galaxy-dev
Threads by month
- ----- 2026 -----
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
- 10009 discussions
details: http://www.bx.psu.edu/hg/galaxy/rev/6eddc13b1d3b
changeset: 3005:6eddc13b1d3b
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 16:02:49 2009 -0500
description:
Fix for the broken test I just committed
diffstat:
test/base/twilltestcase.py | 2 +-
1 files changed, 1 insertions(+), 1 deletions(-)
diffs (12 lines):
diff -r 4f923033e9d0 -r 6eddc13b1d3b test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Tue Nov 10 15:10:43 2009 -0500
+++ b/test/base/twilltestcase.py Tue Nov 10 16:02:49 2009 -0500
@@ -1651,7 +1651,7 @@
t.extract( n, tmpd )
t.close()
elif zipfile.is_zipfile( archive ):
- z = zipfile.open( archive )
+ z = zipfile.ZipFile( archive, 'r' )
for n in z.namelist():
mkdir( n )
open( os.path.join( tmpd, n ), 'wb' ).write( z.read( n ) )
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/4f923033e9d0
changeset: 3004:4f923033e9d0
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 15:10:43 2009 -0500
description:
Add test for library tarball downloads
diffstat:
test/base/twilltestcase.py | 60 ++++++++++++++++++++++++++++-
test/functional/test_security_and_libraries.py | 9 ++++
2 files changed, 66 insertions(+), 3 deletions(-)
diffs (110 lines):
diff -r d5fd27771019 -r 4f923033e9d0 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Tue Nov 10 15:04:03 2009 -0500
+++ b/test/base/twilltestcase.py Tue Nov 10 15:10:43 2009 -0500
@@ -1,7 +1,7 @@
import pkg_resources
pkg_resources.require( "twill==0.9" )
-import StringIO, os, sys, random, filecmp, time, unittest, urllib, logging, difflib, zipfile, tempfile, re
+import StringIO, os, sys, random, filecmp, time, unittest, urllib, logging, difflib, tarfile, zipfile, tempfile, re, shutil
from itertools import *
import twill
@@ -736,8 +736,8 @@
errmsg = "no match to '%s'\npage content written to '%s'" % ( patt, fname )
raise AssertionError( errmsg )
- def write_temp_file( self, content ):
- fd, fname = tempfile.mkstemp( suffix='.html', prefix='twilltestcase-' )
+ def write_temp_file( self, content, suffix='.html' ):
+ fd, fname = tempfile.mkstemp( suffix=suffix, prefix='twilltestcase-' )
f = os.fdopen( fd, "w" )
f.write( content )
f.close()
@@ -1616,6 +1616,60 @@
self.check_page_for_string( check_str_after_submit )
self.library_wait( library_id, controller='library' )
self.home()
+ def download_archive_of_library_files( self, library_id, ldda_ids, format ):
+ self.home()
+ self.visit_url( "%s/library/browse_library?obj_id=%s" % ( self.url, library_id ) )
+ for ldda_id in ldda_ids:
+ tc.fv( "1", "ldda_ids", ldda_id )
+ tc.fv( "1", "do_action", format )
+ tc.submit( "action_on_datasets_button" )
+ tc.code( 200 )
+ archive = self.write_temp_file( self.last_page(), suffix=format )
+ self.home()
+ return archive
+ def check_archive_contents( self, archive, lddas ):
+ def get_ldda_path( ldda ):
+ path = ""
+ parent_folder = ldda.library_dataset.folder
+ while parent_folder is not None:
+ if parent_folder.parent is None:
+ path = os.path.join( parent_folder.library_root[0].name, path )
+ break
+ path = os.path.join( parent_folder.name, path )
+ parent_folder = parent_folder.parent
+ path += ldda.name
+ return path
+ def mkdir( file ):
+ dir = os.path.join( tmpd, os.path.dirname( file ) )
+ if not os.path.exists( dir ):
+ os.makedirs( dir )
+ tmpd = tempfile.mkdtemp()
+ if tarfile.is_tarfile( archive ):
+ t = tarfile.open( archive )
+ for n in t.getnames():
+ mkdir( n )
+ t.extract( n, tmpd )
+ t.close()
+ elif zipfile.is_zipfile( archive ):
+ z = zipfile.open( archive )
+ for n in z.namelist():
+ mkdir( n )
+ open( os.path.join( tmpd, n ), 'wb' ).write( z.read( n ) )
+ z.close()
+ else:
+ raise Exception( 'Unable to read archive: %s' % archive )
+ for ldda in lddas:
+ orig_file = self.get_filename( ldda.name )
+ downloaded_file = os.path.join( tmpd, get_ldda_path( ldda ) )
+ assert os.path.exists( downloaded_file )
+ try:
+ self.files_diff( orig_file, downloaded_file )
+ except AssertionError, err:
+ errmsg = 'Library item %s different than expected, difference:\n' % ldda.name
+ errmsg += str( err )
+ errmsg += 'Unpacked archive remains in: %s\n' % tmpd
+ raise AssertionError( errmsg )
+ shutil.rmtree( tmpd )
def delete_library_item( self, library_id, library_item_id, library_item_name, library_item_type='library_dataset' ):
"""Mark a library item as deleted"""
self.home()
diff -r d5fd27771019 -r 4f923033e9d0 test/functional/test_security_and_libraries.py
--- a/test/functional/test_security_and_libraries.py Tue Nov 10 15:04:03 2009 -0500
+++ b/test/functional/test_security_and_libraries.py Tue Nov 10 15:10:43 2009 -0500
@@ -6,6 +6,7 @@
not_logged_in_security_msg = 'You must be logged in as an administrator to access this feature.'
logged_in_security_msg = 'You must be an administrator to access this feature.'
+import sys
class TestSecurityAndLibraries( TwillTestCase ):
def test_000_admin_features_when_not_logged_in( self ):
"""Testing admin_features when not logged in"""
@@ -1385,6 +1386,14 @@
self.home()
self.logout()
self.login( email=admin_user.email )
+ def test_167_download_archive_of_library_files( self ):
+ """Testing downloading an archive of files from the library"""
+ for format in ( 'tbz', 'tgz', 'zip' ):
+ archive = self.download_archive_of_library_files( str( library_one.id ),
+ ( str( ldda_one.id ), str( ldda_two.id ) ),
+ format )
+ self.check_archive_contents( archive, ( ldda_one, ldda_two ) )
+ os.remove( archive )
def test_170_mark_group_deleted( self ):
"""Testing marking a group as deleted"""
# Logged in as admin_user
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/5a9b6c39d173
changeset: 3002:5a9b6c39d173
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 13:49:34 2009 -0500
description:
Upgrade to Routes 1.11
diffstat:
eggs.ini | 4 ++--
1 files changed, 2 insertions(+), 2 deletions(-)
diffs (21 lines):
diff -r c146726d274f -r 5a9b6c39d173 eggs.ini
--- a/eggs.ini Tue Nov 10 13:47:34 2009 -0500
+++ b/eggs.ini Tue Nov 10 13:49:34 2009 -0500
@@ -40,7 +40,7 @@
Paste = 1.5.1
PasteDeploy = 1.3.1
PasteScript = 1.3.6
-Routes = 1.6.3
+Routes = 1.11
simplejson = 1.5
SQLAlchemy = 0.5.6
sqlalchemy_migrate = 0.5.4
@@ -90,7 +90,7 @@
PasteDeploy = http://cheeseshop.python.org/packages/source/P/PasteDeploy/PasteDeploy-1.3.…
PasteScript = http://cheeseshop.python.org/packages/source/P/PasteScript/PasteScript-1.3.…
PSI = http://pypi.python.org/packages/source/P/PSI/PSI-0.3b1.1.tar.gz
-Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.6.3.tar.gz
+Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.11.tar.gz
simplejson = http://cheeseshop.python.org/packages/source/s/simplejson/simplejson-1.5.ta…
SQLAlchemy = http://pypi.python.org/packages/source/S/SQLAlchemy/SQLAlchemy-0.5.6.tar.gz
sqlalchemy_migrate = http://pypi.python.org/packages/source/s/sqlalchemy-migrate/sqlalchemy-migr…
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/d5fd27771019
changeset: 3003:d5fd27771019
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 15:04:03 2009 -0500
description:
Remove the "unknown extension in data factory" messages
diffstat:
lib/galaxy/datatypes/registry.py | 2 --
1 files changed, 0 insertions(+), 2 deletions(-)
diffs (12 lines):
diff -r 5a9b6c39d173 -r d5fd27771019 lib/galaxy/datatypes/registry.py
--- a/lib/galaxy/datatypes/registry.py Tue Nov 10 13:49:34 2009 -0500
+++ b/lib/galaxy/datatypes/registry.py Tue Nov 10 15:04:03 2009 -0500
@@ -219,8 +219,6 @@
builder = self.datatypes_by_extension[ext]
except KeyError:
builder = data.Text()
- if ext is not None:
- self.log.warning('unknown extension in data factory %s', ext)
return builder
def change_datatype(self, data, ext ):
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/c146726d274f
changeset: 3001:c146726d274f
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 13:47:34 2009 -0500
description:
Upgrade to Cheetah 2.2.2
diffstat:
eggs.ini | 4 +-
lib/galaxy/eggs/__init__.py | 1 +
scripts/scramble/lib/get_platform.py | 18 ++++++
scripts/scramble/scripts/Cheetah-py2.5.py | 55 ------------------
scripts/scramble/scripts/Cheetah.py | 62 ++++++++++++++++++++
scripts/scramble/scripts/DRMAA_python.py | 1 +
scripts/scramble/scripts/MySQL_python.py | 1 +
scripts/scramble/scripts/generic.py | 1 +
scripts/scramble/scripts/pbs_python.py | 1 +
scripts/scramble/scripts/psycopg2.py | 1 +
scripts/scramble/scripts/pysqlite.py | 1 +
scripts/scramble/scripts/python_lzo.py | 1 +
tools/filters/joiner.xml | 35 ++++++-----
tools/maf/genebed_maf_to_fasta.xml | 7 +-
tools/maf/interval2maf.xml | 10 +-
tools/maf/interval_maf_to_merged_fasta.xml | 7 +-
tools/maf/maf_to_fasta.xml | 6 +-
tools/metag_tools/blat_wrapper.xml | 7 +-
tools/metag_tools/shrimp_color_wrapper.xml | 6 +-
tools/metag_tools/shrimp_wrapper.xml | 10 +-
tools/samtools/pileup_parser.xml | 8 +-
tools/sr_mapping/lastz_wrapper.xml | 18 +++---
tools/stats/aggregate_binned_scores_in_intervals.xml | 6 +-
23 files changed, 151 insertions(+), 116 deletions(-)
diffs (485 lines):
diff -r facf315d9e0e -r c146726d274f eggs.ini
--- a/eggs.ini Tue Nov 10 13:46:53 2009 -0500
+++ b/eggs.ini Tue Nov 10 13:47:34 2009 -0500
@@ -13,7 +13,7 @@
[eggs:platform]
bx_python = 0.5.0
-Cheetah = 1.0
+Cheetah = 2.2.2
DRMAA_python = 0.2
MySQL_python = 1.2.2
pbs_python = 2.9.4
@@ -66,7 +66,7 @@
; source location, necessary for scrambling
[source]
bx_python = http://bitbucket.org/james_taylor/bx-python/get/4bf1f32e6b76.bz2
-Cheetah = http://voxel.dl.sourceforge.net/sourceforge/cheetahtemplate/Cheetah-1.0.tar…
+Cheetah = http://pypi.python.org/packages/source/C/Cheetah/Cheetah-2.2.2.tar.gz
DRMAA_python = http://gridengine.sunsource.net/files/documents/7/36/DRMAA-python-0.2.tar.gz
MySQL_python = http://superb-west.dl.sourceforge.net/sourceforge/mysql-python/MySQL-python… http://downloads.mysql.com/archives/mysql-5.0/mysql-5.0.67.tar.gz
pbs_python = http://ftp.sara.nl/pub/outgoing/pbs_python-2.9.4.tar.gz
diff -r facf315d9e0e -r c146726d274f lib/galaxy/eggs/__init__.py
--- a/lib/galaxy/eggs/__init__.py Tue Nov 10 13:46:53 2009 -0500
+++ b/lib/galaxy/eggs/__init__.py Tue Nov 10 13:47:34 2009 -0500
@@ -140,6 +140,7 @@
cmd = "ssh %s 'cd %s; %s -ES %s'" % ( self.build_host, self.buildpath, self.python, "scramble.py" )
else:
cmd = "%s -ES %s" % ( self.python, "scramble.py" )
+ log.debug( 'Executing: %s' % cmd )
p = subprocess.Popen( args = cmd, shell = True, cwd = self.buildpath )
r = p.wait()
if r != 0:
diff -r facf315d9e0e -r c146726d274f scripts/scramble/lib/get_platform.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/scripts/scramble/lib/get_platform.py Tue Nov 10 13:47:34 2009 -0500
@@ -0,0 +1,18 @@
+"""
+Monkeypatch get_platform since it's broken on OS X versions of Python 2.5
+"""
+import os, sys
+from distutils.sysconfig import get_config_vars
+if sys.platform == 'darwin' and get_config_vars().get('UNIVERSALSDK', '').strip():
+ # Has to be before anything imports pkg_resources
+ def _get_platform_monkeypatch():
+ plat = distutils.util._get_platform()
+ if plat.startswith( 'macosx-' ):
+ plat = 'macosx-10.3-fat'
+ return plat
+ import distutils.util
+ try:
+ assert distutils.util._get_platform
+ except:
+ distutils.util._get_platform = distutils.util.get_platform
+ distutils.util.get_platform = _get_platform_monkeypatch
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/Cheetah-py2.5.py
--- a/scripts/scramble/scripts/Cheetah-py2.5.py Tue Nov 10 13:46:53 2009 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,55 +0,0 @@
-import os, sys, shutil
-
-# change back to the build dir
-if os.path.dirname( sys.argv[0] ) != "":
- os.chdir( os.path.dirname( sys.argv[0] ) )
-
-# find setuptools
-scramble_lib = os.path.join( "..", "..", "..", "lib" )
-sys.path.append( scramble_lib )
-from ez_setup import use_setuptools
-use_setuptools( download_delay=8, to_dir=scramble_lib )
-from setuptools import *
-
-# get the tag
-if os.access( ".galaxy_tag", os.F_OK ):
- tagfile = open( ".galaxy_tag", "r" )
- tag = tagfile.readline().strip()
-else:
- tag = None
-
-# in case you're running this by hand from a dirty module source dir
-for dir in [ "build", "dist" ]:
- if os.access( dir, os.F_OK ):
- print "scramble_it.py: removing dir:", dir
- shutil.rmtree( dir )
-
-# patch
-for file in [ "src/NameMapper.py", "src/Tests/NameMapper.py" ]:
- if not os.access( "%s.orig" %file, os.F_OK ):
- print "scramble_it(): Patching", file
- shutil.copyfile( file, "%s.orig" %file )
- i = open( "%s.orig" %file, "r" )
- o = open( file, "w" )
- for line in i.readlines():
- if line.startswith("__author__ ="):
- print >>o, "from __future__ import generators"
- elif line == "from __future__ import generators\n":
- continue
- print >>o, line,
- i.close()
- o.close()
-
-# reset args for distutils
-me = sys.argv[0]
-sys.argv = [ me ]
-sys.argv.append( "egg_info" )
-if tag is not None:
- #sys.argv.append( "egg_info" )
- sys.argv.append( "--tag-build=%s" %tag )
-# svn revision (if any) is handled directly in tag-build
-sys.argv.append( "--no-svn-revision" )
-sys.argv.append( "bdist_egg" )
-
-# do it
-execfile( "setup.py", globals(), locals() )
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/Cheetah.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/scripts/scramble/scripts/Cheetah.py Tue Nov 10 13:47:34 2009 -0500
@@ -0,0 +1,62 @@
+import os, sys, shutil
+
+# change back to the build dir
+if os.path.dirname( sys.argv[0] ) != "":
+ os.chdir( os.path.dirname( sys.argv[0] ) )
+
+# find setuptools
+scramble_lib = os.path.join( "..", "..", "..", "lib" )
+sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
+from ez_setup import use_setuptools
+use_setuptools( download_delay=8, to_dir=scramble_lib )
+from setuptools import *
+
+# get the tag
+if os.access( ".galaxy_tag", os.F_OK ):
+ tagfile = open( ".galaxy_tag", "r" )
+ tag = tagfile.readline().strip()
+else:
+ tag = None
+
+# in case you're running this by hand from a dirty module source dir
+for dir in [ "build", "dist" ]:
+ if os.access( dir, os.F_OK ):
+ print "scramble_it.py: removing dir:", dir
+ shutil.rmtree( dir )
+
+# patch
+file = "SetupConfig.py"
+if not os.access( "%s.orig" %file, os.F_OK ):
+ print "scramble.py(): Patching", file
+ shutil.copyfile( file, "%s.orig" %file )
+ i = open( "%s.orig" %file, "r" )
+ o = open( file, "w" )
+ comment = False
+ for line in i.readlines():
+ if line == " install_requires = [\n":
+ comment = True
+ print >>o, "#" + line,
+ elif comment and line == " ]\n":
+ comment = False
+ print >>o, "#" + line,
+ elif comment:
+ print >>o, "#" + line,
+ else:
+ print >>o, line,
+ i.close()
+ o.close()
+
+# reset args for distutils
+me = sys.argv[0]
+sys.argv = [ me ]
+sys.argv.append( "egg_info" )
+if tag is not None:
+ #sys.argv.append( "egg_info" )
+ sys.argv.append( "--tag-build=%s" %tag )
+# svn revision (if any) is handled directly in tag-build
+sys.argv.append( "--no-svn-revision" )
+sys.argv.append( "bdist_egg" )
+
+# do it
+execfile( "setup.py", globals(), locals() )
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/DRMAA_python.py
--- a/scripts/scramble/scripts/DRMAA_python.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/DRMAA_python.py Tue Nov 10 13:47:34 2009 -0500
@@ -12,6 +12,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
try:
from setuptools import *
import pkg_resources
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/MySQL_python.py
--- a/scripts/scramble/scripts/MySQL_python.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/MySQL_python.py Tue Nov 10 13:47:34 2009 -0500
@@ -57,6 +57,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
from ez_setup import use_setuptools
use_setuptools( download_delay=8, to_dir=scramble_lib )
from setuptools import *
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/generic.py
--- a/scripts/scramble/scripts/generic.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/generic.py Tue Nov 10 13:47:34 2009 -0500
@@ -7,6 +7,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
from ez_setup import use_setuptools
use_setuptools( download_delay=8, to_dir=scramble_lib )
from setuptools import *
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/pbs_python.py
--- a/scripts/scramble/scripts/pbs_python.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/pbs_python.py Tue Nov 10 13:47:34 2009 -0500
@@ -12,6 +12,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
try:
from setuptools import *
import pkg_resources
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/psycopg2.py
--- a/scripts/scramble/scripts/psycopg2.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/psycopg2.py Tue Nov 10 13:47:34 2009 -0500
@@ -59,6 +59,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
try:
from setuptools import *
import pkg_resources
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/pysqlite.py
--- a/scripts/scramble/scripts/pysqlite.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/pysqlite.py Tue Nov 10 13:47:34 2009 -0500
@@ -21,6 +21,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
try:
from setuptools import *
import pkg_resources
diff -r facf315d9e0e -r c146726d274f scripts/scramble/scripts/python_lzo.py
--- a/scripts/scramble/scripts/python_lzo.py Tue Nov 10 13:46:53 2009 -0500
+++ b/scripts/scramble/scripts/python_lzo.py Tue Nov 10 13:47:34 2009 -0500
@@ -54,6 +54,7 @@
# find setuptools
scramble_lib = os.path.join( "..", "..", "..", "lib" )
sys.path.append( scramble_lib )
+import get_platform # fixes fat python 2.5
try:
from setuptools import *
import pkg_resources
diff -r facf315d9e0e -r c146726d274f tools/filters/joiner.xml
--- a/tools/filters/joiner.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/filters/joiner.xml Tue Nov 10 13:47:34 2009 -0500
@@ -52,24 +52,25 @@
<configfiles>
<configfile name="fill_options_file"><%
import simplejson
-%>#set $__fill_options = {}
+%>
+#set $__fill_options = {}
#if $fill_empty_columns['fill_empty_columns_switch'] == 'fill_empty':
-#set $__fill_options['fill_unjoined_only'] = $fill_empty_columns['fill_columns_by'].value == 'fill_unjoined_only'
-#if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'single_fill_value':
-#set $__start_fill = $fill_empty_columns['do_fill_empty_columns']['fill_value'].value
-#else:
-#set $__start_fill = ""
-#end if
-#set $__fill_options['file1_columns'] = [ $__start_fill for i in range( int( $input1.metadata.columns ) ) ]
-#set $__fill_options['file2_columns'] = [ $__start_fill for i in range( int( $input2.metadata.columns ) ) ]
-#if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'fill_value_by_column':
-#for column_fill1 in $fill_empty_columns['do_fill_empty_columns']['column_fill1']:
-#set $__fill_options['file1_columns'][ int( column_fill1['column_number1'].value ) - 1 ] = column_fill1['fill_value1'].value
-#end for
-#for column_fill2 in $fill_empty_columns['do_fill_empty_columns']['column_fill2']:
-#set $__fill_options['file2_columns'][ int( column_fill2['column_number2'].value ) - 1 ] = column_fill2['fill_value2'].value
-#end for
-#end if
+ #set $__fill_options['fill_unjoined_only'] = $fill_empty_columns['fill_columns_by'].value == 'fill_unjoined_only'
+ #if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'single_fill_value':
+ #set $__start_fill = $fill_empty_columns['do_fill_empty_columns']['fill_value'].value
+ #else:
+ #set $__start_fill = ""
+ #end if
+ #set $__fill_options['file1_columns'] = [ __start_fill for i in range( int( $input1.metadata.columns ) ) ]
+ #set $__fill_options['file2_columns'] = [ __start_fill for i in range( int( $input2.metadata.columns ) ) ]
+ #if $fill_empty_columns['do_fill_empty_columns']['column_fill_type'] == 'fill_value_by_column':
+ #for column_fill1 in $fill_empty_columns['do_fill_empty_columns']['column_fill1']:
+ #set $__fill_options['file1_columns'][ int( column_fill1['column_number1'].value ) - 1 ] = column_fill1['fill_value1'].value
+ #end for
+ #for column_fill2 in $fill_empty_columns['do_fill_empty_columns']['column_fill2']:
+ #set $__fill_options['file2_columns'][ int( column_fill2['column_number2'].value ) - 1 ] = column_fill2['fill_value2'].value
+ #end for
+ #end if
#end if
${simplejson.dumps( __fill_options )}
</configfile>
diff -r facf315d9e0e -r c146726d274f tools/maf/genebed_maf_to_fasta.xml
--- a/tools/maf/genebed_maf_to_fasta.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/maf/genebed_maf_to_fasta.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,8 +1,9 @@
<tool id="GeneBed_Maf_Fasta2" name="Stitch Gene blocks" version="1.0.1">
<description>given a set of coding exon intervals</description>
- <command interpreter="python">#if $maf_source_type.maf_source == "user":#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
-#else:#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
-#end if# --overwrite_with_gaps=$overwrite_with_gaps
+ <command interpreter="python">
+ #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
+ #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
+ #end if# --overwrite_with_gaps=$overwrite_with_gaps
</command>
<inputs>
<param name="input1" type="data" format="bed" label="Gene BED File">
diff -r facf315d9e0e -r c146726d274f tools/maf/interval2maf.xml
--- a/tools/maf/interval2maf.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/maf/interval2maf.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,11 +1,11 @@
<tool id="Interval2Maf1" name="Extract MAF blocks" version="1.0.1">
<description>given a set of genomic intervals</description>
<command interpreter="python">
- #if $maf_source_type.maf_source == "user":#interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
- #else:#interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
- #end if
- --split_blocks_by_species=$split_blocks_by_species_selector.split_blocks_by_species
- #if $split_blocks_by_species_selector.split_blocks_by_species == "split_blocks_by_species":# --remove_all_gap_columns=$split_blocks_by_species_selector.remove_all_gap_columns
+ #if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
+ #else #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
+ #end if# --split_blocks_by_species=$split_blocks_by_species_selector.split_blocks_by_species
+ #if $split_blocks_by_species_selector.split_blocks_by_species == "split_blocks_by_species"#
+ --remove_all_gap_columns=$split_blocks_by_species_selector.remove_all_gap_columns
#end if
</command>
<inputs>
diff -r facf315d9e0e -r c146726d274f tools/maf/interval_maf_to_merged_fasta.xml
--- a/tools/maf/interval_maf_to_merged_fasta.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/maf/interval_maf_to_merged_fasta.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,8 +1,9 @@
<tool id="Interval_Maf_Merged_Fasta2" name="Stitch MAF blocks" version="1.0.1">
<description>given a set of genomic intervals</description>
- <command interpreter="python">#if $maf_source_type.maf_source == "user":#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
-#else:#interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
-#end if# --overwrite_with_gaps=$overwrite_with_gaps
+ <command interpreter="python">
+ #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
+ #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
+ #end if# --overwrite_with_gaps=$overwrite_with_gaps
</command>
<inputs>
<page>
diff -r facf315d9e0e -r c146726d274f tools/maf/maf_to_fasta.xml
--- a/tools/maf/maf_to_fasta.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/maf/maf_to_fasta.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,9 +1,9 @@
<tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1">
<description>Converts a MAF formated file to FASTA format</description>
<command interpreter="python">
- #if $fasta_target_type.fasta_type == "multiple":#maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks
- #else:#maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1
- #end if
+ #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks
+ #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1
+ #end if#
</command>
<inputs>
<param format="maf" name="input1" type="data" label="MAF file to convert"/>
diff -r facf315d9e0e -r c146726d274f tools/metag_tools/blat_wrapper.xml
--- a/tools/metag_tools/blat_wrapper.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/metag_tools/blat_wrapper.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,10 +1,9 @@
<tool id="blat_wrapper" name="BLAT" version="1.0.0">
<description> compare sequencing reads against UCSC genome builds</description>
<command interpreter="python">
- #if $source.source_select=="database":#blat_wrapper.py 0 $source.dbkey $input_query $output1 $iden $tile_size $one_off
- #else:#blat_wrapper.py 1 $source.input_target $input_query $output1 $iden $tile_size $one_off
- #end if
- ${GALAXY_DATA_INDEX_DIR}
+ #if $source.source_select=="database" #blat_wrapper.py 0 $source.dbkey $input_query $output1 $iden $tile_size $one_off
+ #else #blat_wrapper.py 1 $source.input_target $input_query $output1 $iden $tile_size $one_off
+ #end if# ${GALAXY_DATA_INDEX_DIR}
</command>
<inputs>
<conditional name="source">
diff -r facf315d9e0e -r c146726d274f tools/metag_tools/shrimp_color_wrapper.xml
--- a/tools/metag_tools/shrimp_color_wrapper.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/metag_tools/shrimp_color_wrapper.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,9 +1,9 @@
<tool id="shrimp_color_wrapper" name="SHRiMP for Color-space" version="1.0.0">
<description>reads mapping against reference sequence </description>
<command interpreter="python">
- #if $param.skip_or_full=="skip":#shrimp_color_wrapper.py $input_target $input_query $output1
- #else #shrimp_color_wrapper.py $input_target $input_query $output1 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_crossover_penalty $param.sw_full_hit_threshold $param.sw_vector_hit_threshold
- #end if
+ #if $param.skip_or_full=="skip" #shrimp_color_wrapper.py $input_target $input_query $output1
+ #else #shrimp_color_wrapper.py $input_target $input_query $output1 $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_crossover_penalty $param.sw_full_hit_threshold $param.sw_vector_hit_threshold
+ #end if#
</command>
<inputs>
<page>
diff -r facf315d9e0e -r c146726d274f tools/metag_tools/shrimp_wrapper.xml
--- a/tools/metag_tools/shrimp_wrapper.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/metag_tools/shrimp_wrapper.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,11 +1,11 @@
<tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0">
<description>reads mapping against reference sequence </description>
<command interpreter="python">
- #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $input_target $output1 $output2 $input_query
- #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip"):#shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size
- #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full"):#shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
- #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full"):#shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
- #end if
+ #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query
+ #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size
+ #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
+ #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
+ #end if#
</command>
<inputs>
<page>
diff -r facf315d9e0e -r c146726d274f tools/samtools/pileup_parser.xml
--- a/tools/samtools/pileup_parser.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/samtools/pileup_parser.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,10 +1,10 @@
<tool id="pileup_parser" name="Filter pileup">
<description>on coverage and SNPs</description>
<command interpreter="perl">
- #if $pileup_type.type_select == "six": #pileup_parser.pl $input "3" "5" "6" "4" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1
- #elif $pileup_type.type_select == "ten": #pileup_parser.pl $input "3" "9" "10" "8" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1
- #elif $pileup_type.type_select == "manual": #pileup_parser.pl $input $pileup_type.ref_base_column $pileup_type.read_bases_column $pileup_type.read_qv_column $pileup_type.cvrg_column $qv_cutoff $cvrg_cutoff $snps_only $interval $pileup_type.coord_column $out_file1
- #end if
+ #if $pileup_type.type_select == "six" #pileup_parser.pl $input "3" "5" "6" "4" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1
+ #elif $pileup_type.type_select == "ten" #pileup_parser.pl $input "3" "9" "10" "8" $qv_cutoff $cvrg_cutoff $snps_only $interval "2" $out_file1
+ #elif $pileup_type.type_select == "manual" #pileup_parser.pl $input $pileup_type.ref_base_column $pileup_type.read_bases_column $pileup_type.read_qv_column $pileup_type.cvrg_column $qv_cutoff $cvrg_cutoff $snps_only $interval $pileup_type.coord_column $out_file1
+ #end if#
</command>
<inputs>
<param name="input" type="data" format="tabular" label="Select dataset"/>
diff -r facf315d9e0e -r c146726d274f tools/sr_mapping/lastz_wrapper.xml
--- a/tools/sr_mapping/lastz_wrapper.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/sr_mapping/lastz_wrapper.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,15 +1,15 @@
<tool id="lastz_wrapper_1" name="Lastz" version="1.0.0">
<description> map short reads against reference sequence</description>
<command>
- #if ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="diffs"):#lastz $input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs"):#lastz $seq_name.ref_name::$input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="diffs"):#lastz $input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs"):#lastz $seq_name.ref_name::$input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="maf"):#lastz $input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf"):#lastz $seq_name.ref_name::$input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="maf"):#lastz $input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf"):#lastz $seq_name.ref_name::$input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
- #end if
+ #if ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="diffs") #lastz $input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs") #lastz $seq_name.ref_name::$input1 ${input2}[fullnames] --${params.pre_set_options} --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="diffs") #lastz $input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="diffs") #lastz $seq_name.ref_name::$input1 ${input2}[fullnames] $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --nolaj --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="No" and $out_format.value=="maf") #lastz $input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="pre_set" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf") #lastz $seq_name.ref_name::$input1 read::${input2} --${params.pre_set_options} --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="full" and $seq_name.how_to_name=="No" and $out_format.value=="maf") #lastz $input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #elif ($params.source_select=="full" and $seq_name.how_to_name=="Yes" and $out_format.value=="maf") #lastz $seq_name.ref_name::$input1 read::${input2} $params.strand $params.seed $params.transition O=$params.O E=$params.E X=$params.X Y=$params.Y K=$params.K L=$params.L $params.entropy --ambiguousn --identity=${min_ident}..${max_ident} --census32=$output2 --coverage=$min_cvrg --format=$out_format > $output1
+ #end if#
</command>
<inputs>
<param name="input2" format="fasta" type="data" label="Align sequencing reads" />
diff -r facf315d9e0e -r c146726d274f tools/stats/aggregate_binned_scores_in_intervals.xml
--- a/tools/stats/aggregate_binned_scores_in_intervals.xml Tue Nov 10 13:46:53 2009 -0500
+++ b/tools/stats/aggregate_binned_scores_in_intervals.xml Tue Nov 10 13:47:34 2009 -0500
@@ -1,9 +1,9 @@
<tool id="aggregate_scores_in_intervals2" description="such as phastCons, GERP, binCons, and others for a set of genomic intervals" name="Aggregate datapoints" version="1.1.2">
<description>Appends the average, min, max of datapoints per interval</description>
<command interpreter="python">
- #if $score_source_type.score_source == "user":#aggregate_scores_in_intervals.py $score_source_type.input2 $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 --chrom_buffer=3
- #else:#aggregate_scores_in_intervals.py $score_source_type.datasets $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 -b
- #end if
+ #if $score_source_type.score_source == "user" #aggregate_scores_in_intervals.py $score_source_type.input2 $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 --chrom_buffer=3
+ #else #aggregate_scores_in_intervals.py $score_source_type.datasets $input1 ${input1.metadata.chromCol} ${input1.metadata.startCol} ${input1.metadata.endCol} $out_file1 -b
+ #end if#
</command>
<inputs>
<param format="interval" name="input1" type="data" label="Interval file">
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/7698e2ecca3e
changeset: 2999:7698e2ecca3e
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Tue Nov 10 13:06:20 2009 -0500
description:
Fixed megablast_wrapper test to use phiX database and modified parameter passing to use named parameters
diffstat:
test-data/megablast_wrapper_test1.fa | 200 +++------------------------------
test-data/megablast_wrapper_test1.out | 123 +++-----------------
tools/metag_tools/megablast_wrapper.py | 35 ++++-
tools/metag_tools/megablast_wrapper.xml | 14 ++-
4 files changed, 78 insertions(+), 294 deletions(-)
diffs (446 lines):
diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.fa
--- a/test-data/megablast_wrapper_test1.fa Tue Nov 10 12:35:00 2009 -0500
+++ b/test-data/megablast_wrapper_test1.fa Tue Nov 10 13:06:20 2009 -0500
@@ -1,200 +1,40 @@
>0_0.666667
-CGGACAGCGCCGCCACCAACAAAGCCACCA
+GAGTTTTATCGCTTCCATGACGCAGAAGTT
>1_0.600000
-AAAACACCGGATGCTCCGGCGCTGGCAGAT
+AACACTTTCGGATATTTCTGATGAGTCGAA
>2_0.400000
-TTTGCTTTTAGTACACCGGATTCAGAACCA
+AGCAGGAATTACTACTGCTTGTTTACGAAT
>3_0.566667
-CCGTCCCCATGAATACACCTTTCTGGACGG
+TAAATCGAAGTGGACTGCTGGCGGAAAATG
>4_0.766667
-CACGCTACGTGCGCCCCCGCCCAGAAGGCG
+TCCTTGCGCAGCTCGAGAAGCTCTTACTTT
>5_0.533333
-AAACAAAACCCGCCGAAGCGGGTTAAGTGC
+GCGACCTTTCGCCATCAACTAACGATTCTG
>6_0.533333
-TAAGCCGTTACTGGCAGCAAGTGCAGGCAA
+TTGGATGAGGAGAAGTGGCTTAATATGCTT
>7_0.400000
-TGAATTTACCGTTATCTATCTTGCCTGCCT
+GGCACGTTCGTCAAGGACTGGTTTAGATAT
>8_0.500000
-TTAGCGGGAATAAAACAGGCTGTCAGCCAG
+CATGGTAGAGATTCTCTTGTTGACATTTTA
>9_0.400000
-GCGTTTTGCTAAACTTCTGCCGGAATATAA
+AAAGAGCGTGGATTACTATCTGAGTCCGAT
>10_0.500000
-AAAGAGGCGAGCAGAGTAAAACGCAGGCAA
+ATAGGTAAGAAATCATGAGTCAAGTTACTG
>11_0.533333
-CAAAAGCAGAGTCTGTTGACCCATACGCGC
+AACAATCCGTACGTTTCCAGACCGCTTTGG
>12_0.700000
-GCGGACGATCTTCACGGTCGCCACGCGGAC
+TTCAGGCTTCTGCCGTTTTGGATTTAACCG
>13_0.533333
-TTCTTGTTGGATGGCATACTCCGGCAGCCA
+AAGATGATTTCGATTTTCTGACGAGTAACA
>14_0.666667
-ACCCCGATATCGTCGCAGGCGTTGCCGCAC
+CTGACCGCTCTCGTGCTCGTCGCTGCGTTG
>15_0.666667
-GGCTGCTGTCTCCGCTGGAAGAGGCGCTTC
+AGGCTTGCGTTTATGGTACGCTGGACTTTG
>16_0.566667
-ATGTCCTGATCGAGCGGCGTTTTACCGACC
+TTCCTGCTCCTGTTGAGTTTATTGCTGCCG
>17_0.533333
-GGTGTTGAGTGTCCAGGTAATACGCTCTCG
+TCATTGCTTATTATGTTCATCCCGTCAACA
>18_0.566667
-GTGGTCTCAAGCCCAAAGGAAGAGTGAGGC
+TCATCATGGAAGGCGCTGAATTTACGGAAA
>19_0.566667
-GTTGTAAGCGTCAGAACCGATGCGGTCGGT
->20_0.566667
-CGACATCCTGTAGGCTGGCTTCAATGCGAC
->21_0.733333
-GGGAAGGCTGACGGGCGTCCACACCACGGC
->22_0.566667
-CGGTATTCCTCAGTTCTCGCTGCATGCCTG
->23_0.600000
-TTGCCGTTACGCACCACGCCTTCAGTAGCG
->24_0.733333
-CGCGGGCGCACCACGTCGCTGCTGCTGTTC
->25_0.266667
-TTTTGGGAAAACTAAATACGCATCAAAAAT
->26_0.566667
-CAACGAGGCGCTACCGAGTTGTTCAATGCG
->27_0.600000
-TTACCGAGGCCAGAACCGATACCACGACCC
->28_0.666667
-CGCTCAATCTGCTCGCGCCTGGCTGGCGTT
->29_0.700000
-CTCGTCCGGCGGGCGGTTTTGCCGACAAGG
->30_0.233333
-GGAAATTGTACAATAGAAAAATTACTGTAT
->31_0.533333
-GTGCTGAACTGTTCCACGACCATGGAGATG
->32_0.600000
-TGAGGATGGTCCTCTGACTCTGCAGGCGCA
->33_0.300000
-TAGTAACCCTTTAATAAGATTGTCGATTAG
->34_0.533333
-TGATGTTAAATGCATGGCACCTGCCGGTGC
->35_0.466667
-ACTGCTTTGCCGAGATATTCGAGGTTAACC
->36_0.433333
-TGTTGGCAACATGGCGAGCGTAATCAATTA
->37_0.366667
-ACTTCGTCAGTAAGGATGAGATTAGCAAAT
->38_0.533333
-GCAGCAGGATCGGATCGAACTCTGGTTTCT
->39_0.400000
-TAATGCGGCATTCTCCTGATTTATTGTCAC
->40_0.400000
-AGCGTAATGATAATCGCTATCACTGCGATT
->41_0.566667
-AGCTGACGGTCAGCAGGGATACTTCCTGCA
->42_0.566667
-GCAGTGACTACATCCGCGAGGTGAATGTGG
->43_0.466667
-GCTTTTTCCAGCATCAACGCCACTGAACAA
->44_0.433333
-AAAGTGGTAGATAACGTGGTGCAGACTATG
->45_0.500000
-TTCCTGATACCGGATGACCTTATCGCGGAT
->46_0.466667
-ACCTGTACCCCAGGACCATGGTACATTTAT
->47_0.533333
-ACAATGCAACCAGACCAGCCCGGATCGATA
->48_0.500000
-GGGTAACCAGCTGATGATGGCCATTAACCT
->49_0.433333
-CGTTATACGGAACAACATTTAACTCCAGCG
->50_0.466667
-TTGCTGTTGCCATCGCTTTTCAGGACATAC
->51_0.533333
-CGACGGTATCGGTACGCAGATTGTGATGGA
->52_0.366667
-ATGAGCATCAACATCGAAATCTCAAACCAA
->53_0.533333
-CCAGGCACTCCGCCATATTTTTGCCATGAC
->54_0.400000
-GTATTCTTCATTGATTTGTAAGCGGGTACC
->55_0.466667
-AAGCGCTGTTCAACATAAATTGGCTGACGG
->56_0.433333
-AACCGTCAGCTCTTTACGCAATATTTTGCC
->57_0.566667
-CGCGAAATCCTCGACGTCCAGGCACGTATT
->58_0.300000
-GTTATCCATTAAAATAGATCGGATCGATAT
->59_0.300000
-AAAATCTGCATATCATGATAAGAGTGGTTA
->60_0.533333
-AATCTGGCGAATGCTGATAGCGTGACCGGT
->61_0.366667
-TCAGTTTGAAAGCTTTGTCAGCCGTTTTTT
->62_0.366667
-AATCCTAAACCTAGGAATGCCAGAATATCT
->63_0.566667
-TCACGCTCGCAGTCAAGCTGGCTTATGCCA
->64_0.500000
-GAGATGACGGTTGCAGAGTCATGCGTTTGA
->65_0.533333
-TCTGGATCACGCGCAAACACTGGCTATCGT
->66_0.466667
-TCTGCTTTAGCAAACAGAGTGTGGTCACGA
->67_0.400000
-GCCTTTTGTCTGATCATCCACAATAATGAC
->68_0.566667
-GAAGGATAGTTGGTCAGCAACACCAGCGGC
->69_0.733333
-GGCGCGCTGTCGGCCACGGCGAAATCGACC
->70_0.466667
-TGGTGTTCAGCATCTCAACGGTAATTCGCT
->71_0.533333
-CAGGATGCAAACTGCCGGGAGATCCAGTTA
->72_0.533333
-AACTGGAAGGGCTTGGGATGACACAACAGC
->73_0.500000
-TTTAAGCGCCAACCAGGCTTCTTTGGTTGC
->74_0.433333
-ACCCTTCTTTCGCCATATCAAACTGATGTC
->75_0.533333
-ATAACCCTCTGCAACCGCCGCTTCAGCAAA
->76_0.600000
-TGAAGCCGTACAACGGGCGCTGGAATTCGC
->77_0.700000
-GAGCTGCAACGCGGTCAGCCAGCTGGCGGT
->78_0.566667
-CGGAGTATCCGTTCCCCAACGACAAGCATC
->79_0.500000
-AATACCGGGAAGAGACAACGGGGTCTCTTT
->80_0.500000
-TAATGACAGGGTTGCGAAGCCCTGATTCTC
->81_0.433333
-ATTAATGTTGCCGGCACAACATAATAGGGC
->82_0.500000
-ACTGGGTTGCTCTGAACAAGAAAGGCGCTA
->83_0.533333
-CGCCAGGGACGTATCGCGTCGATATCTATT
->84_0.533333
-TGCTCGTTCCCGTCGTGATGAAGCTCGAAA
->85_0.500000
-AGGAAAGCAAACAACACGACCACCATCAGC
->86_0.566667
-GGCAACGCAGGCGCATGATTCTGCTTGGAA
->87_0.433333
-CGCTGGATGAAAANCGTGAATATCACACCA
->88_0.533333
-CGTACCGGGCTGAAAGTAGAAGAGCGTTTC
->89_0.466667
-ATTAAAAAACAGGCGGTGCGTTTTCCCTGG
->90_0.466667
-ATCACCGTTTCGCTAACCGGTACGTTTAAC
->91_0.566667
-TTCGCCCGGCAAGCTTACCCAACGCTTATC
->92_0.533333
-TTTTCCCCGCCGTTAGTAGCGACTGCAGTT
->93_0.400000
-TTATTTGCCCGATGAGTCAGTTTATTGCAG
->94_0.466667
-CCACGGTGATATCTGGTGCCATACTGATAA
->95_0.466667
-TCCCCCGTAAGGCCTTTCTTTTTCTTTCGT
->96_0.533333
-TTGCCGGGAAGAGAGATATCAATGGCAGGC
->97_0.566667
-TGCGCCGCCGGATTGTTGCTCAACATGCTT
->98_0.366667
-AACGCGCTAACCGCCAATAATAACAAAATT
->99_0.366667
-TAAGAGTTTATTCATGATGTCATCCTGCGA
+ACATTATTAATGGCGTCGAGCGTCCGGTTA
\ No newline at end of file
diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.out
--- a/test-data/megablast_wrapper_test1.out Tue Nov 10 12:35:00 2009 -0500
+++ b/test-data/megablast_wrapper_test1.out Tue Nov 10 13:06:20 2009 -0500
@@ -1,103 +1,20 @@
-0_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5436010 5436039 8e-11 60.0
-1_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 696993 697022 8e-11 60.0
-2_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4100018 4100047 8e-11 60.0
-3_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2305873 2305844 8e-11 60.0
-4_0.766667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3457901 3457930 8e-11 60.0
-5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1264160 1264131 8e-11 60.0
-5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1636514 1636485 8e-11 60.0
-5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2318694 2318723 8e-11 60.0
-5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2777043 2777072 8e-11 60.0
-6_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1185124 1185153 8e-11 60.0
-7_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2458203 2458232 8e-11 60.0
-9_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5286666 5286695 8e-11 60.0
-10_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2787672 2787701 8e-11 60.0
-12_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4116145 4116174 8e-11 60.0
-13_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5442351 5442380 8e-11 60.0
-14_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4626492 4626521 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 346897 346926 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1466565 1466536 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1750132 1750161 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1908046 1908075 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2279107 2279136 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2813407 2813436 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3939162 3939191 8e-11 60.0
-15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4656510 4656539 8e-11 60.0
-16_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2595157 2595186 8e-11 60.0
-17_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 717743 717772 8e-11 60.0
-19_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1237938 1237967 8e-11 60.0
-20_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4792054 4792083 8e-11 60.0
-21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 269757 269786 8e-11 60.0
-21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 274007 274036 8e-11 60.0
-22_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2706426 2706455 8e-11 60.0
-23_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1512107 1512136 8e-11 60.0
-24_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2032108 2032137 8e-11 60.0
-25_0.266667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1343811 1343840 8e-11 60.0
-26_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3112551 3112580 8e-11 60.0
-28_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4405442 4405471 8e-11 60.0
-29_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3600547 3600576 8e-11 60.0
-32_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1435670 1435699 8e-11 60.0
-33_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3788178 3788207 8e-11 60.0
-34_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 484499 484528 8e-11 60.0
-35_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2250064 2250093 8e-11 60.0
-36_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3698178 3698207 8e-11 60.0
-38_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4242501 4242530 8e-11 60.0
-39_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3683151 3683180 8e-11 60.0
-41_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 789086 789115 8e-11 60.0
-42_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1714771 1714800 8e-11 60.0
-43_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4272582 4272611 8e-11 60.0
-44_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5481023 5481052 8e-11 60.0
-45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1271858 1271829 8e-11 60.0
-45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1357981 1357952 8e-11 60.0
-45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2310674 2310703 8e-11 60.0
-45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2769319 2769348 8e-11 60.0
-45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2991293 2991322 8e-11 60.0
-46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1080570 1080599 8e-11 60.0
-46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1476177 1476206 8e-11 60.0
-47_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2887871 2887900 8e-11 60.0
-49_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4152853 4152882 8e-11 60.0
-50_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3568677 3568706 8e-11 60.0
-51_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3739788 3739817 8e-11 60.0
-52_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3789407 3789436 8e-11 60.0
-54_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3161991 3162020 8e-11 60.0
-55_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4384753 4384782 8e-11 60.0
-56_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2915787 2915816 8e-11 60.0
-57_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 294604 294633 8e-11 60.0
-58_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1553483 1553512 8e-11 60.0
-59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1351506 1351535 8e-11 60.0
-59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2997487 2997458 8e-11 60.0
-61_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1987157 1987186 8e-11 60.0
-62_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1667830 1667859 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 231447 231418 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3516862 3516891 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4226650 4226679 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4808486 4808457 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4904764 4904735 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5048944 5048915 8e-11 60.0
-63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5089951 5089922 8e-11 60.0
-64_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5440369 5440398 8e-11 60.0
-65_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3963858 3963887 8e-11 60.0
-66_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4142497 4142526 8e-11 60.0
-67_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3532236 3532265 8e-11 60.0
-68_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 779994 780023 8e-11 60.0
-70_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1317239 1317268 8e-11 60.0
-71_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5080463 5080492 8e-11 60.0
-72_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3605409 3605438 8e-11 60.0
-73_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3280815 3280844 8e-11 60.0
-75_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2230266 2230295 8e-11 60.0
-76_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 462631 462660 8e-11 60.0
-77_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2939076 2939105 8e-11 60.0
-78_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5422053 5422082 8e-11 60.0
-79_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4387420 4387449 8e-11 60.0
-81_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1037150 1037179 8e-11 60.0
-82_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1182188 1182217 8e-11 60.0
-83_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5430210 5430239 8e-11 60.0
-84_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 310995 311024 8e-11 60.0
-85_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4174173 4174202 8e-11 60.0
-86_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 163690 163719 8e-11 60.0
-88_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3071785 3071814 8e-11 60.0
-90_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 692131 692160 8e-11 60.0
-91_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3307050 3307079 8e-11 60.0
-94_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1813009 1813038 8e-11 60.0
-96_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 573782 573811 8e-11 60.0
-97_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3570563 3570592 8e-11 60.0
-98_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4545136 4545165 8e-11 60.0
+0_0.666667 PHIX174 100.00 30 0 0 1 30 1 30 1e-13 60.0
+1_0.600000 PHIX174 100.00 30 0 0 1 30 31 60 1e-13 60.0
+2_0.400000 PHIX174 100.00 30 0 0 1 30 76 105 1e-13 60.0
+3_0.566667 PHIX174 100.00 30 0 0 1 30 106 135 1e-13 60.0
+4_0.766667 PHIX174 100.00 30 0 0 1 30 151 180 1e-13 60.0
+5_0.533333 PHIX174 100.00 30 0 0 1 30 181 210 1e-13 60.0
+6_0.533333 PHIX174 100.00 30 0 0 1 30 226 255 1e-13 60.0
+7_0.400000 PHIX174 100.00 30 0 0 1 30 256 285 1e-13 60.0
+8_0.500000 PHIX174 100.00 30 0 0 1 30 301 330 1e-13 60.0
+9_0.400000 PHIX174 100.00 30 0 0 1 30 331 360 1e-13 60.0
+10_0.500000 PHIX174 100.00 30 0 0 1 30 376 405 1e-13 60.0
+11_0.533333 PHIX174 100.00 30 0 0 1 30 406 435 1e-13 60.0
+12_0.700000 PHIX174 100.00 30 0 0 1 30 451 480 1e-13 60.0
+13_0.533333 PHIX174 100.00 30 0 0 1 30 481 510 1e-13 60.0
+14_0.666667 PHIX174 100.00 30 0 0 1 30 526 555 1e-13 60.0
+15_0.666667 PHIX174 100.00 30 0 0 1 30 556 585 1e-13 60.0
+16_0.566667 PHIX174 100.00 30 0 0 1 30 601 630 1e-13 60.0
+17_0.533333 PHIX174 100.00 30 0 0 1 30 631 660 1e-13 60.0
+18_0.566667 PHIX174 100.00 30 0 0 1 30 676 705 1e-13 60.0
+19_0.566667 PHIX174 100.00 30 0 0 1 30 706 735 1e-13 60.0
diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.py
--- a/tools/metag_tools/megablast_wrapper.py Tue Nov 10 12:35:00 2009 -0500
+++ b/tools/metag_tools/megablast_wrapper.py Tue Nov 10 13:06:20 2009 -0500
@@ -1,9 +1,24 @@
#! /usr/bin/python
"""
run megablast for metagenomics data
+
+usage: %prog [options]
+ -d, --db_build=d: The database to use
+ -i, --input=i: Input FASTQ candidate file
+ -w, --word_size=w: Size of best perfect match
+ -c, --identity_cutoff=c: Report hits at or above this identity
+ -e, --eval_cutoff=e: Expectation value cutoff
+ -f, --filter_query=f: Filter out low complexity regions
+ -x, --index_dir=x: Data index directory
+ -o, --output=o: Output file
+
+usage: %prog db_build input_file word_size identity_cutoff eval_cutoff filter_query index_dir output_file
"""
import sys, os, tempfile
+from galaxy import eggs
+import pkg_resources; pkg_resources.require( "bx-python" )
+from bx.cookbook import doc_optparse
assert sys.version_info[:2] >= ( 2, 4 )
@@ -12,16 +27,18 @@
sys.exit()
def __main__():
+ #Parse Command Line
+ options, args = doc_optparse.parse( __doc__ )
- db_build = sys.argv[1]
- query_filename = sys.argv[2].strip()
- output_filename = sys.argv[3].strip()
- mega_word_size = sys.argv[4] # -W
- mega_iden_cutoff = sys.argv[5] # -p
- mega_evalue_cutoff = sys.argv[6] # -e
+ db_build = options.db_build
+ query_filename = options.input.strip()
+ output_filename = options.output.strip()
+ mega_word_size = options.word_size # -W
+ mega_iden_cutoff = options.identity_cutoff # -p
+ mega_evalue_cutoff = options.eval_cutoff # -e
mega_temp_output = tempfile.NamedTemporaryFile().name
- mega_filter = sys.argv[7] # -F
- GALAXY_DATA_INDEX_DIR = sys.argv[8]
+ mega_filter = options.filter_query # -F
+ GALAXY_DATA_INDEX_DIR = options.index_dir
DB_LOC = "%s/blastdb.loc" % GALAXY_DATA_INDEX_DIR
# megablast parameters
@@ -81,7 +98,7 @@
output.write( "%s\n" % new_line )
output.close()
- os.unlink( mega_temp_output ) #remove the tempfile that we just reformated the contents of
+ os.unlink( mega_temp_output ) #remove the tempfile that we just reformatted the contents of
if invalid_lines:
print "Unable to parse %d lines. Keep the default format." % invalid_lines
diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.xml
--- a/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 12:35:00 2009 -0500
+++ b/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 13:06:20 2009 -0500
@@ -1,6 +1,16 @@
<tool id="megablast_wrapper" name="Megablast" version="1.0.0">
<description> compare short reads against nt and wgs databases</description>
- <command interpreter="python">megablast_wrapper.py $source_select $input_query $output1 $word_size $iden_cutoff $evalue_cutoff $filter_query ${GALAXY_DATA_INDEX_DIR}</command>
+ <command interpreter="python">
+ megablast_wrapper.py
+ --db_build=$source_select
+ --input=$input_query
+ --word_size=$word_size
+ --identity_cutoff=$iden_cutoff
+ --eval_cutoff=$evalue_cutoff
+ --filter_query=$filter_query
+ --index_dir=${GALAXY_DATA_INDEX_DIR}
+ --output=$output1
+ </command>
<inputs>
<param name="input_query" type="data" format="fasta" label="Compare these sequences"/>
<param name="source_select" type="select" display="radio" label="against target database">
@@ -29,7 +39,7 @@
<tests>
<test>
<param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/>
- <param name="source_select" value="test" />
+ <param name="source_select" value="phiX" />
<param name="word_size" value="28" />
<param name="iden_cutoff" value="99.0" />
<param name="evalue_cutoff" value="10.0" />
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/461407cd7013
changeset: 2996:461407cd7013
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 10:10:29 2009 -0500
description:
Don't display diff during tests if it contains non-ascii characters
diffstat:
test/base/twilltestcase.py | 4 ++++
1 files changed, 4 insertions(+), 0 deletions(-)
diffs (14 lines):
diff -r 9f485a539bfb -r 461407cd7013 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Mon Nov 09 23:00:55 2009 -0500
+++ b/test/base/twilltestcase.py Tue Nov 10 10:10:29 2009 -0500
@@ -59,6 +59,10 @@
diff_slice[6].startswith( '-/CreationDate' ) and diff_slice[7].startswith( '-/ModDate' ) \
and diff_slice[8].startswith( '+/CreationDate' ) and diff_slice[9].startswith( '+/ModDate' ):
return True
+ for line in diff_slice:
+ for char in line:
+ if ord( char ) > 128:
+ raise AssertionError( "Binary data detected, not displaying diff" )
raise AssertionError( "".join( diff_slice ) )
return True
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/e2420f742a0a
changeset: 2998:e2420f742a0a
user: rc
date: Tue Nov 10 12:35:00 2009 -0500
description:
Fixed a bug in the view requesttype page.
Now barcodes are visible in the request details page itself.
diffstat:
lib/galaxy/web/controllers/requests_admin.py | 12 ++++++------
templates/admin/requests/show_request.mako | 8 ++++----
templates/admin/requests/view_request_type.mako | 2 +-
test/functional/test_forms_and_requests.py | 5 +++--
4 files changed, 14 insertions(+), 13 deletions(-)
diffs (112 lines):
diff -r ee382d1c63b7 -r e2420f742a0a lib/galaxy/web/controllers/requests_admin.py
--- a/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 11:20:04 2009 -0500
+++ b/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 12:35:00 2009 -0500
@@ -1034,10 +1034,11 @@
event = trans.app.model.SampleEvent(s, new_state, 'Bar code added to this sample')
event.flush()
return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='bar_codes',
- request_id=request.id,
- msg='Bar codes have been saved for this request',
- messagetype='done'))
+ action='list',
+ operation='show_request',
+ id=trans.security.encode_id(request.id),
+ message='Bar codes have been saved for this request',
+ status='done'))
def __set_request_state(self, request):
# check if all the samples of the current request are in the final state
@@ -1183,11 +1184,10 @@
messagetype='done') )
elif params.get('view', False):
rt = trans.sa_session.query( trans.app.model.RequestType ).get( int( util.restore_text( params.id ) ) )
- ss_list = trans.sa_session.query( trans.app.model.SampleState ).filter( trans.app.model.SampleState.table.c.request_type_id == rt.id )
return trans.fill_template( '/admin/requests/view_request_type.mako',
request_type=rt,
forms=get_all_forms( trans ),
- states_list=ss_list,
+ states_list=rt.states,
deleted=False,
show_deleted=False,
msg=msg,
diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/show_request.mako
--- a/templates/admin/requests/show_request.mako Tue Nov 10 11:20:04 2009 -0500
+++ b/templates/admin/requests/show_request.mako Tue Nov 10 12:35:00 2009 -0500
@@ -1,12 +1,10 @@
<%inherit file="/base.mako"/>
<%namespace file="/message.mako" import="render_msg" />
-
%if msg:
${render_msg( msg, messagetype )}
%endif
-
<div class="grid-header">
<h2>Sequencing Request "${request.name}"</h2>
</div>
@@ -44,6 +42,8 @@
</td>
<td>
</td>
+ <td>
+ </td>
%else:
<td>
${sample_name}
@@ -80,11 +80,10 @@
${sample.name}
</td>
%if grid_index == 0:
+ <td>${sample.bar_code}</td>
<td>
%if sample.request.unsubmitted():
Unsubmitted
- %elif not sample.current_state():
- New
%else:
<a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a>
%endif
@@ -150,6 +149,7 @@
<th>No.</th>
<th>Sample Name</th>
%if grid_index == 0:
+ <th>Barcode</th>
<th>State</th>
%endif
%for index, field in fields_dict.items():
diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/view_request_type.mako
--- a/templates/admin/requests/view_request_type.mako Tue Nov 10 11:20:04 2009 -0500
+++ b/templates/admin/requests/view_request_type.mako Tue Nov 10 12:35:00 2009 -0500
@@ -36,7 +36,7 @@
<label>
Possible states
</label>
- %for element_count, state in enumerate(states_list.all()):
+ %for element_count, state in enumerate(states_list):
<div class="form-row">
<label>${1+element_count}. ${state.name}</label>
${state.desc}
diff -r ee382d1c63b7 -r e2420f742a0a test/functional/test_forms_and_requests.py
--- a/test/functional/test_forms_and_requests.py Tue Nov 10 11:20:04 2009 -0500
+++ b/test/functional/test_forms_and_requests.py Tue Nov 10 12:35:00 2009 -0500
@@ -245,7 +245,7 @@
self.check_page_for_string( request_one.name )
assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" \
% ( request_one.name, request_one.states.COMPLETE )
- def test_40_admin_create_request_on_behalf_of_regular_user( self ):
+ def test_040_admin_create_request_on_behalf_of_regular_user( self ):
"""Testing creating and submitting a request as an admin on behalf of a regular user"""
self.logout()
self.login( email='test(a)bx.psu.edu' )
@@ -288,7 +288,8 @@
self.visit_url( '%s/requests_admin/list?show_filter=All' % self.url )
self.check_page_for_string( request_one.name )
self.check_page_for_string( request_two.name )
- def test_45_reject_request( self ):
+ def test_045_reject_request( self ):
+ '''Testing rejecting a request'''
self.logout()
self.login( email='test(a)bx.psu.edu' )
self.reject_request( request_two.id, request_two.name )
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/ee382d1c63b7
changeset: 2997:ee382d1c63b7
user: Nate Coraor <nate(a)bx.psu.edu>
date: Tue Nov 10 11:20:04 2009 -0500
description:
Add env var to set metadata externally during tests
diffstat:
scripts/functional_tests.py | 4 ++++
1 files changed, 4 insertions(+), 0 deletions(-)
diffs (21 lines):
diff -r 461407cd7013 -r ee382d1c63b7 scripts/functional_tests.py
--- a/scripts/functional_tests.py Tue Nov 10 10:10:29 2009 -0500
+++ b/scripts/functional_tests.py Tue Nov 10 11:20:04 2009 -0500
@@ -71,6 +71,9 @@
default_cluster_job_runner = os.environ['GALAXY_TEST_DEF_RUNNER']
else:
default_cluster_job_runner = 'local:///'
+ set_metadata_externally = False
+ if 'GALAXY_SET_METADATA_EXTERNALLY' in os.environ:
+ set_metadata_externally = True
print "Database connection:", database_connection
@@ -104,6 +107,7 @@
admin_users = 'test(a)bx.psu.edu',
library_import_dir = galaxy_test_file_dir,
user_library_import_dir = os.path.join( galaxy_test_file_dir, 'users' ),
+ set_metadata_externally = set_metadata_externally,
global_conf = { "__file__": "universe_wsgi.ini.sample" } )
log.info( "Embedded Universe application started" );
1
0
12 Nov '09
details: http://www.bx.psu.edu/hg/galaxy/rev/facf315d9e0e
changeset: 3000:facf315d9e0e
user: jeremy goecks <jeremy.goecks at emory.edu>
date: Tue Nov 10 13:46:53 2009 -0500
description:
More grid-page integation work. Cleaned up clause generation in grid columns and finalized search for pages grid.
diffstat:
lib/galaxy/web/controllers/page.py | 19 ++++++++++---------
lib/galaxy/web/framework/helpers/grids.py | 32 ++++++++++++++++++--------------
templates/grid_common.mako | 17 +++++++++++++++--
3 files changed, 43 insertions(+), 25 deletions(-)
diffs (160 lines):
diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/controllers/page.py
--- a/lib/galaxy/web/controllers/page.py Tue Nov 10 13:06:20 2009 -0500
+++ b/lib/galaxy/web/controllers/page.py Tue Nov 10 13:46:53 2009 -0500
@@ -12,30 +12,31 @@
else:
return ""
-class PublicURLColumn( grids.GridColumn ):
+class PublicURLColumn( grids.TextColumn ):
def get_value( self, trans, grid, item ):
- username = trans.user.username or "???"
+ username = item.user.username or "???"
return username + "/" + item.slug
def get_link( self, trans, grid, item ):
- if trans.user.username:
+ if item.user.username:
return dict( action='display_by_username_and_slug', username=item.user.username, slug=item.slug )
else:
return None
-class OwnerColumn( grids.GridColumn ):
+class OwnerColumn( grids.TextColumn ):
def get_value( self, trans, grid, item ):
return item.user.username
class PageListGrid( grids.Grid ):
# Grid definition
use_panels = True
- title = "Your pages"
+ title = "Pages"
model_class = model.Page
+ default_filter = { "published" : "All"}
default_sort_key = "-create_time"
columns = [
grids.TextColumn( "Title", key="title", model_class=model.Page, attach_popup=True, filterable="standard" ),
PublicURLColumn( "Public URL" ),
- grids.GridColumn( "Published", key="published", format=format_bool, filterable="advanced" ),
+ grids.GridColumn( "Published", key="published", format=format_bool, filterable="standard" ),
grids.GridColumn( "Created", key="create_time", format=time_ago ),
grids.GridColumn( "Last Updated", key="update_time", format=time_ago ),
]
@@ -56,13 +57,13 @@
class PageAllPublishedGrid( grids.Grid ):
# Grid definition
use_panels = True
- title = "Published pages from all users"
+ title = "Published Pages From All Users"
model_class = model.Page
default_sort_key = "-create_time"
columns = [
- grids.GridColumn( "Title", key="title" ),
+ grids.TextColumn( "Title", model_class=model.Page, key="title", filterable="standard" ),
PublicURLColumn( "Public URL" ),
- OwnerColumn( "Published by" ),
+ OwnerColumn( "Published by", model_class=model.User, key="username" ),
grids.GridColumn( "Created", key="create_time", format=time_ago ),
grids.GridColumn( "Last Updated", key="update_time", format=time_ago ),
]
diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/framework/helpers/grids.py
--- a/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:06:20 2009 -0500
+++ b/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:46:53 2009 -0500
@@ -21,6 +21,7 @@
columns = []
operations = []
standard_filters = []
+ # Any columns that are filterable (either standard or advanced) should have a default value set in the default filter.
default_filter = {}
default_sort_key = None
preserve_state = False
@@ -320,10 +321,10 @@
if isinstance( column_filter, basestring ):
return func.lower( model_class_key_field ).like( "%" + column_filter.lower() + "%" )
elif isinstance( column_filter, list ):
- composite_filter = True
+ clause_list = []
for filter in column_filter:
- composite_filter = and_( composite_filter, func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) )
- return composite_filter
+ clause_list.append( func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) )
+ return and_( *clause_list )
# Generic column that supports tagging.
class TagsColumn( TextColumn ):
@@ -353,15 +354,15 @@
# Collapse list of tags into a single string; this is redundant but effective. TODO: fix this by iterating over tags.
column_filter = ",".join( column_filter )
raw_tags = tag_handler.parse_tags( column_filter.encode("utf-8") )
- filter = True
+ clause_list = []
for name, value in raw_tags.items():
if name:
# Search for tag names.
- filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) )
+ clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) )
if value:
# Search for tag values.
- filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) )
- return filter
+ clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) )
+ return and_( *clause_list )
# Column that performs multicolumn filtering.
class MulticolFilterColumn( TextColumn ):
@@ -373,17 +374,20 @@
if column_filter == "All":
return query
if isinstance( column_filter, list):
- composite_filter = True
+ clause_list = []
for filter in column_filter:
- part_composite_filter = False
+ part_clause_list = []
for column in self.cols_to_filter:
- part_composite_filter = or_( part_composite_filter, column.get_filter( filter ) )
- composite_filter = and_( composite_filter, part_composite_filter )
+ part_clause_list.append( column.get_filter( filter ) )
+ clause_list.append( or_( *part_clause_list ) )
+ complete_filter = and_( *clause_list )
else:
- composite_filter = False
+ clause_list = []
for column in self.cols_to_filter:
- composite_filter = or_( composite_filter, column.get_filter( column_filter ) )
- return query.filter( composite_filter )
+ clause_list.append( column.get_filter( column_filter ) )
+ complete_filter = or_( *clause_list )
+
+ return query.filter( complete_filter )
class GridOperation( object ):
def __init__( self, label, key=None, condition=None, allow_multiple=True, allow_popup=True, target=None, url_args=None ):
diff -r 7698e2ecca3e -r facf315d9e0e templates/grid_common.mako
--- a/templates/grid_common.mako Tue Nov 10 13:06:20 2009 -0500
+++ b/templates/grid_common.mako Tue Nov 10 13:46:53 2009 -0500
@@ -86,10 +86,23 @@
</table>
</td>
<td>
+ ## Clear the standard search.
##|
##<% filter_all = GridColumnFilter( "", { column.key : "All" } ) %>
- ##<a href="${url( filter_all.get_url_args() )}">Clear All</a>
- | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a>
+ ##<a href="${url( filter_all.get_url_args() )}">Clear All</a>
+
+ ## Only show advanced search if there are filterable columns.
+ <%
+ show_advanced_search = False
+ for column in grid.columns:
+ if column.filterable == "advanced":
+ show_advanced_search = True
+ break
+ endif
+ %>
+ %if show_advanced_search:
+ | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a>
+ %endif
</td>
</tr></table>
</div>
1
0