- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2689: Updated Bowtie wrapper tool to add a number of...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e58e140b89f7 changeset: 2689:e58e140b89f7 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Mon Sep 14 14:54:11 2009 -0400 description: Updated Bowtie wrapper tool to add a number of threads parameter and remove two unnecessary options 2 file(s) affected in this change: tools/sr_mapping/bowtie_wrapper.py tools/sr_mapping/bowtie_wrapper.xml diffs (198 lines): diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 12:23:16 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 14:54:11 2009 -0400 @@ -13,6 +13,7 @@ def __main__(): #Parse Command Line parser = optparse.OptionParser() + parser.add_option('', '--threads', dest='threads', help='The number of threads to run') parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format') parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format') parser.add_option('', '--output', dest='output', help='The output file') @@ -35,7 +36,6 @@ parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments') parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions") parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read') - parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode') parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable') parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments') parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments') @@ -45,7 +45,6 @@ parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand') parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time') parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n') - parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index') parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator') parser.add_option('', '--dbkey', dest='dbkey', help='') parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters') @@ -70,10 +69,10 @@ if options.genomeSource == 'history': # set up commands if options.index_settings =='index_pre_set': - indexing_cmds = '' + indexing_cmds = '--quiet' else: try: - indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s --quiet' % \ (('','--noauto')[options.iauto_b=='set'], ('','--packed')[options.ipacked=='packed'], ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1], @@ -88,7 +87,7 @@ ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0], ('','--oldpmap')[options.ioldpmap=='yes']) except ValueError: - indexing_cmds = '' + indexing_cmds = '--quiet' # make temp directory for placement of indices and copy reference file there tmp_dir = tempfile.gettempdir() @@ -97,7 +96,7 @@ except Exception, erf: stop_err('Error creating temp directory for indexing purposes\n' + str(erf)) options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1]) - cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref) + cmd1 = 'cd %s; bowtie-build %s -f %s %s' % (tmp_dir, indexing_cmds, options.ref, options.ref) try: os.system(cmd1) except Exception, erf: @@ -106,11 +105,11 @@ # set up aligning and generate aligning command options # automatically set threads to 8 in both cases if options.params == 'pre_set': - aligning_cmds = '-p 8' + aligning_cmds = '-p %s --quiet' % options.threads else: try: aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \ - '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \ + '%s %s %s %s %s %s %s %s %s %s %s %s -p %s --quiet' % \ (('','-s %s'%options.skip)[options.skip!='None'], ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0], ('','-5 %s'%options.trimH)[int(options.trimH)>=0], @@ -128,7 +127,6 @@ ('','--norc')[options.reverseAlign=='noReverse'], ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')], ('','-y')[options.tryHard=='doTryHard'], - ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0], ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0], ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0], ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0], @@ -137,18 +135,18 @@ ('','-B %s'%options.offbase)[int(options.offbase)>=0], ('','-z %s'%options.phased)[options.phased!='None'], ('','-o %s'%options.offrate)[int(options.offrate)>=0], - ('','--mm')[options.mm=='doMm'], - ('','--seed %s'%options.seed)[int(options.seed)>=0]) + ('','--seed %s'%options.seed)[int(options.seed)>=0], + options.threads) except ValueError: - aligning_cmds = '-p 8' + aligning_cmds = '-p %s --quiet' % options.threads tmp_out = tempfile.NamedTemporaryFile() # prepare actual aligning commands if options.paired == 'paired': - cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name) + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name) else: - cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name) + cmd2 = 'bowtie %s %s %s > %s' % (aligning_cmds, options.ref, options.input1, tmp_out.name) # prepare command to convert bowtie output to sam and alternative cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output) cmd4 = 'cp %s %s' % (tmp_out.name, options.output) diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.xml --- a/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 12:23:16 2009 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 14:54:11 2009 -0400 @@ -2,6 +2,7 @@ <description> fast alignment of reads against reference sequence </description> <command interpreter="python"> bowtie_wrapper.py + --threads="8" --input1=$singlePaired.input1 #if $singlePaired.sPaired == "paired": --input2=$singlePaired.input2 @@ -33,17 +34,14 @@ --suppressAlign=$singlePaired.params.suppressAlign --offbase=$singlePaired.params.offbase --offrate=$singlePaired.params.offrate - --mm=$singlePaired.params.mm --seed=$singlePaired.params.seed --best=$singlePaired.params.bestOption.best #if $singlePaired.params.bestOption.best == "doBest": --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks - --threadMem=$singlePaired.params.bestOption.threadMem --strata=$singlePaired.params.bestOption.strata --phased="None" #else: --maxBacktracks="None" - --threadMem="None" --strata="None" #if $singlePaired.sPaired =="single": --phased=$singlePaired.params.bestOption.phased @@ -83,7 +81,6 @@ --offbase="None" --best="None" --maxBacktracks="None" - --threadMem="None" --strata="None" --minInsert="None" --maxInsert="None" @@ -93,7 +90,6 @@ --reverseAlign="None" --phased="None" --offrate="None" - --mm="None" --seed="None" #end if #if $refGenomeSource.genomeSource == "history": @@ -264,7 +260,6 @@ </when> <when value="doBest"> <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> <option value="noStrata">Do not use strata option</option> <option value="doStrata">Use strata option</option> @@ -272,10 +267,6 @@ </when> </conditional>  <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> - <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)"> - <option value="noMm">Use POSIX/C file I/O</option> - <option value="doMm">Use memory-mapped I/O</option> - </param> <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> </when>  </conditional>  @@ -339,7 +330,6 @@ </when> <when value="doBest"> <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> - <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> <option value="noStrata">Do not use strata option</option> <option value="doStrata">Use strata option</option> @@ -347,10 +337,6 @@ </when> </conditional> <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" /> - <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)"> - <option value="noMm">Use POSIX/C file I/O</option> - <option value="doMm">Use memory-mapped I/O</option> - </param> <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> </when>  </conditional>  @@ -431,10 +417,8 @@ <param name="offbase" value="0" /> <param name="best" value="doBest" /> <param name="maxBacktracks" value="800" /> - <param name="threadMem" value="32" /> <param name="strata" value="noStrata" /> <param name="offrate" value="-1" /> - <param name="mm" value="noMm" /> <param name="seed" value="403" /> <output name="output" ftype="sam" file="bowtie_out2.sam" /> </test>

1 0

[hg] galaxy 2688: Fix path mangling in cleanup_datasets.py
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/7f4c8fee3b39 changeset: 2688:7f4c8fee3b39 user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Sep 14 12:23:16 2009 -0400 description: Fix path mangling in cleanup_datasets.py 1 file(s) affected in this change: scripts/cleanup_datasets/cleanup_datasets.py diffs (23 lines): diff -r a5ee939839eb -r 7f4c8fee3b39 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Mon Sep 14 12:11:00 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Mon Sep 14 12:23:16 2009 -0400 @@ -1,4 +1,8 @@ #!/usr/bin/env python + +new_path = [ os.path.join( os.getcwd(), "lib" ) ] +new_path.extend( sys.path[1:] ) # remove scripts/ from the path +sys.path = new_path from galaxy import eggs import pkg_resources @@ -8,10 +12,6 @@ from datetime import datetime, timedelta from time import strftime from optparse import OptionParser - -new_path = [ os.path.join( os.getcwd(), "lib" ) ] -new_path.extend( sys.path[1:] ) # remove scripts/ from the path -sys.path = new_path import galaxy.model.mapping from galaxy.model.orm import and_, eagerload

1 0

[hg] galaxy 2687: Remove session stuff from reports webapp
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/a5ee939839eb changeset: 2687:a5ee939839eb user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Sep 14 12:11:00 2009 -0400 description: Remove session stuff from reports webapp 1 file(s) affected in this change: lib/galaxy/webapps/reports/buildapp.py diffs (28 lines): diff -r d301a67eda40 -r a5ee939839eb lib/galaxy/webapps/reports/buildapp.py --- a/lib/galaxy/webapps/reports/buildapp.py Mon Sep 14 11:05:36 2009 -0400 +++ b/lib/galaxy/webapps/reports/buildapp.py Mon Sep 14 12:11:00 2009 -0400 @@ -87,17 +87,6 @@ from paste import recursive app = recursive.RecursiveMiddleware( app, conf ) log.debug( "Enabling 'recursive' middleware" ) - ## # Session middleware puts a session factory into the environment - ## if asbool( conf.get( 'use_session', True ) ): - ## store = flup_session.MemorySessionStore() - ## app = flup_session.SessionMiddleware( store, app ) - ## log.debug( "Enabling 'flup session' middleware" ) - # Beaker session middleware - if asbool( conf.get( 'use_beaker_session', False ) ): - pkg_resources.require( "Beaker" ) - import beaker.session - app = beaker.session.SessionMiddleware( app, conf ) - log.debug( "Enabling 'beaker session' middleware" ) # Various debug middleware that can only be turned on if the debug # flag is set, either because they are insecure or greatly hurt # performance @@ -185,4 +174,4 @@ if isinstance( exc_value, AttributeError ) and exc_value.args[0].startswith( "'Undefined' object has no attribute" ): return mako.exceptions.html_error_template().render( full=False, css=False ) formatters.append( mako_html_data ) - return formatters \ No newline at end of file + return formatters

1 0

[hg] galaxy 2686: Move the data library admin methods to a separ...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d301a67eda40 changeset: 2686:d301a67eda40 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Mon Sep 14 11:05:36 2009 -0400 description: Move the data library admin methods to a separate library_admin controller. 23 file(s) affected in this change: lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/library_admin.py templates/admin/index.mako templates/admin/library/browse_libraries.mako templates/admin/library/browse_library.mako templates/admin/library/common.mako templates/admin/library/folder_info.mako templates/admin/library/folder_permissions.mako templates/admin/library/ldda_edit_info.mako templates/admin/library/ldda_info.mako templates/admin/library/ldda_permissions.mako templates/admin/library/library_dataset_info.mako templates/admin/library/library_dataset_permissions.mako templates/admin/library/library_info.mako templates/admin/library/library_permissions.mako templates/admin/library/new_dataset.mako templates/admin/library/new_folder.mako templates/admin/library/new_library.mako templates/admin/library/select_info_template.mako templates/admin/requests/show_request.mako test/base/twilltestcase.py test/functional/test_forms_and_requests.py test/functional/test_security_and_libraries.py diffs (truncated from 3482 to 3000 lines): diff -r f2af04af3caa -r d301a67eda40 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Fri Sep 11 16:09:02 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Mon Sep 14 11:05:36 2009 -0400 @@ -1,15 +1,9 @@ -import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys +import string, sys from datetime import datetime, timedelta from galaxy import util, datatypes from galaxy.web.base.controller import * from galaxy.model.orm import * from galaxy.web.controllers.forms import get_all_forms, get_form_widgets -# Older py compatibility -try: - set() -except: - from sets import Set as set - import logging log = logging.getLogger( __name__ ) @@ -673,1188 +667,6 @@ out_groups=out_groups, msg=msg, messagetype=messagetype ) - - # Galaxy Library Stuff - @web.expose - @web.require_admin - def browse_libraries( self, trans, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - return trans.fill_template( '/admin/library/browse_libraries.mako', - libraries=trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \ - .order_by( trans.app.model.Library.name ).all(), - deleted=False, - show_deleted=False, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def browse_library( self, trans, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - id = params.get( 'id', None ) - deleted = util.string_as_bool( params.get( 'deleted', False ) ) - show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) ) - if not id: - msg = "You must specify a library id." - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_libraries', - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - library = library=trans.app.model.Library.get( id ) - if not library: - msg = "Invalid library id ( %s )." - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_libraries', - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - created_ldda_ids = params.get( 'created_ldda_ids', '' ) - return trans.fill_template( '/admin/library/browse_library.mako', - library=trans.app.model.Library.get( id ), - deleted=deleted, - created_ldda_ids=created_ldda_ids, - forms=get_all_forms( trans, filter=dict(deleted=False) ), - msg=msg, - messagetype=messagetype, - show_deleted=show_deleted ) - @web.expose - @web.require_admin - def library( self, trans, id=None, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - if params.get( 'new', False ): - action = 'new' - elif params.get( 'delete', False ): - action = 'delete' - elif params.get( 'permissions', False ): - action = 'permissions' - else: - action = 'information' - if not id and not action == 'new': - msg = "You must specify a library to %s." % action - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_libraries', - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if not action == 'new': - library = trans.app.model.Library.get( int( id ) ) - if action == 'new': - if params.new == 'submitted': - library = trans.app.model.Library( name = util.restore_text( params.name ), - description = util.restore_text( params.description ) ) - root_folder = trans.app.model.LibraryFolder( name = util.restore_text( params.name ), description = "" ) - root_folder.flush() - library.root_folder = root_folder - library.flush() - msg = "The new library named '%s' has been created" % library.name - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library.id, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/new_library.mako', msg=msg, messagetype=messagetype ) - elif action == 'information': - # See if we have any associated templates - info_association = library.get_info_association() - if info_association: - template = info_association.template - # See if we have any field contents - info = info_association.info - if info: - widgets = get_form_widgets( trans, template, info.content ) - else: - widgets = get_form_widgets( trans, template ) - else: - widgets = [] - if params.get( 'rename_library_button', False ): - old_name = library.name - new_name = util.restore_text( params.name ) - new_description = util.restore_text( params.description ) - if not new_name: - msg = 'Enter a valid name' - return trans.fill_template( '/admin/library/library_info.mako', - library=library, - widgets=widgets, - msg=msg, - messagetype='error' ) - else: - library.name = new_name - library.description = new_description - library.flush() - # Rename the root_folder - library.root_folder.name = new_name - library.root_folder.description = new_description - library.root_folder.flush() - msg = "Library '%s' has been renamed to '%s'" % ( old_name, new_name ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='library', - id=id, - edit_info=True, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/library_info.mako', - library=library, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif action == 'delete': - def delete_folder( library_folder ): - library_folder.refresh() - for folder in library_folder.folders: - delete_folder( folder ) - for library_dataset in library_folder.datasets: - library_dataset.refresh() - ldda = library_dataset.library_dataset_dataset_association - if ldda: - ldda.refresh() - # We don't set ldda.dataset.deleted to True here because the cleanup_dataset script - # will eventually remove it from disk. The purge_library method below sets the dataset - # to deleted. This allows for the library to be undeleted ( before it is purged ), - # restoring all of its contents. - ldda.deleted = True - ldda.flush() - library_dataset.deleted = True - library_dataset.flush() - library_folder.deleted = True - library_folder.flush() - library.refresh() - delete_folder( library.root_folder ) - library.deleted = True - library.flush() - msg = "Library '%s' and all of its contents have been marked deleted" % library.name - return trans.response.send_redirect( web.url_for( action='browse_libraries', msg=util.sanitize_text( msg ), messagetype='done' ) ) - elif action == 'permissions': - if params.get( 'update_roles_button', False ): - # The user clicked the Save button on the 'Associate With Roles' form - permissions = {} - for k, v in trans.app.model.Library.permitted_actions.items(): - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - trans.app.security_agent.set_all_library_permissions( library, permissions ) - library.refresh() - # Copy the permissions to the root folder - trans.app.security_agent.copy_library_permissions( library, library.root_folder ) - msg = "Permissions updated for library '%s'" % library.name - return trans.response.send_redirect( web.url_for( controller='admin', - action='library', - id=id, - permissions=True, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/library_permissions.mako', - library=library, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def deleted_libraries( self, trans, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - libraries=trans.app.model.Library.filter( and_( trans.app.model.Library.table.c.deleted==True, - trans.app.model.Library.table.c.purged==False ) ) \ - .order_by( trans.app.model.Library.table.c.name ).all() - return trans.fill_template( '/admin/library/browse_libraries.mako', - libraries=libraries, - deleted=True, - msg=msg, - messagetype=messagetype, - show_deleted=True ) - @web.expose - @web.require_admin - def purge_library( self, trans, **kwd ): - params = util.Params( kwd ) - library = trans.app.model.Library.get( int( params.id ) ) - def purge_folder( library_folder ): - for lf in library_folder.folders: - purge_folder( lf ) - library_folder.refresh() - for library_dataset in library_folder.datasets: - library_dataset.refresh() - ldda = library_dataset.library_dataset_dataset_association - if ldda: - ldda.refresh() - dataset = ldda.dataset - dataset.refresh() - # If the dataset is not associated with any additional undeleted folders, then we can delete it. - # We don't set dataset.purged to True here because the cleanup_datasets script will do that for - # us, as well as removing the file from disk. - #if not dataset.deleted and len( dataset.active_library_associations ) <= 1: # This is our current ldda - dataset.deleted = True - dataset.flush() - ldda.deleted = True - ldda.flush() - library_dataset.deleted = True - library_dataset.flush() - library_folder.deleted = True - library_folder.purged = True - library_folder.flush() - if not library.deleted: - msg = "Library '%s' has not been marked deleted, so it cannot be purged" % ( library.name ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_libraries', - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - else: - purge_folder( library.root_folder ) - library.purged = True - library.flush() - msg = "Library '%s' and all of its contents have been purged, datasets will be removed from disk via the cleanup_datasets script" % library.name - return trans.response.send_redirect( web.url_for( controller='admin', - action='deleted_libraries', - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - @web.expose - @web.require_admin - def folder( self, trans, id, library_id, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - if params.get( 'new', False ): - action = 'new' - elif params.get( 'delete', False ): - action = 'delete' - elif params.get( 'permissions', False ): - action = 'permissions' - else: - # 'information' will be the default - action = 'information' - folder = trans.app.model.LibraryFolder.get( int( id ) ) - if not folder: - msg = "Invalid folder specified, id: %s" % str( id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if action == 'new': - if params.new == 'submitted': - new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ), - description=util.restore_text( params.description ) ) - # We are associating the last used genome build with folders, so we will always - # initialize a new folder with the first dbkey in util.dbnames which is currently - # ? unspecified (?) - new_folder.genome_build = util.dbnames.default_value - folder.add_folder( new_folder ) - new_folder.flush() - # New folders default to having the same permissions as their parent folder - trans.app.security_agent.copy_library_permissions( folder, new_folder ) - msg = "New folder named '%s' has been added to the library" % new_folder.name - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/new_folder.mako', - library_id=library_id, - folder=folder, - msg=msg, - messagetype=messagetype ) - elif action == 'information': - # See if we have any associated templates - info_association = folder.get_info_association() - if info_association: - template = info_association.template - # See if we have any field contents - info = info_association.info - if info: - widgets = get_form_widgets( trans, template, info.content ) - else: - widgets = get_form_widgets( trans, template ) - else: - widgets = [] - if params.get( 'rename_folder_button', False ): - old_name = folder.name - new_name = util.restore_text( params.name ) - new_description = util.restore_text( params.description ) - if not new_name: - msg = 'Enter a valid name' - return trans.fill_template( '/admin/library/folder_info.mako', - folder=folder, - library_id=library_id, - widgets=widgets, - msg=msg, - messagetype='error' ) - else: - folder.name = new_name - folder.description = new_description - folder.flush() - msg = "Folder '%s' has been renamed to '%s'" % ( old_name, new_name ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='folder', - id=id, - library_id=library_id, - edit_info=True, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/folder_info.mako', - folder=folder, - library_id=library_id, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif action == 'delete': - folder.deleted = True - folder.flush() - msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name - return trans.response.send_redirect( web.url_for( action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - elif action =='permissions': - if params.get( 'update_roles_button', False ): - # The user clicked the Save button on the 'Associate With Roles' form - permissions = {} - for k, v in trans.app.model.Library.permitted_actions.items(): - in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ] - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - trans.app.security_agent.set_all_library_permissions( folder, permissions ) - folder.refresh() - msg = "Permissions updated for folder '%s'" % folder.name - return trans.response.send_redirect( web.url_for( controller='admin', - action='folder', - id=id, - library_id=library_id, - permissions=True, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - return trans.fill_template( '/admin/library/folder_permissions.mako', - folder=folder, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def library_dataset( self, trans, id, library_id, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - if params.get( 'permissions', False ): - action = 'permissions' - else: - action = 'information' - library_dataset = trans.app.model.LibraryDataset.get( id ) - if not library_dataset: - msg = "Invalid library dataset specified, id: %s" %str( id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if action == 'information': - if params.get( 'edit_attributes_button', False ): - old_name = library_dataset.name - new_name = util.restore_text( params.get( 'name', '' ) ) - new_info = util.restore_text( params.get( 'info', '' ) ) - if not new_name: - msg = 'Enter a valid name' - messagetype = 'error' - else: - library_dataset.name = new_name - library_dataset.info = new_info - library_dataset.flush() - msg = "Dataset '%s' has been renamed to '%s'" % ( old_name, new_name ) - messagetype = 'done' - return trans.fill_template( '/admin/library/library_dataset_info.mako', - library_dataset=library_dataset, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - elif action == 'permissions': - if params.get( 'update_roles_button', False ): - # The user clicked the Save button on the 'Edit permissions and role associations' form - permissions = {} - for k, v in trans.app.model.Library.permitted_actions.items(): - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - # Set the LIBRARY permissions on the LibraryDataset - # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions - trans.app.security_agent.set_all_library_permissions( library_dataset, permissions ) - library_dataset.refresh() - # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation - trans.app.security_agent.set_all_library_permissions( library_dataset.library_dataset_dataset_association, permissions ) - library_dataset.library_dataset_dataset_association.refresh() - msg = 'Permissions and roles have been updated for library dataset %s' % library_dataset.name - return trans.fill_template( '/admin/library/library_dataset_permissions.mako', - library_dataset=library_dataset, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def library_dataset_dataset_association( self, trans, library_id, folder_id, id=None, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - deleted = util.string_as_bool( params.get( 'deleted', False ) ) - show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) ) - dbkey = params.get( 'dbkey', None ) - if isinstance( dbkey, list ): - last_used_build = dbkey[0] - else: - last_used_build = dbkey - folder = trans.app.model.LibraryFolder.get( folder_id ) - if folder and last_used_build in [ 'None', None, '?' ]: - last_used_build = folder.genome_build - replace_id = params.get( 'replace_id', None ) - if replace_id: - replace_dataset = trans.app.model.LibraryDataset.get( int( replace_id ) ) - if not last_used_build: - last_used_build = replace_dataset.library_dataset_dataset_association.dbkey - else: - replace_dataset = None - # Let's not overwrite the imported datatypes module with the variable datatypes? - # The built-in 'id' is overwritten in lots of places as well - ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] - ldatatypes.sort() - if params.get( 'new_dataset_button', False ): - upload_option = params.get( 'upload_option', 'upload_file' ) - created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans, - controller='admin', - library_id=library_id, - folder_id=folder_id, - replace_dataset=replace_dataset, - **kwd ) - if created_ldda_ids: - total_added = len( created_ldda_ids.split( ',' ) ) - if replace_dataset: - msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name ) - else: - if not folder.parent: - # Libraries have the same name as their root_folder - msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name ) - else: - msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name ) - msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary." - messagetype='done' - else: - msg = "Upload failed" - messagetype='error' - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - created_ldda_ids=created_ldda_ids, - msg=util.sanitize_text( msg ), - messagetype=messagetype ) ) - elif not id or replace_dataset: - # See if we have any associated templates - info_association = folder.get_info_association() - if info_association: - template = info_association.template - widgets = get_form_widgets( trans, template ) - else: - widgets = [] - upload_option = params.get( 'upload_option', 'upload_file' ) - # No dataset(s) specified, so display the upload form. Send list of data formats to the form - # so the "extension" select list can be populated dynamically - file_formats = trans.app.datatypes_registry.upload_file_formats - # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically - def get_dbkey_options( last_used_build ): - for dbkey, build_name in util.dbnames: - yield build_name, dbkey, ( dbkey==last_used_build ) - dbkeys = get_dbkey_options( last_used_build ) - # Send list of roles to the form so the dataset can be associated with 1 or more of them. - roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all() - # Send the current history to the form to enable importing datasets from history to library - history = trans.get_history() - history.refresh() - return trans.fill_template( '/admin/library/new_dataset.mako', - upload_option=upload_option, - library_id=library_id, - folder_id=folder_id, - replace_id=replace_id, - file_formats=file_formats, - dbkeys=dbkeys, - last_used_build=last_used_build, - roles=roles, - history=history, - widgets=widgets, - msg=msg, - messagetype=messagetype, - replace_dataset=replace_dataset ) - else: - if params.get( 'permissions', False ): - action = 'permissions' - elif params.get( 'edit_info', False ): - action = 'edit_info' - else: - action = 'info' - if id.count( ',' ): - ids = id.split( ',' ) - id = None - else: - ids = None - if id: - # ldda_id specified, display attributes form - ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if not ldda: - msg = "Invalid LibraryDatasetDatasetAssociation specified, id: %s" % str( id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - # See if we have any associated templates - info_association = ldda.get_info_association() - if info_association: - template = info_association.template - # See if we have any field contents - info = info_association.info - if info: - widgets = get_form_widgets( trans, template, info.content ) - else: - widgets = get_form_widgets( trans, template ) - else: - widgets = [] - if action == 'permissions': - if params.get( 'update_roles_button', False ): - permissions = {} - accessible = False - for k, v in trans.app.model.Dataset.permitted_actions.items(): - # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not - # the DATASET_ACCESS permission, making the former useless. Need to display a warning message. - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] - # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible - if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: - if len( in_roles ) > 1: - # Get the set of all users that are being associated with the dataset - in_roles_set = set() - for role in in_roles: - in_roles_set.add( role ) - users_set = set() - for role in in_roles: - for ura in role.users: - users_set.add( ura.user ) - # Make sure that at least 1 user has every role being associated with the dataset - for user in users_set: - user_roles_set = set() - for ura in user.roles: - user_roles_set.add( ura.role ) - if in_roles_set.issubset( user_roles_set ): - accessible = True - break - else: - accessible = True - if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: - # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions - # TODO: keep access permissions as they originally were, rather than automatically making public - permissions[ trans.app.security_agent.get_action( v.action ) ] = [] - else: - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - # Set the DATASET permissions on the Dataset - trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions ) - ldda.dataset.refresh() - permissions = {} - for k, v in trans.app.model.Library.permitted_actions.items(): - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - # Set the LIBRARY permissions on the LibraryDataset - # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions - trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions ) - ldda.library_dataset.refresh() - # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation - trans.app.security_agent.set_all_library_permissions( ldda, permissions ) - ldda.refresh() - if not accessible: - msg = "At least 1 user must have every role associated with accessing dataset '%s'. " % ldda.name - msg += "The roles you attempted to associate for access would make this dataset inaccessible by everyone, " - msg += "so access permissions were not set. All other permissions were updated for the dataset." - messagetype = 'error' - else: - msg = "Permissions updated for dataset '%s'" % ldda.name - return trans.fill_template( '/admin/library/ldda_permissions.mako', - ldda=ldda, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - elif action == 'info': - return trans.fill_template( '/admin/library/ldda_info.mako', - ldda=ldda, - library_id=library_id, - deleted=deleted, - show_deleted=show_deleted, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif action == 'edit_info': - if params.get( 'change', False ): - # The user clicked the Save button on the 'Change data type' form - if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: - trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) - trans.app.model.flush() - msg = "Data type changed for library dataset '%s'" % ldda.name - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - else: - return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) ) - elif params.get( 'save', False ): - # The user clicked the Save button on the 'Edit Attributes' form - old_name = ldda.name - new_name = util.restore_text( params.get( 'name', '' ) ) - new_info = util.restore_text( params.get( 'info', '' ) ) - new_message = util.restore_text( params.get( 'message', '' ) ) - if not new_name: - msg = 'Enter a valid name' - messagetype = 'error' - else: - ldda.name = new_name - ldda.info = new_info - ldda.message = new_message - # The following for loop will save all metadata_spec items - for name, spec in ldda.datatype.metadata_spec.items(): - if spec.get("readonly"): - continue - optional = params.get( "is_" + name, None ) - if optional and optional == 'true': - # optional element... == 'true' actually means it is NOT checked (and therefore ommitted) - setattr( ldda.metadata, name, None ) - else: - setattr( ldda.metadata, name, spec.unwrap( params.get ( name, None ) ) ) - ldda.metadata.dbkey = dbkey - ldda.datatype.after_edit( ldda ) - trans.app.model.flush() - msg = 'Attributes updated for library dataset %s' % ldda.name - messagetype = 'done' - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif params.get( 'detect', False ): - # The user clicked the Auto-detect button on the 'Edit Attributes' form - for name, spec in ldda.datatype.metadata_spec.items(): - # We need to be careful about the attributes we are resetting - if name not in [ 'name', 'info', 'dbkey' ]: - if spec.get( 'default' ): - setattr( ldda.metadata, name, spec.unwrap( spec.get( 'default' ) ) ) - ldda.datatype.set_meta( ldda ) - ldda.datatype.after_edit( ldda ) - trans.app.model.flush() - msg = 'Attributes updated for library dataset %s' % ldda.name - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif params.get( 'delete', False ): - ldda.deleted = True - ldda.flush() - msg = 'Dataset %s has been removed from this library' % ldda.name - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - ldda.datatype.before_edit( ldda ) - if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey: - # Copy dbkey into metadata, for backwards compatability - # This looks like it does nothing, but getting the dbkey - # returns the metadata dbkey unless it is None, in which - # case it resorts to the old dbkey. Setting the dbkey - # sets it properly in the metadata - ldda.metadata.dbkey = ldda.dbkey - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - elif ids: - # Multiple ids specfied, display permission form, permissions will be updated for all simultaneously. - lddas = [] - for id in [ int( id ) for id in ids ]: - ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if ldda is None: - msg = 'You specified an invalid LibraryDatasetDatasetAssociation id: %s' %str( id ) - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - lddas.append( ldda ) - if len( lddas ) < 2: - msg = 'You must specify at least two datasets on which to modify permissions, ids you sent: %s' % str( ids ) - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if action == 'permissions': - if params.get( 'update_roles_button', False ): - permissions = {} - accessible = False - for k, v in trans.app.model.Dataset.permitted_actions.items(): - # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not - # the DATASET_ACCESS permission, making the former useless. Need to display a warning message. - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] - # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible - if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: - if len( in_roles ) > 1: - # Get the set of all users that are being associated with the dataset - in_roles_set = set() - for role in in_roles: - in_roles_set.add( role ) - users_set = set() - for role in in_roles: - for ura in role.users: - users_set.add( ura.user ) - # Make sure that at least 1 user has every role being associated with the dataset - for user in users_set: - user_roles_set = set() - for ura in user.roles: - user_roles_set.add( ura.role ) - if in_roles_set.issubset( user_roles_set ): - accessible = True - break - else: - accessible = True - if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: - # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions - # TODO: keep access permissions as they originally were, rather than automatically making public - permissions[ trans.app.security_agent.get_action( v.action ) ] = [] - else: - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - for ldda in lddas: - # Set the DATASET permissions on the Dataset - trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions ) - ldda.dataset.refresh() - permissions = {} - for k, v in trans.app.model.Library.permitted_actions.items(): - in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] - permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles - for ldda in lddas: - # Set the LIBRARY permissions on the LibraryDataset - # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions - trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions ) - ldda.library_dataset.refresh() - # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation - trans.app.security_agent.set_all_library_permissions( ldda, permissions ) - ldda.refresh() - if not accessible: - msg = "At least 1 user must have every role associated with accessing these %d datasets. " % len( lddas ) - msg += "The roles you attempted to associate for access would make these datasets inaccessible by everyone, " - msg += "so access permissions were not set. All other permissions were updated for the datasets." - messagetype = 'error' - else: - msg = "Permissions have been updated on %d datasets" % len( lddas ) - return trans.fill_template( "/admin/library/ldda_permissions.mako", - ldda=lddas, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - # Ensure that the permissions across all library items are identical, otherwise we can't update them together. - check_list = [] - for ldda in lddas: - permissions = [] - # Check the library level permissions - the permissions on the LibraryDatasetDatasetAssociation - # will always be the same as the permissions on the associated LibraryDataset, so we only need to - # check one Library object - for library_permission in trans.app.security_agent.get_library_dataset_permissions( ldda.library_dataset ): - if library_permission.action not in permissions: - permissions.append( library_permission.action ) - for dataset_permission in trans.app.security_agent.get_dataset_permissions( ldda.dataset ): - if dataset_permission.action not in permissions: - permissions.append( dataset_permission.action ) - permissions.sort() - if not check_list: - check_list = permissions - if permissions != check_list: - msg = 'The datasets you selected do not have identical permissions, so they can not be updated together' - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - return trans.fill_template( "/admin/library/ldda_permissions.mako", - ldda=lddas, - library_id=library_id, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def add_history_datasets_to_library( self, trans, library_id, folder_id, hda_ids='', **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - try: - folder = trans.app.model.LibraryFolder.get( int( folder_id ) ) - except: - msg = "Invalid folder id: %s" % str( folder_id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - replace_id = params.get( 'replace_id', None ) - if replace_id: - replace_dataset = trans.app.model.LibraryDataset.get( replace_id ) - else: - replace_dataset = None - # See if the current history is empty - history = trans.get_history() - history.refresh() - if not history.active_datasets: - msg = 'Your current history is empty' - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if params.get( 'add_history_datasets_to_library_button', False ): - hda_ids = util.listify( hda_ids ) - if hda_ids: - dataset_names = [] - created_ldda_ids = '' - for hda_id in hda_ids: - hda = trans.app.model.HistoryDatasetAssociation.get( hda_id ) - if hda: - ldda = hda.to_library_dataset_dataset_association( target_folder=folder, replace_dataset=replace_dataset ) - created_ldda_ids = '%s,%s' % ( created_ldda_ids, str( ldda.id ) ) - dataset_names.append( ldda.name ) - if not replace_dataset: - # If replace_dataset is None, the Library level permissions will be taken from the folder and applied to the new - # LDDA and LibraryDataset. - trans.app.security_agent.copy_library_permissions( folder, ldda ) - trans.app.security_agent.copy_library_permissions( folder, ldda.library_dataset ) - # Permissions must be the same on the LibraryDatasetDatasetAssociation and the associated LibraryDataset - trans.app.security_agent.copy_library_permissions( ldda.library_dataset, ldda ) - else: - msg = "The requested HistoryDatasetAssociation id %s is invalid" % str( hda_id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - if created_ldda_ids: - created_ldda_ids = created_ldda_ids.lstrip( ',' ) - ldda_id_list = created_ldda_ids.split( ',' ) - total_added = len( ldda_id_list ) - if replace_dataset: - msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name ) - else: - if not folder.parent: - # Libraries have the same name as their root_folder - msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name ) - else: - msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name ) - msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary." - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - created_ldda_ids=created_ldda_ids, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - else: - msg = 'Select at least one dataset from the list of active datasets in your current history' - messagetype = 'error' - last_used_build = folder.genome_build - upload_option = params.get( 'upload_option', 'import_from_history' ) - # Send list of data formats to the form so the "extension" select list can be populated dynamically - file_formats = trans.app.datatypes_registry.upload_file_formats - # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically - def get_dbkey_options( last_used_build ): - for dbkey, build_name in util.dbnames: - yield build_name, dbkey, ( dbkey==last_used_build ) - dbkeys = get_dbkey_options( last_used_build ) - # Send list of roles to the form so the dataset can be associated with 1 or more of them. - roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all() - return trans.fill_template( "/admin/library/new_dataset.mako", - upload_option=upload_option, - library_id=library_id, - folder_id=folder_id, - replace_id=replace_id, - file_formats=file_formats, - dbkeys=dbkeys, - last_used_build=last_used_build, - roles=roles, - history=history, - widgets=widgets, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def info_template( self, trans, library_id, id=None, folder_id=None, ldda_id=None, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - if id: - library_item = trans.app.model.FormDefinition.get( int( id ) ) - library_item_desc = 'information template' - response_action = 'info_template' - response_id = id - elif folder_id: - library_item = trans.app.model.LibraryFolder.get( int( folder_id ) ) - library_item_desc = 'folder' - response_action = 'folder' - response_id = folder_id - elif ldda_id: - library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( int( ldda_id ) ) - library_item_desc = 'library dataset' - response_action = 'library_dataset_dataset_association' - response_id = ldda_id - else: - library_item = trans.app.model.Library.get( int( library_id ) ) - library_item_desc = 'library' - response_action = 'browse_library' - response_id = library_id - forms = get_all_forms( trans, filter=dict(deleted=False) ) - if not forms: - msg = "There are no forms on which to base the template, so create a form and " - msg += "try again to add the information template to the %s." % library_item_desc - trans.response.send_redirect( web.url_for( controller='forms', - action='new', - new=True, - msg=msg, - messagetype='done' ) ) - if params.get( 'add', False ): - if params.get( 'add_info_template_button', False ): - form = trans.app.model.FormDefinition.get( int( kwd[ 'form_id' ] ) ) - #fields = list( copy.deepcopy( form.fields ) ) - form_values = trans.app.model.FormValues( form, [] ) - form_values.flush() - if folder_id: - assoc = trans.app.model.LibraryFolderInfoAssociation( library_item, form, form_values ) - elif ldda_id: - assoc = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, form, form_values ) - else: - assoc = trans.app.model.LibraryInfoAssociation( library_item, form, form_values ) - assoc.flush() - msg = 'An information template based on the form "%s" has been added to this %s.' % ( form.name, library_item_desc ) - trans.response.send_redirect( web.url_for( controller='admin', - action=response_action, - id=response_id, - msg=msg, - message_type='done' ) ) - return trans.fill_template( '/admin/library/select_info_template.mako', - library_item_name=library_item.name, - library_item_desc=library_item_desc, - library_id=library_id, - folder_id=folder_id, - ldda_id=ldda_id, - forms=forms, - msg=msg, - messagetype=messagetype ) - @web.expose - @web.require_admin - def edit_template_info( self, trans, library_id, num_widgets, library_item_id=None, library_item_type=None, **kwd ): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - folder_id = None - if library_item_type == 'library': - library_item = trans.app.model.Library.get( library_item_id ) - elif library_item_type == 'library_dataset': - library_item = trans.app.model.LibraryDataset.get( library_item_id ) - elif library_item_type == 'folder': - library_item = trans.app.model.LibraryFolder.get( library_item_id ) - elif library_item_type == 'library_dataset_dataset_association': - library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( library_item_id ) - # This response_action method requires a folder_id - folder_id = library_item.library_dataset.folder.id - else: - msg = "Invalid library item type ( %s ) specified, id ( %s )" % ( str( library_item_type ), str( library_item_id ) ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - # Save updated template field contents - field_contents = [] - for index in range( int( num_widgets ) ): - field_contents.append( util.restore_text( params.get( 'field_%i' % ( index ), '' ) ) ) - if field_contents: - # Since information templates are inherited, the template fields can be displayed on the information - # page for a folder or library dataset when it has no info_association object. If the user has added - # field contents on an inherited template via a parent's info_association, we'll need to create a new - # form_values and info_association for the current object. - info_association = library_item.get_info_association( restrict=True ) - if info_association: - template = info_association.template - info = info_association.info - form_values = trans.app.model.FormValues.get( info.id ) - # Update existing content only if it has changed - if form_values.content != field_contents: - form_values.content = field_contents - form_values.flush() - else: - # Inherit the next available info_association so we can get the template - info_association = library_item.get_info_association() - template = info_association.template - # Create a new FormValues object - form_values = trans.app.model.FormValues( template, field_contents ) - form_values.flush() - # Create a new info_association between the current library item and form_values - if library_item_type == 'folder': - info_association = trans.app.model.LibraryFolderInfoAssociation( library_item, template, form_values ) - info_association.flush() - elif library_item_type == 'library_dataset_dataset_association': - info_association = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, template, form_values ) - info_association.flush() - msg = 'The information has been updated.' - return trans.response.send_redirect( web.url_for( controller='admin', - action=library_item_type, - id=library_item.id, - library_id=library_id, - folder_id=folder_id, - edit_info=True, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - @web.expose - @web.require_admin - def download_dataset_from_folder(self, trans, id, library_id=None, **kwd): - """Catches the dataset id and displays file contents as directed""" - # id must refer to a LibraryDatasetDatasetAssociation object - ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if not ldda.dataset: - msg = 'Invalid LibraryDatasetDatasetAssociation id %s received for file downlaod' % str( id ) - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - mime = trans.app.datatypes_registry.get_mimetype_by_extension( ldda.extension.lower() ) - trans.response.set_content_type( mime ) - fStat = os.stat( ldda.file_name ) - trans.response.headers[ 'Content-Length' ] = int( fStat.st_size ) - valid_chars = '.,^_-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ' - fname = ldda.name - fname = ''.join( c in valid_chars and c or '_' for c in fname )[ 0:150 ] - trans.response.headers[ "Content-Disposition" ] = "attachment; filename=GalaxyLibraryDataset-%s-[%s]" % ( str( id ), fname ) - try: - return open( ldda.file_name ) - except: - msg = 'This dataset contains no content' - return trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - @web.expose - @web.require_admin - def datasets( self, trans, library_id, **kwd ): - # This method is used by the select list labeled "Perform action on selected datasets" - # on the admin library browser. - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - if params.get( 'action_on_datasets_button', False ): - if not params.ldda_ids: - msg = "At least one dataset must be selected for %s" % params.action - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - ldda_ids = util.listify( params.ldda_ids ) - if params.action == 'edit': - # We need the folder containing the LibraryDatasetDatasetAssociation(s) - ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_ids[0] ) - trans.response.send_redirect( web.url_for( controller='admin', - action='library_dataset_dataset_association', - library_id=library_id, - folder_id=ldda.library_dataset.folder.id, - id=",".join( ldda_ids ), - permissions=True, - msg=util.sanitize_text( msg ), - messagetype=messagetype ) ) - elif params.action == 'delete': - for id in ldda_ids: - ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - ldda.deleted = True - ldda.flush() - msg = "The selected datasets have been removed from this library" - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - show_deleted=False, - msg=util.sanitize_text( msg ), - messagetype='done' ) ) - else: - msg = "Action %s is not yet implemented" % str( params.action ) - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype='error' ) ) - else: - trans.response.send_redirect( web.url_for( controller='admin', - action='browse_library', - id=library_id, - msg=util.sanitize_text( msg ), - messagetype=messagetype ) ) - @web.expose - @web.require_admin - def delete_library_item( self, trans, library_id, library_item_id, library_item_type ): - # This action will handle deleting all types of library items. State is saved for libraries and - # folders ( i.e., if undeleted, the state of contents of the library or folder will remain, so previously - # deleted / purged contents will have the same state ). When a library or folder has been deleted for - # the amount of time defined in the cleanup_datasets.py script, the library or folder and all of its - # contents will be purged. The association between this method and the cleanup_datasets.py script - # enables clean maintenance of libraries and library dataset disk files. This is also why the following - # 3 objects, and not any of the associations ( the cleanup_datasets.py scipot handles everything else ). - library_item_types = { 'library': trans.app.model.Library, - 'folder': trans.app.model.LibraryFolder, - 'library_dataset': trans.app.model.LibraryDataset } - if library_item_type not in library_item_types: - msg = 'Bad library_item_type specified: %s' % str( library_item_type ) - messagetype = 'error' - else: - if library_item_type == 'library_dataset': - library_item_desc = 'Dataset' - else: - library_item_desc = library_item_type.capitalize() - library_item = library_item_types[ library_item_type ].get( int( library_item_id ) ) - library_item.deleted = True - library_item.flush() - msg = util.sanitize_text( "%s '%s' has been marked deleted" % ( library_item_desc, library_item.name ) ) - messagetype = 'done' - if library_item_type == 'library': - return self.browse_libraries( trans, msg=msg, messagetype=messagetype ) - else: - return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype ) - @web.expose - @web.require_admin - def undelete_library_item( self, trans, library_id, library_item_id, library_item_type ): - # This action will handle undeleting all types of library items - library_item_types = { 'library': trans.app.model.Library, - 'folder': trans.app.model.LibraryFolder, - 'library_dataset': trans.app.model.LibraryDataset } - if library_item_type not in library_item_types: - msg = 'Bad library_item_type specified: %s' % str( library_item_type ) - messagetype = 'error' - else: - if library_item_type == 'library_dataset': - library_item_desc = 'Dataset' - else: - library_item_desc = library_item_type.capitalize() - library_item = library_item_types[ library_item_type ].get( int( library_item_id ) ) - if library_item.purged: - msg = '%s %s has been purged, so it cannot be undeleted' % ( library_item_desc, library_item.name ) - messagetype = 'error' - else: - library_item.deleted = False - library_item.flush() - msg = util.sanitize_text( "%s '%s' has been marked undeleted" % ( library_item_desc, library_item.name ) ) - messagetype = 'done' - if library_item_type == 'library': - return self.browse_libraries( trans, msg=msg, messagetype=messagetype ) - else: - return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype ) @web.expose @web.require_admin def memdump( self, trans, ids = 'None', sorts = 'None', pages = 'None', new_id = None, new_sort = None, **kwd ): diff -r f2af04af3caa -r d301a67eda40 lib/galaxy/web/controllers/library_admin.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/web/controllers/library_admin.py Mon Sep 14 11:05:36 2009 -0400 @@ -0,0 +1,1195 @@ +import sys +from galaxy import util +from galaxy.web.base.controller import * +from galaxy.model.orm import * +from galaxy.web.controllers.forms import get_all_forms, get_form_widgets +# Older py compatibility +try: + set() +except: + from sets import Set as set + +import logging +log = logging.getLogger( __name__ ) + +class LibraryAdmin( BaseController ): + @web.expose + @web.require_admin + def browse_libraries( self, trans, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + return trans.fill_template( '/admin/library/browse_libraries.mako', + libraries=trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \ + .order_by( trans.app.model.Library.name ).all(), + deleted=False, + show_deleted=False, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def browse_library( self, trans, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + id = params.get( 'id', None ) + deleted = util.string_as_bool( params.get( 'deleted', False ) ) + show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) ) + if not id: + msg = "You must specify a library id." + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_libraries', + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + library = library=trans.app.model.Library.get( id ) + if not library: + msg = "Invalid library id ( %s )." + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_libraries', + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + created_ldda_ids = params.get( 'created_ldda_ids', '' ) + return trans.fill_template( '/admin/library/browse_library.mako', + library=trans.app.model.Library.get( id ), + deleted=deleted, + created_ldda_ids=created_ldda_ids, + forms=get_all_forms( trans, filter=dict(deleted=False) ), + msg=msg, + messagetype=messagetype, + show_deleted=show_deleted ) + @web.expose + @web.require_admin + def library( self, trans, id=None, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if params.get( 'new', False ): + action = 'new' + elif params.get( 'delete', False ): + action = 'delete' + elif params.get( 'permissions', False ): + action = 'permissions' + else: + action = 'information' + if not id and not action == 'new': + msg = "You must specify a library to %s." % action + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_libraries', + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if not action == 'new': + library = trans.app.model.Library.get( int( id ) ) + if action == 'new': + if params.new == 'submitted': + library = trans.app.model.Library( name = util.restore_text( params.name ), + description = util.restore_text( params.description ) ) + root_folder = trans.app.model.LibraryFolder( name = util.restore_text( params.name ), description = "" ) + root_folder.flush() + library.root_folder = root_folder + library.flush() + msg = "The new library named '%s' has been created" % library.name + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library.id, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/new_library.mako', msg=msg, messagetype=messagetype ) + elif action == 'information': + # See if we have any associated templates + info_association = library.get_info_association() + if info_association: + template = info_association.template + # See if we have any field contents + info = info_association.info + if info: + widgets = get_form_widgets( trans, template, info.content ) + else: + widgets = get_form_widgets( trans, template ) + else: + widgets = [] + if params.get( 'rename_library_button', False ): + old_name = library.name + new_name = util.restore_text( params.name ) + new_description = util.restore_text( params.description ) + if not new_name: + msg = 'Enter a valid name' + return trans.fill_template( '/admin/library/library_info.mako', + library=library, + widgets=widgets, + msg=msg, + messagetype='error' ) + else: + library.name = new_name + library.description = new_description + library.flush() + # Rename the root_folder + library.root_folder.name = new_name + library.root_folder.description = new_description + library.root_folder.flush() + msg = "Library '%s' has been renamed to '%s'" % ( old_name, new_name ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='library', + id=id, + edit_info=True, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/library_info.mako', + library=library, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif action == 'delete': + def delete_folder( library_folder ): + library_folder.refresh() + for folder in library_folder.folders: + delete_folder( folder ) + for library_dataset in library_folder.datasets: + library_dataset.refresh() + ldda = library_dataset.library_dataset_dataset_association + if ldda: + ldda.refresh() + # We don't set ldda.dataset.deleted to True here because the cleanup_dataset script + # will eventually remove it from disk. The purge_library method below sets the dataset + # to deleted. This allows for the library to be undeleted ( before it is purged ), + # restoring all of its contents. + ldda.deleted = True + ldda.flush() + library_dataset.deleted = True + library_dataset.flush() + library_folder.deleted = True + library_folder.flush() + library.refresh() + delete_folder( library.root_folder ) + library.deleted = True + library.flush() + msg = "Library '%s' and all of its contents have been marked deleted" % library.name + return trans.response.send_redirect( web.url_for( action='browse_libraries', msg=util.sanitize_text( msg ), messagetype='done' ) ) + elif action == 'permissions': + if params.get( 'update_roles_button', False ): + # The user clicked the Save button on the 'Associate With Roles' form + permissions = {} + for k, v in trans.app.model.Library.permitted_actions.items(): + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + trans.app.security_agent.set_all_library_permissions( library, permissions ) + library.refresh() + # Copy the permissions to the root folder + trans.app.security_agent.copy_library_permissions( library, library.root_folder ) + msg = "Permissions updated for library '%s'" % library.name + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='library', + id=id, + permissions=True, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/library_permissions.mako', + library=library, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def deleted_libraries( self, trans, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + libraries=trans.app.model.Library.filter( and_( trans.app.model.Library.table.c.deleted==True, + trans.app.model.Library.table.c.purged==False ) ) \ + .order_by( trans.app.model.Library.table.c.name ).all() + return trans.fill_template( '/admin/library/browse_libraries.mako', + libraries=libraries, + deleted=True, + msg=msg, + messagetype=messagetype, + show_deleted=True ) + @web.expose + @web.require_admin + def purge_library( self, trans, **kwd ): + params = util.Params( kwd ) + library = trans.app.model.Library.get( int( params.id ) ) + def purge_folder( library_folder ): + for lf in library_folder.folders: + purge_folder( lf ) + library_folder.refresh() + for library_dataset in library_folder.datasets: + library_dataset.refresh() + ldda = library_dataset.library_dataset_dataset_association + if ldda: + ldda.refresh() + dataset = ldda.dataset + dataset.refresh() + # If the dataset is not associated with any additional undeleted folders, then we can delete it. + # We don't set dataset.purged to True here because the cleanup_datasets script will do that for + # us, as well as removing the file from disk. + #if not dataset.deleted and len( dataset.active_library_associations ) <= 1: # This is our current ldda + dataset.deleted = True + dataset.flush() + ldda.deleted = True + ldda.flush() + library_dataset.deleted = True + library_dataset.flush() + library_folder.deleted = True + library_folder.purged = True + library_folder.flush() + if not library.deleted: + msg = "Library '%s' has not been marked deleted, so it cannot be purged" % ( library.name ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_libraries', + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + else: + purge_folder( library.root_folder ) + library.purged = True + library.flush() + msg = "Library '%s' and all of its contents have been purged, datasets will be removed from disk via the cleanup_datasets script" % library.name + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='deleted_libraries', + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + @web.expose + @web.require_admin + def folder( self, trans, id, library_id, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if params.get( 'new', False ): + action = 'new' + elif params.get( 'delete', False ): + action = 'delete' + elif params.get( 'permissions', False ): + action = 'permissions' + else: + # 'information' will be the default + action = 'information' + folder = trans.app.model.LibraryFolder.get( int( id ) ) + if not folder: + msg = "Invalid folder specified, id: %s" % str( id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if action == 'new': + if params.new == 'submitted': + new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ), + description=util.restore_text( params.description ) ) + # We are associating the last used genome build with folders, so we will always + # initialize a new folder with the first dbkey in util.dbnames which is currently + # ? unspecified (?) + new_folder.genome_build = util.dbnames.default_value + folder.add_folder( new_folder ) + new_folder.flush() + # New folders default to having the same permissions as their parent folder + trans.app.security_agent.copy_library_permissions( folder, new_folder ) + msg = "New folder named '%s' has been added to the library" % new_folder.name + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/new_folder.mako', + library_id=library_id, + folder=folder, + msg=msg, + messagetype=messagetype ) + elif action == 'information': + # See if we have any associated templates + info_association = folder.get_info_association() + if info_association: + template = info_association.template + # See if we have any field contents + info = info_association.info + if info: + widgets = get_form_widgets( trans, template, info.content ) + else: + widgets = get_form_widgets( trans, template ) + else: + widgets = [] + if params.get( 'rename_folder_button', False ): + old_name = folder.name + new_name = util.restore_text( params.name ) + new_description = util.restore_text( params.description ) + if not new_name: + msg = 'Enter a valid name' + return trans.fill_template( '/admin/library/folder_info.mako', + folder=folder, + library_id=library_id, + widgets=widgets, + msg=msg, + messagetype='error' ) + else: + folder.name = new_name + folder.description = new_description + folder.flush() + msg = "Folder '%s' has been renamed to '%s'" % ( old_name, new_name ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='folder', + id=id, + library_id=library_id, + edit_info=True, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/folder_info.mako', + folder=folder, + library_id=library_id, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif action == 'delete': + folder.deleted = True + folder.flush() + msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name + return trans.response.send_redirect( web.url_for( action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + elif action =='permissions': + if params.get( 'update_roles_button', False ): + # The user clicked the Save button on the 'Associate With Roles' form + permissions = {} + for k, v in trans.app.model.Library.permitted_actions.items(): + in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ] + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + trans.app.security_agent.set_all_library_permissions( folder, permissions ) + folder.refresh() + msg = "Permissions updated for folder '%s'" % folder.name + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='folder', + id=id, + library_id=library_id, + permissions=True, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + return trans.fill_template( '/admin/library/folder_permissions.mako', + folder=folder, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def library_dataset( self, trans, id, library_id, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if params.get( 'permissions', False ): + action = 'permissions' + else: + action = 'information' + library_dataset = trans.app.model.LibraryDataset.get( id ) + if not library_dataset: + msg = "Invalid library dataset specified, id: %s" %str( id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if action == 'information': + if params.get( 'edit_attributes_button', False ): + old_name = library_dataset.name + new_name = util.restore_text( params.get( 'name', '' ) ) + new_info = util.restore_text( params.get( 'info', '' ) ) + if not new_name: + msg = 'Enter a valid name' + messagetype = 'error' + else: + library_dataset.name = new_name + library_dataset.info = new_info + library_dataset.flush() + msg = "Dataset '%s' has been renamed to '%s'" % ( old_name, new_name ) + messagetype = 'done' + return trans.fill_template( '/admin/library/library_dataset_info.mako', + library_dataset=library_dataset, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + elif action == 'permissions': + if params.get( 'update_roles_button', False ): + # The user clicked the Save button on the 'Edit permissions and role associations' form + permissions = {} + for k, v in trans.app.model.Library.permitted_actions.items(): + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + # Set the LIBRARY permissions on the LibraryDataset + # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions + trans.app.security_agent.set_all_library_permissions( library_dataset, permissions ) + library_dataset.refresh() + # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation + trans.app.security_agent.set_all_library_permissions( library_dataset.library_dataset_dataset_association, permissions ) + library_dataset.library_dataset_dataset_association.refresh() + msg = 'Permissions and roles have been updated for library dataset %s' % library_dataset.name + return trans.fill_template( '/admin/library/library_dataset_permissions.mako', + library_dataset=library_dataset, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def library_dataset_dataset_association( self, trans, library_id, folder_id, id=None, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + deleted = util.string_as_bool( params.get( 'deleted', False ) ) + show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) ) + dbkey = params.get( 'dbkey', None ) + if isinstance( dbkey, list ): + last_used_build = dbkey[0] + else: + last_used_build = dbkey + folder = trans.app.model.LibraryFolder.get( folder_id ) + if folder and last_used_build in [ 'None', None, '?' ]: + last_used_build = folder.genome_build + replace_id = params.get( 'replace_id', None ) + if replace_id: + replace_dataset = trans.app.model.LibraryDataset.get( int( replace_id ) ) + if not last_used_build: + last_used_build = replace_dataset.library_dataset_dataset_association.dbkey + else: + replace_dataset = None + # Let's not overwrite the imported datatypes module with the variable datatypes? + # The built-in 'id' is overwritten in lots of places as well + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] + ldatatypes.sort() + if params.get( 'new_dataset_button', False ): + upload_option = params.get( 'upload_option', 'upload_file' ) + created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans, + controller='library_admin', + library_id=library_id, + folder_id=folder_id, + replace_dataset=replace_dataset, + **kwd ) + if created_ldda_ids: + total_added = len( created_ldda_ids.split( ',' ) ) + if replace_dataset: + msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name ) + else: + if not folder.parent: + # Libraries have the same name as their root_folder + msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name ) + else: + msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name ) + msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary." + messagetype='done' + else: + msg = "Upload failed" + messagetype='error' + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + created_ldda_ids=created_ldda_ids, + msg=util.sanitize_text( msg ), + messagetype=messagetype ) ) + elif not id or replace_dataset: + # See if we have any associated templates + info_association = folder.get_info_association() + if info_association: + template = info_association.template + widgets = get_form_widgets( trans, template ) + else: + widgets = [] + upload_option = params.get( 'upload_option', 'upload_file' ) + # No dataset(s) specified, so display the upload form. Send list of data formats to the form + # so the "extension" select list can be populated dynamically + file_formats = trans.app.datatypes_registry.upload_file_formats + # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically + def get_dbkey_options( last_used_build ): + for dbkey, build_name in util.dbnames: + yield build_name, dbkey, ( dbkey==last_used_build ) + dbkeys = get_dbkey_options( last_used_build ) + # Send list of roles to the form so the dataset can be associated with 1 or more of them. + roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all() + # Send the current history to the form to enable importing datasets from history to library + history = trans.get_history() + history.refresh() + return trans.fill_template( '/admin/library/new_dataset.mako', + upload_option=upload_option, + library_id=library_id, + folder_id=folder_id, + replace_id=replace_id, + file_formats=file_formats, + dbkeys=dbkeys, + last_used_build=last_used_build, + roles=roles, + history=history, + widgets=widgets, + msg=msg, + messagetype=messagetype, + replace_dataset=replace_dataset ) + else: + if params.get( 'permissions', False ): + action = 'permissions' + elif params.get( 'edit_info', False ): + action = 'edit_info' + else: + action = 'info' + if id.count( ',' ): + ids = id.split( ',' ) + id = None + else: + ids = None + if id: + # ldda_id specified, display attributes form + ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) + if not ldda: + msg = "Invalid LibraryDatasetDatasetAssociation specified, id: %s" % str( id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + # See if we have any associated templates + info_association = ldda.get_info_association() + if info_association: + template = info_association.template + # See if we have any field contents + info = info_association.info + if info: + widgets = get_form_widgets( trans, template, info.content ) + else: + widgets = get_form_widgets( trans, template ) + else: + widgets = [] + if action == 'permissions': + if params.get( 'update_roles_button', False ): + permissions = {} + accessible = False + for k, v in trans.app.model.Dataset.permitted_actions.items(): + # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not + # the DATASET_ACCESS permission, making the former useless. Need to display a warning message. + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] + # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible + if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: + if len( in_roles ) > 1: + # Get the set of all users that are being associated with the dataset + in_roles_set = set() + for role in in_roles: + in_roles_set.add( role ) + users_set = set() + for role in in_roles: + for ura in role.users: + users_set.add( ura.user ) + # Make sure that at least 1 user has every role being associated with the dataset + for user in users_set: + user_roles_set = set() + for ura in user.roles: + user_roles_set.add( ura.role ) + if in_roles_set.issubset( user_roles_set ): + accessible = True + break + else: + accessible = True + if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: + # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions + # TODO: keep access permissions as they originally were, rather than automatically making public + permissions[ trans.app.security_agent.get_action( v.action ) ] = [] + else: + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + # Set the DATASET permissions on the Dataset + trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions ) + ldda.dataset.refresh() + permissions = {} + for k, v in trans.app.model.Library.permitted_actions.items(): + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + # Set the LIBRARY permissions on the LibraryDataset + # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions + trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions ) + ldda.library_dataset.refresh() + # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation + trans.app.security_agent.set_all_library_permissions( ldda, permissions ) + ldda.refresh() + if not accessible: + msg = "At least 1 user must have every role associated with accessing dataset '%s'. " % ldda.name + msg += "The roles you attempted to associate for access would make this dataset inaccessible by everyone, " + msg += "so access permissions were not set. All other permissions were updated for the dataset." + messagetype = 'error' + else: + msg = "Permissions updated for dataset '%s'" % ldda.name + return trans.fill_template( '/admin/library/ldda_permissions.mako', + ldda=ldda, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + elif action == 'info': + return trans.fill_template( '/admin/library/ldda_info.mako', + ldda=ldda, + library_id=library_id, + deleted=deleted, + show_deleted=show_deleted, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif action == 'edit_info': + if params.get( 'change', False ): + # The user clicked the Save button on the 'Change data type' form + if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) + trans.app.model.flush() + msg = "Data type changed for library dataset '%s'" % ldda.name + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + else: + return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) ) + elif params.get( 'save', False ): + # The user clicked the Save button on the 'Edit Attributes' form + old_name = ldda.name + new_name = util.restore_text( params.get( 'name', '' ) ) + new_info = util.restore_text( params.get( 'info', '' ) ) + new_message = util.restore_text( params.get( 'message', '' ) ) + if not new_name: + msg = 'Enter a valid name' + messagetype = 'error' + else: + ldda.name = new_name + ldda.info = new_info + ldda.message = new_message + # The following for loop will save all metadata_spec items + for name, spec in ldda.datatype.metadata_spec.items(): + if spec.get("readonly"): + continue + optional = params.get( "is_" + name, None ) + if optional and optional == 'true': + # optional element... == 'true' actually means it is NOT checked (and therefore ommitted) + setattr( ldda.metadata, name, None ) + else: + setattr( ldda.metadata, name, spec.unwrap( params.get ( name, None ) ) ) + ldda.metadata.dbkey = dbkey + ldda.datatype.after_edit( ldda ) + trans.app.model.flush() + msg = 'Attributes updated for library dataset %s' % ldda.name + messagetype = 'done' + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif params.get( 'detect', False ): + # The user clicked the Auto-detect button on the 'Edit Attributes' form + for name, spec in ldda.datatype.metadata_spec.items(): + # We need to be careful about the attributes we are resetting + if name not in [ 'name', 'info', 'dbkey' ]: + if spec.get( 'default' ): + setattr( ldda.metadata, name, spec.unwrap( spec.get( 'default' ) ) ) + ldda.datatype.set_meta( ldda ) + ldda.datatype.after_edit( ldda ) + trans.app.model.flush() + msg = 'Attributes updated for library dataset %s' % ldda.name + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif params.get( 'delete', False ): + ldda.deleted = True + ldda.flush() + msg = 'Dataset %s has been removed from this library' % ldda.name + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + ldda.datatype.before_edit( ldda ) + if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey: + # Copy dbkey into metadata, for backwards compatability + # This looks like it does nothing, but getting the dbkey + # returns the metadata dbkey unless it is None, in which + # case it resorts to the old dbkey. Setting the dbkey + # sets it properly in the metadata + ldda.metadata.dbkey = ldda.dbkey + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + elif ids: + # Multiple ids specfied, display permission form, permissions will be updated for all simultaneously. + lddas = [] + for id in [ int( id ) for id in ids ]: + ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) + if ldda is None: + msg = 'You specified an invalid LibraryDatasetDatasetAssociation id: %s' %str( id ) + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + lddas.append( ldda ) + if len( lddas ) < 2: + msg = 'You must specify at least two datasets on which to modify permissions, ids you sent: %s' % str( ids ) + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if action == 'permissions': + if params.get( 'update_roles_button', False ): + permissions = {} + accessible = False + for k, v in trans.app.model.Dataset.permitted_actions.items(): + # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not + # the DATASET_ACCESS permission, making the former useless. Need to display a warning message. + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ] + # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible + if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: + if len( in_roles ) > 1: + # Get the set of all users that are being associated with the dataset + in_roles_set = set() + for role in in_roles: + in_roles_set.add( role ) + users_set = set() + for role in in_roles: + for ura in role.users: + users_set.add( ura.user ) + # Make sure that at least 1 user has every role being associated with the dataset + for user in users_set: + user_roles_set = set() + for ura in user.roles: + user_roles_set.add( ura.role ) + if in_roles_set.issubset( user_roles_set ): + accessible = True + break + else: + accessible = True + if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: + # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions + # TODO: keep access permissions as they originally were, rather than automatically making public + permissions[ trans.app.security_agent.get_action( v.action ) ] = [] + else: + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + for ldda in lddas: + # Set the DATASET permissions on the Dataset + trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions ) + ldda.dataset.refresh() + permissions = {} + for k, v in trans.app.model.Library.permitted_actions.items(): + in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ] + permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles + for ldda in lddas: + # Set the LIBRARY permissions on the LibraryDataset + # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions + trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions ) + ldda.library_dataset.refresh() + # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation + trans.app.security_agent.set_all_library_permissions( ldda, permissions ) + ldda.refresh() + if not accessible: + msg = "At least 1 user must have every role associated with accessing these %d datasets. " % len( lddas ) + msg += "The roles you attempted to associate for access would make these datasets inaccessible by everyone, " + msg += "so access permissions were not set. All other permissions were updated for the datasets." + messagetype = 'error' + else: + msg = "Permissions have been updated on %d datasets" % len( lddas ) + return trans.fill_template( "/admin/library/ldda_permissions.mako", + ldda=lddas, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + # Ensure that the permissions across all library items are identical, otherwise we can't update them together. + check_list = [] + for ldda in lddas: + permissions = [] + # Check the library level permissions - the permissions on the LibraryDatasetDatasetAssociation + # will always be the same as the permissions on the associated LibraryDataset, so we only need to + # check one Library object + for library_permission in trans.app.security_agent.get_library_dataset_permissions( ldda.library_dataset ): + if library_permission.action not in permissions: + permissions.append( library_permission.action ) + for dataset_permission in trans.app.security_agent.get_dataset_permissions( ldda.dataset ): + if dataset_permission.action not in permissions: + permissions.append( dataset_permission.action ) + permissions.sort() + if not check_list: + check_list = permissions + if permissions != check_list: + msg = 'The datasets you selected do not have identical permissions, so they can not be updated together' + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + return trans.fill_template( "/admin/library/ldda_permissions.mako", + ldda=lddas, + library_id=library_id, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def add_history_datasets_to_library( self, trans, library_id, folder_id, hda_ids='', **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + try: + folder = trans.app.model.LibraryFolder.get( int( folder_id ) ) + except: + msg = "Invalid folder id: %s" % str( folder_id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + replace_id = params.get( 'replace_id', None ) + if replace_id: + replace_dataset = trans.app.model.LibraryDataset.get( replace_id ) + else: + replace_dataset = None + # See if the current history is empty + history = trans.get_history() + history.refresh() + if not history.active_datasets: + msg = 'Your current history is empty' + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if params.get( 'add_history_datasets_to_library_button', False ): + hda_ids = util.listify( hda_ids ) + if hda_ids: + dataset_names = [] + created_ldda_ids = '' + for hda_id in hda_ids: + hda = trans.app.model.HistoryDatasetAssociation.get( hda_id ) + if hda: + ldda = hda.to_library_dataset_dataset_association( target_folder=folder, replace_dataset=replace_dataset ) + created_ldda_ids = '%s,%s' % ( created_ldda_ids, str( ldda.id ) ) + dataset_names.append( ldda.name ) + if not replace_dataset: + # If replace_dataset is None, the Library level permissions will be taken from the folder and applied to the new + # LDDA and LibraryDataset. + trans.app.security_agent.copy_library_permissions( folder, ldda ) + trans.app.security_agent.copy_library_permissions( folder, ldda.library_dataset ) + # Permissions must be the same on the LibraryDatasetDatasetAssociation and the associated LibraryDataset + trans.app.security_agent.copy_library_permissions( ldda.library_dataset, ldda ) + else: + msg = "The requested HistoryDatasetAssociation id %s is invalid" % str( hda_id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + if created_ldda_ids: + created_ldda_ids = created_ldda_ids.lstrip( ',' ) + ldda_id_list = created_ldda_ids.split( ',' ) + total_added = len( ldda_id_list ) + if replace_dataset: + msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name ) + else: + if not folder.parent: + # Libraries have the same name as their root_folder + msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name ) + else: + msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name ) + msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary." + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + created_ldda_ids=created_ldda_ids, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + else: + msg = 'Select at least one dataset from the list of active datasets in your current history' + messagetype = 'error' + last_used_build = folder.genome_build + upload_option = params.get( 'upload_option', 'import_from_history' ) + # Send list of data formats to the form so the "extension" select list can be populated dynamically + file_formats = trans.app.datatypes_registry.upload_file_formats + # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically + def get_dbkey_options( last_used_build ): + for dbkey, build_name in util.dbnames: + yield build_name, dbkey, ( dbkey==last_used_build ) + dbkeys = get_dbkey_options( last_used_build ) + # Send list of roles to the form so the dataset can be associated with 1 or more of them. + roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all() + return trans.fill_template( "/admin/library/new_dataset.mako", + upload_option=upload_option, + library_id=library_id, + folder_id=folder_id, + replace_id=replace_id, + file_formats=file_formats, + dbkeys=dbkeys, + last_used_build=last_used_build, + roles=roles, + history=history, + widgets=widgets, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def info_template( self, trans, library_id, id=None, folder_id=None, ldda_id=None, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if id: + library_item = trans.app.model.FormDefinition.get( int( id ) ) + library_item_desc = 'information template' + response_action = 'info_template' + response_id = id + elif folder_id: + library_item = trans.app.model.LibraryFolder.get( int( folder_id ) ) + library_item_desc = 'folder' + response_action = 'folder' + response_id = folder_id + elif ldda_id: + library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( int( ldda_id ) ) + library_item_desc = 'library dataset' + response_action = 'library_dataset_dataset_association' + response_id = ldda_id + else: + library_item = trans.app.model.Library.get( int( library_id ) ) + library_item_desc = 'library' + response_action = 'browse_library' + response_id = library_id + forms = get_all_forms( trans, filter=dict(deleted=False) ) + if not forms: + msg = "There are no forms on which to base the template, so create a form and " + msg += "try again to add the information template to the %s." % library_item_desc + trans.response.send_redirect( web.url_for( controller='forms', + action='new', + new=True, + msg=msg, + messagetype='done' ) ) + if params.get( 'add', False ): + if params.get( 'add_info_template_button', False ): + form = trans.app.model.FormDefinition.get( int( kwd[ 'form_id' ] ) ) + #fields = list( copy.deepcopy( form.fields ) ) + form_values = trans.app.model.FormValues( form, [] ) + form_values.flush() + if folder_id: + assoc = trans.app.model.LibraryFolderInfoAssociation( library_item, form, form_values ) + elif ldda_id: + assoc = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, form, form_values ) + else: + assoc = trans.app.model.LibraryInfoAssociation( library_item, form, form_values ) + assoc.flush() + msg = 'An information template based on the form "%s" has been added to this %s.' % ( form.name, library_item_desc ) + trans.response.send_redirect( web.url_for( controller='library_admin', + action=response_action, + id=response_id, + msg=msg, + message_type='done' ) ) + return trans.fill_template( '/admin/library/select_info_template.mako', + library_item_name=library_item.name, + library_item_desc=library_item_desc, + library_id=library_id, + folder_id=folder_id, + ldda_id=ldda_id, + forms=forms, + msg=msg, + messagetype=messagetype ) + @web.expose + @web.require_admin + def edit_template_info( self, trans, library_id, num_widgets, library_item_id=None, library_item_type=None, **kwd ): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + folder_id = None + if library_item_type == 'library': + library_item = trans.app.model.Library.get( library_item_id ) + elif library_item_type == 'library_dataset': + library_item = trans.app.model.LibraryDataset.get( library_item_id ) + elif library_item_type == 'folder': + library_item = trans.app.model.LibraryFolder.get( library_item_id ) + elif library_item_type == 'library_dataset_dataset_association': + library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( library_item_id ) + # This response_action method requires a folder_id + folder_id = library_item.library_dataset.folder.id + else: + msg = "Invalid library item type ( %s ) specified, id ( %s )" % ( str( library_item_type ), str( library_item_id ) ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + # Save updated template field contents + field_contents = [] + for index in range( int( num_widgets ) ): + field_contents.append( util.restore_text( params.get( 'field_%i' % ( index ), '' ) ) ) + if field_contents: + # Since information templates are inherited, the template fields can be displayed on the information + # page for a folder or library dataset when it has no info_association object. If the user has added + # field contents on an inherited template via a parent's info_association, we'll need to create a new + # form_values and info_association for the current object. + info_association = library_item.get_info_association( restrict=True ) + if info_association: + template = info_association.template + info = info_association.info + form_values = trans.app.model.FormValues.get( info.id ) + # Update existing content only if it has changed + if form_values.content != field_contents: + form_values.content = field_contents + form_values.flush() + else: + # Inherit the next available info_association so we can get the template + info_association = library_item.get_info_association() + template = info_association.template + # Create a new FormValues object + form_values = trans.app.model.FormValues( template, field_contents ) + form_values.flush() + # Create a new info_association between the current library item and form_values + if library_item_type == 'folder': + info_association = trans.app.model.LibraryFolderInfoAssociation( library_item, template, form_values ) + info_association.flush() + elif library_item_type == 'library_dataset_dataset_association': + info_association = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, template, form_values ) + info_association.flush() + msg = 'The information has been updated.' + return trans.response.send_redirect( web.url_for( controller='library_admin', + action=library_item_type, + id=library_item.id, + library_id=library_id, + folder_id=folder_id, + edit_info=True, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + @web.expose + @web.require_admin + def download_dataset_from_folder(self, trans, id, library_id=None, **kwd): + """Catches the dataset id and displays file contents as directed""" + # id must refer to a LibraryDatasetDatasetAssociation object + ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) + if not ldda.dataset: + msg = 'Invalid LibraryDatasetDatasetAssociation id %s received for file downlaod' % str( id ) + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + mime = trans.app.datatypes_registry.get_mimetype_by_extension( ldda.extension.lower() ) + trans.response.set_content_type( mime ) + fStat = os.stat( ldda.file_name ) + trans.response.headers[ 'Content-Length' ] = int( fStat.st_size ) + valid_chars = '.,^_-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ' + fname = ldda.name + fname = ''.join( c in valid_chars and c or '_' for c in fname )[ 0:150 ] + trans.response.headers[ "Content-Disposition" ] = "attachment; filename=GalaxyLibraryDataset-%s-[%s]" % ( str( id ), fname ) + try: + return open( ldda.file_name ) + except: + msg = 'This dataset contains no content' + return trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + @web.expose + @web.require_admin + def datasets( self, trans, library_id, **kwd ): + # This method is used by the select list labeled "Perform action on selected datasets" + # on the admin library browser. + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if params.get( 'action_on_datasets_button', False ): + if not params.ldda_ids: + msg = "At least one dataset must be selected for %s" % params.action + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + ldda_ids = util.listify( params.ldda_ids ) + if params.action == 'edit': + # We need the folder containing the LibraryDatasetDatasetAssociation(s) + ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_ids[0] ) + trans.response.send_redirect( web.url_for( controller='library_admin', + action='library_dataset_dataset_association', + library_id=library_id, + folder_id=ldda.library_dataset.folder.id, + id=",".join( ldda_ids ), + permissions=True, + msg=util.sanitize_text( msg ), + messagetype=messagetype ) ) + elif params.action == 'delete': + for id in ldda_ids: + ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) + ldda.deleted = True + ldda.flush() + msg = "The selected datasets have been removed from this library" + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + show_deleted=False, + msg=util.sanitize_text( msg ), + messagetype='done' ) ) + else: + msg = "Action %s is not yet implemented" % str( params.action ) + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype='error' ) ) + else: + trans.response.send_redirect( web.url_for( controller='library_admin', + action='browse_library', + id=library_id, + msg=util.sanitize_text( msg ), + messagetype=messagetype ) ) + @web.expose + @web.require_admin + def delete_library_item( self, trans, library_id, library_item_id, library_item_type ): + # This action will handle deleting all types of library items. State is saved for libraries and + # folders ( i.e., if undeleted, the state of contents of the library or folder will remain, so previously + # deleted / purged contents will have the same state ). When a library or folder has been deleted for + # the amount of time defined in the cleanup_datasets.py script, the library or folder and all of its + # contents will be purged. The association between this method and the cleanup_datasets.py script + # enables clean maintenance of libraries and library dataset disk files. This is also why the following + # 3 objects, and not any of the associations ( the cleanup_datasets.py scipot handles everything else ). + library_item_types = { 'library': trans.app.model.Library, + 'folder': trans.app.model.LibraryFolder, + 'library_dataset': trans.app.model.LibraryDataset } + if library_item_type not in library_item_types: + msg = 'Bad library_item_type specified: %s' % str( library_item_type ) + messagetype = 'error' + else: + if library_item_type == 'library_dataset': + library_item_desc = 'Dataset' + else: + library_item_desc = library_item_type.capitalize() + library_item = library_item_types[ library_item_type ].get( int( library_item_id ) ) + library_item.deleted = True + library_item.flush() + msg = util.sanitize_text( "%s '%s' has been marked deleted" % ( library_item_desc, library_item.name ) ) + messagetype = 'done' + if library_item_type == 'library': + return self.browse_libraries( trans, msg=msg, messagetype=messagetype ) + else: + return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype ) + @web.expose + @web.require_admin + def undelete_library_item( self, trans, library_id, library_item_id, library_item_type ): + # This action will handle undeleting all types of library items + library_item_types = { 'library': trans.app.model.Library, + 'folder': trans.app.model.LibraryFolder, + 'library_dataset': trans.app.model.LibraryDataset } + if library_item_type not in library_item_types: + msg = 'Bad library_item_type specified: %s' % str( library_item_type ) + messagetype = 'error' + else: + if library_item_type == 'library_dataset': + library_item_desc = 'Dataset' + else: + library_item_desc = library_item_type.capitalize() + library_item = library_item_types[ library_item_type ].get( int( library_item_id ) ) + if library_item.purged: + msg = '%s %s has been purged, so it cannot be undeleted' % ( library_item_desc, library_item.name ) + messagetype = 'error' + else: + library_item.deleted = False + library_item.flush() + msg = util.sanitize_text( "%s '%s' has been marked undeleted" % ( library_item_desc, library_item.name ) ) + messagetype = 'done' + if library_item_type == 'library': + return self.browse_libraries( trans, msg=msg, messagetype=messagetype ) + else: + return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype ) diff -r f2af04af3caa -r d301a67eda40 templates/admin/index.mako --- a/templates/admin/index.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/index.mako Mon Sep 14 11:05:36 2009 -0400 @@ -89,7 +89,7 @@ </div> <div class="toolSectionBody"> <div class="toolSectionBg"> - <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div> + <div class="toolTitle"><a href="${h.url_for( controller='library_admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div> </div> </div> <div class="toolSectionPad"></div> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/browse_libraries.mako --- a/templates/admin/library/browse_libraries.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/browse_libraries.mako Mon Sep 14 11:05:36 2009 -0400 @@ -13,10 +13,10 @@ <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library', new=True )}"><span>Create a new data library</span></a> </li> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a> </li> %endif </ul> @@ -42,7 +42,7 @@ <tbody> %for library in libraries: <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - <td><a href="${h.url_for( controller='admin', action='browse_library', id=library.id, deleted=deleted, show_deleted=show_deleted )}">${library.name}</a></td> + <td><a href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, deleted=deleted, show_deleted=show_deleted )}">${library.name}</a></td> <td><i>${library.description}</i></td> </tr> %endfor diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/browse_library.mako Mon Sep 14 11:05:36 2009 -0400 @@ -97,26 +97,26 @@ <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> %endif <span class="libraryItemDeleted-${ldda.deleted}"> - <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a> + <a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a> </span> <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> %if not library.deleted and not folder.deleted and not library_dataset.deleted: <div popupmenu="dataset-${ldda.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use - ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> + ##<a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %if current_version: - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: - <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> %endif - <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a> + <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a> </div> %elif not library.deleted and not folder.deleted and library_dataset.deleted: <div popupmenu="dataset-${ldda.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a> </div> %endif </td> @@ -156,23 +156,23 @@ %endif %if not folder.deleted: <div popupmenu="folder-${folder.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> - <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> - <a class="action-button" href="${h.url_for( controller='admin', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a> ## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition ##%if folder.info_association: ## <% form_id = folder.info_association[0].template.id %> ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this folder's information template</a> ##%else: %if not folder.info_association: - <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, folder_id=folder.id, add=True )}">Add an information template to this folder</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, folder_id=folder.id, add=True )}">Add an information template to this folder</a> %endif - <a class="action-button" href="${h.url_for( controller='admin', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a> - <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='admin', action='delete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Delete this folder and its contents</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a> + <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Delete this folder and its contents</a> </div> %elif not deleted and folder.deleted and not folder.purged: <div popupmenu="folder-${folder.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Undelete this folder</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Undelete this folder</a> </div> %endif </li> @@ -216,10 +216,10 @@ <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a> </li> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a> </li> %endif </ul> @@ -228,7 +228,7 @@ ${render_msg( msg, messagetype )} %endif -<form name="update_multiple_datasets" action="${h.url_for( controller='admin', action='datasets', library_id=library.id )}" onSubmit="javascript:return checkForm();" method="post"> +<form name="update_multiple_datasets" action="${h.url_for( controller='library_admin', action='datasets', library_id=library.id )}" onSubmit="javascript:return checkForm();" method="post"> <ul> <li class="libraryRow libraryOrFolderRow" id="libraryRow"> <div class="rowTitle"> @@ -244,24 +244,24 @@ <a id="library-${library.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="library-${library.id}-popup"> %if not deleted: - <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library', id=library.id, information=True )}">Edit this data library's information</a> ## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition ##%if library.info_association: ## <% form_id = library.info_association[0].template.id %> ## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this data library's information template</a> ##%else: %if not library.info_association: - <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a> %endif - <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a> - <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a> + <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a> %if show_deleted: - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a> %else: - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a> %endif %elif not library.purged: - <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a> %endif </div> </th> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/common.mako --- a/templates/admin/library/common.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/common.mako Mon Sep 14 11:05:36 2009 -0400 @@ -22,7 +22,7 @@ <div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div> <div class="toolFormBody"> %if editable: - <form name="edit_info" action="${h.url_for( controller='admin', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post"> + <form name="edit_info" action="${h.url_for( controller='library_admin', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post"> <input type="hidden" name="library_item_id" value="${library_item.id}"/> <input type="hidden" name="library_item_type" value="${library_item_type}"/> %for i, field in enumerate( widgets ): diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/folder_info.mako --- a/templates/admin/library/folder_info.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/folder_info.mako Mon Sep 14 11:05:36 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -16,7 +16,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit folder name and description</div> <div class="toolFormBody"> - <form name="folder" action="${h.url_for( controller='admin', action='folder', information=True, id=folder.id, library_id=library_id )}" method="post" > + <form name="folder" action="${h.url_for( controller='library_admin', action='folder', information=True, id=folder.id, library_id=library_id )}" method="post" > <div class="form-row"> <label>Name:</label> <input type="text" name="name" value="${folder.name}" size="40"/> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/folder_permissions.mako --- a/templates/admin/library/folder_permissions.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/folder_permissions.mako Mon Sep 14 11:05:36 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -17,4 +17,4 @@ roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> -${render_permission_form( folder, folder.name, h.url_for( controller='admin', action='folder', id=folder.id, library_id=library_id, permissions=True ), roles )} +${render_permission_form( folder, folder.name, h.url_for( controller='library_admin', action='folder', id=folder.id, library_id=library_id, permissions=True ), roles )} diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_edit_info.mako --- a/templates/admin/library/ldda_edit_info.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/ldda_edit_info.mako Mon Sep 14 11:05:36 2009 -0400 @@ -12,7 +12,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -35,7 +35,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${ldda.name}</div> <div class="toolFormBody"> - <form name="edit_attributes" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <form name="edit_attributes" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> <input type="hidden" name="id" value="${ldda.id}"/> <br/> <div class="form-row"> @@ -73,7 +73,7 @@ <input type="submit" name="save" value="Save"/> </div> </form> - <form name="auto_detect" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <form name="auto_detect" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> <div class="form-row"> <input type="hidden" name="id" value="${ldda.id}"/> <input type="submit" name="detect" value="Auto-detect"/> @@ -89,7 +89,7 @@ <div class="toolFormTitle">Change data type of ${ldda.name}</div> <div class="toolFormBody"> %if ldda.datatype.allow_datatype_change: - <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <form name="change_datatype" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> <input type="hidden" name="id" value="${ldda.id}"/> <div class="form-row"> <label>New Type:</label> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_info.mako --- a/templates/admin/library/ldda_info.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/ldda_info.mako Mon Sep 14 11:05:36 2009 -0400 @@ -20,7 +20,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a> </li> </ul> @@ -41,18 +41,18 @@ %if not library.deleted and not ldda.library_dataset.folder.deleted and not ldda.deleted: <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use - ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library_id, library_dataset_id=ldda.library_dataset.id, new_template=True )}">Add an information template to this dataset</a> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> + ##<a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library_id, library_dataset_id=ldda.library_dataset.id, new_template=True )}">Add an information template to this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %if current_version: - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: - <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library_id )}">Download this dataset</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='download_dataset_from_folder', id=ldda.id, library_id=library_id )}">Download this dataset</a> %endif %if not library.deleted and not ldda.library_dataset.folder.deleted and not ldda.deleted: - <a class="action-button" confirm="Click OK to remove dataset '${ldda.name}'?" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, delete=True )}">Delete this dataset</a> + <a class="action-button" confirm="Click OK to remove dataset '${ldda.name}'?" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, delete=True )}">Delete this dataset</a> %endif </div> %endif @@ -104,7 +104,7 @@ <div class="toolFormTitle">Expired versions of ${ldda.name}</div> %for expired_ldda in expired_lddas: <div class="form-row"> - <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=expired_ldda.library_dataset.folder.id, id=expired_ldda.id, info=True )}">${expired_ldda.name}</a> + <a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=expired_ldda.library_dataset.folder.id, id=expired_ldda.id, info=True )}">${expired_ldda.name}</a> </div> %endfor %endif diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_permissions.mako --- a/templates/admin/library/ldda_permissions.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/ldda_permissions.mako Mon Sep 14 11:05:36 2009 -0400 @@ -15,7 +15,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -35,7 +35,7 @@ <a id="ldda-${ldd_assoc.id}-popup" class="popup-arrow" style="display: none;">▼</a> </div> <div popupmenu="ldd_assoc-${ldd_assoc.id}-popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset', id=ldd_assoc.library_dataset_id, library_id=library_id )}">Manage this dataset's versions</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset', id=ldd_assoc.library_dataset_id, library_id=library_id )}">Manage this dataset's versions</a> </div> </td> <td> @@ -59,4 +59,4 @@ %endif <% ldda_ids = ",".join( [ str( d.id ) for d in lddas ] ) %> -${render_permission_form( lddas[0], name_str, h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=lddas[0].library_dataset.folder.id, id=ldda_ids, permissions=True ), roles )} +${render_permission_form( lddas[0], name_str, h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=lddas[0].library_dataset.folder.id, id=ldda_ids, permissions=True ), roles )} diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_dataset_info.mako --- a/templates/admin/library/library_dataset_info.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/library_dataset_info.mako Mon Sep 14 11:05:36 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -22,7 +22,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div> <div class="toolFormBody"> - <form name="edit_attributes" action="${h.url_for( controller='admin', action='library_dataset' )}" method="post"> + <form name="edit_attributes" action="${h.url_for( controller='library_admin', action='library_dataset' )}" method="post"> <input type="hidden" name="id" value="${library_dataset.id}"/> <div class="form-row"> <label>Name:</label> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_dataset_permissions.mako --- a/templates/admin/library/library_dataset_permissions.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/library_dataset_permissions.mako Mon Sep 14 11:05:36 2009 -0400 @@ -11,7 +11,7 @@ <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -23,4 +23,4 @@ roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> -${render_permission_form( library_dataset, library_dataset.name, h.url_for( controller='admin', action='library_dataset', id=library_dataset.id, library_id=library_id, permissions=True ), roles )} +${render_permission_form( library_dataset, library_dataset.name, h.url_for( controller='library_admin', action='library_dataset', id=library_dataset.id, library_id=library_id, permissions=True ), roles )} diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_info.mako --- a/templates/admin/library/library_info.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/library_info.mako Mon Sep 14 11:05:36 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> @@ -16,7 +16,7 @@ <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> - <form name="library" action="${h.url_for( controller='admin', action='library', information=True, id=library.id )}" method="post" > + <form name="library" action="${h.url_for( controller='library_admin', action='library', information=True, id=library.id )}" method="post" > <div class="form-row"> <label>Name:</label> <div style="float: left; width: 250px; margin-right: 10px;"> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_permissions.mako --- a/templates/admin/library/library_permissions.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/library_permissions.mako Mon Sep 14 11:05:36 2009 -0400 @@ -5,7 +5,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a> </li> </ul> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_dataset.mako --- a/templates/admin/library/new_dataset.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/new_dataset.mako Mon Sep 14 11:05:36 2009 -0400 @@ -7,16 +7,16 @@ <b>Create new data library datasets</b> <a id="upload-librarydataset--popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="upload-librarydataset--popup"> - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a> %if trans.app.config.library_import_dir and os.path.exists( trans.app.config.library_import_dir ): - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_directory' )}">Upload directory of files</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_directory' )}">Upload directory of files</a> %endif - <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='import_from_history' )}">Import datasets from your current history</a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='import_from_history' )}">Import datasets from your current history</a> </div> <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -32,13 +32,13 @@ <div class="toolFormTitle">Upload a directory of files</div> %endif <div class="toolFormBody"> - <form name="tool_form" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id )}" enctype="multipart/form-data" method="post"> + <form name="tool_form" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id )}" enctype="multipart/form-data" method="post"> <input type="hidden" name="folder_id" value="${folder_id}"/> <input type="hidden" name="upload_option" value="${upload_option}"/> %if replace_dataset: <input type="hidden" name="replace_id" value="${replace_dataset.id}"/> <div class="form-row"> - You are currently selecting a new file to replace '<a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'. + You are currently selecting a new file to replace '<a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'. <div style="clear: both"></div> </div> %endif @@ -184,13 +184,13 @@ <div class="toolFormTitle">Active datasets in your current history (${history.name})</div> <div class="toolFormBody"> %if history and history.active_datasets: - <form name="add_history_datasets_to_library" action="${h.url_for( controller='admin', action='add_history_datasets_to_library', library_id=library_id )}" enctype="multipart/form-data" method="post"> + <form name="add_history_datasets_to_library" action="${h.url_for( controller='library_admin', action='add_history_datasets_to_library', library_id=library_id )}" enctype="multipart/form-data" method="post"> <input type="hidden" name="folder_id" value="${folder_id}"/> <input type="hidden" name="upload_option" value="${upload_option}"/> %if replace_dataset: <input type="hidden" name="replace_id" value="${replace_dataset.id}"/> <div class="form-row"> - You are currently selecting a new file to replace '<a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'. + You are currently selecting a new file to replace '<a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'. <div style="clear: both"></div> </div> %endif diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_folder.mako --- a/templates/admin/library/new_folder.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/new_folder.mako Mon Sep 14 11:05:36 2009 -0400 @@ -4,7 +4,7 @@ <br/<br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -15,7 +15,7 @@ <div class="toolForm"> <div class="toolFormTitle">Create a new folder</div> <div class="toolFormBody"> - <form name="folder" action="${h.url_for( controller='admin', action='folder', id=folder.id, library_id=library_id )}" method="post" > + <form name="folder" action="${h.url_for( controller='library_admin', action='folder', id=folder.id, library_id=library_id )}" method="post" > <div class="form-row"> <label>Name:</label> <div style="float: left; width: 250px; margin-right: 10px;"> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_library.mako --- a/templates/admin/library/new_library.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/new_library.mako Mon Sep 14 11:05:36 2009 -0400 @@ -8,7 +8,7 @@ <div class="toolForm"> <div class="toolFormTitle">Create a new data library</div> <div class="toolFormBody"> - <form name="library" action="${h.url_for( controller='admin', action='library' )}" method="post" > + <form name="library" action="${h.url_for( controller='library_admin', action='library' )}" method="post" > <div class="form-row"> <label>Name:</label> <div style="float: left; width: 250px; margin-right: 10px;"> diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/select_info_template.mako --- a/templates/admin/library/select_info_template.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/library/select_info_template.mako Mon Sep 14 11:05:36 2009 -0400 @@ -4,7 +4,7 @@ <br/><br/> <ul class="manage-table-actions"> <li> - <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> + <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a> </li> </ul> @@ -14,7 +14,7 @@ <div class="toolForm"> <div class="toolFormTitle">Select a form on which to base the template for the ${library_item_desc} '${library_item_name}'</div> - <form name="new_info_template" action="${h.url_for( controller='admin', action='info_template', add=True )}" method="post" > + <form name="new_info_template" action="${h.url_for( controller='library_admin', action='info_template', add=True )}" method="post" > <div class="toolFormBody"> <div class="form-row"> <input type="hidden" name="library_id" value="${library_id}"/> diff -r f2af04af3caa -r d301a67eda40 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Fri Sep 11 16:09:02 2009 -0400 +++ b/templates/admin/requests/show_request.mako Mon Sep 14 11:05:36 2009 -0400 @@ -80,7 +80,7 @@ <i>None</i> %else: %if rd['label'] == 'Data library': - <a href="${h.url_for( controller='admin', action='browse_library', id=request.library.id )}">${rd['value']}</a> + <a href="${h.url_for( controller='library_admin', action='browse_library', id=request.library.id )}">${rd['value']}</a> %else: ${rd['value']} %endif diff -r f2af04af3caa -r d301a67eda40 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Fri Sep 11 16:09:02 2009 -0400 +++ b/test/base/twilltestcase.py Mon Sep 14 11:05:36 2009 -0400 @@ -1139,14 +1139,14 @@ def create_library( self, name='Library One', description='This is Library One' ): """Create a new library""" self.home() - self.visit_url( "%s/admin/library?new=True" % self.url ) + self.visit_url( "%s/library_admin/library?new=True" % self.url ) self.check_page_for_string( 'Create a new data library' ) tc.fv( "1", "1", name ) # form field 1 is the field named name... tc.fv( "1", "2", description ) # form field 1 is the field named name... tc.submit( "create_library_button" ) self.home() def set_library_permissions( self, library_id, library_name, role_id, permissions_in, permissions_out ): - url = "admin/library?id=%s&permissions=True&update_roles_button=Save" % ( library_id ) + url = "library_admin/library?id=%s&permissions=True&update_roles_button=Save" % ( library_id ) for po in permissions_out: key = '%s_out' % po url ="%s&%s=%s" % ( url, key, str( role_id ) ) @@ -1161,10 +1161,10 @@ def rename_library( self, library_id, old_name, name='Library One Renamed', description='This is Library One Re-described' ): """Rename a library""" self.home() - self.visit_url( "%s/admin/library?information=True&id=%s" % ( self.url, library_id ) ) + self.visit_url( "%s/library_admin/library?information=True&id=%s" % ( self.url, library_id ) ) self.check_page_for_string( 'Change library name and description' ) # Since twill barfs on the form submisson, we ar forced to simulate it - url = "%s/admin/library?information=True&id=%s&rename_library_button=Save&description=%s&name=%s" % \ + url = "%s/library_admin/library?information=True&id=%s&rename_library_button=Save&description=%s&name=%s" % \ ( self.url, library_id, description.replace( ' ', '+' ), name.replace( ' ', '+' ) ) self.home() self.visit_url( url ) @@ -1174,7 +1174,7 @@ def add_library_info_template( self, library_id, library_name, form_id, form_name ): """Add a new info template to a library""" self.home() - url = "%s/admin/info_template?library_id=%s&add=True" % ( self.url, library_id ) + url = "%s/library_admin/info_template?library_id=%s&add=True" % ( self.url, library_id ) self.visit_url( url ) self.check_page_for_string ( "Select a form on which to base the template" ) tc.fv( '1', 'library_id', library_id ) @@ -1184,7 +1184,7 @@ def edit_library_info( self, library_id, library_name, ele_1_field_name, ele_1_contents, ele_2_field_name, ele_2_contents ): """Add information to a library using an existing template with 2 elements""" self.home() - self.visit_url( "%s/admin/library?information=True&id=%s" % ( self.url, library_id ) ) + self.visit_url( "%s/library_admin/library?information=True&id=%s" % ( self.url, library_id ) ) check_str = 'Other information about library %s' % library_name self.check_page_for_string( check_str ) tc.fv( '2', ele_1_field_name, ele_1_contents ) @@ -1195,7 +1195,7 @@ ele_desc_1, desc_1, ele_name_2, name_2, ele_desc_2, desc_2 ): """Edit an existing library info template""" self.home() - url = "%s/admin/info_template?library_id=%s&id=%s&edit_template=True" % ( self.url, library_id, id ) + url = "%s/library_admin/info_template?library_id=%s&id=%s&edit_template=True" % ( self.url, library_id, id ) self.visit_url( url ) self.check_page_for_string ( 'Edit template' ) tc.fv( '1', 'id', id ) @@ -1213,7 +1213,7 @@ name='Folder Template 1', ele_name_0='Fu', ele_help_0='', ele_name_1='Bar', ele_help_1='' ): """Add a new info template to a folder""" self.home() - url = "%s/admin/info_template?library_id=%s&folder_id=%s&new_template=True&num_fields=2&create_info_template_button=Go" % \ + url = "%s/library_admin/info_template?library_id=%s&folder_id=%s&new_template=True&num_fields=2&create_info_template_button=Go" % \ ( self.url, library_id, folder_id ) self.home() self.visit_url( url ) @@ -1232,7 +1232,7 @@ def add_folder( self, library_id, folder_id, name='Folder One', description='This is Folder One' ): """Create a new folder""" self.home() - self.visit_url( "%s/admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) ) + self.visit_url( "%s/library_admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) )

1 0

[hg] galaxy 2684: Merge
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/355b6844b123 changeset: 2684:355b6844b123 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Sep 11 15:04:53 2009 -0400 description: Merge 0 file(s) affected in this change: diffs (878 lines): diff -r 032478337b82 -r 355b6844b123 eggs.ini --- a/eggs.ini Fri Sep 11 14:57:02 2009 -0400 +++ b/eggs.ini Fri Sep 11 15:04:53 2009 -0400 @@ -31,7 +31,7 @@ elementtree = 1.2.6_20050316 lrucache = 0.2 ;lsprof - james -Mako = 0.2.4 +Mako = 0.2.5 MyghtyUtils = 0.52 nose = 0.9.1 NoseHTML = 0.2 @@ -79,7 +79,7 @@ docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz -Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz +Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2 diff -r 032478337b82 -r 355b6844b123 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 14:57:02 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 15:04:53 2009 -0400 @@ -1,4 +1,8 @@ #!/usr/bin/env python + +from galaxy import eggs +import pkg_resources +pkg_resources.require( "SQLAlchemy >= 0.4" ) import sys, os, time, ConfigParser, shutil from datetime import datetime, timedelta @@ -9,12 +13,7 @@ new_path.extend( sys.path[1:] ) # remove scripts/ from the path sys.path = new_path -from galaxy import eggs import galaxy.model.mapping -import pkg_resources - -pkg_resources.require( "SQLAlchemy >= 0.4" ) - from galaxy.model.orm import and_, eagerload assert sys.version_info[:2] >= ( 2, 4 ) diff -r 032478337b82 -r 355b6844b123 templates/workflow/run.mako --- a/templates/workflow/run.mako Fri Sep 11 14:57:02 2009 -0400 +++ b/templates/workflow/run.mako Fri Sep 11 15:04:53 2009 -0400 @@ -87,8 +87,7 @@ ${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )} <input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" /> %endif - %elif isinstance( value, RuntimeValue ) or \ - ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: + %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: ## On the first load we may see a RuntimeValue, so we write ## an input field using the initial value for the param. ## Subsequents posts will no longer have the runtime value diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in1.fastq Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,5 @@ +@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 +GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I + diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in2.fastq Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,4 @@ +@HWI-EAS91_1_30788AAXX:1:2:618:346/1 +TAGACTACGAAAGTGACTTTAATACCTCTGACTACA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in3.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in3.fastq Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,4 @@ +@HWI-EAS91_1_30788AAXX:1:2:618:346/2 +ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG ++ +IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2) diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_out1.sam Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,1 @@ +HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_out2.sam Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,2 @@ +HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36 +HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18 diff -r 032478337b82 -r 355b6844b123 tool-data/bowtie_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie_indices.loc.sample Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,28 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Bowtie indexed sequences data files. You will need +#to create these data files and then create a bowtie_indices.loc file +#similar to this one (store it in this directory ) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (white space characters are TAB characters): +# +#<build> <file_base> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/bowtie/hg18/, +#then the bowtie_indices.loc entry would look like this: +# +#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +# +#and your /depot/data2/galaxy/bowtie/hg18/ directory +#would contain hg18.*.ebwt files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt +#...etc... +# +#Your bowtie_indices.loc file should include an entry per line for +#each index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 diff -r 032478337b82 -r 355b6844b123 tool_conf.xml.sample --- a/tool_conf.xml.sample Fri Sep 11 14:57:02 2009 -0400 +++ b/tool_conf.xml.sample Fri Sep 11 15:04:53 2009 -0400 @@ -332,7 +332,8 @@ <tool file="metag_tools/megablast_xml_parser.xml" /> <tool file="metag_tools/blat_wrapper.xml" /> <tool file="metag_tools/mapping_to_ucsc.xml" /> - </section> + <tool file="sr_mapping/bowtie_wrapper.xml" /> + </section> <section name="Tracks" id="tracks"> <tool file="visualization/genetrack.xml" /> </section> diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/bowtie_wrapper.py Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,174 @@ +#! /usr/bin/python + +""" +Runs Bowtie on single-end or paired-end data. +""" + +import optparse, os, sys, tempfile + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format') + parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format') + parser.add_option('', '--output', dest='output', help='The output file') + parser.add_option('', '--paired', dest='paired', help='Whether the data is single- or paired-end') + parser.add_option('', '--genomeSource', dest='genomeSource', help='The type of reference provided') + parser.add_option('', '--ref', dest='ref', help='The reference genome to use or index') + parser.add_option('', '--skip', dest='skip', help='Skip the first n reads') + parser.add_option('', '--alignLimit', dest='alignLimit', help='Only align the first n reads') + parser.add_option('', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment') + parser.add_option('', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment') + parser.add_option('', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed') + parser.add_option('', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions') + parser.add_option('', '--seedLen', dest='seedLen', help='Seed length') + parser.add_option('', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30') + parser.add_option('', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy') + parser.add_option('', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist') + parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read') + parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read') + parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist') + parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments') + parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions") + parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read') + parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode') + parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable') + parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments') + parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments') + parser.add_option('', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand') + parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate') + parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand') + parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand') + parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time') + parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n') + parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index') + parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator') + parser.add_option('', '--dbkey', dest='dbkey', help='') + parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters') + parser.add_option('', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior') + parser.add_option('', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings') + parser.add_option('', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block') + parser.add_option('', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference') + parser.add_option('', '--idcv', dest='idcv', help='The period for the difference-cover sample') + parser.add_option('', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample') + parser.add_option('', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paried-end alignment') + parser.add_option('', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows') + parser.add_option('', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query') + parser.add_option('', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As') + parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file') + parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator') + parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index') + parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8') + parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set') + (options, args) = parser.parse_args() + + # index if necessary + if options.genomeSource == 'history': + # set up commands + if options.index_settings =='index_pre_set': + indexing_cmds = '' + else: + try: + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + (('','--noauto')[options.iauto_b=='set'], + ('','--packed')[options.ipacked=='packed'], + ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1], + ('','--bmaxdivn %s'%options.ibmaxdivn)[options.ibmaxdivn!='None'], + ('','--dcv %s'%options.idcv)[options.idcv!='None'], + ('','--nodc')[options.inodc=='nodc'], + ('','--noref')[options.inoref=='noref'], options.ioffrate, + ('','--ftabchars %s'%options.iftab)[int(options.iftab)>=0], + ('','--ntoa')[options.intoa=='yes'], + ('--little','--big')[options.iendian=='big'], + ('','--seed %s'%options.iseed)[int(options.iseed)>0], + ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0], + ('','--oldpmap')[options.ioldpmap=='yes']) + except ValueError: + indexing_cmds = '' + + # make temp directory for placement of indices and copy reference file there + tmp_dir = tempfile.gettempdir() + try: + os.system('cp %s %s' % (options.ref, tmp_dir)) + except Exception, erf: + stop_err('Error creating temp directory for indexing purposes\n' + str(erf)) + options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1]) + cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref) + try: + os.system(cmd1) + except Exception, erf: + stop_err('Error indexing reference sequence\n' + str(erf)) + + # set up aligning and generate aligning command options + # automatically set threads to 8 in both cases + if options.params == 'pre_set': + aligning_cmds = '-p 8' + else: + try: + aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \ + '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \ + (('','-s %s'%options.skip)[options.skip!='None'], + ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0], + ('','-5 %s'%options.trimH)[int(options.trimH)>=0], + ('','-3 %s'%options.trimL)[int(options.trimL)>=0], + ('','-n %s'%options.mismatchSeed)[options.mismatchSeed=='0' or options.mismatchSeed=='1' or options.mismatchSeed=='2' or options.mismatchSeed=='3'], + ('','-e %s'%options.mismatchQual)[int(options.mismatchQual)>=0], + ('','-l %s'%options.seedLen)[int(options.seedLen)>=5], + ('','--nomaqround')[options.rounding=='noRound'], + ('','-v %s'%options.maqSoapAlign)[options.maqSoapAlign!='-1'], + ('','-I %s'%options.minInsert)[options.minInsert!='None'], + ('','-X %s'%options.maxInsert)[options.maxInsert!='None'], + ('','--%s'%options.mateOrient)[options.mateOrient!='None'], + ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0], + ('','--nofw')[options.forwardAlign=='noForward'], + ('','--norc')[options.reverseAlign=='noReverse'], + ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')], + ('','-y')[options.tryHard=='doTryHard'], + ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0], + ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0], + ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0], + ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0], + ('','--best')[options.best=='doBest'], + ('','--strata')[options.strata=='doStrata'], + ('','-B %s'%options.offbase)[int(options.offbase)>=0], + ('','-z %s'%options.phased)[options.phased!='None'], + ('','-o %s'%options.offrate)[int(options.offrate)>=0], + ('','--mm')[options.mm=='doMm'], + ('','--seed %s'%options.seed)[int(options.seed)>=0]) + except ValueError: + aligning_cmds = '-p 8' + + tmp_out = tempfile.NamedTemporaryFile() + + # prepare actual aligning commands + if options.paired == 'paired': + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name) + else: + cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name) + # prepare command to convert bowtie output to sam and alternative + cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output) + cmd4 = 'cp %s %s' % (tmp_out.name, options.output) + + # align + try: + os.system(cmd2) + except Exception, erf: + stop_err("Error aligning sequence\n" + str(erf)) + if len(file(tmp_out.name,'r').read()) > 0: + #convert + try: + os.system(cmd3) + except Exception, erf: + stop_err('Error converting output to sam format\n' + str(erf)) + else: + try: + os.system(cmd4) + sys.stdout.write('Alignment file contained no data') + except Exception, erf: + stop_err('Error producing alignment file. File contained no data.\n' + str(erf)) + +if __name__=="__main__": __main__() diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/bowtie_wrapper.xml Fri Sep 11 15:04:53 2009 -0400 @@ -0,0 +1,556 @@ +<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0"> + <description> fast alignment of reads against reference sequence </description> + <command interpreter="python"> + bowtie_wrapper.py + --input1=$singlePaired.input1 + #if $singlePaired.sPaired == "paired": + --input2=$singlePaired.input2 + #else: + --input2="None" + #end if + --output=$output + --paired=$singlePaired.sPaired + --genomeSource=$refGenomeSource.genomeSource + #if $refGenomeSource.genomeSource == "history": + --ref=$refGenomeSource.ownFile + #else: + --ref=$refGenomeSource.indices.value + #end if + --params=$singlePaired.params.settings_type + #if $singlePaired.params.settings_type == "full": + --skip=$singlePaired.params.skip + --alignLimit=$singlePaired.params.alignLimit + --trimH=$singlePaired.params.trimH + --trimL=$singlePaired.params.trimL + --mismatchSeed=$singlePaired.params.mismatchSeed + --mismatchQual=$singlePaired.params.mismatchQual + --seedLen=$singlePaired.params.seedLen + --rounding=$singlePaired.params.rounding + --maqSoapAlign=$singlePaired.params.maqSoapAlign + --tryHard=$singlePaired.params.tryHard + --valAlign=$singlePaired.params.valAlign + --allValAligns=$singlePaired.params.allValAligns + --suppressAlign=$singlePaired.params.suppressAlign + --offbase=$singlePaired.params.offbase + --offrate=$singlePaired.params.offrate + --mm=$singlePaired.params.mm + --seed=$singlePaired.params.seed + --best=$singlePaired.params.bestOption.best + #if $singlePaired.params.bestOption.best == "doBest": + --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks + --threadMem=$singlePaired.params.bestOption.threadMem + --strata=$singlePaired.params.bestOption.strata + --phased="None" + #else: + --maxBacktracks="None" + --threadMem="None" + --strata="None" + #if $singlePaired.sPaired =="single": + --phased=$singlePaired.params.bestOption.phased + #else: + --phased="None" + #end if + #end if + #if $singlePaired.sPaired == "single": + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + #else: + --minInsert=$singlePaired.params.minInsert + --maxInsert=$singlePaired.params.maxInsert + --mateOrient=$singlePaired.params.mateOrient + --maxAlignAttempt=$singlePaired.params.maxAlignAttempt + --forwardAlign=$singlePaired.params.forwardAlign + --reverseAlign=$singlePaired.params.reverseAlign + #end if + #else + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --offbase="None" + --best="None" + --maxBacktracks="None" + --threadMem="None" + --strata="None" + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + --phased="None" + --offrate="None" + --mm="None" + --seed="None" + #end if + #if $refGenomeSource.genomeSource == "history": + --dbkey=$dbkey + #else: + --dbkey="None" + #end if + #if $refGenomeSource.genomeSource == "history": + --indexSettings=$refGenomeSource.indexParams.index_settings + #else: + --indexSettings="None" + #end if + #if $refGenomeSource.genomeSource == "history" and $refGenomeSource.indexParams.index_settings == "index_full": + --iauto_b=$refGenomeSource.indexParams.auto_behavior.auto_b + #if $refGenomeSource.indexParams.auto_behavior.auto_b == "set": + --ipacked=$refGenomeSource.indexParams.auto_behavior.packed + --ibmax=$refGenomeSource.indexParams.auto_behavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.auto_behavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.auto_behavior.dcv + #else: + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + --ioldpmap=$refGenomeSource.indexParams.oldpmap + #else: + --iauto_b="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + --ioldpmap="None" + #end if + </command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="indices" type="select" label="Select a reference genome"> + <options from_file="bowtie_indices.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + <filter type="sort_by" column="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + <conditional name="indexParams"> + <param name="index_settings" type="select" label="Choose whether to use default options or to set your own"> + <option value="index_pre_set">Commonly Used</option> + <option value="index_full">Full Parameter List</option> + </param> + <when value="index_pre_set" /> + <when value="index_full"> + <conditional name="auto_behavior"> + <param name="auto_b" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> + <option value="auto">Automatic behavior</option> + <option value="set">Set values (sets --noauto and allows others to be set)</option> + </param> + <when value="auto" /> + <when value="set"> + <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> + <option value="unpacked">Use regular representation</option> + <option value="packed">Use packed representation</option> + </param> + <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> + <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> + <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> + </when> + </conditional> + <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetetive reference)"> + <option value="dc">Use difference-cover sample</option> + <option value="nodc">Disable difference-cover sample</option> + </param> + <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> + <option value="ref">Build all index files</option> + <option value="noref">Do not build paired-end alignment index files</option> + </param> + <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> + <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> + <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> + <option value="no">Do not convert Ns</option> + <option value="yes">Convert Ns to As</option> + </param> + <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> + <option value="little">Little</option> + <option value="big">Big</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> + <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> + <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't"> + <option value="no">Use the new scheme</option> + <option value="yes">Use the old scheme</option> + </param> + </when>  + </conditional> + </when> + </conditional>  + <conditional name="singlePaired"> + <param name="sPaired" type="select" label="Is this library mate-paired?"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> + <conditional name="params"> + <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="pre_set">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="pre_set" /> + <when value="full"> + <param name="skip" type="integer" value="0" label="Skip the first n reads (-s)" /> + <param name="alignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> + <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> + <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> + <conditional name="bestOption"> + <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)"> + <option value="noPhased">Don't alternate</option> + <option value="doPhased">Do alternate</option> + </param> + </when> + <when value="doBest"> + <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> + <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional>  + <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)"> + <option value="noMm">Use POSIX/C file I/O</option> + <option value="doMm">Use memory-mapped I/O</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when>  + </conditional>  + </when>  + <when value="paired"> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> + <conditional name="params"> + <param name="settings_type" type="select" label="BWA settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="pre_set">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="pre_set" /> + <when value="full"> + <param name="skip" type="integer" value="0" label="Skip the first n pairs (-s)" /> + <param name="alignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> + <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> + <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="mateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + <option value="ff">FF</option> + </param> + <param name="maxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> + <param name="forwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> + <option value="forward">Align against the forward reference strand</option> + <option value="noForward">Do not align against the forward reference strand</option> + </param> + <param name="reverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> + <option value="reverse">Align against the reverse-complement reference strand</option> + <option value="noReverse">Do not align against the reverse-complement reference strand</option> + </param> + <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> + <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> + <conditional name="bestOption"> + <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> + <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional> + <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" /> + <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)"> + <option value="noMm">Use POSIX/C file I/O</option> + <option value="doMm">Use memory-mapped I/O</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when>  + </conditional>  + </when>  + </conditional>  + </inputs> + <outputs> + <data format="sam" name="output" /> + </outputs> + <tests> + <test> + <param name="genomeSource" value="indexed" /> + <param name="indices" value="chrM" /> + <param name="sPaired" value="single" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out1.sam" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chrM.fa" /> + <param name="index_settings" value="index_pre_set" /> + <param name="sPaired" value="paired" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" /> + <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out2.sam" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chrM.fa" /> + <param name="index_settings" value="index_full" /> + <param name="auto_b" value="set" /> + <param name="packed" value="unpacked" /> + <param name="bmax" value="-1" /> + <param name="bmaxdivn" value="4" /> + <param name="dcv" value="2048" /> + <param name="nodc" value="dc" /> + <param name="noref" value="noref" /> + <param name="offrate" value="6" /> + <param name="ftab" value="10" /> + <param name="ntoa" value="yes" /> + <param name="endian" value="little" /> + <param name="seed" value="-1" /> + <param name="cutoff" value="-1" /> + <param name="oldpmap" value="no" /> + <param name="sPaired" value="single" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out1.sam" /> + </test> + <test> + <param name="genomeSource" value="indexed" /> + <param name="indices" value="chrM" /> + <param name="sPaired" value="paired" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" /> + <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" /> + <param name="settings_type" value="full" /> + <param name="skip" value="0" /> + <param name="alignLimit" value="-1" /> + <param name="trimL" value="0" /> + <param name="trimH" value="0" /> + <param name="mismatchSeed" value="3" /> + <param name="mismatchQual" value="50" /> + <param name="seedLen" value="10" /> + <param name="rounding" value="round" /> + <param name="maqSoapAlign" value="-1" /> + <param name="minInsert" value="0" /> + <param name="maxInsert" value="250" /> + <param name="mateOrient" value="fr" /> + <param name="maxAlignAttempt" value="100" /> + <param name="forwardAlign" value="forward" /> + <param name="reverseAlign" value="reverse" /> + <param name="tryHard" value="doTryHard" /> + <param name="valAlign" value="1" /> + <param name="allValAligns" value="noAllValAligns" /> + <param name="suppressAlign" value="-1" /> + <param name="offbase" value="0" /> + <param name="best" value="doBest" /> + <param name="maxBacktracks" value="800" /> + <param name="threadMem" value="32" /> + <param name="strata" value="noStrata" /> + <param name="offrate" value="-1" /> + <param name="mm" value="noMm" /> + <param name="seed" value="403" /> + <output name="output" ftype="sam" file="bowtie_out2.sam" /> + </test> + </tests> + <help> + +**What it does** + +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool. + +.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +------ + +**Input formats** + +Bowtie accepts files in Sanger FASTQ format. + +------ + +**Outputs** + +The output is in SAM format, and has the following columns:: + + 1 QNAME - Query (pair) NAME + 2 FLAG - bitwise FLAG + 3 RNAME - Reference sequence NAME + 4 POS - 1-based leftmost POSition/coordinate of clipped sequence + 5 MAPQ - MAPping Quality (Phred-scaled) + 6 CIGAR - extended CIGAR string + 7 MRNM - Mate Reference sequence NaMe ('=' if same as RNAME) + 8 MPOS - 1-based Mate POSition + 9 ISIZE - Inferred insert SIZE + 10 SEQ - query SEQuence on the same strand as the reference + 11 QUAL - query QUALity (ASCII-33 gives the Phred base quality) + 12 OPT - variable OPTional fields in the format TAG:VTYPE:VALU + +The flags are as follows:: + + Flag - Description + 0x0001 - the read is paired in sequencing + 0x0002 - the read is mapped in a proper pair + 0x0004 - the query sequence itself is unmapped + 0x0008 - the mate is unmapped + 0x0010 - strand of the query (1 for reverse) + 0x0020 - strand of the mate + 0x0040 - the read is the first read in a pair + 0x0080 - the read is the second read in a pair + 0x0100 - the alignment is not primary + +It looks like this (scroll sideways to see the entire example):: + + QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT + HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh + HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh + +------- + +**Bowtie settings** + +All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here. + +------ + +**Bowtie parameter list** + +This is an exhaustive list of Bowtie options: + +For indexing (bowtie-build):: + -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off] + -p Packing. Use a packed representation for DNA strings. [auto] + --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto] + --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4] + --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024] + --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off] + -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off] + -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5] + -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10] + --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off] + --big Endianness. Endianness to use when serializing integers to the index file. [off] + --little Endianness. [--little] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off] + --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off] + +For aligning (bowtie):: + -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off] + -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit] + -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0] + -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0] + -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2] + -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70] + -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28] + --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off] + -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off] + -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0] + --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr] + --rf Mate orientation. [off] + --ff Mate orientation. [off] + -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250] + --pairtries <int> Maximum alignment attempts for paired-end data. [100] + --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off] + --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off] + --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best] + -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off] + --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32] + -k <int> Valid alignments. The number of valid alignments per read or pair. [off] + -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off] + -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit] + --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off] + --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off] + -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0] + -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off] + -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off] + --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + + </help> +</tool>

1 0

[hg] galaxy 2685: Add tool_conf.xml.main that was removed
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f2af04af3caa changeset: 2685:f2af04af3caa user: Kanwei Li <kanwei(a)gmail.com> date: Fri Sep 11 16:09:02 2009 -0400 description: Add tool_conf.xml.main that was removed 1 file(s) affected in this change: tool_conf.xml.main diffs (267 lines): diff -r 355b6844b123 -r f2af04af3caa tool_conf.xml.main --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_conf.xml.main Fri Sep 11 16:09:02 2009 -0400 @@ -0,0 +1,263 @@ +<?xml version="1.0"?> +<toolbox> + <section name="Get Data" id="getext"> + <tool file="data_source/upload.xml"/> + <tool file="data_source/ucsc_tablebrowser.xml" /> + <tool file="data_source/ucsc_tablebrowser_archaea.xml" /> + <tool file="data_source/microbial_import.xml" /> + <tool file="data_source/biomart.xml" /> + <tool file="data_source/gramene_mart.xml" /> + <tool file="data_source/flymine.xml" /> + <tool file="data_source/encode_db.xml" /> + <tool file="data_source/epigraph_import.xml" /> + </section> + <section name="Send Data" id="send"> + <tool file="data_destination/epigraph.xml" /> + </section> + <section name="ENCODE Tools" id="EncodeTools"> + <tool file="encode/gencode_partition.xml" /> + <tool file="encode/random_intervals.xml" /> + </section> + <section name="Lift-Over" id="liftOver"> + <tool file="extract/liftOver_wrapper.xml" /> + </section> + <section name="Text Manipulation" id="textutil"> + <tool file="filters/fixedValueColumn.xml" /> + <tool file="stats/column_maker.xml" /> + <tool file="filters/catWrapper.xml" /> + <tool file="filters/condense_characters.xml" /> + <tool file="filters/convert_characters.xml" /> + <tool file="filters/CreateInterval.xml" /> + <tool file="filters/cutWrapper.xml" /> + <tool file="filters/changeCase.xml" /> + <tool file="filters/pasteWrapper.xml" /> + <tool file="filters/remove_beginning.xml" /> + <tool file="filters/headWrapper.xml" /> + <tool file="filters/tailWrapper.xml" /> + </section> + <section name="Convert Formats" id="convert"> + <tool file="filters/bed2gff.xml" /> + <tool file="fasta_tools/fasta_to_tabular.xml" /> + <tool file="filters/gff2bed.xml" /> + <tool file="maf/maf_to_bed.xml" /> + <tool file="maf/maf_to_fasta.xml" /> + <tool file="fasta_tools/tabular_to_fasta.xml" /> + </section> + <section name="FASTA manipulation" id="fasta_manipulation"> + <tool file="fasta_tools/fasta_compute_length.xml" /> + <tool file="fasta_tools/fasta_filter_by_length.xml" /> + <tool file="fasta_tools/fasta_concatenate_by_species.xml" /> + <tool file="fasta_tools/fasta_to_tabular.xml" /> + <tool file="fasta_tools/tabular_to_fasta.xml" /> + </section> + <section name="Filter and Sort" id="filter"> + <tool file="stats/filtering.xml" /> + <tool file="filters/sorter.xml" /> + <tool file="filters/grep.xml" /> + </section> + <section name="Join, Subtract and Group" id="group"> + <tool file="filters/joiner.xml" /> + <tool file="filters/compare.xml"/> + <tool file="new_operations/subtract_query.xml"/> + <tool file="stats/grouping.xml" /> + </section> + <section name="Extract Features" id="features"> + <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" /> + <tool file="extract/extract_GFF_Features.xml" /> + </section> + <section name="Fetch Sequences" id="fetchSeq"> + <tool file="extract/extract_genomic_dna.xml" /> + </section> + <section name="Fetch Alignments" id="fetchAlign"> + <tool file="maf/interval2maf_pairwise.xml" /> + <tool file="maf/interval2maf.xml" /> + <tool file="maf/interval_maf_to_merged_fasta.xml" /> + <tool file="maf/genebed_maf_to_fasta.xml"/> + <tool file="maf/maf_stats.xml"/> + <tool file="maf/maf_thread_for_species.xml"/> + <tool file="maf/maf_limit_to_species.xml"/> + <tool file="maf/maf_limit_size.xml"/> + <tool file="maf/maf_by_block_number.xml"/> + <tool file="maf/maf_filter.xml"/> +  + </section> + <section name="Get Genomic Scores" id="scores"> + <tool file="stats/wiggle_to_simple.xml" /> + <tool file="stats/aggregate_binned_scores_in_intervals.xml" /> + <tool file="extract/phastOdds/phastOdds_tool.xml" /> + </section> + <section name="Operate on Genomic Intervals" id="bxops"> + <tool file="new_operations/intersect.xml" /> + <tool file="new_operations/subtract.xml" /> + <tool file="new_operations/merge.xml" /> + <tool file="new_operations/concat.xml" /> + <tool file="new_operations/basecoverage.xml" /> + <tool file="new_operations/coverage.xml" /> + <tool file="new_operations/complement.xml" /> + <tool file="new_operations/cluster.xml" id="cluster" /> + <tool file="new_operations/join.xml" /> + <tool file="new_operations/get_flanks.xml" /> + <tool file="new_operations/flanking_features.xml" /> + <tool file="annotation_profiler/annotation_profiler.xml" /> + </section> + <section name="Statistics" id="stats"> + <tool file="stats/gsummary.xml" /> + <tool file="filters/uniq.xml" /> + <tool file="stats/cor.xml" /> + </section> + <section name="Graph/Display Data" id="plots"> + <tool file="plotting/histogram2.xml" /> + <tool file="plotting/scatterplot.xml" /> + <tool file="plotting/xy_plot.xml" /> + <tool file="visualization/GMAJ.xml" /> + <tool file="visualization/build_ucsc_custom_track.xml" /> + </section> + <section name="Regional Variation" id="regVar"> + <tool file="regVariation/windowSplitter.xml" /> + <tool file="regVariation/featureCounter.xml" /> + <tool file="regVariation/quality_filter.xml" /> + <tool file="regVariation/maf_cpg_filter.xml" /> + <tool file="regVariation/getIndels_2way.xml" /> + <tool file="regVariation/getIndels_3way.xml" /> + <tool file="regVariation/getIndelRates_3way.xml" /> + <tool file="regVariation/substitutions.xml" /> + <tool file="regVariation/substitution_rates.xml" /> + <tool file="regVariation/microsats_alignment_level.xml" /> + <tool file="regVariation/microsats_mutability.xml" /> + </section> + <section name="Multiple regression" id="multReg"> + <tool file="regVariation/linear_regression.xml" /> + <tool file="regVariation/best_regression_subsets.xml" /> + <tool file="regVariation/rcve.xml" /> + </section> + <section name="Evolution: HyPhy" id="hyphy"> + <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" /> + <tool file="hyphy/hyphy_nj_tree_wrapper.xml" /> + <tool file="hyphy/hyphy_dnds_wrapper.xml" /> + </section> + <section name="Metagenomic analyses" id="tax_manipulation"> + <tool file="taxonomy/gi2taxonomy.xml" /> + <tool file="taxonomy/t2t_report.xml" /> + <tool file="taxonomy/t2ps_wrapper.xml" /> + <tool file="taxonomy/find_diag_hits.xml" /> + <tool file="taxonomy/lca.xml" /> + <tool file="taxonomy/poisson2test.xml" /> + </section> + <section name="Short Read Analysis" id="short_read_analysis"> + <tool file="metag_tools/short_reads_figure_score.xml" /> + <tool file="metag_tools/short_reads_trim_seq.xml" /> + <tool file="metag_tools/megablast_wrapper.xml" /> + <tool file="metag_tools/megablast_xml_parser.xml" /> + </section> + <section name="EMBOSS" id="EMBOSSLite"> + <tool file="emboss_5/emboss_antigenic.xml" /> + <tool file="emboss_5/emboss_backtranseq.xml" /> + <tool file="emboss_5/emboss_banana.xml" /> + <tool file="emboss_5/emboss_biosed.xml" /> + <tool file="emboss_5/emboss_btwisted.xml" /> + <tool file="emboss_5/emboss_cai_custom.xml" /> + <tool file="emboss_5/emboss_cai.xml" /> + <tool file="emboss_5/emboss_chaos.xml" /> + <tool file="emboss_5/emboss_charge.xml" /> + <tool file="emboss_5/emboss_checktrans.xml" /> + <tool file="emboss_5/emboss_chips.xml" /> + <tool file="emboss_5/emboss_cirdna.xml" /> + <tool file="emboss_5/emboss_codcmp.xml" /> + <tool file="emboss_5/emboss_coderet.xml" /> + <tool file="emboss_5/emboss_compseq.xml" /> + <tool file="emboss_5/emboss_cpgplot.xml" /> + <tool file="emboss_5/emboss_cpgreport.xml" /> + <tool file="emboss_5/emboss_cusp.xml" /> + <tool file="emboss_5/emboss_cutseq.xml" /> + <tool file="emboss_5/emboss_dan.xml" /> + <tool file="emboss_5/emboss_degapseq.xml" /> + <tool file="emboss_5/emboss_descseq.xml" /> + <tool file="emboss_5/emboss_diffseq.xml" /> + <tool file="emboss_5/emboss_digest.xml" /> + <tool file="emboss_5/emboss_dotmatcher.xml" /> + <tool file="emboss_5/emboss_dotpath.xml" /> + <tool file="emboss_5/emboss_dottup.xml" /> + <tool file="emboss_5/emboss_dreg.xml" /> + <tool file="emboss_5/emboss_einverted.xml" /> + <tool file="emboss_5/emboss_epestfind.xml" /> + <tool file="emboss_5/emboss_equicktandem.xml" /> + <tool file="emboss_5/emboss_est2genome.xml" /> + <tool file="emboss_5/emboss_etandem.xml" /> + <tool file="emboss_5/emboss_extractfeat.xml" /> + <tool file="emboss_5/emboss_extractseq.xml" /> + <tool file="emboss_5/emboss_freak.xml" /> + <tool file="emboss_5/emboss_fuzznuc.xml" /> + <tool file="emboss_5/emboss_fuzzpro.xml" /> + <tool file="emboss_5/emboss_fuzztran.xml" /> + <tool file="emboss_5/emboss_garnier.xml" /> + <tool file="emboss_5/emboss_geecee.xml" /> + <tool file="emboss_5/emboss_getorf.xml" /> + <tool file="emboss_5/emboss_helixturnhelix.xml" /> + <tool file="emboss_5/emboss_hmoment.xml" /> + <tool file="emboss_5/emboss_iep.xml" /> + <tool file="emboss_5/emboss_infoseq.xml" /> + <tool file="emboss_5/emboss_isochore.xml" /> + <tool file="emboss_5/emboss_lindna.xml" /> + <tool file="emboss_5/emboss_marscan.xml" /> + <tool file="emboss_5/emboss_maskfeat.xml" /> + <tool file="emboss_5/emboss_maskseq.xml" /> + <tool file="emboss_5/emboss_matcher.xml" /> + <tool file="emboss_5/emboss_megamerger.xml" /> + <tool file="emboss_5/emboss_merger.xml" /> + <tool file="emboss_5/emboss_msbar.xml" /> + <tool file="emboss_5/emboss_needle.xml" /> + <tool file="emboss_5/emboss_newcpgreport.xml" /> + <tool file="emboss_5/emboss_newcpgseek.xml" /> + <tool file="emboss_5/emboss_newseq.xml" /> + <tool file="emboss_5/emboss_noreturn.xml" /> + <tool file="emboss_5/emboss_notseq.xml" /> + <tool file="emboss_5/emboss_nthseq.xml" /> + <tool file="emboss_5/emboss_octanol.xml" /> + <tool file="emboss_5/emboss_oddcomp.xml" /> + <tool file="emboss_5/emboss_palindrome.xml" /> + <tool file="emboss_5/emboss_pasteseq.xml" /> + <tool file="emboss_5/emboss_patmatdb.xml" /> + <tool file="emboss_5/emboss_pepcoil.xml" /> + <tool file="emboss_5/emboss_pepinfo.xml" /> + <tool file="emboss_5/emboss_pepnet.xml" /> + <tool file="emboss_5/emboss_pepstats.xml" /> + <tool file="emboss_5/emboss_pepwheel.xml" /> + <tool file="emboss_5/emboss_pepwindow.xml" /> + <tool file="emboss_5/emboss_pepwindowall.xml" /> + <tool file="emboss_5/emboss_plotcon.xml" /> + <tool file="emboss_5/emboss_plotorf.xml" /> + <tool file="emboss_5/emboss_polydot.xml" /> + <tool file="emboss_5/emboss_preg.xml" /> + <tool file="emboss_5/emboss_prettyplot.xml" /> + <tool file="emboss_5/emboss_prettyseq.xml" /> + <tool file="emboss_5/emboss_primersearch.xml" /> + <tool file="emboss_5/emboss_revseq.xml" /> + <tool file="emboss_5/emboss_seqmatchall.xml" /> + <tool file="emboss_5/emboss_seqret.xml" /> + <tool file="emboss_5/emboss_showfeat.xml" /> + <tool file="emboss_5/emboss_shuffleseq.xml" /> + <tool file="emboss_5/emboss_sigcleave.xml" /> + <tool file="emboss_5/emboss_sirna.xml" /> + <tool file="emboss_5/emboss_sixpack.xml" /> + <tool file="emboss_5/emboss_skipseq.xml" /> + <tool file="emboss_5/emboss_splitter.xml" /> + <tool file="emboss_5/emboss_supermatcher.xml" /> + <tool file="emboss_5/emboss_syco.xml" /> + <tool file="emboss_5/emboss_tcode.xml" /> + <tool file="emboss_5/emboss_textsearch.xml" /> + <tool file="emboss_5/emboss_tmap.xml" /> + <tool file="emboss_5/emboss_tranalign.xml" /> + <tool file="emboss_5/emboss_transeq.xml" /> + <tool file="emboss_5/emboss_trimest.xml" /> + <tool file="emboss_5/emboss_trimseq.xml" /> + <tool file="emboss_5/emboss_twofeat.xml" /> + <tool file="emboss_5/emboss_union.xml" /> + <tool file="emboss_5/emboss_vectorstrip.xml" /> + <tool file="emboss_5/emboss_water.xml" /> + <tool file="emboss_5/emboss_wobble.xml" /> + <tool file="emboss_5/emboss_wordcount.xml" /> + <tool file="emboss_5/emboss_wordmatch.xml" /> + </section> +</toolbox>

1 0

[hg] galaxy 2680: Fix for cleanup_datasets.py script.
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/8877ef766447 changeset: 2680:8877ef766447 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Sep 11 11:26:26 2009 -0400 description: Fix for cleanup_datasets.py script. 1 file(s) affected in this change: scripts/cleanup_datasets/cleanup_datasets.py diffs (25 lines): diff -r ed4cbaf23c88 -r 8877ef766447 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 09:00:36 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 11:26:26 2009 -0400 @@ -1,4 +1,8 @@ #!/usr/bin/env python + +from galaxy import eggs +import pkg_resources +pkg_resources.require( "SQLAlchemy >= 0.4" ) import sys, os, time, ConfigParser, shutil from datetime import datetime, timedelta @@ -9,12 +13,7 @@ new_path.extend( sys.path[1:] ) # remove scripts/ from the path sys.path = new_path -from galaxy import eggs import galaxy.model.mapping -import pkg_resources - -pkg_resources.require( "SQLAlchemy >= 0.4" ) - from galaxy.model.orm import and_, eagerload assert sys.version_info[:2] >= ( 2, 4 )

1 0

[hg] galaxy 2679: Eliminate buttons from shared history grid tha...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ed4cbaf23c88 changeset: 2679:ed4cbaf23c88 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Sep 11 09:00:36 2009 -0400 description: Eliminate buttons from shared history grid that were not meant to be committed. 1 file(s) affected in this change: lib/galaxy/web/controllers/history.py diffs (35 lines): diff -r f0adb6152df9 -r ed4cbaf23c88 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Sep 10 21:24:06 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Sep 11 09:00:36 2009 -0400 @@ -104,9 +104,7 @@ ] operations = [ grids.GridOperation( "Clone" ), - grids.GridOperation( "Unshare" ), - grids.GridOperation( "Enable import via link", condition=( lambda item: item.deleted ) ), - grids.GridOperation( "Disable import via link", condition=( lambda item: item.deleted ) ) + grids.GridOperation( "Unshare" ) ] standard_filters = [] def build_initial_query( self, session ): @@ -280,20 +278,6 @@ association.flush() message = "Unshared %d shared histories" % len( ids ) status = 'done' - elif operation == "enable import via link": - if ids: - histories = [ get_history( trans, id ) for id in ids ] - for history in histories: - if not history.importable: - history.importable = True - history.flush() - elif operation == "disable import via link": - if ids: - histories = [ get_history( trans, id ) for id in ids ] - for history in histories: - if history.importable: - history.importable = False - history.flush() # Render the list view return self.shared_list_grid( trans, status=status, message=message, **kwargs ) @web.expose

1 0

[hg] galaxy 2681: Fix syntax error when running workflows. This ...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e7b899fb4462 changeset: 2681:e7b899fb4462 user: James Taylor <james(a)jamestaylor.org> date: Fri Sep 11 12:48:33 2009 -0400 description: Fix syntax error when running workflows. This is actually a regression in Mako, the multiline conditional in the elif was somehow causing it to improperly nest the if statements 2 file(s) affected in this change: eggs.ini templates/workflow/run.mako diffs (34 lines): diff -r 8877ef766447 -r e7b899fb4462 eggs.ini --- a/eggs.ini Fri Sep 11 11:26:26 2009 -0400 +++ b/eggs.ini Fri Sep 11 12:48:33 2009 -0400 @@ -31,7 +31,7 @@ elementtree = 1.2.6_20050316 lrucache = 0.2 ;lsprof - james -Mako = 0.2.4 +Mako = 0.2.5 MyghtyUtils = 0.52 nose = 0.9.1 NoseHTML = 0.2 @@ -79,7 +79,7 @@ docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz -Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz +Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2 diff -r 8877ef766447 -r e7b899fb4462 templates/workflow/run.mako --- a/templates/workflow/run.mako Fri Sep 11 11:26:26 2009 -0400 +++ b/templates/workflow/run.mako Fri Sep 11 12:48:33 2009 -0400 @@ -87,8 +87,7 @@ ${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )} <input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" /> %endif - %elif isinstance( value, RuntimeValue ) or \ - ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: + %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: ## On the first load we may see a RuntimeValue, so we write ## an input field using the initial value for the param. ## Subsequents posts will no longer have the runtime value

1 0

[hg] galaxy 2683: (1) Unicode support for tagging and (2) added ...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/032478337b82 changeset: 2683:032478337b82 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Sep 11 14:57:02 2009 -0400 description: (1) Unicode support for tagging and (2) added tagging_common mako file to support creation and standardization of tagging elements across all pages. 9 file(s) affected in this change: lib/galaxy/web/controllers/history.py lib/galaxy/web/controllers/tag.py static/scripts/autocomplete_tagging.js static/scripts/packed/autocomplete_tagging.js templates/dataset/edit_attributes.mako templates/history/grid.mako templates/root/history.mako templates/tagging_common.mako tool_conf.xml.main diffs (781 lines): diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Fri Sep 11 09:00:36 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Sep 11 14:57:02 2009 -0400 @@ -38,6 +38,17 @@ if item.users_shared_with or item.importable: return dict( operation="sharing" ) return None + class TagsColumn( grids.GridColumn ): + def __init__(self, col_name): + grids.GridColumn.__init__(self, col_name) + self.tag_elt_id_gen = 0 + + def get_value( self, trans, grid, history ): + self.tag_elt_id_gen += 1 + return trans.fill_template( "/tagging_common.mako", trans=trans, + tagged_item=history, + elt_id="tagging-elt" + str(self.tag_elt_id_gen) ) + # Grid definition title = "Stored histories" model_class = model.History @@ -48,6 +59,7 @@ link=( lambda item: iff( item.deleted, None, dict( operation="switch", id=item.id ) ) ), attach_popup=True ), DatasetsByStateColumn( "Datasets (by state)", ncells=4 ), + #TagsColumn( "Tags" ), StatusColumn( "Status", attach_popup=False ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/tag.py --- a/lib/galaxy/web/controllers/tag.py Fri Sep 11 09:00:36 2009 -0400 +++ b/lib/galaxy/web/controllers/tag.py Fri Sep 11 14:57:02 2009 -0400 @@ -4,7 +4,6 @@ from galaxy.model import History, HistoryTagAssociation, Dataset, DatasetTagAssociation, \ HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation, Page, PageTagAssociation - from galaxy.web.base.controller import * from galaxy.tags.tag_handler import * from sqlalchemy.sql.expression import func, and_ @@ -15,65 +14,68 @@ def __init__(self, app): BaseController.__init__(self, app) - # Set up dict for mapping from short-hand to full item class. - self.shorthand_to_item_class_dict = dict() - self.shorthand_to_item_class_dict["history"] = History - self.shorthand_to_item_class_dict["hda"] = HistoryDatasetAssociation + # Keep a list of taggable classes. + self.taggable_classes = dict() + self.taggable_classes[History.__name__] = History + self.taggable_classes[HistoryDatasetAssociation.__name__] = HistoryDatasetAssociation + self.taggable_classes[Page.__name__] = Page - # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, ... + # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, Page, ... self.tag_handler = TagHandler() self.tag_handler.add_tag_assoc_class(History, HistoryTagAssociation) self.tag_handler.add_tag_assoc_class(HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation) - + self.tag_handler.add_tag_assoc_class(Page, PageTagAssociation) + @web.expose - def add_tag_async( self, trans, id=None, item_type=None, new_tag=None ): + @web.require_login( "Add tag to an item." ) + def add_tag_async( self, trans, id=None, item_class=None, new_tag=None ): """ Add tag to an item. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) - self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tag).encode('utf-8') ) trans.sa_session.flush() @web.expose - def remove_tag_async( self, trans, id=None, item_type=None, tag_name=None ): + @web.require_login( "Remove tag from an item." ) + def remove_tag_async( self, trans, id=None, item_class=None, tag_name=None ): """ Remove tag from an item. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) - self.tag_handler.remove_item_tag(item, tag_name) + self.tag_handler.remove_item_tag( item, unicode(tag_name).encode('utf-8') ) + #print tag_name + #print unicode(tag_name) trans.sa_session.flush() # Retag an item. All previous tags are deleted and new tags are applied. @web.expose - def retag_async( self, trans, id=None, item_type=None, new_tags=None ): + @web.require_login( "Apply a new set of tags to an item; previous tags are deleted." ) + def retag_async( self, trans, id=None, item_class=None, new_tags=None ): """ Apply a new set of tags to an item; previous tags are deleted. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) tag_handler.delete_item_tags(item) - self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tags).encode('utf-8') ) trans.sa_session.flush() - - tag_handler.delete_item_tags(history) - tag_handler.apply_item_tags(trans.sa_session, history, new_tags) - # Flush to complete changes. - trans.sa_session.flush() - + @web.expose @web.require_login( "get autocomplete data for an item's tags" ) - def tag_autocomplete_data(self, trans, id=None, item_type=None, q=None, limit=None, timestamp=None): + def tag_autocomplete_data(self, trans, id=None, item_class=None, q=None, limit=None, timestamp=None): """ Get autocomplete data for an item's tags. """ # # Get item, do security check, and get autocomplete data. # - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) + q = unicode(q).encode('utf-8') if q.find(":") == -1: return self._get_tag_autocomplete_names(trans, item, q, limit, timestamp) else: @@ -184,9 +186,9 @@ # Use the user_id associated with the HDA's history. return History.table.c.user_id - def _get_item(self, trans, item_type, id): + def _get_item(self, trans, item_class_name, id): """ Get an item based on type and id. """ - item_class = self.shorthand_to_item_class_dict[item_type] + item_class = self.taggable_classes[item_class_name] item = trans.sa_session.query(item_class).filter("id=" + str(id))[0] return item; diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/autocomplete_tagging.js --- a/static/scripts/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400 +++ b/static/scripts/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400 @@ -187,13 +187,14 @@ // Tag button is image's parent. var tag_button = $(this).parent(); - // Get tag name. + // Get tag name, value. var tag_name_elt = tag_button.find(".tag-name").eq(0); var tag_str = tag_name_elt.text(); - var tag_name = get_tag_name_and_value(tag_str)[0]; + var tag_name_and_value = get_tag_name_and_value(tag_str); + var tag_name = tag_name_and_value[0]; + var tag_value = tag_name_and_value[1]; - // TODO: should remove succeed if tag is not already applied to - // history? + var prev_button = tag_button.prev(); tag_button.remove(); // Remove tag from local list for consistency. @@ -209,12 +210,28 @@ data: { tag_name: tag_name }, error: function() { - // Failed. - alert( "Remove tag failed" ); + // Failed. Roll back changes and show alert. + settings.tags[tag_name] = tag_value; + if (prev_button.hasClass("tag-button")) + prev_button.after(tag_button); + else + tag_area.prepend(tag_button); + var new_text = settings.get_toggle_link_text_fn(settings.tags); + alert( "Remove tag failed" ); + + toggle_link.text(new_text); + + // TODO: no idea why it's necessary to set this up again. + delete_img.mouseenter( function () + { + $(this).attr("src", settings.delete_tag_img_rollover); + }); + delete_img.mouseleave( function () + { + $(this).attr("src", settings.delete_tag_img); + }); }, - success: function() - { - } + success: function() {} }); return true; @@ -323,8 +340,9 @@ data: { new_tag: new_value }, error: function() { - // Remove tag and show alert. + // Failed. Roll back changes and show alert. new_tag_button.remove(); + delete settings.tags[tag_name_and_value[0]]; var new_text = settings.get_toggle_link_text_fn(settings.tags); toggle_link.text(new_text); alert( "Add tag failed" ); diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/packed/autocomplete_tagging.js --- a/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400 +++ b/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400 @@ -1,1 +1,1 @@ -var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b(); if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var B=$(this).parent();var A=B.find(".tag-name").eq(0);var z=A.text();var C=h(z)[0];B.remove();delete p.tags[C];var y=p.get_toggle_link_text_fn(p.tags);s.text(y);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:C},error:function(){alert("Remove tag failed")},success:function(){}});return true});var w=$("<span>"+u+" </span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){this.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag -button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClas s("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file +var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b(); if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var D=$(this).parent();var C=D.find(".tag-name").eq(0);var B=C.text();var z=h(B);var F=z[0];var y=z[1];var E=D.prev();D.remove();delete p.tags[F];var A=p.get_toggle_link_text_fn(p.tags);s.text(A);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:F},error:function(){p.tags[F]=y;if(E.hasClass("tag-button")){E.after(D) }else{m.prepend(D)}var G=p.get_toggle_link_text_fn(p.tags);alert("Remove tag failed");s.text(G);v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)})},success:function(){}});return true});var w=$("<span>"+u+"</span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){thi s.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();delete p.tags[y[0]];var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input ");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClass("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file diff -r ed4cbaf23c88 -r 032478337b82 templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Fri Sep 11 14:57:02 2009 -0400 @@ -9,43 +9,8 @@ <% user, user_roles = trans.get_user_and_roles() %> <%def name="javascripts()"> - ##  - ${h.js( "jquery", "galaxy.base", "jquery.autocomplete", "autocomplete_tagging" )} - <script type="text/javascript"> - $( document ).ready( function() { - // Set up autocomplete tagger. -<% - ## Build string of tag name, values. - tag_names_and_values = list() - for tag in data.tags: - tag_name = tag.user_tname - tag_value = "" - if tag.value is not None: - tag_value = tag.user_value - tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"") -%> - var options = { - tags : {${", ".join(tag_names_and_values)}}, - tag_click_fn: function(tag) { /* Do nothing. */ }, - use_toggle_link: false, - input_size: 30, - in_form: true, - <% encoded_data_id = trans.security.encode_id(data.id) %> - ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_data_id, item_type="hda" )}", - ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_data_id, item_type="hda" )}", - ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_data_id, item_type="hda" )}", - delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", - delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", - add_tag_img: "${h.url_for('/static/images/add_icon.png')}", - add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", - }; -% if trans.get_user() is not None: - $("#dataset-tag-area").autocomplete_tagging(options); -% endif -}); - </script> + ${parent.javascripts()} + ${h.js( "jquery.autocomplete", "autocomplete_tagging" )} </%def> <%def name="datatype( dataset, datatypes )"> @@ -84,16 +49,18 @@ <div style="clear: both"></div> </div> %if trans.get_user() is not None: - <div class="form-row"> - <label> - Tags: - </label> - <div id="dataset-tag-area" + <%namespace file="../tagging_common.mako" import="render_tagging_element" /> + <div class="form-row"> + <label> + Tags: + </label> + <div id="dataset-tag-area" style="float: left; margin-left: 1px; width: 295px; margin-right: 10px; border-style: inset; border-color: #ddd; border-width: 1px"> - </div> - <div style="clear: both"></div> - </div> - %endif + </div> + <div style="clear: both"></div> + </div> + ${render_tagging_element(data, "dataset-tag-area", use_toggle_link="false", in_form="true", input_size="30")} + %endif %for name, spec in data.metadata.spec.items(): %if spec.visible: <div class="form-row"> diff -r ed4cbaf23c88 -r 032478337b82 templates/history/grid.mako --- a/templates/history/grid.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/history/grid.mako Fri Sep 11 14:57:02 2009 -0400 @@ -10,6 +10,7 @@ <%def name="javascripts()"> ${parent.javascripts()} + ${h.js("jquery.autocomplete", "autocomplete_tagging" )} <script type="text/javascript"> ## TODO: generalize and move into galaxy.base.js $(document).ready(function() { @@ -58,7 +59,7 @@ </%def> <%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> + ${h.css( "base", "autocomplete_tagging" )} <style> ## Not generic to all grids -- move to base? .count-box { diff -r ed4cbaf23c88 -r 032478337b82 templates/root/history.mako --- a/templates/root/history.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/root/history.mako Fri Sep 11 14:57:02 2009 -0400 @@ -77,83 +77,6 @@ <% updateable = [data for data in reversed( datasets ) if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]] %> ${ ",".join( map(lambda data: "\"%s\" : \"%s\"" % (data.id, data.state), updateable) ) } }); - - // Set up autocomplete tagger. -<% - ## Build string of tag name, values. - tag_names_and_values = list() - for tag in history.tags: - tag_name = tag.user_tname - tag_value = "" - if tag.value is not None: - tag_value = tag.user_value - tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"") -%> - // Returns the number of keys (elements) in an array/dictionary. - var array_length = function(an_array) - { - if (an_array.length) - return an_array.length; - - var count = 0; - for (element in an_array) - count++; - return count; - }; - - // Function get text to display on the toggle link. - var get_toggle_link_text = function(tags) - { - var text = ""; - var num_tags = array_length(tags); - if (num_tags != 0) { - text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); - /* - // Show first N tags; hide the rest. - var max_to_show = 1; - - // Build tag string. - var tag_strs = new Array(); - var count = 0; - for (tag_name in tags) - { - tag_value = tags[tag_name]; - tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value); - if (++count == max_to_show) - break; - } - tag_str = tag_strs.join(", "); - - // Finalize text. - var num_tags_hiding = num_tags - max_to_show; - text = "Tags: " + tag_str + - (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : ""); - */ - } else { - // No tags. - text = "Add tags to this history"; - } - return text; - }; - - var options = { - tags : {${", ".join(tag_names_and_values)}}, - get_toggle_link_text_fn: get_toggle_link_text, - input_size: 15, - tag_click_fn: function(tag) { /* Do nothing. */ }, - <% encoded_history_id = trans.security.encode_id(history.id) %> - ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_history_id, item_type="history" )}", - ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_history_id, item_type="history" )}", - ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_history_id, item_type="history" )}", - delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", - delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", - add_tag_img: "${h.url_for('/static/images/add_icon.png')}", - add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", - }; -% if trans.get_user() is not None: - $("#history-tag-area").autocomplete_tagging(options); -% endif - }); // Functionized so AJAX'd datasets can call them function initShowHide() { @@ -361,7 +284,13 @@ <div id="history-tag-area" style="margin-bottom: 1em"> </div> +<%namespace file="../tagging_common.mako" import="render_tagging_element" /> <%namespace file="history_common.mako" import="render_dataset" /> + +%if trans.get_user() is not None: + <div id='history-tag-area' class="tag-element"></div> + ${render_tagging_element(history, "history-tag-area")} +%endif %if not datasets: diff -r ed4cbaf23c88 -r 032478337b82 templates/tagging_common.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/tagging_common.mako Fri Sep 11 14:57:02 2009 -0400 @@ -0,0 +1,92 @@ +## Render the tags 'tags' as an autocomplete element. +<%def name="render_tagging_element(tagged_item, elt_id, use_toggle_link='true', in_form='false', input_size='15')"> + <script type="text/javascript"> + + // + // Set up autocomplete tagger. + // + <% + ## Build string of tag name, values. + tag_names_and_values = list() + for tag in tagged_item.tags: + tag_name = tag.user_tname + tag_value = "" + if tag.value is not None: + tag_value = tag.user_value + tag_names_and_values.append( ("\"" + tag_name + "\" : \"" + tag_value + "\"") ) + %> + // + // Returns the number of keys (elements) in an array/dictionary. + // + var array_length = function(an_array) + { + if (an_array.length) + return an_array.length; + + var count = 0; + for (element in an_array) + count++; + return count; + }; + + // + // Function get text to display on the toggle link. + // + var get_toggle_link_text = function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + { + text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); + /* + // Show first N tags; hide the rest. + var max_to_show = 1; + + // Build tag string. + var tag_strs = new Array(); + var count = 0; + for (tag_name in tags) + { + tag_value = tags[tag_name]; + tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value); + if (++count == max_to_show) + break; + } + tag_str = tag_strs.join(", "); + + // Finalize text. + var num_tags_hiding = num_tags - max_to_show; + text = "Tags: " + tag_str + + (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : ""); + */ + } + else + { + // No tags. + text = "Add tags to history"; + } + return text; + }; + + var options = + { + tags : {${unicode(", ".join(tag_names_and_values), 'utf-8')}}, + get_toggle_link_text_fn: get_toggle_link_text, + tag_click_fn: function(tag) { /* Do nothing. */ }, + <% tagged_item_id = trans.security.encode_id(tagged_item.id) %> + ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", + delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", + add_tag_img: "${h.url_for('/static/images/add_icon.png')}", + add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", + input_size: ${input_size}, + in_form: ${in_form}, + use_toggle_link: ${use_toggle_link} + }; + + $("#${elt_id}").autocomplete_tagging(options) + </script> +</%def> \ No newline at end of file diff -r ed4cbaf23c88 -r 032478337b82 tool_conf.xml.main --- a/tool_conf.xml.main Fri Sep 11 09:00:36 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,263 +0,0 @@ -<?xml version="1.0"?> -<toolbox> - <section name="Get Data" id="getext"> - <tool file="data_source/upload.xml"/> - <tool file="data_source/ucsc_tablebrowser.xml" /> - <tool file="data_source/ucsc_tablebrowser_archaea.xml" /> - <tool file="data_source/microbial_import.xml" /> - <tool file="data_source/biomart.xml" /> - <tool file="data_source/gramene_mart.xml" /> - <tool file="data_source/flymine.xml" /> - <tool file="data_source/encode_db.xml" /> - <tool file="data_source/epigraph_import.xml" /> - </section> - <section name="Send Data" id="send"> - <tool file="data_destination/epigraph.xml" /> - </section> - <section name="ENCODE Tools" id="EncodeTools"> - <tool file="encode/gencode_partition.xml" /> - <tool file="encode/random_intervals.xml" /> - </section> - <section name="Lift-Over" id="liftOver"> - <tool file="extract/liftOver_wrapper.xml" /> - </section> - <section name="Text Manipulation" id="textutil"> - <tool file="filters/fixedValueColumn.xml" /> - <tool file="stats/column_maker.xml" /> - <tool file="filters/catWrapper.xml" /> - <tool file="filters/condense_characters.xml" /> - <tool file="filters/convert_characters.xml" /> - <tool file="filters/CreateInterval.xml" /> - <tool file="filters/cutWrapper.xml" /> - <tool file="filters/changeCase.xml" /> - <tool file="filters/pasteWrapper.xml" /> - <tool file="filters/remove_beginning.xml" /> - <tool file="filters/headWrapper.xml" /> - <tool file="filters/tailWrapper.xml" /> - </section> - <section name="Convert Formats" id="convert"> - <tool file="filters/bed2gff.xml" /> - <tool file="fasta_tools/fasta_to_tabular.xml" /> - <tool file="filters/gff2bed.xml" /> - <tool file="maf/maf_to_bed.xml" /> - <tool file="maf/maf_to_fasta.xml" /> - <tool file="fasta_tools/tabular_to_fasta.xml" /> - </section> - <section name="FASTA manipulation" id="fasta_manipulation"> - <tool file="fasta_tools/fasta_compute_length.xml" /> - <tool file="fasta_tools/fasta_filter_by_length.xml" /> - <tool file="fasta_tools/fasta_concatenate_by_species.xml" /> - <tool file="fasta_tools/fasta_to_tabular.xml" /> - <tool file="fasta_tools/tabular_to_fasta.xml" /> - </section> - <section name="Filter and Sort" id="filter"> - <tool file="stats/filtering.xml" /> - <tool file="filters/sorter.xml" /> - <tool file="filters/grep.xml" /> - </section> - <section name="Join, Subtract and Group" id="group"> - <tool file="filters/joiner.xml" /> - <tool file="filters/compare.xml"/> - <tool file="new_operations/subtract_query.xml"/> - <tool file="stats/grouping.xml" /> - </section> - <section name="Extract Features" id="features"> - <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" /> - <tool file="extract/extract_GFF_Features.xml" /> - </section> - <section name="Fetch Sequences" id="fetchSeq"> - <tool file="extract/extract_genomic_dna.xml" /> - </section> - <section name="Fetch Alignments" id="fetchAlign"> - <tool file="maf/interval2maf_pairwise.xml" /> - <tool file="maf/interval2maf.xml" /> - <tool file="maf/interval_maf_to_merged_fasta.xml" /> - <tool file="maf/genebed_maf_to_fasta.xml"/> - <tool file="maf/maf_stats.xml"/> - <tool file="maf/maf_thread_for_species.xml"/> - <tool file="maf/maf_limit_to_species.xml"/> - <tool file="maf/maf_limit_size.xml"/> - <tool file="maf/maf_by_block_number.xml"/> - <tool file="maf/maf_filter.xml"/> -  - </section> - <section name="Get Genomic Scores" id="scores"> - <tool file="stats/wiggle_to_simple.xml" /> - <tool file="stats/aggregate_binned_scores_in_intervals.xml" /> - <tool file="extract/phastOdds/phastOdds_tool.xml" /> - </section> - <section name="Operate on Genomic Intervals" id="bxops"> - <tool file="new_operations/intersect.xml" /> - <tool file="new_operations/subtract.xml" /> - <tool file="new_operations/merge.xml" /> - <tool file="new_operations/concat.xml" /> - <tool file="new_operations/basecoverage.xml" /> - <tool file="new_operations/coverage.xml" /> - <tool file="new_operations/complement.xml" /> - <tool file="new_operations/cluster.xml" id="cluster" /> - <tool file="new_operations/join.xml" /> - <tool file="new_operations/get_flanks.xml" /> - <tool file="new_operations/flanking_features.xml" /> - <tool file="annotation_profiler/annotation_profiler.xml" /> - </section> - <section name="Statistics" id="stats"> - <tool file="stats/gsummary.xml" /> - <tool file="filters/uniq.xml" /> - <tool file="stats/cor.xml" /> - </section> - <section name="Graph/Display Data" id="plots"> - <tool file="plotting/histogram2.xml" /> - <tool file="plotting/scatterplot.xml" /> - <tool file="plotting/xy_plot.xml" /> - <tool file="visualization/GMAJ.xml" /> - <tool file="visualization/build_ucsc_custom_track.xml" /> - </section> - <section name="Regional Variation" id="regVar"> - <tool file="regVariation/windowSplitter.xml" /> - <tool file="regVariation/featureCounter.xml" /> - <tool file="regVariation/quality_filter.xml" /> - <tool file="regVariation/maf_cpg_filter.xml" /> - <tool file="regVariation/getIndels_2way.xml" /> - <tool file="regVariation/getIndels_3way.xml" /> - <tool file="regVariation/getIndelRates_3way.xml" /> - <tool file="regVariation/substitutions.xml" /> - <tool file="regVariation/substitution_rates.xml" /> - <tool file="regVariation/microsats_alignment_level.xml" /> - <tool file="regVariation/microsats_mutability.xml" /> - </section> - <section name="Multiple regression" id="multReg"> - <tool file="regVariation/linear_regression.xml" /> - <tool file="regVariation/best_regression_subsets.xml" /> - <tool file="regVariation/rcve.xml" /> - </section> - <section name="Evolution: HyPhy" id="hyphy"> - <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" /> - <tool file="hyphy/hyphy_nj_tree_wrapper.xml" /> - <tool file="hyphy/hyphy_dnds_wrapper.xml" /> - </section> - <section name="Metagenomic analyses" id="tax_manipulation"> - <tool file="taxonomy/gi2taxonomy.xml" /> - <tool file="taxonomy/t2t_report.xml" /> - <tool file="taxonomy/t2ps_wrapper.xml" /> - <tool file="taxonomy/find_diag_hits.xml" /> - <tool file="taxonomy/lca.xml" /> - <tool file="taxonomy/poisson2test.xml" /> - </section> - <section name="Short Read Analysis" id="short_read_analysis"> - <tool file="metag_tools/short_reads_figure_score.xml" /> - <tool file="metag_tools/short_reads_trim_seq.xml" /> - <tool file="metag_tools/megablast_wrapper.xml" /> - <tool file="metag_tools/megablast_xml_parser.xml" /> - </section> - <section name="EMBOSS" id="EMBOSSLite"> - <tool file="emboss_5/emboss_antigenic.xml" /> - <tool file="emboss_5/emboss_backtranseq.xml" /> - <tool file="emboss_5/emboss_banana.xml" /> - <tool file="emboss_5/emboss_biosed.xml" /> - <tool file="emboss_5/emboss_btwisted.xml" /> - <tool file="emboss_5/emboss_cai_custom.xml" /> - <tool file="emboss_5/emboss_cai.xml" /> - <tool file="emboss_5/emboss_chaos.xml" /> - <tool file="emboss_5/emboss_charge.xml" /> - <tool file="emboss_5/emboss_checktrans.xml" /> - <tool file="emboss_5/emboss_chips.xml" /> - <tool file="emboss_5/emboss_cirdna.xml" /> - <tool file="emboss_5/emboss_codcmp.xml" /> - <tool file="emboss_5/emboss_coderet.xml" /> - <tool file="emboss_5/emboss_compseq.xml" /> - <tool file="emboss_5/emboss_cpgplot.xml" /> - <tool file="emboss_5/emboss_cpgreport.xml" /> - <tool file="emboss_5/emboss_cusp.xml" /> - <tool file="emboss_5/emboss_cutseq.xml" /> - <tool file="emboss_5/emboss_dan.xml" /> - <tool file="emboss_5/emboss_degapseq.xml" /> - <tool file="emboss_5/emboss_descseq.xml" /> - <tool file="emboss_5/emboss_diffseq.xml" /> - <tool file="emboss_5/emboss_digest.xml" /> - <tool file="emboss_5/emboss_dotmatcher.xml" /> - <tool file="emboss_5/emboss_dotpath.xml" /> - <tool file="emboss_5/emboss_dottup.xml" /> - <tool file="emboss_5/emboss_dreg.xml" /> - <tool file="emboss_5/emboss_einverted.xml" /> - <tool file="emboss_5/emboss_epestfind.xml" /> - <tool file="emboss_5/emboss_equicktandem.xml" /> - <tool file="emboss_5/emboss_est2genome.xml" /> - <tool file="emboss_5/emboss_etandem.xml" /> - <tool file="emboss_5/emboss_extractfeat.xml" /> - <tool file="emboss_5/emboss_extractseq.xml" /> - <tool file="emboss_5/emboss_freak.xml" /> - <tool file="emboss_5/emboss_fuzznuc.xml" /> - <tool file="emboss_5/emboss_fuzzpro.xml" /> - <tool file="emboss_5/emboss_fuzztran.xml" /> - <tool file="emboss_5/emboss_garnier.xml" /> - <tool file="emboss_5/emboss_geecee.xml" /> - <tool file="emboss_5/emboss_getorf.xml" /> - <tool file="emboss_5/emboss_helixturnhelix.xml" /> - <tool file="emboss_5/emboss_hmoment.xml" /> - <tool file="emboss_5/emboss_iep.xml" /> - <tool file="emboss_5/emboss_infoseq.xml" /> - <tool file="emboss_5/emboss_isochore.xml" /> - <tool file="emboss_5/emboss_lindna.xml" /> - <tool file="emboss_5/emboss_marscan.xml" /> - <tool file="emboss_5/emboss_maskfeat.xml" /> - <tool file="emboss_5/emboss_maskseq.xml" /> - <tool file="emboss_5/emboss_matcher.xml" /> - <tool file="emboss_5/emboss_megamerger.xml" /> - <tool file="emboss_5/emboss_merger.xml" /> - <tool file="emboss_5/emboss_msbar.xml" /> - <tool file="emboss_5/emboss_needle.xml" /> - <tool file="emboss_5/emboss_newcpgreport.xml" /> - <tool file="emboss_5/emboss_newcpgseek.xml" /> - <tool file="emboss_5/emboss_newseq.xml" /> - <tool file="emboss_5/emboss_noreturn.xml" /> - <tool file="emboss_5/emboss_notseq.xml" /> - <tool file="emboss_5/emboss_nthseq.xml" /> - <tool file="emboss_5/emboss_octanol.xml" /> - <tool file="emboss_5/emboss_oddcomp.xml" /> - <tool file="emboss_5/emboss_palindrome.xml" /> - <tool file="emboss_5/emboss_pasteseq.xml" /> - <tool file="emboss_5/emboss_patmatdb.xml" /> - <tool file="emboss_5/emboss_pepcoil.xml" /> - <tool file="emboss_5/emboss_pepinfo.xml" /> - <tool file="emboss_5/emboss_pepnet.xml" /> - <tool file="emboss_5/emboss_pepstats.xml" /> - <tool file="emboss_5/emboss_pepwheel.xml" /> - <tool file="emboss_5/emboss_pepwindow.xml" /> - <tool file="emboss_5/emboss_pepwindowall.xml" /> - <tool file="emboss_5/emboss_plotcon.xml" /> - <tool file="emboss_5/emboss_plotorf.xml" /> - <tool file="emboss_5/emboss_polydot.xml" /> - <tool file="emboss_5/emboss_preg.xml" /> - <tool file="emboss_5/emboss_prettyplot.xml" /> - <tool file="emboss_5/emboss_prettyseq.xml" /> - <tool file="emboss_5/emboss_primersearch.xml" /> - <tool file="emboss_5/emboss_revseq.xml" /> - <tool file="emboss_5/emboss_seqmatchall.xml" /> - <tool file="emboss_5/emboss_seqret.xml" /> - <tool file="emboss_5/emboss_showfeat.xml" /> - <tool file="emboss_5/emboss_shuffleseq.xml" /> - <tool file="emboss_5/emboss_sigcleave.xml" /> - <tool file="emboss_5/emboss_sirna.xml" /> - <tool file="emboss_5/emboss_sixpack.xml" /> - <tool file="emboss_5/emboss_skipseq.xml" /> - <tool file="emboss_5/emboss_splitter.xml" /> - <tool file="emboss_5/emboss_supermatcher.xml" /> - <tool file="emboss_5/emboss_syco.xml" /> - <tool file="emboss_5/emboss_tcode.xml" /> - <tool file="emboss_5/emboss_textsearch.xml" /> - <tool file="emboss_5/emboss_tmap.xml" /> - <tool file="emboss_5/emboss_tranalign.xml" /> - <tool file="emboss_5/emboss_transeq.xml" /> - <tool file="emboss_5/emboss_trimest.xml" /> - <tool file="emboss_5/emboss_trimseq.xml" /> - <tool file="emboss_5/emboss_twofeat.xml" /> - <tool file="emboss_5/emboss_union.xml" /> - <tool file="emboss_5/emboss_vectorstrip.xml" /> - <tool file="emboss_5/emboss_water.xml" /> - <tool file="emboss_5/emboss_wobble.xml" /> - <tool file="emboss_5/emboss_wordcount.xml" /> - <tool file="emboss_5/emboss_wordmatch.xml" /> - </section> -</toolbox>

1 0