from . import ToolAction
+from __init__ import ToolAction
from galaxy.datatypes.metadata import JobExternalOutputMetadataWrapper
import logging
diff -r 32c76fdcacd2 -r b56291fad13d lib/galaxy/tools/actions/upload.py
--- a/lib/galaxy/tools/actions/upload.py Sat Aug 15 16:26:37 2009 -0400
+++ b/lib/galaxy/tools/actions/upload.py Mon Aug 17 09:54:57 2009 -0400
@@ -1,5 +1,5 @@
import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile
-from . import ToolAction
+from __init__ import ToolAction
from galaxy import datatypes, jobs
from galaxy.datatypes import sniff
from galaxy import model, util
1
0
Hi,
I'm trying to switch from sqlite to mySQL and need a little assistance
with what goes in the database connection field in universe_wsgi.ini.
For instance, if I set up the following mySQL database:
database = galaxy_test
user = galaxy
password = password
what would I use to connect to this. I have tried using
mysql:///galaxy_test?unix_socket=/var/run/mysqld/mysqld.sock but I
cannot connect as it looks like a username and password are expected.
Thanks for any help
Shaun Webb
--
The University of Edinburgh is a charitable body, registered in
Scotland, with registration number SC005336.
2
2