galaxy-dev
Threads by month
- ----- 2026 -----
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
- 10009 discussions
14 Sep '09
details: http://www.bx.psu.edu/hg/galaxy/rev/e58e140b89f7
changeset: 2689:e58e140b89f7
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Mon Sep 14 14:54:11 2009 -0400
description:
Updated Bowtie wrapper tool to add a number of threads parameter and remove two unnecessary options
2 file(s) affected in this change:
tools/sr_mapping/bowtie_wrapper.py
tools/sr_mapping/bowtie_wrapper.xml
diffs (198 lines):
diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.py
--- a/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 12:23:16 2009 -0400
+++ b/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 14:54:11 2009 -0400
@@ -13,6 +13,7 @@
def __main__():
#Parse Command Line
parser = optparse.OptionParser()
+ parser.add_option('', '--threads', dest='threads', help='The number of threads to run')
parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format')
parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format')
parser.add_option('', '--output', dest='output', help='The output file')
@@ -35,7 +36,6 @@
parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments')
parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions")
parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read')
- parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode')
parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable')
parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments')
parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments')
@@ -45,7 +45,6 @@
parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand')
parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time')
parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n')
- parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index')
parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator')
parser.add_option('', '--dbkey', dest='dbkey', help='')
parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters')
@@ -70,10 +69,10 @@
if options.genomeSource == 'history':
# set up commands
if options.index_settings =='index_pre_set':
- indexing_cmds = ''
+ indexing_cmds = '--quiet'
else:
try:
- indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s --quiet' % \
(('','--noauto')[options.iauto_b=='set'],
('','--packed')[options.ipacked=='packed'],
('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1],
@@ -88,7 +87,7 @@
('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0],
('','--oldpmap')[options.ioldpmap=='yes'])
except ValueError:
- indexing_cmds = ''
+ indexing_cmds = '--quiet'
# make temp directory for placement of indices and copy reference file there
tmp_dir = tempfile.gettempdir()
@@ -97,7 +96,7 @@
except Exception, erf:
stop_err('Error creating temp directory for indexing purposes\n' + str(erf))
options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1])
- cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref)
+ cmd1 = 'cd %s; bowtie-build %s -f %s %s' % (tmp_dir, indexing_cmds, options.ref, options.ref)
try:
os.system(cmd1)
except Exception, erf:
@@ -106,11 +105,11 @@
# set up aligning and generate aligning command options
# automatically set threads to 8 in both cases
if options.params == 'pre_set':
- aligning_cmds = '-p 8'
+ aligning_cmds = '-p %s --quiet' % options.threads
else:
try:
aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \
- '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \
+ '%s %s %s %s %s %s %s %s %s %s %s %s -p %s --quiet' % \
(('','-s %s'%options.skip)[options.skip!='None'],
('','-u %s'%options.alignLimit)[int(options.alignLimit)>0],
('','-5 %s'%options.trimH)[int(options.trimH)>=0],
@@ -128,7 +127,6 @@
('','--norc')[options.reverseAlign=='noReverse'],
('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')],
('','-y')[options.tryHard=='doTryHard'],
- ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0],
('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0],
('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0],
('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0],
@@ -137,18 +135,18 @@
('','-B %s'%options.offbase)[int(options.offbase)>=0],
('','-z %s'%options.phased)[options.phased!='None'],
('','-o %s'%options.offrate)[int(options.offrate)>=0],
- ('','--mm')[options.mm=='doMm'],
- ('','--seed %s'%options.seed)[int(options.seed)>=0])
+ ('','--seed %s'%options.seed)[int(options.seed)>=0],
+ options.threads)
except ValueError:
- aligning_cmds = '-p 8'
+ aligning_cmds = '-p %s --quiet' % options.threads
tmp_out = tempfile.NamedTemporaryFile()
# prepare actual aligning commands
if options.paired == 'paired':
- cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
else:
- cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
+ cmd2 = 'bowtie %s %s %s > %s' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
# prepare command to convert bowtie output to sam and alternative
cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output)
cmd4 = 'cp %s %s' % (tmp_out.name, options.output)
diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.xml
--- a/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 12:23:16 2009 -0400
+++ b/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 14:54:11 2009 -0400
@@ -2,6 +2,7 @@
<description> fast alignment of reads against reference sequence </description>
<command interpreter="python">
bowtie_wrapper.py
+ --threads="8"
--input1=$singlePaired.input1
#if $singlePaired.sPaired == "paired":
--input2=$singlePaired.input2
@@ -33,17 +34,14 @@
--suppressAlign=$singlePaired.params.suppressAlign
--offbase=$singlePaired.params.offbase
--offrate=$singlePaired.params.offrate
- --mm=$singlePaired.params.mm
--seed=$singlePaired.params.seed
--best=$singlePaired.params.bestOption.best
#if $singlePaired.params.bestOption.best == "doBest":
--maxBacktracks=$singlePaired.params.bestOption.maxBacktracks
- --threadMem=$singlePaired.params.bestOption.threadMem
--strata=$singlePaired.params.bestOption.strata
--phased="None"
#else:
--maxBacktracks="None"
- --threadMem="None"
--strata="None"
#if $singlePaired.sPaired =="single":
--phased=$singlePaired.params.bestOption.phased
@@ -83,7 +81,6 @@
--offbase="None"
--best="None"
--maxBacktracks="None"
- --threadMem="None"
--strata="None"
--minInsert="None"
--maxInsert="None"
@@ -93,7 +90,6 @@
--reverseAlign="None"
--phased="None"
--offrate="None"
- --mm="None"
--seed="None"
#end if
#if $refGenomeSource.genomeSource == "history":
@@ -264,7 +260,6 @@
</when>
<when value="doBest">
<param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
- <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
<param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
<option value="noStrata">Do not use strata option</option>
<option value="doStrata">Use strata option</option>
@@ -272,10 +267,6 @@
</when>
</conditional> <!-- bestOption -->
<param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" />
- <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)">
- <option value="noMm">Use POSIX/C file I/O</option>
- <option value="doMm">Use memory-mapped I/O</option>
- </param>
<param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
</when> <!-- full -->
</conditional> <!-- params -->
@@ -339,7 +330,6 @@
</when>
<when value="doBest">
<param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
- <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
<param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
<option value="noStrata">Do not use strata option</option>
<option value="doStrata">Use strata option</option>
@@ -347,10 +337,6 @@
</when>
</conditional>
<param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" />
- <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)">
- <option value="noMm">Use POSIX/C file I/O</option>
- <option value="doMm">Use memory-mapped I/O</option>
- </param>
<param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
</when> <!-- full -->
</conditional> <!-- params -->
@@ -431,10 +417,8 @@
<param name="offbase" value="0" />
<param name="best" value="doBest" />
<param name="maxBacktracks" value="800" />
- <param name="threadMem" value="32" />
<param name="strata" value="noStrata" />
<param name="offrate" value="-1" />
- <param name="mm" value="noMm" />
<param name="seed" value="403" />
<output name="output" ftype="sam" file="bowtie_out2.sam" />
</test>
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/0f97b3048bc3
changeset: 2690:0f97b3048bc3
user: anton(a)nekrut-mbp.bx.psu.edu
date: Mon Sep 14 15:27:55 2009 -0400
description:
Modifications for fastq splitted help
2 file(s) affected in this change:
tool_conf.xml.sample
tools/metag_tools/split_paired_reads.xml
diffs (23 lines):
diff -r e58e140b89f7 -r 0f97b3048bc3 tool_conf.xml.sample
--- a/tool_conf.xml.sample Mon Sep 14 14:54:11 2009 -0400
+++ b/tool_conf.xml.sample Mon Sep 14 15:27:55 2009 -0400
@@ -338,6 +338,7 @@
<tool file="visualization/genetrack.xml" />
</section>
<section name="SAM Tools" id="samtools">
+ <tool file="samtools/sam_bitwise_flag_filter.xml" />
<tool file="samtools/sam_to_bam.xml" />
<tool file="samtools/sam_merge.xml" />
<tool file="samtools/sam_pileup.xml" />
diff -r e58e140b89f7 -r 0f97b3048bc3 tools/metag_tools/split_paired_reads.xml
--- a/tools/metag_tools/split_paired_reads.xml Mon Sep 14 14:54:11 2009 -0400
+++ b/tools/metag_tools/split_paired_reads.xml Mon Sep 14 15:27:55 2009 -0400
@@ -20,7 +20,7 @@
**What it does**
-This tool splits a single paired-end file in half and returns two files with each ends.
+Splits a single fastq datasret representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
-----
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/a5ee939839eb
changeset: 2687:a5ee939839eb
user: Nate Coraor <nate(a)bx.psu.edu>
date: Mon Sep 14 12:11:00 2009 -0400
description:
Remove session stuff from reports webapp
1 file(s) affected in this change:
lib/galaxy/webapps/reports/buildapp.py
diffs (28 lines):
diff -r d301a67eda40 -r a5ee939839eb lib/galaxy/webapps/reports/buildapp.py
--- a/lib/galaxy/webapps/reports/buildapp.py Mon Sep 14 11:05:36 2009 -0400
+++ b/lib/galaxy/webapps/reports/buildapp.py Mon Sep 14 12:11:00 2009 -0400
@@ -87,17 +87,6 @@
from paste import recursive
app = recursive.RecursiveMiddleware( app, conf )
log.debug( "Enabling 'recursive' middleware" )
- ## # Session middleware puts a session factory into the environment
- ## if asbool( conf.get( 'use_session', True ) ):
- ## store = flup_session.MemorySessionStore()
- ## app = flup_session.SessionMiddleware( store, app )
- ## log.debug( "Enabling 'flup session' middleware" )
- # Beaker session middleware
- if asbool( conf.get( 'use_beaker_session', False ) ):
- pkg_resources.require( "Beaker" )
- import beaker.session
- app = beaker.session.SessionMiddleware( app, conf )
- log.debug( "Enabling 'beaker session' middleware" )
# Various debug middleware that can only be turned on if the debug
# flag is set, either because they are insecure or greatly hurt
# performance
@@ -185,4 +174,4 @@
if isinstance( exc_value, AttributeError ) and exc_value.args[0].startswith( "'Undefined' object has no attribute" ):
return mako.exceptions.html_error_template().render( full=False, css=False )
formatters.append( mako_html_data )
- return formatters
\ No newline at end of file
+ return formatters
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/7f4c8fee3b39
changeset: 2688:7f4c8fee3b39
user: Nate Coraor <nate(a)bx.psu.edu>
date: Mon Sep 14 12:23:16 2009 -0400
description:
Fix path mangling in cleanup_datasets.py
1 file(s) affected in this change:
scripts/cleanup_datasets/cleanup_datasets.py
diffs (23 lines):
diff -r a5ee939839eb -r 7f4c8fee3b39 scripts/cleanup_datasets/cleanup_datasets.py
--- a/scripts/cleanup_datasets/cleanup_datasets.py Mon Sep 14 12:11:00 2009 -0400
+++ b/scripts/cleanup_datasets/cleanup_datasets.py Mon Sep 14 12:23:16 2009 -0400
@@ -1,4 +1,8 @@
#!/usr/bin/env python
+
+new_path = [ os.path.join( os.getcwd(), "lib" ) ]
+new_path.extend( sys.path[1:] ) # remove scripts/ from the path
+sys.path = new_path
from galaxy import eggs
import pkg_resources
@@ -8,10 +12,6 @@
from datetime import datetime, timedelta
from time import strftime
from optparse import OptionParser
-
-new_path = [ os.path.join( os.getcwd(), "lib" ) ]
-new_path.extend( sys.path[1:] ) # remove scripts/ from the path
-sys.path = new_path
import galaxy.model.mapping
from galaxy.model.orm import and_, eagerload
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/f2af04af3caa
changeset: 2685:f2af04af3caa
user: Kanwei Li <kanwei(a)gmail.com>
date: Fri Sep 11 16:09:02 2009 -0400
description:
Add tool_conf.xml.main that was removed
1 file(s) affected in this change:
tool_conf.xml.main
diffs (267 lines):
diff -r 355b6844b123 -r f2af04af3caa tool_conf.xml.main
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_conf.xml.main Fri Sep 11 16:09:02 2009 -0400
@@ -0,0 +1,263 @@
+<?xml version="1.0"?>
+<toolbox>
+ <section name="Get Data" id="getext">
+ <tool file="data_source/upload.xml"/>
+ <tool file="data_source/ucsc_tablebrowser.xml" />
+ <tool file="data_source/ucsc_tablebrowser_archaea.xml" />
+ <tool file="data_source/microbial_import.xml" />
+ <tool file="data_source/biomart.xml" />
+ <tool file="data_source/gramene_mart.xml" />
+ <tool file="data_source/flymine.xml" />
+ <tool file="data_source/encode_db.xml" />
+ <tool file="data_source/epigraph_import.xml" />
+ </section>
+ <section name="Send Data" id="send">
+ <tool file="data_destination/epigraph.xml" />
+ </section>
+ <section name="ENCODE Tools" id="EncodeTools">
+ <tool file="encode/gencode_partition.xml" />
+ <tool file="encode/random_intervals.xml" />
+ </section>
+ <section name="Lift-Over" id="liftOver">
+ <tool file="extract/liftOver_wrapper.xml" />
+ </section>
+ <section name="Text Manipulation" id="textutil">
+ <tool file="filters/fixedValueColumn.xml" />
+ <tool file="stats/column_maker.xml" />
+ <tool file="filters/catWrapper.xml" />
+ <tool file="filters/condense_characters.xml" />
+ <tool file="filters/convert_characters.xml" />
+ <tool file="filters/CreateInterval.xml" />
+ <tool file="filters/cutWrapper.xml" />
+ <tool file="filters/changeCase.xml" />
+ <tool file="filters/pasteWrapper.xml" />
+ <tool file="filters/remove_beginning.xml" />
+ <tool file="filters/headWrapper.xml" />
+ <tool file="filters/tailWrapper.xml" />
+ </section>
+ <section name="Convert Formats" id="convert">
+ <tool file="filters/bed2gff.xml" />
+ <tool file="fasta_tools/fasta_to_tabular.xml" />
+ <tool file="filters/gff2bed.xml" />
+ <tool file="maf/maf_to_bed.xml" />
+ <tool file="maf/maf_to_fasta.xml" />
+ <tool file="fasta_tools/tabular_to_fasta.xml" />
+ </section>
+ <section name="FASTA manipulation" id="fasta_manipulation">
+ <tool file="fasta_tools/fasta_compute_length.xml" />
+ <tool file="fasta_tools/fasta_filter_by_length.xml" />
+ <tool file="fasta_tools/fasta_concatenate_by_species.xml" />
+ <tool file="fasta_tools/fasta_to_tabular.xml" />
+ <tool file="fasta_tools/tabular_to_fasta.xml" />
+ </section>
+ <section name="Filter and Sort" id="filter">
+ <tool file="stats/filtering.xml" />
+ <tool file="filters/sorter.xml" />
+ <tool file="filters/grep.xml" />
+ </section>
+ <section name="Join, Subtract and Group" id="group">
+ <tool file="filters/joiner.xml" />
+ <tool file="filters/compare.xml"/>
+ <tool file="new_operations/subtract_query.xml"/>
+ <tool file="stats/grouping.xml" />
+ </section>
+ <section name="Extract Features" id="features">
+ <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" />
+ <tool file="extract/extract_GFF_Features.xml" />
+ </section>
+ <section name="Fetch Sequences" id="fetchSeq">
+ <tool file="extract/extract_genomic_dna.xml" />
+ </section>
+ <section name="Fetch Alignments" id="fetchAlign">
+ <tool file="maf/interval2maf_pairwise.xml" />
+ <tool file="maf/interval2maf.xml" />
+ <tool file="maf/interval_maf_to_merged_fasta.xml" />
+ <tool file="maf/genebed_maf_to_fasta.xml"/>
+ <tool file="maf/maf_stats.xml"/>
+ <tool file="maf/maf_thread_for_species.xml"/>
+ <tool file="maf/maf_limit_to_species.xml"/>
+ <tool file="maf/maf_limit_size.xml"/>
+ <tool file="maf/maf_by_block_number.xml"/>
+ <tool file="maf/maf_filter.xml"/>
+ <!--
+ <tool file="maf/maf_reverse_complement.xml"/>
+ -->
+ </section>
+ <section name="Get Genomic Scores" id="scores">
+ <tool file="stats/wiggle_to_simple.xml" />
+ <tool file="stats/aggregate_binned_scores_in_intervals.xml" />
+ <tool file="extract/phastOdds/phastOdds_tool.xml" />
+ </section>
+ <section name="Operate on Genomic Intervals" id="bxops">
+ <tool file="new_operations/intersect.xml" />
+ <tool file="new_operations/subtract.xml" />
+ <tool file="new_operations/merge.xml" />
+ <tool file="new_operations/concat.xml" />
+ <tool file="new_operations/basecoverage.xml" />
+ <tool file="new_operations/coverage.xml" />
+ <tool file="new_operations/complement.xml" />
+ <tool file="new_operations/cluster.xml" id="cluster" />
+ <tool file="new_operations/join.xml" />
+ <tool file="new_operations/get_flanks.xml" />
+ <tool file="new_operations/flanking_features.xml" />
+ <tool file="annotation_profiler/annotation_profiler.xml" />
+ </section>
+ <section name="Statistics" id="stats">
+ <tool file="stats/gsummary.xml" />
+ <tool file="filters/uniq.xml" />
+ <tool file="stats/cor.xml" />
+ </section>
+ <section name="Graph/Display Data" id="plots">
+ <tool file="plotting/histogram2.xml" />
+ <tool file="plotting/scatterplot.xml" />
+ <tool file="plotting/xy_plot.xml" />
+ <tool file="visualization/GMAJ.xml" />
+ <tool file="visualization/build_ucsc_custom_track.xml" />
+ </section>
+ <section name="Regional Variation" id="regVar">
+ <tool file="regVariation/windowSplitter.xml" />
+ <tool file="regVariation/featureCounter.xml" />
+ <tool file="regVariation/quality_filter.xml" />
+ <tool file="regVariation/maf_cpg_filter.xml" />
+ <tool file="regVariation/getIndels_2way.xml" />
+ <tool file="regVariation/getIndels_3way.xml" />
+ <tool file="regVariation/getIndelRates_3way.xml" />
+ <tool file="regVariation/substitutions.xml" />
+ <tool file="regVariation/substitution_rates.xml" />
+ <tool file="regVariation/microsats_alignment_level.xml" />
+ <tool file="regVariation/microsats_mutability.xml" />
+ </section>
+ <section name="Multiple regression" id="multReg">
+ <tool file="regVariation/linear_regression.xml" />
+ <tool file="regVariation/best_regression_subsets.xml" />
+ <tool file="regVariation/rcve.xml" />
+ </section>
+ <section name="Evolution: HyPhy" id="hyphy">
+ <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" />
+ <tool file="hyphy/hyphy_nj_tree_wrapper.xml" />
+ <tool file="hyphy/hyphy_dnds_wrapper.xml" />
+ </section>
+ <section name="Metagenomic analyses" id="tax_manipulation">
+ <tool file="taxonomy/gi2taxonomy.xml" />
+ <tool file="taxonomy/t2t_report.xml" />
+ <tool file="taxonomy/t2ps_wrapper.xml" />
+ <tool file="taxonomy/find_diag_hits.xml" />
+ <tool file="taxonomy/lca.xml" />
+ <tool file="taxonomy/poisson2test.xml" />
+ </section>
+ <section name="Short Read Analysis" id="short_read_analysis">
+ <tool file="metag_tools/short_reads_figure_score.xml" />
+ <tool file="metag_tools/short_reads_trim_seq.xml" />
+ <tool file="metag_tools/megablast_wrapper.xml" />
+ <tool file="metag_tools/megablast_xml_parser.xml" />
+ </section>
+ <section name="EMBOSS" id="EMBOSSLite">
+ <tool file="emboss_5/emboss_antigenic.xml" />
+ <tool file="emboss_5/emboss_backtranseq.xml" />
+ <tool file="emboss_5/emboss_banana.xml" />
+ <tool file="emboss_5/emboss_biosed.xml" />
+ <tool file="emboss_5/emboss_btwisted.xml" />
+ <tool file="emboss_5/emboss_cai_custom.xml" />
+ <tool file="emboss_5/emboss_cai.xml" />
+ <tool file="emboss_5/emboss_chaos.xml" />
+ <tool file="emboss_5/emboss_charge.xml" />
+ <tool file="emboss_5/emboss_checktrans.xml" />
+ <tool file="emboss_5/emboss_chips.xml" />
+ <tool file="emboss_5/emboss_cirdna.xml" />
+ <tool file="emboss_5/emboss_codcmp.xml" />
+ <tool file="emboss_5/emboss_coderet.xml" />
+ <tool file="emboss_5/emboss_compseq.xml" />
+ <tool file="emboss_5/emboss_cpgplot.xml" />
+ <tool file="emboss_5/emboss_cpgreport.xml" />
+ <tool file="emboss_5/emboss_cusp.xml" />
+ <tool file="emboss_5/emboss_cutseq.xml" />
+ <tool file="emboss_5/emboss_dan.xml" />
+ <tool file="emboss_5/emboss_degapseq.xml" />
+ <tool file="emboss_5/emboss_descseq.xml" />
+ <tool file="emboss_5/emboss_diffseq.xml" />
+ <tool file="emboss_5/emboss_digest.xml" />
+ <tool file="emboss_5/emboss_dotmatcher.xml" />
+ <tool file="emboss_5/emboss_dotpath.xml" />
+ <tool file="emboss_5/emboss_dottup.xml" />
+ <tool file="emboss_5/emboss_dreg.xml" />
+ <tool file="emboss_5/emboss_einverted.xml" />
+ <tool file="emboss_5/emboss_epestfind.xml" />
+ <tool file="emboss_5/emboss_equicktandem.xml" />
+ <tool file="emboss_5/emboss_est2genome.xml" />
+ <tool file="emboss_5/emboss_etandem.xml" />
+ <tool file="emboss_5/emboss_extractfeat.xml" />
+ <tool file="emboss_5/emboss_extractseq.xml" />
+ <tool file="emboss_5/emboss_freak.xml" />
+ <tool file="emboss_5/emboss_fuzznuc.xml" />
+ <tool file="emboss_5/emboss_fuzzpro.xml" />
+ <tool file="emboss_5/emboss_fuzztran.xml" />
+ <tool file="emboss_5/emboss_garnier.xml" />
+ <tool file="emboss_5/emboss_geecee.xml" />
+ <tool file="emboss_5/emboss_getorf.xml" />
+ <tool file="emboss_5/emboss_helixturnhelix.xml" />
+ <tool file="emboss_5/emboss_hmoment.xml" />
+ <tool file="emboss_5/emboss_iep.xml" />
+ <tool file="emboss_5/emboss_infoseq.xml" />
+ <tool file="emboss_5/emboss_isochore.xml" />
+ <tool file="emboss_5/emboss_lindna.xml" />
+ <tool file="emboss_5/emboss_marscan.xml" />
+ <tool file="emboss_5/emboss_maskfeat.xml" />
+ <tool file="emboss_5/emboss_maskseq.xml" />
+ <tool file="emboss_5/emboss_matcher.xml" />
+ <tool file="emboss_5/emboss_megamerger.xml" />
+ <tool file="emboss_5/emboss_merger.xml" />
+ <tool file="emboss_5/emboss_msbar.xml" />
+ <tool file="emboss_5/emboss_needle.xml" />
+ <tool file="emboss_5/emboss_newcpgreport.xml" />
+ <tool file="emboss_5/emboss_newcpgseek.xml" />
+ <tool file="emboss_5/emboss_newseq.xml" />
+ <tool file="emboss_5/emboss_noreturn.xml" />
+ <tool file="emboss_5/emboss_notseq.xml" />
+ <tool file="emboss_5/emboss_nthseq.xml" />
+ <tool file="emboss_5/emboss_octanol.xml" />
+ <tool file="emboss_5/emboss_oddcomp.xml" />
+ <tool file="emboss_5/emboss_palindrome.xml" />
+ <tool file="emboss_5/emboss_pasteseq.xml" />
+ <tool file="emboss_5/emboss_patmatdb.xml" />
+ <tool file="emboss_5/emboss_pepcoil.xml" />
+ <tool file="emboss_5/emboss_pepinfo.xml" />
+ <tool file="emboss_5/emboss_pepnet.xml" />
+ <tool file="emboss_5/emboss_pepstats.xml" />
+ <tool file="emboss_5/emboss_pepwheel.xml" />
+ <tool file="emboss_5/emboss_pepwindow.xml" />
+ <tool file="emboss_5/emboss_pepwindowall.xml" />
+ <tool file="emboss_5/emboss_plotcon.xml" />
+ <tool file="emboss_5/emboss_plotorf.xml" />
+ <tool file="emboss_5/emboss_polydot.xml" />
+ <tool file="emboss_5/emboss_preg.xml" />
+ <tool file="emboss_5/emboss_prettyplot.xml" />
+ <tool file="emboss_5/emboss_prettyseq.xml" />
+ <tool file="emboss_5/emboss_primersearch.xml" />
+ <tool file="emboss_5/emboss_revseq.xml" />
+ <tool file="emboss_5/emboss_seqmatchall.xml" />
+ <tool file="emboss_5/emboss_seqret.xml" />
+ <tool file="emboss_5/emboss_showfeat.xml" />
+ <tool file="emboss_5/emboss_shuffleseq.xml" />
+ <tool file="emboss_5/emboss_sigcleave.xml" />
+ <tool file="emboss_5/emboss_sirna.xml" />
+ <tool file="emboss_5/emboss_sixpack.xml" />
+ <tool file="emboss_5/emboss_skipseq.xml" />
+ <tool file="emboss_5/emboss_splitter.xml" />
+ <tool file="emboss_5/emboss_supermatcher.xml" />
+ <tool file="emboss_5/emboss_syco.xml" />
+ <tool file="emboss_5/emboss_tcode.xml" />
+ <tool file="emboss_5/emboss_textsearch.xml" />
+ <tool file="emboss_5/emboss_tmap.xml" />
+ <tool file="emboss_5/emboss_tranalign.xml" />
+ <tool file="emboss_5/emboss_transeq.xml" />
+ <tool file="emboss_5/emboss_trimest.xml" />
+ <tool file="emboss_5/emboss_trimseq.xml" />
+ <tool file="emboss_5/emboss_twofeat.xml" />
+ <tool file="emboss_5/emboss_union.xml" />
+ <tool file="emboss_5/emboss_vectorstrip.xml" />
+ <tool file="emboss_5/emboss_water.xml" />
+ <tool file="emboss_5/emboss_wobble.xml" />
+ <tool file="emboss_5/emboss_wordcount.xml" />
+ <tool file="emboss_5/emboss_wordmatch.xml" />
+ </section>
+</toolbox>
1
0
14 Sep '09
details: http://www.bx.psu.edu/hg/galaxy/rev/d301a67eda40
changeset: 2686:d301a67eda40
user: Greg Von Kuster <greg(a)bx.psu.edu>
date: Mon Sep 14 11:05:36 2009 -0400
description:
Move the data library admin methods to a separate library_admin controller.
23 file(s) affected in this change:
lib/galaxy/web/controllers/admin.py
lib/galaxy/web/controllers/library_admin.py
templates/admin/index.mako
templates/admin/library/browse_libraries.mako
templates/admin/library/browse_library.mako
templates/admin/library/common.mako
templates/admin/library/folder_info.mako
templates/admin/library/folder_permissions.mako
templates/admin/library/ldda_edit_info.mako
templates/admin/library/ldda_info.mako
templates/admin/library/ldda_permissions.mako
templates/admin/library/library_dataset_info.mako
templates/admin/library/library_dataset_permissions.mako
templates/admin/library/library_info.mako
templates/admin/library/library_permissions.mako
templates/admin/library/new_dataset.mako
templates/admin/library/new_folder.mako
templates/admin/library/new_library.mako
templates/admin/library/select_info_template.mako
templates/admin/requests/show_request.mako
test/base/twilltestcase.py
test/functional/test_forms_and_requests.py
test/functional/test_security_and_libraries.py
diffs (truncated from 3482 to 3000 lines):
diff -r f2af04af3caa -r d301a67eda40 lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py Fri Sep 11 16:09:02 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py Mon Sep 14 11:05:36 2009 -0400
@@ -1,15 +1,9 @@
-import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys
+import string, sys
from datetime import datetime, timedelta
from galaxy import util, datatypes
from galaxy.web.base.controller import *
from galaxy.model.orm import *
from galaxy.web.controllers.forms import get_all_forms, get_form_widgets
-# Older py compatibility
-try:
- set()
-except:
- from sets import Set as set
-
import logging
log = logging.getLogger( __name__ )
@@ -673,1188 +667,6 @@
out_groups=out_groups,
msg=msg,
messagetype=messagetype )
-
- # Galaxy Library Stuff
- @web.expose
- @web.require_admin
- def browse_libraries( self, trans, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- return trans.fill_template( '/admin/library/browse_libraries.mako',
- libraries=trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \
- .order_by( trans.app.model.Library.name ).all(),
- deleted=False,
- show_deleted=False,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def browse_library( self, trans, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- id = params.get( 'id', None )
- deleted = util.string_as_bool( params.get( 'deleted', False ) )
- show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
- if not id:
- msg = "You must specify a library id."
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_libraries',
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- library = library=trans.app.model.Library.get( id )
- if not library:
- msg = "Invalid library id ( %s )."
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_libraries',
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- created_ldda_ids = params.get( 'created_ldda_ids', '' )
- return trans.fill_template( '/admin/library/browse_library.mako',
- library=trans.app.model.Library.get( id ),
- deleted=deleted,
- created_ldda_ids=created_ldda_ids,
- forms=get_all_forms( trans, filter=dict(deleted=False) ),
- msg=msg,
- messagetype=messagetype,
- show_deleted=show_deleted )
- @web.expose
- @web.require_admin
- def library( self, trans, id=None, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- if params.get( 'new', False ):
- action = 'new'
- elif params.get( 'delete', False ):
- action = 'delete'
- elif params.get( 'permissions', False ):
- action = 'permissions'
- else:
- action = 'information'
- if not id and not action == 'new':
- msg = "You must specify a library to %s." % action
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_libraries',
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if not action == 'new':
- library = trans.app.model.Library.get( int( id ) )
- if action == 'new':
- if params.new == 'submitted':
- library = trans.app.model.Library( name = util.restore_text( params.name ),
- description = util.restore_text( params.description ) )
- root_folder = trans.app.model.LibraryFolder( name = util.restore_text( params.name ), description = "" )
- root_folder.flush()
- library.root_folder = root_folder
- library.flush()
- msg = "The new library named '%s' has been created" % library.name
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library.id,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/new_library.mako', msg=msg, messagetype=messagetype )
- elif action == 'information':
- # See if we have any associated templates
- info_association = library.get_info_association()
- if info_association:
- template = info_association.template
- # See if we have any field contents
- info = info_association.info
- if info:
- widgets = get_form_widgets( trans, template, info.content )
- else:
- widgets = get_form_widgets( trans, template )
- else:
- widgets = []
- if params.get( 'rename_library_button', False ):
- old_name = library.name
- new_name = util.restore_text( params.name )
- new_description = util.restore_text( params.description )
- if not new_name:
- msg = 'Enter a valid name'
- return trans.fill_template( '/admin/library/library_info.mako',
- library=library,
- widgets=widgets,
- msg=msg,
- messagetype='error' )
- else:
- library.name = new_name
- library.description = new_description
- library.flush()
- # Rename the root_folder
- library.root_folder.name = new_name
- library.root_folder.description = new_description
- library.root_folder.flush()
- msg = "Library '%s' has been renamed to '%s'" % ( old_name, new_name )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='library',
- id=id,
- edit_info=True,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/library_info.mako',
- library=library,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif action == 'delete':
- def delete_folder( library_folder ):
- library_folder.refresh()
- for folder in library_folder.folders:
- delete_folder( folder )
- for library_dataset in library_folder.datasets:
- library_dataset.refresh()
- ldda = library_dataset.library_dataset_dataset_association
- if ldda:
- ldda.refresh()
- # We don't set ldda.dataset.deleted to True here because the cleanup_dataset script
- # will eventually remove it from disk. The purge_library method below sets the dataset
- # to deleted. This allows for the library to be undeleted ( before it is purged ),
- # restoring all of its contents.
- ldda.deleted = True
- ldda.flush()
- library_dataset.deleted = True
- library_dataset.flush()
- library_folder.deleted = True
- library_folder.flush()
- library.refresh()
- delete_folder( library.root_folder )
- library.deleted = True
- library.flush()
- msg = "Library '%s' and all of its contents have been marked deleted" % library.name
- return trans.response.send_redirect( web.url_for( action='browse_libraries', msg=util.sanitize_text( msg ), messagetype='done' ) )
- elif action == 'permissions':
- if params.get( 'update_roles_button', False ):
- # The user clicked the Save button on the 'Associate With Roles' form
- permissions = {}
- for k, v in trans.app.model.Library.permitted_actions.items():
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- trans.app.security_agent.set_all_library_permissions( library, permissions )
- library.refresh()
- # Copy the permissions to the root folder
- trans.app.security_agent.copy_library_permissions( library, library.root_folder )
- msg = "Permissions updated for library '%s'" % library.name
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='library',
- id=id,
- permissions=True,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/library_permissions.mako',
- library=library,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def deleted_libraries( self, trans, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- libraries=trans.app.model.Library.filter( and_( trans.app.model.Library.table.c.deleted==True,
- trans.app.model.Library.table.c.purged==False ) ) \
- .order_by( trans.app.model.Library.table.c.name ).all()
- return trans.fill_template( '/admin/library/browse_libraries.mako',
- libraries=libraries,
- deleted=True,
- msg=msg,
- messagetype=messagetype,
- show_deleted=True )
- @web.expose
- @web.require_admin
- def purge_library( self, trans, **kwd ):
- params = util.Params( kwd )
- library = trans.app.model.Library.get( int( params.id ) )
- def purge_folder( library_folder ):
- for lf in library_folder.folders:
- purge_folder( lf )
- library_folder.refresh()
- for library_dataset in library_folder.datasets:
- library_dataset.refresh()
- ldda = library_dataset.library_dataset_dataset_association
- if ldda:
- ldda.refresh()
- dataset = ldda.dataset
- dataset.refresh()
- # If the dataset is not associated with any additional undeleted folders, then we can delete it.
- # We don't set dataset.purged to True here because the cleanup_datasets script will do that for
- # us, as well as removing the file from disk.
- #if not dataset.deleted and len( dataset.active_library_associations ) <= 1: # This is our current ldda
- dataset.deleted = True
- dataset.flush()
- ldda.deleted = True
- ldda.flush()
- library_dataset.deleted = True
- library_dataset.flush()
- library_folder.deleted = True
- library_folder.purged = True
- library_folder.flush()
- if not library.deleted:
- msg = "Library '%s' has not been marked deleted, so it cannot be purged" % ( library.name )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_libraries',
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- else:
- purge_folder( library.root_folder )
- library.purged = True
- library.flush()
- msg = "Library '%s' and all of its contents have been purged, datasets will be removed from disk via the cleanup_datasets script" % library.name
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='deleted_libraries',
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- @web.expose
- @web.require_admin
- def folder( self, trans, id, library_id, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- if params.get( 'new', False ):
- action = 'new'
- elif params.get( 'delete', False ):
- action = 'delete'
- elif params.get( 'permissions', False ):
- action = 'permissions'
- else:
- # 'information' will be the default
- action = 'information'
- folder = trans.app.model.LibraryFolder.get( int( id ) )
- if not folder:
- msg = "Invalid folder specified, id: %s" % str( id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if action == 'new':
- if params.new == 'submitted':
- new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ),
- description=util.restore_text( params.description ) )
- # We are associating the last used genome build with folders, so we will always
- # initialize a new folder with the first dbkey in util.dbnames which is currently
- # ? unspecified (?)
- new_folder.genome_build = util.dbnames.default_value
- folder.add_folder( new_folder )
- new_folder.flush()
- # New folders default to having the same permissions as their parent folder
- trans.app.security_agent.copy_library_permissions( folder, new_folder )
- msg = "New folder named '%s' has been added to the library" % new_folder.name
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/new_folder.mako',
- library_id=library_id,
- folder=folder,
- msg=msg,
- messagetype=messagetype )
- elif action == 'information':
- # See if we have any associated templates
- info_association = folder.get_info_association()
- if info_association:
- template = info_association.template
- # See if we have any field contents
- info = info_association.info
- if info:
- widgets = get_form_widgets( trans, template, info.content )
- else:
- widgets = get_form_widgets( trans, template )
- else:
- widgets = []
- if params.get( 'rename_folder_button', False ):
- old_name = folder.name
- new_name = util.restore_text( params.name )
- new_description = util.restore_text( params.description )
- if not new_name:
- msg = 'Enter a valid name'
- return trans.fill_template( '/admin/library/folder_info.mako',
- folder=folder,
- library_id=library_id,
- widgets=widgets,
- msg=msg,
- messagetype='error' )
- else:
- folder.name = new_name
- folder.description = new_description
- folder.flush()
- msg = "Folder '%s' has been renamed to '%s'" % ( old_name, new_name )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='folder',
- id=id,
- library_id=library_id,
- edit_info=True,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/folder_info.mako',
- folder=folder,
- library_id=library_id,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif action == 'delete':
- folder.deleted = True
- folder.flush()
- msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name
- return trans.response.send_redirect( web.url_for( action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- elif action =='permissions':
- if params.get( 'update_roles_button', False ):
- # The user clicked the Save button on the 'Associate With Roles' form
- permissions = {}
- for k, v in trans.app.model.Library.permitted_actions.items():
- in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ]
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- trans.app.security_agent.set_all_library_permissions( folder, permissions )
- folder.refresh()
- msg = "Permissions updated for folder '%s'" % folder.name
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='folder',
- id=id,
- library_id=library_id,
- permissions=True,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- return trans.fill_template( '/admin/library/folder_permissions.mako',
- folder=folder,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def library_dataset( self, trans, id, library_id, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- if params.get( 'permissions', False ):
- action = 'permissions'
- else:
- action = 'information'
- library_dataset = trans.app.model.LibraryDataset.get( id )
- if not library_dataset:
- msg = "Invalid library dataset specified, id: %s" %str( id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if action == 'information':
- if params.get( 'edit_attributes_button', False ):
- old_name = library_dataset.name
- new_name = util.restore_text( params.get( 'name', '' ) )
- new_info = util.restore_text( params.get( 'info', '' ) )
- if not new_name:
- msg = 'Enter a valid name'
- messagetype = 'error'
- else:
- library_dataset.name = new_name
- library_dataset.info = new_info
- library_dataset.flush()
- msg = "Dataset '%s' has been renamed to '%s'" % ( old_name, new_name )
- messagetype = 'done'
- return trans.fill_template( '/admin/library/library_dataset_info.mako',
- library_dataset=library_dataset,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- elif action == 'permissions':
- if params.get( 'update_roles_button', False ):
- # The user clicked the Save button on the 'Edit permissions and role associations' form
- permissions = {}
- for k, v in trans.app.model.Library.permitted_actions.items():
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- # Set the LIBRARY permissions on the LibraryDataset
- # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
- trans.app.security_agent.set_all_library_permissions( library_dataset, permissions )
- library_dataset.refresh()
- # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
- trans.app.security_agent.set_all_library_permissions( library_dataset.library_dataset_dataset_association, permissions )
- library_dataset.library_dataset_dataset_association.refresh()
- msg = 'Permissions and roles have been updated for library dataset %s' % library_dataset.name
- return trans.fill_template( '/admin/library/library_dataset_permissions.mako',
- library_dataset=library_dataset,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def library_dataset_dataset_association( self, trans, library_id, folder_id, id=None, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- deleted = util.string_as_bool( params.get( 'deleted', False ) )
- show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
- dbkey = params.get( 'dbkey', None )
- if isinstance( dbkey, list ):
- last_used_build = dbkey[0]
- else:
- last_used_build = dbkey
- folder = trans.app.model.LibraryFolder.get( folder_id )
- if folder and last_used_build in [ 'None', None, '?' ]:
- last_used_build = folder.genome_build
- replace_id = params.get( 'replace_id', None )
- if replace_id:
- replace_dataset = trans.app.model.LibraryDataset.get( int( replace_id ) )
- if not last_used_build:
- last_used_build = replace_dataset.library_dataset_dataset_association.dbkey
- else:
- replace_dataset = None
- # Let's not overwrite the imported datatypes module with the variable datatypes?
- # The built-in 'id' is overwritten in lots of places as well
- ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
- ldatatypes.sort()
- if params.get( 'new_dataset_button', False ):
- upload_option = params.get( 'upload_option', 'upload_file' )
- created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans,
- controller='admin',
- library_id=library_id,
- folder_id=folder_id,
- replace_dataset=replace_dataset,
- **kwd )
- if created_ldda_ids:
- total_added = len( created_ldda_ids.split( ',' ) )
- if replace_dataset:
- msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name )
- else:
- if not folder.parent:
- # Libraries have the same name as their root_folder
- msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name )
- else:
- msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name )
- msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
- messagetype='done'
- else:
- msg = "Upload failed"
- messagetype='error'
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- created_ldda_ids=created_ldda_ids,
- msg=util.sanitize_text( msg ),
- messagetype=messagetype ) )
- elif not id or replace_dataset:
- # See if we have any associated templates
- info_association = folder.get_info_association()
- if info_association:
- template = info_association.template
- widgets = get_form_widgets( trans, template )
- else:
- widgets = []
- upload_option = params.get( 'upload_option', 'upload_file' )
- # No dataset(s) specified, so display the upload form. Send list of data formats to the form
- # so the "extension" select list can be populated dynamically
- file_formats = trans.app.datatypes_registry.upload_file_formats
- # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically
- def get_dbkey_options( last_used_build ):
- for dbkey, build_name in util.dbnames:
- yield build_name, dbkey, ( dbkey==last_used_build )
- dbkeys = get_dbkey_options( last_used_build )
- # Send list of roles to the form so the dataset can be associated with 1 or more of them.
- roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all()
- # Send the current history to the form to enable importing datasets from history to library
- history = trans.get_history()
- history.refresh()
- return trans.fill_template( '/admin/library/new_dataset.mako',
- upload_option=upload_option,
- library_id=library_id,
- folder_id=folder_id,
- replace_id=replace_id,
- file_formats=file_formats,
- dbkeys=dbkeys,
- last_used_build=last_used_build,
- roles=roles,
- history=history,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype,
- replace_dataset=replace_dataset )
- else:
- if params.get( 'permissions', False ):
- action = 'permissions'
- elif params.get( 'edit_info', False ):
- action = 'edit_info'
- else:
- action = 'info'
- if id.count( ',' ):
- ids = id.split( ',' )
- id = None
- else:
- ids = None
- if id:
- # ldda_id specified, display attributes form
- ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
- if not ldda:
- msg = "Invalid LibraryDatasetDatasetAssociation specified, id: %s" % str( id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- # See if we have any associated templates
- info_association = ldda.get_info_association()
- if info_association:
- template = info_association.template
- # See if we have any field contents
- info = info_association.info
- if info:
- widgets = get_form_widgets( trans, template, info.content )
- else:
- widgets = get_form_widgets( trans, template )
- else:
- widgets = []
- if action == 'permissions':
- if params.get( 'update_roles_button', False ):
- permissions = {}
- accessible = False
- for k, v in trans.app.model.Dataset.permitted_actions.items():
- # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not
- # the DATASET_ACCESS permission, making the former useless. Need to display a warning message.
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
- # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible
- if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
- if len( in_roles ) > 1:
- # Get the set of all users that are being associated with the dataset
- in_roles_set = set()
- for role in in_roles:
- in_roles_set.add( role )
- users_set = set()
- for role in in_roles:
- for ura in role.users:
- users_set.add( ura.user )
- # Make sure that at least 1 user has every role being associated with the dataset
- for user in users_set:
- user_roles_set = set()
- for ura in user.roles:
- user_roles_set.add( ura.role )
- if in_roles_set.issubset( user_roles_set ):
- accessible = True
- break
- else:
- accessible = True
- if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
- # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions
- # TODO: keep access permissions as they originally were, rather than automatically making public
- permissions[ trans.app.security_agent.get_action( v.action ) ] = []
- else:
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- # Set the DATASET permissions on the Dataset
- trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions )
- ldda.dataset.refresh()
- permissions = {}
- for k, v in trans.app.model.Library.permitted_actions.items():
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- # Set the LIBRARY permissions on the LibraryDataset
- # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
- trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions )
- ldda.library_dataset.refresh()
- # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
- trans.app.security_agent.set_all_library_permissions( ldda, permissions )
- ldda.refresh()
- if not accessible:
- msg = "At least 1 user must have every role associated with accessing dataset '%s'. " % ldda.name
- msg += "The roles you attempted to associate for access would make this dataset inaccessible by everyone, "
- msg += "so access permissions were not set. All other permissions were updated for the dataset."
- messagetype = 'error'
- else:
- msg = "Permissions updated for dataset '%s'" % ldda.name
- return trans.fill_template( '/admin/library/ldda_permissions.mako',
- ldda=ldda,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- elif action == 'info':
- return trans.fill_template( '/admin/library/ldda_info.mako',
- ldda=ldda,
- library_id=library_id,
- deleted=deleted,
- show_deleted=show_deleted,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif action == 'edit_info':
- if params.get( 'change', False ):
- # The user clicked the Save button on the 'Change data type' form
- if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
- trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
- trans.app.model.flush()
- msg = "Data type changed for library dataset '%s'" % ldda.name
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- else:
- return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) )
- elif params.get( 'save', False ):
- # The user clicked the Save button on the 'Edit Attributes' form
- old_name = ldda.name
- new_name = util.restore_text( params.get( 'name', '' ) )
- new_info = util.restore_text( params.get( 'info', '' ) )
- new_message = util.restore_text( params.get( 'message', '' ) )
- if not new_name:
- msg = 'Enter a valid name'
- messagetype = 'error'
- else:
- ldda.name = new_name
- ldda.info = new_info
- ldda.message = new_message
- # The following for loop will save all metadata_spec items
- for name, spec in ldda.datatype.metadata_spec.items():
- if spec.get("readonly"):
- continue
- optional = params.get( "is_" + name, None )
- if optional and optional == 'true':
- # optional element... == 'true' actually means it is NOT checked (and therefore ommitted)
- setattr( ldda.metadata, name, None )
- else:
- setattr( ldda.metadata, name, spec.unwrap( params.get ( name, None ) ) )
- ldda.metadata.dbkey = dbkey
- ldda.datatype.after_edit( ldda )
- trans.app.model.flush()
- msg = 'Attributes updated for library dataset %s' % ldda.name
- messagetype = 'done'
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif params.get( 'detect', False ):
- # The user clicked the Auto-detect button on the 'Edit Attributes' form
- for name, spec in ldda.datatype.metadata_spec.items():
- # We need to be careful about the attributes we are resetting
- if name not in [ 'name', 'info', 'dbkey' ]:
- if spec.get( 'default' ):
- setattr( ldda.metadata, name, spec.unwrap( spec.get( 'default' ) ) )
- ldda.datatype.set_meta( ldda )
- ldda.datatype.after_edit( ldda )
- trans.app.model.flush()
- msg = 'Attributes updated for library dataset %s' % ldda.name
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif params.get( 'delete', False ):
- ldda.deleted = True
- ldda.flush()
- msg = 'Dataset %s has been removed from this library' % ldda.name
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- ldda.datatype.before_edit( ldda )
- if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey:
- # Copy dbkey into metadata, for backwards compatability
- # This looks like it does nothing, but getting the dbkey
- # returns the metadata dbkey unless it is None, in which
- # case it resorts to the old dbkey. Setting the dbkey
- # sets it properly in the metadata
- ldda.metadata.dbkey = ldda.dbkey
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- elif ids:
- # Multiple ids specfied, display permission form, permissions will be updated for all simultaneously.
- lddas = []
- for id in [ int( id ) for id in ids ]:
- ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
- if ldda is None:
- msg = 'You specified an invalid LibraryDatasetDatasetAssociation id: %s' %str( id )
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- lddas.append( ldda )
- if len( lddas ) < 2:
- msg = 'You must specify at least two datasets on which to modify permissions, ids you sent: %s' % str( ids )
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if action == 'permissions':
- if params.get( 'update_roles_button', False ):
- permissions = {}
- accessible = False
- for k, v in trans.app.model.Dataset.permitted_actions.items():
- # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not
- # the DATASET_ACCESS permission, making the former useless. Need to display a warning message.
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
- # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible
- if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
- if len( in_roles ) > 1:
- # Get the set of all users that are being associated with the dataset
- in_roles_set = set()
- for role in in_roles:
- in_roles_set.add( role )
- users_set = set()
- for role in in_roles:
- for ura in role.users:
- users_set.add( ura.user )
- # Make sure that at least 1 user has every role being associated with the dataset
- for user in users_set:
- user_roles_set = set()
- for ura in user.roles:
- user_roles_set.add( ura.role )
- if in_roles_set.issubset( user_roles_set ):
- accessible = True
- break
- else:
- accessible = True
- if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
- # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions
- # TODO: keep access permissions as they originally were, rather than automatically making public
- permissions[ trans.app.security_agent.get_action( v.action ) ] = []
- else:
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- for ldda in lddas:
- # Set the DATASET permissions on the Dataset
- trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions )
- ldda.dataset.refresh()
- permissions = {}
- for k, v in trans.app.model.Library.permitted_actions.items():
- in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
- permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
- for ldda in lddas:
- # Set the LIBRARY permissions on the LibraryDataset
- # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
- trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions )
- ldda.library_dataset.refresh()
- # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
- trans.app.security_agent.set_all_library_permissions( ldda, permissions )
- ldda.refresh()
- if not accessible:
- msg = "At least 1 user must have every role associated with accessing these %d datasets. " % len( lddas )
- msg += "The roles you attempted to associate for access would make these datasets inaccessible by everyone, "
- msg += "so access permissions were not set. All other permissions were updated for the datasets."
- messagetype = 'error'
- else:
- msg = "Permissions have been updated on %d datasets" % len( lddas )
- return trans.fill_template( "/admin/library/ldda_permissions.mako",
- ldda=lddas,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- # Ensure that the permissions across all library items are identical, otherwise we can't update them together.
- check_list = []
- for ldda in lddas:
- permissions = []
- # Check the library level permissions - the permissions on the LibraryDatasetDatasetAssociation
- # will always be the same as the permissions on the associated LibraryDataset, so we only need to
- # check one Library object
- for library_permission in trans.app.security_agent.get_library_dataset_permissions( ldda.library_dataset ):
- if library_permission.action not in permissions:
- permissions.append( library_permission.action )
- for dataset_permission in trans.app.security_agent.get_dataset_permissions( ldda.dataset ):
- if dataset_permission.action not in permissions:
- permissions.append( dataset_permission.action )
- permissions.sort()
- if not check_list:
- check_list = permissions
- if permissions != check_list:
- msg = 'The datasets you selected do not have identical permissions, so they can not be updated together'
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- return trans.fill_template( "/admin/library/ldda_permissions.mako",
- ldda=lddas,
- library_id=library_id,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def add_history_datasets_to_library( self, trans, library_id, folder_id, hda_ids='', **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- try:
- folder = trans.app.model.LibraryFolder.get( int( folder_id ) )
- except:
- msg = "Invalid folder id: %s" % str( folder_id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- replace_id = params.get( 'replace_id', None )
- if replace_id:
- replace_dataset = trans.app.model.LibraryDataset.get( replace_id )
- else:
- replace_dataset = None
- # See if the current history is empty
- history = trans.get_history()
- history.refresh()
- if not history.active_datasets:
- msg = 'Your current history is empty'
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if params.get( 'add_history_datasets_to_library_button', False ):
- hda_ids = util.listify( hda_ids )
- if hda_ids:
- dataset_names = []
- created_ldda_ids = ''
- for hda_id in hda_ids:
- hda = trans.app.model.HistoryDatasetAssociation.get( hda_id )
- if hda:
- ldda = hda.to_library_dataset_dataset_association( target_folder=folder, replace_dataset=replace_dataset )
- created_ldda_ids = '%s,%s' % ( created_ldda_ids, str( ldda.id ) )
- dataset_names.append( ldda.name )
- if not replace_dataset:
- # If replace_dataset is None, the Library level permissions will be taken from the folder and applied to the new
- # LDDA and LibraryDataset.
- trans.app.security_agent.copy_library_permissions( folder, ldda )
- trans.app.security_agent.copy_library_permissions( folder, ldda.library_dataset )
- # Permissions must be the same on the LibraryDatasetDatasetAssociation and the associated LibraryDataset
- trans.app.security_agent.copy_library_permissions( ldda.library_dataset, ldda )
- else:
- msg = "The requested HistoryDatasetAssociation id %s is invalid" % str( hda_id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- if created_ldda_ids:
- created_ldda_ids = created_ldda_ids.lstrip( ',' )
- ldda_id_list = created_ldda_ids.split( ',' )
- total_added = len( ldda_id_list )
- if replace_dataset:
- msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name )
- else:
- if not folder.parent:
- # Libraries have the same name as their root_folder
- msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name )
- else:
- msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name )
- msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- created_ldda_ids=created_ldda_ids,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- else:
- msg = 'Select at least one dataset from the list of active datasets in your current history'
- messagetype = 'error'
- last_used_build = folder.genome_build
- upload_option = params.get( 'upload_option', 'import_from_history' )
- # Send list of data formats to the form so the "extension" select list can be populated dynamically
- file_formats = trans.app.datatypes_registry.upload_file_formats
- # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically
- def get_dbkey_options( last_used_build ):
- for dbkey, build_name in util.dbnames:
- yield build_name, dbkey, ( dbkey==last_used_build )
- dbkeys = get_dbkey_options( last_used_build )
- # Send list of roles to the form so the dataset can be associated with 1 or more of them.
- roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all()
- return trans.fill_template( "/admin/library/new_dataset.mako",
- upload_option=upload_option,
- library_id=library_id,
- folder_id=folder_id,
- replace_id=replace_id,
- file_formats=file_formats,
- dbkeys=dbkeys,
- last_used_build=last_used_build,
- roles=roles,
- history=history,
- widgets=widgets,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def info_template( self, trans, library_id, id=None, folder_id=None, ldda_id=None, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- if id:
- library_item = trans.app.model.FormDefinition.get( int( id ) )
- library_item_desc = 'information template'
- response_action = 'info_template'
- response_id = id
- elif folder_id:
- library_item = trans.app.model.LibraryFolder.get( int( folder_id ) )
- library_item_desc = 'folder'
- response_action = 'folder'
- response_id = folder_id
- elif ldda_id:
- library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( int( ldda_id ) )
- library_item_desc = 'library dataset'
- response_action = 'library_dataset_dataset_association'
- response_id = ldda_id
- else:
- library_item = trans.app.model.Library.get( int( library_id ) )
- library_item_desc = 'library'
- response_action = 'browse_library'
- response_id = library_id
- forms = get_all_forms( trans, filter=dict(deleted=False) )
- if not forms:
- msg = "There are no forms on which to base the template, so create a form and "
- msg += "try again to add the information template to the %s." % library_item_desc
- trans.response.send_redirect( web.url_for( controller='forms',
- action='new',
- new=True,
- msg=msg,
- messagetype='done' ) )
- if params.get( 'add', False ):
- if params.get( 'add_info_template_button', False ):
- form = trans.app.model.FormDefinition.get( int( kwd[ 'form_id' ] ) )
- #fields = list( copy.deepcopy( form.fields ) )
- form_values = trans.app.model.FormValues( form, [] )
- form_values.flush()
- if folder_id:
- assoc = trans.app.model.LibraryFolderInfoAssociation( library_item, form, form_values )
- elif ldda_id:
- assoc = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, form, form_values )
- else:
- assoc = trans.app.model.LibraryInfoAssociation( library_item, form, form_values )
- assoc.flush()
- msg = 'An information template based on the form "%s" has been added to this %s.' % ( form.name, library_item_desc )
- trans.response.send_redirect( web.url_for( controller='admin',
- action=response_action,
- id=response_id,
- msg=msg,
- message_type='done' ) )
- return trans.fill_template( '/admin/library/select_info_template.mako',
- library_item_name=library_item.name,
- library_item_desc=library_item_desc,
- library_id=library_id,
- folder_id=folder_id,
- ldda_id=ldda_id,
- forms=forms,
- msg=msg,
- messagetype=messagetype )
- @web.expose
- @web.require_admin
- def edit_template_info( self, trans, library_id, num_widgets, library_item_id=None, library_item_type=None, **kwd ):
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- folder_id = None
- if library_item_type == 'library':
- library_item = trans.app.model.Library.get( library_item_id )
- elif library_item_type == 'library_dataset':
- library_item = trans.app.model.LibraryDataset.get( library_item_id )
- elif library_item_type == 'folder':
- library_item = trans.app.model.LibraryFolder.get( library_item_id )
- elif library_item_type == 'library_dataset_dataset_association':
- library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( library_item_id )
- # This response_action method requires a folder_id
- folder_id = library_item.library_dataset.folder.id
- else:
- msg = "Invalid library item type ( %s ) specified, id ( %s )" % ( str( library_item_type ), str( library_item_id ) )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- # Save updated template field contents
- field_contents = []
- for index in range( int( num_widgets ) ):
- field_contents.append( util.restore_text( params.get( 'field_%i' % ( index ), '' ) ) )
- if field_contents:
- # Since information templates are inherited, the template fields can be displayed on the information
- # page for a folder or library dataset when it has no info_association object. If the user has added
- # field contents on an inherited template via a parent's info_association, we'll need to create a new
- # form_values and info_association for the current object.
- info_association = library_item.get_info_association( restrict=True )
- if info_association:
- template = info_association.template
- info = info_association.info
- form_values = trans.app.model.FormValues.get( info.id )
- # Update existing content only if it has changed
- if form_values.content != field_contents:
- form_values.content = field_contents
- form_values.flush()
- else:
- # Inherit the next available info_association so we can get the template
- info_association = library_item.get_info_association()
- template = info_association.template
- # Create a new FormValues object
- form_values = trans.app.model.FormValues( template, field_contents )
- form_values.flush()
- # Create a new info_association between the current library item and form_values
- if library_item_type == 'folder':
- info_association = trans.app.model.LibraryFolderInfoAssociation( library_item, template, form_values )
- info_association.flush()
- elif library_item_type == 'library_dataset_dataset_association':
- info_association = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, template, form_values )
- info_association.flush()
- msg = 'The information has been updated.'
- return trans.response.send_redirect( web.url_for( controller='admin',
- action=library_item_type,
- id=library_item.id,
- library_id=library_id,
- folder_id=folder_id,
- edit_info=True,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- @web.expose
- @web.require_admin
- def download_dataset_from_folder(self, trans, id, library_id=None, **kwd):
- """Catches the dataset id and displays file contents as directed"""
- # id must refer to a LibraryDatasetDatasetAssociation object
- ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
- if not ldda.dataset:
- msg = 'Invalid LibraryDatasetDatasetAssociation id %s received for file downlaod' % str( id )
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- mime = trans.app.datatypes_registry.get_mimetype_by_extension( ldda.extension.lower() )
- trans.response.set_content_type( mime )
- fStat = os.stat( ldda.file_name )
- trans.response.headers[ 'Content-Length' ] = int( fStat.st_size )
- valid_chars = '.,^_-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ'
- fname = ldda.name
- fname = ''.join( c in valid_chars and c or '_' for c in fname )[ 0:150 ]
- trans.response.headers[ "Content-Disposition" ] = "attachment; filename=GalaxyLibraryDataset-%s-[%s]" % ( str( id ), fname )
- try:
- return open( ldda.file_name )
- except:
- msg = 'This dataset contains no content'
- return trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- @web.expose
- @web.require_admin
- def datasets( self, trans, library_id, **kwd ):
- # This method is used by the select list labeled "Perform action on selected datasets"
- # on the admin library browser.
- params = util.Params( kwd )
- msg = util.restore_text( params.get( 'msg', '' ) )
- messagetype = params.get( 'messagetype', 'done' )
- if params.get( 'action_on_datasets_button', False ):
- if not params.ldda_ids:
- msg = "At least one dataset must be selected for %s" % params.action
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- ldda_ids = util.listify( params.ldda_ids )
- if params.action == 'edit':
- # We need the folder containing the LibraryDatasetDatasetAssociation(s)
- ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_ids[0] )
- trans.response.send_redirect( web.url_for( controller='admin',
- action='library_dataset_dataset_association',
- library_id=library_id,
- folder_id=ldda.library_dataset.folder.id,
- id=",".join( ldda_ids ),
- permissions=True,
- msg=util.sanitize_text( msg ),
- messagetype=messagetype ) )
- elif params.action == 'delete':
- for id in ldda_ids:
- ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
- ldda.deleted = True
- ldda.flush()
- msg = "The selected datasets have been removed from this library"
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- show_deleted=False,
- msg=util.sanitize_text( msg ),
- messagetype='done' ) )
- else:
- msg = "Action %s is not yet implemented" % str( params.action )
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype='error' ) )
- else:
- trans.response.send_redirect( web.url_for( controller='admin',
- action='browse_library',
- id=library_id,
- msg=util.sanitize_text( msg ),
- messagetype=messagetype ) )
- @web.expose
- @web.require_admin
- def delete_library_item( self, trans, library_id, library_item_id, library_item_type ):
- # This action will handle deleting all types of library items. State is saved for libraries and
- # folders ( i.e., if undeleted, the state of contents of the library or folder will remain, so previously
- # deleted / purged contents will have the same state ). When a library or folder has been deleted for
- # the amount of time defined in the cleanup_datasets.py script, the library or folder and all of its
- # contents will be purged. The association between this method and the cleanup_datasets.py script
- # enables clean maintenance of libraries and library dataset disk files. This is also why the following
- # 3 objects, and not any of the associations ( the cleanup_datasets.py scipot handles everything else ).
- library_item_types = { 'library': trans.app.model.Library,
- 'folder': trans.app.model.LibraryFolder,
- 'library_dataset': trans.app.model.LibraryDataset }
- if library_item_type not in library_item_types:
- msg = 'Bad library_item_type specified: %s' % str( library_item_type )
- messagetype = 'error'
- else:
- if library_item_type == 'library_dataset':
- library_item_desc = 'Dataset'
- else:
- library_item_desc = library_item_type.capitalize()
- library_item = library_item_types[ library_item_type ].get( int( library_item_id ) )
- library_item.deleted = True
- library_item.flush()
- msg = util.sanitize_text( "%s '%s' has been marked deleted" % ( library_item_desc, library_item.name ) )
- messagetype = 'done'
- if library_item_type == 'library':
- return self.browse_libraries( trans, msg=msg, messagetype=messagetype )
- else:
- return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype )
- @web.expose
- @web.require_admin
- def undelete_library_item( self, trans, library_id, library_item_id, library_item_type ):
- # This action will handle undeleting all types of library items
- library_item_types = { 'library': trans.app.model.Library,
- 'folder': trans.app.model.LibraryFolder,
- 'library_dataset': trans.app.model.LibraryDataset }
- if library_item_type not in library_item_types:
- msg = 'Bad library_item_type specified: %s' % str( library_item_type )
- messagetype = 'error'
- else:
- if library_item_type == 'library_dataset':
- library_item_desc = 'Dataset'
- else:
- library_item_desc = library_item_type.capitalize()
- library_item = library_item_types[ library_item_type ].get( int( library_item_id ) )
- if library_item.purged:
- msg = '%s %s has been purged, so it cannot be undeleted' % ( library_item_desc, library_item.name )
- messagetype = 'error'
- else:
- library_item.deleted = False
- library_item.flush()
- msg = util.sanitize_text( "%s '%s' has been marked undeleted" % ( library_item_desc, library_item.name ) )
- messagetype = 'done'
- if library_item_type == 'library':
- return self.browse_libraries( trans, msg=msg, messagetype=messagetype )
- else:
- return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype )
@web.expose
@web.require_admin
def memdump( self, trans, ids = 'None', sorts = 'None', pages = 'None', new_id = None, new_sort = None, **kwd ):
diff -r f2af04af3caa -r d301a67eda40 lib/galaxy/web/controllers/library_admin.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/web/controllers/library_admin.py Mon Sep 14 11:05:36 2009 -0400
@@ -0,0 +1,1195 @@
+import sys
+from galaxy import util
+from galaxy.web.base.controller import *
+from galaxy.model.orm import *
+from galaxy.web.controllers.forms import get_all_forms, get_form_widgets
+# Older py compatibility
+try:
+ set()
+except:
+ from sets import Set as set
+
+import logging
+log = logging.getLogger( __name__ )
+
+class LibraryAdmin( BaseController ):
+ @web.expose
+ @web.require_admin
+ def browse_libraries( self, trans, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ return trans.fill_template( '/admin/library/browse_libraries.mako',
+ libraries=trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \
+ .order_by( trans.app.model.Library.name ).all(),
+ deleted=False,
+ show_deleted=False,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def browse_library( self, trans, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ id = params.get( 'id', None )
+ deleted = util.string_as_bool( params.get( 'deleted', False ) )
+ show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
+ if not id:
+ msg = "You must specify a library id."
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_libraries',
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ library = library=trans.app.model.Library.get( id )
+ if not library:
+ msg = "Invalid library id ( %s )."
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_libraries',
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ created_ldda_ids = params.get( 'created_ldda_ids', '' )
+ return trans.fill_template( '/admin/library/browse_library.mako',
+ library=trans.app.model.Library.get( id ),
+ deleted=deleted,
+ created_ldda_ids=created_ldda_ids,
+ forms=get_all_forms( trans, filter=dict(deleted=False) ),
+ msg=msg,
+ messagetype=messagetype,
+ show_deleted=show_deleted )
+ @web.expose
+ @web.require_admin
+ def library( self, trans, id=None, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ if params.get( 'new', False ):
+ action = 'new'
+ elif params.get( 'delete', False ):
+ action = 'delete'
+ elif params.get( 'permissions', False ):
+ action = 'permissions'
+ else:
+ action = 'information'
+ if not id and not action == 'new':
+ msg = "You must specify a library to %s." % action
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_libraries',
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if not action == 'new':
+ library = trans.app.model.Library.get( int( id ) )
+ if action == 'new':
+ if params.new == 'submitted':
+ library = trans.app.model.Library( name = util.restore_text( params.name ),
+ description = util.restore_text( params.description ) )
+ root_folder = trans.app.model.LibraryFolder( name = util.restore_text( params.name ), description = "" )
+ root_folder.flush()
+ library.root_folder = root_folder
+ library.flush()
+ msg = "The new library named '%s' has been created" % library.name
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library.id,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/new_library.mako', msg=msg, messagetype=messagetype )
+ elif action == 'information':
+ # See if we have any associated templates
+ info_association = library.get_info_association()
+ if info_association:
+ template = info_association.template
+ # See if we have any field contents
+ info = info_association.info
+ if info:
+ widgets = get_form_widgets( trans, template, info.content )
+ else:
+ widgets = get_form_widgets( trans, template )
+ else:
+ widgets = []
+ if params.get( 'rename_library_button', False ):
+ old_name = library.name
+ new_name = util.restore_text( params.name )
+ new_description = util.restore_text( params.description )
+ if not new_name:
+ msg = 'Enter a valid name'
+ return trans.fill_template( '/admin/library/library_info.mako',
+ library=library,
+ widgets=widgets,
+ msg=msg,
+ messagetype='error' )
+ else:
+ library.name = new_name
+ library.description = new_description
+ library.flush()
+ # Rename the root_folder
+ library.root_folder.name = new_name
+ library.root_folder.description = new_description
+ library.root_folder.flush()
+ msg = "Library '%s' has been renamed to '%s'" % ( old_name, new_name )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='library',
+ id=id,
+ edit_info=True,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/library_info.mako',
+ library=library,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'delete':
+ def delete_folder( library_folder ):
+ library_folder.refresh()
+ for folder in library_folder.folders:
+ delete_folder( folder )
+ for library_dataset in library_folder.datasets:
+ library_dataset.refresh()
+ ldda = library_dataset.library_dataset_dataset_association
+ if ldda:
+ ldda.refresh()
+ # We don't set ldda.dataset.deleted to True here because the cleanup_dataset script
+ # will eventually remove it from disk. The purge_library method below sets the dataset
+ # to deleted. This allows for the library to be undeleted ( before it is purged ),
+ # restoring all of its contents.
+ ldda.deleted = True
+ ldda.flush()
+ library_dataset.deleted = True
+ library_dataset.flush()
+ library_folder.deleted = True
+ library_folder.flush()
+ library.refresh()
+ delete_folder( library.root_folder )
+ library.deleted = True
+ library.flush()
+ msg = "Library '%s' and all of its contents have been marked deleted" % library.name
+ return trans.response.send_redirect( web.url_for( action='browse_libraries', msg=util.sanitize_text( msg ), messagetype='done' ) )
+ elif action == 'permissions':
+ if params.get( 'update_roles_button', False ):
+ # The user clicked the Save button on the 'Associate With Roles' form
+ permissions = {}
+ for k, v in trans.app.model.Library.permitted_actions.items():
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ trans.app.security_agent.set_all_library_permissions( library, permissions )
+ library.refresh()
+ # Copy the permissions to the root folder
+ trans.app.security_agent.copy_library_permissions( library, library.root_folder )
+ msg = "Permissions updated for library '%s'" % library.name
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='library',
+ id=id,
+ permissions=True,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/library_permissions.mako',
+ library=library,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def deleted_libraries( self, trans, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ libraries=trans.app.model.Library.filter( and_( trans.app.model.Library.table.c.deleted==True,
+ trans.app.model.Library.table.c.purged==False ) ) \
+ .order_by( trans.app.model.Library.table.c.name ).all()
+ return trans.fill_template( '/admin/library/browse_libraries.mako',
+ libraries=libraries,
+ deleted=True,
+ msg=msg,
+ messagetype=messagetype,
+ show_deleted=True )
+ @web.expose
+ @web.require_admin
+ def purge_library( self, trans, **kwd ):
+ params = util.Params( kwd )
+ library = trans.app.model.Library.get( int( params.id ) )
+ def purge_folder( library_folder ):
+ for lf in library_folder.folders:
+ purge_folder( lf )
+ library_folder.refresh()
+ for library_dataset in library_folder.datasets:
+ library_dataset.refresh()
+ ldda = library_dataset.library_dataset_dataset_association
+ if ldda:
+ ldda.refresh()
+ dataset = ldda.dataset
+ dataset.refresh()
+ # If the dataset is not associated with any additional undeleted folders, then we can delete it.
+ # We don't set dataset.purged to True here because the cleanup_datasets script will do that for
+ # us, as well as removing the file from disk.
+ #if not dataset.deleted and len( dataset.active_library_associations ) <= 1: # This is our current ldda
+ dataset.deleted = True
+ dataset.flush()
+ ldda.deleted = True
+ ldda.flush()
+ library_dataset.deleted = True
+ library_dataset.flush()
+ library_folder.deleted = True
+ library_folder.purged = True
+ library_folder.flush()
+ if not library.deleted:
+ msg = "Library '%s' has not been marked deleted, so it cannot be purged" % ( library.name )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_libraries',
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ else:
+ purge_folder( library.root_folder )
+ library.purged = True
+ library.flush()
+ msg = "Library '%s' and all of its contents have been purged, datasets will be removed from disk via the cleanup_datasets script" % library.name
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='deleted_libraries',
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ @web.expose
+ @web.require_admin
+ def folder( self, trans, id, library_id, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ if params.get( 'new', False ):
+ action = 'new'
+ elif params.get( 'delete', False ):
+ action = 'delete'
+ elif params.get( 'permissions', False ):
+ action = 'permissions'
+ else:
+ # 'information' will be the default
+ action = 'information'
+ folder = trans.app.model.LibraryFolder.get( int( id ) )
+ if not folder:
+ msg = "Invalid folder specified, id: %s" % str( id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if action == 'new':
+ if params.new == 'submitted':
+ new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ),
+ description=util.restore_text( params.description ) )
+ # We are associating the last used genome build with folders, so we will always
+ # initialize a new folder with the first dbkey in util.dbnames which is currently
+ # ? unspecified (?)
+ new_folder.genome_build = util.dbnames.default_value
+ folder.add_folder( new_folder )
+ new_folder.flush()
+ # New folders default to having the same permissions as their parent folder
+ trans.app.security_agent.copy_library_permissions( folder, new_folder )
+ msg = "New folder named '%s' has been added to the library" % new_folder.name
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/new_folder.mako',
+ library_id=library_id,
+ folder=folder,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'information':
+ # See if we have any associated templates
+ info_association = folder.get_info_association()
+ if info_association:
+ template = info_association.template
+ # See if we have any field contents
+ info = info_association.info
+ if info:
+ widgets = get_form_widgets( trans, template, info.content )
+ else:
+ widgets = get_form_widgets( trans, template )
+ else:
+ widgets = []
+ if params.get( 'rename_folder_button', False ):
+ old_name = folder.name
+ new_name = util.restore_text( params.name )
+ new_description = util.restore_text( params.description )
+ if not new_name:
+ msg = 'Enter a valid name'
+ return trans.fill_template( '/admin/library/folder_info.mako',
+ folder=folder,
+ library_id=library_id,
+ widgets=widgets,
+ msg=msg,
+ messagetype='error' )
+ else:
+ folder.name = new_name
+ folder.description = new_description
+ folder.flush()
+ msg = "Folder '%s' has been renamed to '%s'" % ( old_name, new_name )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='folder',
+ id=id,
+ library_id=library_id,
+ edit_info=True,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/folder_info.mako',
+ folder=folder,
+ library_id=library_id,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'delete':
+ folder.deleted = True
+ folder.flush()
+ msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name
+ return trans.response.send_redirect( web.url_for( action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ elif action =='permissions':
+ if params.get( 'update_roles_button', False ):
+ # The user clicked the Save button on the 'Associate With Roles' form
+ permissions = {}
+ for k, v in trans.app.model.Library.permitted_actions.items():
+ in_roles = [ trans.app.model.Role.get( int( x ) ) for x in util.listify( params.get( k + '_in', [] ) ) ]
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ trans.app.security_agent.set_all_library_permissions( folder, permissions )
+ folder.refresh()
+ msg = "Permissions updated for folder '%s'" % folder.name
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='folder',
+ id=id,
+ library_id=library_id,
+ permissions=True,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ return trans.fill_template( '/admin/library/folder_permissions.mako',
+ folder=folder,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def library_dataset( self, trans, id, library_id, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ if params.get( 'permissions', False ):
+ action = 'permissions'
+ else:
+ action = 'information'
+ library_dataset = trans.app.model.LibraryDataset.get( id )
+ if not library_dataset:
+ msg = "Invalid library dataset specified, id: %s" %str( id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if action == 'information':
+ if params.get( 'edit_attributes_button', False ):
+ old_name = library_dataset.name
+ new_name = util.restore_text( params.get( 'name', '' ) )
+ new_info = util.restore_text( params.get( 'info', '' ) )
+ if not new_name:
+ msg = 'Enter a valid name'
+ messagetype = 'error'
+ else:
+ library_dataset.name = new_name
+ library_dataset.info = new_info
+ library_dataset.flush()
+ msg = "Dataset '%s' has been renamed to '%s'" % ( old_name, new_name )
+ messagetype = 'done'
+ return trans.fill_template( '/admin/library/library_dataset_info.mako',
+ library_dataset=library_dataset,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'permissions':
+ if params.get( 'update_roles_button', False ):
+ # The user clicked the Save button on the 'Edit permissions and role associations' form
+ permissions = {}
+ for k, v in trans.app.model.Library.permitted_actions.items():
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ # Set the LIBRARY permissions on the LibraryDataset
+ # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
+ trans.app.security_agent.set_all_library_permissions( library_dataset, permissions )
+ library_dataset.refresh()
+ # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
+ trans.app.security_agent.set_all_library_permissions( library_dataset.library_dataset_dataset_association, permissions )
+ library_dataset.library_dataset_dataset_association.refresh()
+ msg = 'Permissions and roles have been updated for library dataset %s' % library_dataset.name
+ return trans.fill_template( '/admin/library/library_dataset_permissions.mako',
+ library_dataset=library_dataset,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def library_dataset_dataset_association( self, trans, library_id, folder_id, id=None, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ deleted = util.string_as_bool( params.get( 'deleted', False ) )
+ show_deleted = util.string_as_bool( params.get( 'show_deleted', False ) )
+ dbkey = params.get( 'dbkey', None )
+ if isinstance( dbkey, list ):
+ last_used_build = dbkey[0]
+ else:
+ last_used_build = dbkey
+ folder = trans.app.model.LibraryFolder.get( folder_id )
+ if folder and last_used_build in [ 'None', None, '?' ]:
+ last_used_build = folder.genome_build
+ replace_id = params.get( 'replace_id', None )
+ if replace_id:
+ replace_dataset = trans.app.model.LibraryDataset.get( int( replace_id ) )
+ if not last_used_build:
+ last_used_build = replace_dataset.library_dataset_dataset_association.dbkey
+ else:
+ replace_dataset = None
+ # Let's not overwrite the imported datatypes module with the variable datatypes?
+ # The built-in 'id' is overwritten in lots of places as well
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
+ ldatatypes.sort()
+ if params.get( 'new_dataset_button', False ):
+ upload_option = params.get( 'upload_option', 'upload_file' )
+ created_ldda_ids = trans.webapp.controllers[ 'library_dataset' ].upload_dataset( trans,
+ controller='library_admin',
+ library_id=library_id,
+ folder_id=folder_id,
+ replace_dataset=replace_dataset,
+ **kwd )
+ if created_ldda_ids:
+ total_added = len( created_ldda_ids.split( ',' ) )
+ if replace_dataset:
+ msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name )
+ else:
+ if not folder.parent:
+ # Libraries have the same name as their root_folder
+ msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name )
+ else:
+ msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name )
+ msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
+ messagetype='done'
+ else:
+ msg = "Upload failed"
+ messagetype='error'
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ created_ldda_ids=created_ldda_ids,
+ msg=util.sanitize_text( msg ),
+ messagetype=messagetype ) )
+ elif not id or replace_dataset:
+ # See if we have any associated templates
+ info_association = folder.get_info_association()
+ if info_association:
+ template = info_association.template
+ widgets = get_form_widgets( trans, template )
+ else:
+ widgets = []
+ upload_option = params.get( 'upload_option', 'upload_file' )
+ # No dataset(s) specified, so display the upload form. Send list of data formats to the form
+ # so the "extension" select list can be populated dynamically
+ file_formats = trans.app.datatypes_registry.upload_file_formats
+ # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically
+ def get_dbkey_options( last_used_build ):
+ for dbkey, build_name in util.dbnames:
+ yield build_name, dbkey, ( dbkey==last_used_build )
+ dbkeys = get_dbkey_options( last_used_build )
+ # Send list of roles to the form so the dataset can be associated with 1 or more of them.
+ roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all()
+ # Send the current history to the form to enable importing datasets from history to library
+ history = trans.get_history()
+ history.refresh()
+ return trans.fill_template( '/admin/library/new_dataset.mako',
+ upload_option=upload_option,
+ library_id=library_id,
+ folder_id=folder_id,
+ replace_id=replace_id,
+ file_formats=file_formats,
+ dbkeys=dbkeys,
+ last_used_build=last_used_build,
+ roles=roles,
+ history=history,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype,
+ replace_dataset=replace_dataset )
+ else:
+ if params.get( 'permissions', False ):
+ action = 'permissions'
+ elif params.get( 'edit_info', False ):
+ action = 'edit_info'
+ else:
+ action = 'info'
+ if id.count( ',' ):
+ ids = id.split( ',' )
+ id = None
+ else:
+ ids = None
+ if id:
+ # ldda_id specified, display attributes form
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
+ if not ldda:
+ msg = "Invalid LibraryDatasetDatasetAssociation specified, id: %s" % str( id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ # See if we have any associated templates
+ info_association = ldda.get_info_association()
+ if info_association:
+ template = info_association.template
+ # See if we have any field contents
+ info = info_association.info
+ if info:
+ widgets = get_form_widgets( trans, template, info.content )
+ else:
+ widgets = get_form_widgets( trans, template )
+ else:
+ widgets = []
+ if action == 'permissions':
+ if params.get( 'update_roles_button', False ):
+ permissions = {}
+ accessible = False
+ for k, v in trans.app.model.Dataset.permitted_actions.items():
+ # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not
+ # the DATASET_ACCESS permission, making the former useless. Need to display a warning message.
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
+ # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible
+ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
+ if len( in_roles ) > 1:
+ # Get the set of all users that are being associated with the dataset
+ in_roles_set = set()
+ for role in in_roles:
+ in_roles_set.add( role )
+ users_set = set()
+ for role in in_roles:
+ for ura in role.users:
+ users_set.add( ura.user )
+ # Make sure that at least 1 user has every role being associated with the dataset
+ for user in users_set:
+ user_roles_set = set()
+ for ura in user.roles:
+ user_roles_set.add( ura.role )
+ if in_roles_set.issubset( user_roles_set ):
+ accessible = True
+ break
+ else:
+ accessible = True
+ if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
+ # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions
+ # TODO: keep access permissions as they originally were, rather than automatically making public
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = []
+ else:
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ # Set the DATASET permissions on the Dataset
+ trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions )
+ ldda.dataset.refresh()
+ permissions = {}
+ for k, v in trans.app.model.Library.permitted_actions.items():
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ # Set the LIBRARY permissions on the LibraryDataset
+ # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
+ trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions )
+ ldda.library_dataset.refresh()
+ # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
+ trans.app.security_agent.set_all_library_permissions( ldda, permissions )
+ ldda.refresh()
+ if not accessible:
+ msg = "At least 1 user must have every role associated with accessing dataset '%s'. " % ldda.name
+ msg += "The roles you attempted to associate for access would make this dataset inaccessible by everyone, "
+ msg += "so access permissions were not set. All other permissions were updated for the dataset."
+ messagetype = 'error'
+ else:
+ msg = "Permissions updated for dataset '%s'" % ldda.name
+ return trans.fill_template( '/admin/library/ldda_permissions.mako',
+ ldda=ldda,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'info':
+ return trans.fill_template( '/admin/library/ldda_info.mako',
+ ldda=ldda,
+ library_id=library_id,
+ deleted=deleted,
+ show_deleted=show_deleted,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif action == 'edit_info':
+ if params.get( 'change', False ):
+ # The user clicked the Save button on the 'Change data type' form
+ if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
+ trans.app.model.flush()
+ msg = "Data type changed for library dataset '%s'" % ldda.name
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ else:
+ return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) )
+ elif params.get( 'save', False ):
+ # The user clicked the Save button on the 'Edit Attributes' form
+ old_name = ldda.name
+ new_name = util.restore_text( params.get( 'name', '' ) )
+ new_info = util.restore_text( params.get( 'info', '' ) )
+ new_message = util.restore_text( params.get( 'message', '' ) )
+ if not new_name:
+ msg = 'Enter a valid name'
+ messagetype = 'error'
+ else:
+ ldda.name = new_name
+ ldda.info = new_info
+ ldda.message = new_message
+ # The following for loop will save all metadata_spec items
+ for name, spec in ldda.datatype.metadata_spec.items():
+ if spec.get("readonly"):
+ continue
+ optional = params.get( "is_" + name, None )
+ if optional and optional == 'true':
+ # optional element... == 'true' actually means it is NOT checked (and therefore ommitted)
+ setattr( ldda.metadata, name, None )
+ else:
+ setattr( ldda.metadata, name, spec.unwrap( params.get ( name, None ) ) )
+ ldda.metadata.dbkey = dbkey
+ ldda.datatype.after_edit( ldda )
+ trans.app.model.flush()
+ msg = 'Attributes updated for library dataset %s' % ldda.name
+ messagetype = 'done'
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif params.get( 'detect', False ):
+ # The user clicked the Auto-detect button on the 'Edit Attributes' form
+ for name, spec in ldda.datatype.metadata_spec.items():
+ # We need to be careful about the attributes we are resetting
+ if name not in [ 'name', 'info', 'dbkey' ]:
+ if spec.get( 'default' ):
+ setattr( ldda.metadata, name, spec.unwrap( spec.get( 'default' ) ) )
+ ldda.datatype.set_meta( ldda )
+ ldda.datatype.after_edit( ldda )
+ trans.app.model.flush()
+ msg = 'Attributes updated for library dataset %s' % ldda.name
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif params.get( 'delete', False ):
+ ldda.deleted = True
+ ldda.flush()
+ msg = 'Dataset %s has been removed from this library' % ldda.name
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ ldda.datatype.before_edit( ldda )
+ if "dbkey" in ldda.datatype.metadata_spec and not ldda.metadata.dbkey:
+ # Copy dbkey into metadata, for backwards compatability
+ # This looks like it does nothing, but getting the dbkey
+ # returns the metadata dbkey unless it is None, in which
+ # case it resorts to the old dbkey. Setting the dbkey
+ # sets it properly in the metadata
+ ldda.metadata.dbkey = ldda.dbkey
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ elif ids:
+ # Multiple ids specfied, display permission form, permissions will be updated for all simultaneously.
+ lddas = []
+ for id in [ int( id ) for id in ids ]:
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
+ if ldda is None:
+ msg = 'You specified an invalid LibraryDatasetDatasetAssociation id: %s' %str( id )
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ lddas.append( ldda )
+ if len( lddas ) < 2:
+ msg = 'You must specify at least two datasets on which to modify permissions, ids you sent: %s' % str( ids )
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if action == 'permissions':
+ if params.get( 'update_roles_button', False ):
+ permissions = {}
+ accessible = False
+ for k, v in trans.app.model.Dataset.permitted_actions.items():
+ # TODO: need to handle case where a user has the DATASET_MANAGE_PERMISSIONS permission, but not
+ # the DATASET_ACCESS permission, making the former useless. Need to display a warning message.
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( params.get( k + '_in', [] ) ) ]
+ # At least 1 user must have every role associated with this dataset, or the dataset is inaccessible
+ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
+ if len( in_roles ) > 1:
+ # Get the set of all users that are being associated with the dataset
+ in_roles_set = set()
+ for role in in_roles:
+ in_roles_set.add( role )
+ users_set = set()
+ for role in in_roles:
+ for ura in role.users:
+ users_set.add( ura.user )
+ # Make sure that at least 1 user has every role being associated with the dataset
+ for user in users_set:
+ user_roles_set = set()
+ for ura in user.roles:
+ user_roles_set.add( ura.role )
+ if in_roles_set.issubset( user_roles_set ):
+ accessible = True
+ break
+ else:
+ accessible = True
+ if not accessible and v == trans.app.security_agent.permitted_actions.DATASET_ACCESS:
+ # Don't set the permissions for DATASET_ACCESS if inaccessbile, but set all other permissions
+ # TODO: keep access permissions as they originally were, rather than automatically making public
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = []
+ else:
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ for ldda in lddas:
+ # Set the DATASET permissions on the Dataset
+ trans.app.security_agent.set_all_dataset_permissions( ldda.dataset, permissions )
+ ldda.dataset.refresh()
+ permissions = {}
+ for k, v in trans.app.model.Library.permitted_actions.items():
+ in_roles = [ trans.app.model.Role.get( x ) for x in util.listify( kwd.get( k + '_in', [] ) ) ]
+ permissions[ trans.app.security_agent.get_action( v.action ) ] = in_roles
+ for ldda in lddas:
+ # Set the LIBRARY permissions on the LibraryDataset
+ # NOTE: the LibraryDataset and LibraryDatasetDatasetAssociation will be set with the same permissions
+ trans.app.security_agent.set_all_library_permissions( ldda.library_dataset, permissions )
+ ldda.library_dataset.refresh()
+ # Set the LIBRARY permissions on the LibraryDatasetDatasetAssociation
+ trans.app.security_agent.set_all_library_permissions( ldda, permissions )
+ ldda.refresh()
+ if not accessible:
+ msg = "At least 1 user must have every role associated with accessing these %d datasets. " % len( lddas )
+ msg += "The roles you attempted to associate for access would make these datasets inaccessible by everyone, "
+ msg += "so access permissions were not set. All other permissions were updated for the datasets."
+ messagetype = 'error'
+ else:
+ msg = "Permissions have been updated on %d datasets" % len( lddas )
+ return trans.fill_template( "/admin/library/ldda_permissions.mako",
+ ldda=lddas,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ # Ensure that the permissions across all library items are identical, otherwise we can't update them together.
+ check_list = []
+ for ldda in lddas:
+ permissions = []
+ # Check the library level permissions - the permissions on the LibraryDatasetDatasetAssociation
+ # will always be the same as the permissions on the associated LibraryDataset, so we only need to
+ # check one Library object
+ for library_permission in trans.app.security_agent.get_library_dataset_permissions( ldda.library_dataset ):
+ if library_permission.action not in permissions:
+ permissions.append( library_permission.action )
+ for dataset_permission in trans.app.security_agent.get_dataset_permissions( ldda.dataset ):
+ if dataset_permission.action not in permissions:
+ permissions.append( dataset_permission.action )
+ permissions.sort()
+ if not check_list:
+ check_list = permissions
+ if permissions != check_list:
+ msg = 'The datasets you selected do not have identical permissions, so they can not be updated together'
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ return trans.fill_template( "/admin/library/ldda_permissions.mako",
+ ldda=lddas,
+ library_id=library_id,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def add_history_datasets_to_library( self, trans, library_id, folder_id, hda_ids='', **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ try:
+ folder = trans.app.model.LibraryFolder.get( int( folder_id ) )
+ except:
+ msg = "Invalid folder id: %s" % str( folder_id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ replace_id = params.get( 'replace_id', None )
+ if replace_id:
+ replace_dataset = trans.app.model.LibraryDataset.get( replace_id )
+ else:
+ replace_dataset = None
+ # See if the current history is empty
+ history = trans.get_history()
+ history.refresh()
+ if not history.active_datasets:
+ msg = 'Your current history is empty'
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if params.get( 'add_history_datasets_to_library_button', False ):
+ hda_ids = util.listify( hda_ids )
+ if hda_ids:
+ dataset_names = []
+ created_ldda_ids = ''
+ for hda_id in hda_ids:
+ hda = trans.app.model.HistoryDatasetAssociation.get( hda_id )
+ if hda:
+ ldda = hda.to_library_dataset_dataset_association( target_folder=folder, replace_dataset=replace_dataset )
+ created_ldda_ids = '%s,%s' % ( created_ldda_ids, str( ldda.id ) )
+ dataset_names.append( ldda.name )
+ if not replace_dataset:
+ # If replace_dataset is None, the Library level permissions will be taken from the folder and applied to the new
+ # LDDA and LibraryDataset.
+ trans.app.security_agent.copy_library_permissions( folder, ldda )
+ trans.app.security_agent.copy_library_permissions( folder, ldda.library_dataset )
+ # Permissions must be the same on the LibraryDatasetDatasetAssociation and the associated LibraryDataset
+ trans.app.security_agent.copy_library_permissions( ldda.library_dataset, ldda )
+ else:
+ msg = "The requested HistoryDatasetAssociation id %s is invalid" % str( hda_id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ if created_ldda_ids:
+ created_ldda_ids = created_ldda_ids.lstrip( ',' )
+ ldda_id_list = created_ldda_ids.split( ',' )
+ total_added = len( ldda_id_list )
+ if replace_dataset:
+ msg = "Added %d dataset versions to the library dataset '%s' in the folder '%s'." % ( total_added, replace_dataset.name, folder.name )
+ else:
+ if not folder.parent:
+ # Libraries have the same name as their root_folder
+ msg = "Added %d datasets to the library '%s' ( each is selected ). " % ( total_added, folder.name )
+ else:
+ msg = "Added %d datasets to the folder '%s' ( each is selected ). " % ( total_added, folder.name )
+ msg += "Click the Go button at the bottom of this page to edit the permissions on these datasets if necessary."
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ created_ldda_ids=created_ldda_ids,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ else:
+ msg = 'Select at least one dataset from the list of active datasets in your current history'
+ messagetype = 'error'
+ last_used_build = folder.genome_build
+ upload_option = params.get( 'upload_option', 'import_from_history' )
+ # Send list of data formats to the form so the "extension" select list can be populated dynamically
+ file_formats = trans.app.datatypes_registry.upload_file_formats
+ # Send list of genome builds to the form so the "dbkey" select list can be populated dynamically
+ def get_dbkey_options( last_used_build ):
+ for dbkey, build_name in util.dbnames:
+ yield build_name, dbkey, ( dbkey==last_used_build )
+ dbkeys = get_dbkey_options( last_used_build )
+ # Send list of roles to the form so the dataset can be associated with 1 or more of them.
+ roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.c.name ).all()
+ return trans.fill_template( "/admin/library/new_dataset.mako",
+ upload_option=upload_option,
+ library_id=library_id,
+ folder_id=folder_id,
+ replace_id=replace_id,
+ file_formats=file_formats,
+ dbkeys=dbkeys,
+ last_used_build=last_used_build,
+ roles=roles,
+ history=history,
+ widgets=widgets,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def info_template( self, trans, library_id, id=None, folder_id=None, ldda_id=None, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ if id:
+ library_item = trans.app.model.FormDefinition.get( int( id ) )
+ library_item_desc = 'information template'
+ response_action = 'info_template'
+ response_id = id
+ elif folder_id:
+ library_item = trans.app.model.LibraryFolder.get( int( folder_id ) )
+ library_item_desc = 'folder'
+ response_action = 'folder'
+ response_id = folder_id
+ elif ldda_id:
+ library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( int( ldda_id ) )
+ library_item_desc = 'library dataset'
+ response_action = 'library_dataset_dataset_association'
+ response_id = ldda_id
+ else:
+ library_item = trans.app.model.Library.get( int( library_id ) )
+ library_item_desc = 'library'
+ response_action = 'browse_library'
+ response_id = library_id
+ forms = get_all_forms( trans, filter=dict(deleted=False) )
+ if not forms:
+ msg = "There are no forms on which to base the template, so create a form and "
+ msg += "try again to add the information template to the %s." % library_item_desc
+ trans.response.send_redirect( web.url_for( controller='forms',
+ action='new',
+ new=True,
+ msg=msg,
+ messagetype='done' ) )
+ if params.get( 'add', False ):
+ if params.get( 'add_info_template_button', False ):
+ form = trans.app.model.FormDefinition.get( int( kwd[ 'form_id' ] ) )
+ #fields = list( copy.deepcopy( form.fields ) )
+ form_values = trans.app.model.FormValues( form, [] )
+ form_values.flush()
+ if folder_id:
+ assoc = trans.app.model.LibraryFolderInfoAssociation( library_item, form, form_values )
+ elif ldda_id:
+ assoc = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, form, form_values )
+ else:
+ assoc = trans.app.model.LibraryInfoAssociation( library_item, form, form_values )
+ assoc.flush()
+ msg = 'An information template based on the form "%s" has been added to this %s.' % ( form.name, library_item_desc )
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action=response_action,
+ id=response_id,
+ msg=msg,
+ message_type='done' ) )
+ return trans.fill_template( '/admin/library/select_info_template.mako',
+ library_item_name=library_item.name,
+ library_item_desc=library_item_desc,
+ library_id=library_id,
+ folder_id=folder_id,
+ ldda_id=ldda_id,
+ forms=forms,
+ msg=msg,
+ messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def edit_template_info( self, trans, library_id, num_widgets, library_item_id=None, library_item_type=None, **kwd ):
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ folder_id = None
+ if library_item_type == 'library':
+ library_item = trans.app.model.Library.get( library_item_id )
+ elif library_item_type == 'library_dataset':
+ library_item = trans.app.model.LibraryDataset.get( library_item_id )
+ elif library_item_type == 'folder':
+ library_item = trans.app.model.LibraryFolder.get( library_item_id )
+ elif library_item_type == 'library_dataset_dataset_association':
+ library_item = trans.app.model.LibraryDatasetDatasetAssociation.get( library_item_id )
+ # This response_action method requires a folder_id
+ folder_id = library_item.library_dataset.folder.id
+ else:
+ msg = "Invalid library item type ( %s ) specified, id ( %s )" % ( str( library_item_type ), str( library_item_id ) )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ # Save updated template field contents
+ field_contents = []
+ for index in range( int( num_widgets ) ):
+ field_contents.append( util.restore_text( params.get( 'field_%i' % ( index ), '' ) ) )
+ if field_contents:
+ # Since information templates are inherited, the template fields can be displayed on the information
+ # page for a folder or library dataset when it has no info_association object. If the user has added
+ # field contents on an inherited template via a parent's info_association, we'll need to create a new
+ # form_values and info_association for the current object.
+ info_association = library_item.get_info_association( restrict=True )
+ if info_association:
+ template = info_association.template
+ info = info_association.info
+ form_values = trans.app.model.FormValues.get( info.id )
+ # Update existing content only if it has changed
+ if form_values.content != field_contents:
+ form_values.content = field_contents
+ form_values.flush()
+ else:
+ # Inherit the next available info_association so we can get the template
+ info_association = library_item.get_info_association()
+ template = info_association.template
+ # Create a new FormValues object
+ form_values = trans.app.model.FormValues( template, field_contents )
+ form_values.flush()
+ # Create a new info_association between the current library item and form_values
+ if library_item_type == 'folder':
+ info_association = trans.app.model.LibraryFolderInfoAssociation( library_item, template, form_values )
+ info_association.flush()
+ elif library_item_type == 'library_dataset_dataset_association':
+ info_association = trans.app.model.LibraryDatasetDatasetInfoAssociation( library_item, template, form_values )
+ info_association.flush()
+ msg = 'The information has been updated.'
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action=library_item_type,
+ id=library_item.id,
+ library_id=library_id,
+ folder_id=folder_id,
+ edit_info=True,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ @web.expose
+ @web.require_admin
+ def download_dataset_from_folder(self, trans, id, library_id=None, **kwd):
+ """Catches the dataset id and displays file contents as directed"""
+ # id must refer to a LibraryDatasetDatasetAssociation object
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
+ if not ldda.dataset:
+ msg = 'Invalid LibraryDatasetDatasetAssociation id %s received for file downlaod' % str( id )
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ mime = trans.app.datatypes_registry.get_mimetype_by_extension( ldda.extension.lower() )
+ trans.response.set_content_type( mime )
+ fStat = os.stat( ldda.file_name )
+ trans.response.headers[ 'Content-Length' ] = int( fStat.st_size )
+ valid_chars = '.,^_-()[]0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ'
+ fname = ldda.name
+ fname = ''.join( c in valid_chars and c or '_' for c in fname )[ 0:150 ]
+ trans.response.headers[ "Content-Disposition" ] = "attachment; filename=GalaxyLibraryDataset-%s-[%s]" % ( str( id ), fname )
+ try:
+ return open( ldda.file_name )
+ except:
+ msg = 'This dataset contains no content'
+ return trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ @web.expose
+ @web.require_admin
+ def datasets( self, trans, library_id, **kwd ):
+ # This method is used by the select list labeled "Perform action on selected datasets"
+ # on the admin library browser.
+ params = util.Params( kwd )
+ msg = util.restore_text( params.get( 'msg', '' ) )
+ messagetype = params.get( 'messagetype', 'done' )
+ if params.get( 'action_on_datasets_button', False ):
+ if not params.ldda_ids:
+ msg = "At least one dataset must be selected for %s" % params.action
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ ldda_ids = util.listify( params.ldda_ids )
+ if params.action == 'edit':
+ # We need the folder containing the LibraryDatasetDatasetAssociation(s)
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_ids[0] )
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='library_dataset_dataset_association',
+ library_id=library_id,
+ folder_id=ldda.library_dataset.folder.id,
+ id=",".join( ldda_ids ),
+ permissions=True,
+ msg=util.sanitize_text( msg ),
+ messagetype=messagetype ) )
+ elif params.action == 'delete':
+ for id in ldda_ids:
+ ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id )
+ ldda.deleted = True
+ ldda.flush()
+ msg = "The selected datasets have been removed from this library"
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ show_deleted=False,
+ msg=util.sanitize_text( msg ),
+ messagetype='done' ) )
+ else:
+ msg = "Action %s is not yet implemented" % str( params.action )
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype='error' ) )
+ else:
+ trans.response.send_redirect( web.url_for( controller='library_admin',
+ action='browse_library',
+ id=library_id,
+ msg=util.sanitize_text( msg ),
+ messagetype=messagetype ) )
+ @web.expose
+ @web.require_admin
+ def delete_library_item( self, trans, library_id, library_item_id, library_item_type ):
+ # This action will handle deleting all types of library items. State is saved for libraries and
+ # folders ( i.e., if undeleted, the state of contents of the library or folder will remain, so previously
+ # deleted / purged contents will have the same state ). When a library or folder has been deleted for
+ # the amount of time defined in the cleanup_datasets.py script, the library or folder and all of its
+ # contents will be purged. The association between this method and the cleanup_datasets.py script
+ # enables clean maintenance of libraries and library dataset disk files. This is also why the following
+ # 3 objects, and not any of the associations ( the cleanup_datasets.py scipot handles everything else ).
+ library_item_types = { 'library': trans.app.model.Library,
+ 'folder': trans.app.model.LibraryFolder,
+ 'library_dataset': trans.app.model.LibraryDataset }
+ if library_item_type not in library_item_types:
+ msg = 'Bad library_item_type specified: %s' % str( library_item_type )
+ messagetype = 'error'
+ else:
+ if library_item_type == 'library_dataset':
+ library_item_desc = 'Dataset'
+ else:
+ library_item_desc = library_item_type.capitalize()
+ library_item = library_item_types[ library_item_type ].get( int( library_item_id ) )
+ library_item.deleted = True
+ library_item.flush()
+ msg = util.sanitize_text( "%s '%s' has been marked deleted" % ( library_item_desc, library_item.name ) )
+ messagetype = 'done'
+ if library_item_type == 'library':
+ return self.browse_libraries( trans, msg=msg, messagetype=messagetype )
+ else:
+ return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype )
+ @web.expose
+ @web.require_admin
+ def undelete_library_item( self, trans, library_id, library_item_id, library_item_type ):
+ # This action will handle undeleting all types of library items
+ library_item_types = { 'library': trans.app.model.Library,
+ 'folder': trans.app.model.LibraryFolder,
+ 'library_dataset': trans.app.model.LibraryDataset }
+ if library_item_type not in library_item_types:
+ msg = 'Bad library_item_type specified: %s' % str( library_item_type )
+ messagetype = 'error'
+ else:
+ if library_item_type == 'library_dataset':
+ library_item_desc = 'Dataset'
+ else:
+ library_item_desc = library_item_type.capitalize()
+ library_item = library_item_types[ library_item_type ].get( int( library_item_id ) )
+ if library_item.purged:
+ msg = '%s %s has been purged, so it cannot be undeleted' % ( library_item_desc, library_item.name )
+ messagetype = 'error'
+ else:
+ library_item.deleted = False
+ library_item.flush()
+ msg = util.sanitize_text( "%s '%s' has been marked undeleted" % ( library_item_desc, library_item.name ) )
+ messagetype = 'done'
+ if library_item_type == 'library':
+ return self.browse_libraries( trans, msg=msg, messagetype=messagetype )
+ else:
+ return self.browse_library( trans, id=library_id , msg=msg, messagetype=messagetype )
diff -r f2af04af3caa -r d301a67eda40 templates/admin/index.mako
--- a/templates/admin/index.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/index.mako Mon Sep 14 11:05:36 2009 -0400
@@ -89,7 +89,7 @@
</div>
<div class="toolSectionBody">
<div class="toolSectionBg">
- <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div>
+ <div class="toolTitle"><a href="${h.url_for( controller='library_admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div>
</div>
</div>
<div class="toolSectionPad"></div>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/browse_libraries.mako
--- a/templates/admin/library/browse_libraries.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/browse_libraries.mako Mon Sep 14 11:05:36 2009 -0400
@@ -13,10 +13,10 @@
<ul class="manage-table-actions">
%if not deleted:
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library', new=True )}"><span>Create a new data library</span></a>
</li>
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a>
</li>
%endif
</ul>
@@ -42,7 +42,7 @@
<tbody>
%for library in libraries:
<tr class="libraryRow libraryOrFolderRow" id="libraryRow">
- <td><a href="${h.url_for( controller='admin', action='browse_library', id=library.id, deleted=deleted, show_deleted=show_deleted )}">${library.name}</a></td>
+ <td><a href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, deleted=deleted, show_deleted=show_deleted )}">${library.name}</a></td>
<td><i>${library.description}</i></td>
</tr>
%endfor
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/browse_library.mako
--- a/templates/admin/library/browse_library.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/browse_library.mako Mon Sep 14 11:05:36 2009 -0400
@@ -97,26 +97,26 @@
<input type="checkbox" name="ldda_ids" value="${ldda.id}"/>
%endif
<span class="libraryItemDeleted-${ldda.deleted}">
- <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a>
+ <a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, info=True, deleted=deleted, show_deleted=show_deleted )}"><b>${ldda.name[:50]}</b></a>
</span>
<a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
%if not library.deleted and not folder.deleted and not library_dataset.deleted:
<div popupmenu="dataset-${ldda.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use
- ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
+ ##<a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
%if current_version:
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a>
%endif
%if ldda.has_data:
- <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a>
%endif
- <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a>
+ <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Delete this dataset</a>
</div>
%elif not library.deleted and not folder.deleted and library_dataset.deleted:
<div popupmenu="dataset-${ldda.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library.id, library_item_id=library_dataset.id, library_item_type='library_dataset' )}">Undelete this dataset</a>
</div>
%endif
</td>
@@ -156,23 +156,23 @@
%endif
%if not folder.deleted:
<div popupmenu="folder-${folder.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a>
- <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a>
- <a class="action-button" href="${h.url_for( controller='admin', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a>
## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition
##%if folder.info_association:
## <% form_id = folder.info_association[0].template.id %>
## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this folder's information template</a>
##%else:
%if not folder.info_association:
- <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, folder_id=folder.id, add=True )}">Add an information template to this folder</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, folder_id=folder.id, add=True )}">Add an information template to this folder</a>
%endif
- <a class="action-button" href="${h.url_for( controller='admin', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a>
- <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='admin', action='delete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Delete this folder and its contents</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a>
+ <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Delete this folder and its contents</a>
</div>
%elif not deleted and folder.deleted and not folder.purged:
<div popupmenu="folder-${folder.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Undelete this folder</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library_id, library_item_id=folder.id, library_item_type='folder' )}">Undelete this folder</a>
</div>
%endif
</li>
@@ -216,10 +216,10 @@
<ul class="manage-table-actions">
%if not deleted:
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this data library</span></a>
</li>
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='folder', new=True, id=library.root_folder.id, library_id=library.id )}">Add a folder to this data library</a>
</li>
%endif
</ul>
@@ -228,7 +228,7 @@
${render_msg( msg, messagetype )}
%endif
-<form name="update_multiple_datasets" action="${h.url_for( controller='admin', action='datasets', library_id=library.id )}" onSubmit="javascript:return checkForm();" method="post">
+<form name="update_multiple_datasets" action="${h.url_for( controller='library_admin', action='datasets', library_id=library.id )}" onSubmit="javascript:return checkForm();" method="post">
<ul>
<li class="libraryRow libraryOrFolderRow" id="libraryRow">
<div class="rowTitle">
@@ -244,24 +244,24 @@
<a id="library-${library.id}-popup" class="popup-arrow" style="display: none;">▼</a>
<div popupmenu="library-${library.id}-popup">
%if not deleted:
- <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, information=True )}">Edit this data library's information</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library', id=library.id, information=True )}">Edit this data library's information</a>
## Editing templates disabled until we determine optimal approach to re-linking library item to new version of form definition
##%if library.info_association:
## <% form_id = library.info_association[0].template.id %>
## <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form_id, show_form=True )}">Edit this data library's information template</a>
##%else:
%if not library.info_association:
- <a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library.id, add=True )}">Add an information template to this data library</a>
%endif
- <a class="action-button" href="${h.url_for( controller='admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a>
- <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library', id=library.id, permissions=True )}">Edit this data library's permissions</a>
+ <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Delete this data library and its contents</a>
%if show_deleted:
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, show_deleted=False )}">Hide deleted data library items</a>
%else:
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id, show_deleted=True )}">Show deleted data library items</a>
%endif
%elif not library.purged:
- <a class="action-button" href="${h.url_for( controller='admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library.id, library_item_id=library.id, library_item_type='library' )}">Undelete this data library</a>
%endif
</div>
</th>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/common.mako
--- a/templates/admin/library/common.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/common.mako Mon Sep 14 11:05:36 2009 -0400
@@ -22,7 +22,7 @@
<div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div>
<div class="toolFormBody">
%if editable:
- <form name="edit_info" action="${h.url_for( controller='admin', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post">
+ <form name="edit_info" action="${h.url_for( controller='library_admin', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post">
<input type="hidden" name="library_item_id" value="${library_item.id}"/>
<input type="hidden" name="library_item_type" value="${library_item_type}"/>
%for i, field in enumerate( widgets ):
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/folder_info.mako
--- a/templates/admin/library/folder_info.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/folder_info.mako Mon Sep 14 11:05:36 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -16,7 +16,7 @@
<div class="toolForm">
<div class="toolFormTitle">Edit folder name and description</div>
<div class="toolFormBody">
- <form name="folder" action="${h.url_for( controller='admin', action='folder', information=True, id=folder.id, library_id=library_id )}" method="post" >
+ <form name="folder" action="${h.url_for( controller='library_admin', action='folder', information=True, id=folder.id, library_id=library_id )}" method="post" >
<div class="form-row">
<label>Name:</label>
<input type="text" name="name" value="${folder.name}" size="40"/>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/folder_permissions.mako
--- a/templates/admin/library/folder_permissions.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/folder_permissions.mako Mon Sep 14 11:05:36 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -17,4 +17,4 @@
roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all()
%>
-${render_permission_form( folder, folder.name, h.url_for( controller='admin', action='folder', id=folder.id, library_id=library_id, permissions=True ), roles )}
+${render_permission_form( folder, folder.name, h.url_for( controller='library_admin', action='folder', id=folder.id, library_id=library_id, permissions=True ), roles )}
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_edit_info.mako
--- a/templates/admin/library/ldda_edit_info.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/ldda_edit_info.mako Mon Sep 14 11:05:36 2009 -0400
@@ -12,7 +12,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -35,7 +35,7 @@
<div class="toolForm">
<div class="toolFormTitle">Edit attributes of ${ldda.name}</div>
<div class="toolFormBody">
- <form name="edit_attributes" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <form name="edit_attributes" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
<input type="hidden" name="id" value="${ldda.id}"/>
<br/>
<div class="form-row">
@@ -73,7 +73,7 @@
<input type="submit" name="save" value="Save"/>
</div>
</form>
- <form name="auto_detect" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <form name="auto_detect" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
<div class="form-row">
<input type="hidden" name="id" value="${ldda.id}"/>
<input type="submit" name="detect" value="Auto-detect"/>
@@ -89,7 +89,7 @@
<div class="toolFormTitle">Change data type of ${ldda.name}</div>
<div class="toolFormBody">
%if ldda.datatype.allow_datatype_change:
- <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <form name="change_datatype" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
<input type="hidden" name="id" value="${ldda.id}"/>
<div class="form-row">
<label>New Type:</label>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_info.mako
--- a/templates/admin/library/ldda_info.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/ldda_info.mako Mon Sep 14 11:05:36 2009 -0400
@@ -20,7 +20,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id, deleted=library.deleted, show_deleted=show_deleted )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -41,18 +41,18 @@
%if not library.deleted and not ldda.library_dataset.folder.deleted and not ldda.deleted:
<a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a>
<div popupmenu="dataset-${ldda.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a>
## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use
- ##<a class="action-button" href="${h.url_for( controller='admin', action='info_template', library_id=library_id, library_dataset_id=ldda.library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
+ ##<a class="action-button" href="${h.url_for( controller='library_admin', action='info_template', library_id=library_id, library_dataset_id=ldda.library_dataset.id, new_template=True )}">Add an information template to this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a>
%if current_version:
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a>
%endif
%if ldda.has_data:
- <a class="action-button" href="${h.url_for( controller='admin', action='download_dataset_from_folder', id=ldda.id, library_id=library_id )}">Download this dataset</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='download_dataset_from_folder', id=ldda.id, library_id=library_id )}">Download this dataset</a>
%endif
%if not library.deleted and not ldda.library_dataset.folder.deleted and not ldda.deleted:
- <a class="action-button" confirm="Click OK to remove dataset '${ldda.name}'?" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, delete=True )}">Delete this dataset</a>
+ <a class="action-button" confirm="Click OK to remove dataset '${ldda.name}'?" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, delete=True )}">Delete this dataset</a>
%endif
</div>
%endif
@@ -104,7 +104,7 @@
<div class="toolFormTitle">Expired versions of ${ldda.name}</div>
%for expired_ldda in expired_lddas:
<div class="form-row">
- <a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=expired_ldda.library_dataset.folder.id, id=expired_ldda.id, info=True )}">${expired_ldda.name}</a>
+ <a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=expired_ldda.library_dataset.folder.id, id=expired_ldda.id, info=True )}">${expired_ldda.name}</a>
</div>
%endfor
%endif
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/ldda_permissions.mako
--- a/templates/admin/library/ldda_permissions.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/ldda_permissions.mako Mon Sep 14 11:05:36 2009 -0400
@@ -15,7 +15,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -35,7 +35,7 @@
<a id="ldda-${ldd_assoc.id}-popup" class="popup-arrow" style="display: none;">▼</a>
</div>
<div popupmenu="ldd_assoc-${ldd_assoc.id}-popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset', id=ldd_assoc.library_dataset_id, library_id=library_id )}">Manage this dataset's versions</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset', id=ldd_assoc.library_dataset_id, library_id=library_id )}">Manage this dataset's versions</a>
</div>
</td>
<td>
@@ -59,4 +59,4 @@
%endif
<% ldda_ids = ",".join( [ str( d.id ) for d in lddas ] ) %>
-${render_permission_form( lddas[0], name_str, h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=lddas[0].library_dataset.folder.id, id=ldda_ids, permissions=True ), roles )}
+${render_permission_form( lddas[0], name_str, h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=lddas[0].library_dataset.folder.id, id=ldda_ids, permissions=True ), roles )}
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_dataset_info.mako
--- a/templates/admin/library/library_dataset_info.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/library_dataset_info.mako Mon Sep 14 11:05:36 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -22,7 +22,7 @@
<div class="toolForm">
<div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div>
<div class="toolFormBody">
- <form name="edit_attributes" action="${h.url_for( controller='admin', action='library_dataset' )}" method="post">
+ <form name="edit_attributes" action="${h.url_for( controller='library_admin', action='library_dataset' )}" method="post">
<input type="hidden" name="id" value="${library_dataset.id}"/>
<div class="form-row">
<label>Name:</label>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_dataset_permissions.mako
--- a/templates/admin/library/library_dataset_permissions.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/library_dataset_permissions.mako Mon Sep 14 11:05:36 2009 -0400
@@ -11,7 +11,7 @@
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -23,4 +23,4 @@
roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all()
%>
-${render_permission_form( library_dataset, library_dataset.name, h.url_for( controller='admin', action='library_dataset', id=library_dataset.id, library_id=library_id, permissions=True ), roles )}
+${render_permission_form( library_dataset, library_dataset.name, h.url_for( controller='library_admin', action='library_dataset', id=library_dataset.id, library_id=library_id, permissions=True ), roles )}
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_info.mako
--- a/templates/admin/library/library_info.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/library_info.mako Mon Sep 14 11:05:36 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -16,7 +16,7 @@
<div class="toolForm">
<div class="toolFormTitle">Change library name and description</div>
<div class="toolFormBody">
- <form name="library" action="${h.url_for( controller='admin', action='library', information=True, id=library.id )}" method="post" >
+ <form name="library" action="${h.url_for( controller='library_admin', action='library', information=True, id=library.id )}" method="post" >
<div class="form-row">
<label>Name:</label>
<div style="float: left; width: 250px; margin-right: 10px;">
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/library_permissions.mako
--- a/templates/admin/library/library_permissions.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/library_permissions.mako Mon Sep 14 11:05:36 2009 -0400
@@ -5,7 +5,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library.id )}"><span>Browse this data library</span></a>
</li>
</ul>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_dataset.mako
--- a/templates/admin/library/new_dataset.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/new_dataset.mako Mon Sep 14 11:05:36 2009 -0400
@@ -7,16 +7,16 @@
<b>Create new data library datasets</b>
<a id="upload-librarydataset--popup" class="popup-arrow" style="display: none;">▼</a>
<div popupmenu="upload-librarydataset--popup">
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_file' )}">Upload files</a>
%if trans.app.config.library_import_dir and os.path.exists( trans.app.config.library_import_dir ):
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_directory' )}">Upload directory of files</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='upload_directory' )}">Upload directory of files</a>
%endif
- <a class="action-button" href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='import_from_history' )}">Import datasets from your current history</a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, replace_id=replace_id, upload_option='import_from_history' )}">Import datasets from your current history</a>
</div>
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -32,13 +32,13 @@
<div class="toolFormTitle">Upload a directory of files</div>
%endif
<div class="toolFormBody">
- <form name="tool_form" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id )}" enctype="multipart/form-data" method="post">
+ <form name="tool_form" action="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id )}" enctype="multipart/form-data" method="post">
<input type="hidden" name="folder_id" value="${folder_id}"/>
<input type="hidden" name="upload_option" value="${upload_option}"/>
%if replace_dataset:
<input type="hidden" name="replace_id" value="${replace_dataset.id}"/>
<div class="form-row">
- You are currently selecting a new file to replace '<a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'.
+ You are currently selecting a new file to replace '<a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'.
<div style="clear: both"></div>
</div>
%endif
@@ -184,13 +184,13 @@
<div class="toolFormTitle">Active datasets in your current history (${history.name})</div>
<div class="toolFormBody">
%if history and history.active_datasets:
- <form name="add_history_datasets_to_library" action="${h.url_for( controller='admin', action='add_history_datasets_to_library', library_id=library_id )}" enctype="multipart/form-data" method="post">
+ <form name="add_history_datasets_to_library" action="${h.url_for( controller='library_admin', action='add_history_datasets_to_library', library_id=library_id )}" enctype="multipart/form-data" method="post">
<input type="hidden" name="folder_id" value="${folder_id}"/>
<input type="hidden" name="upload_option" value="${upload_option}"/>
%if replace_dataset:
<input type="hidden" name="replace_id" value="${replace_dataset.id}"/>
<div class="form-row">
- You are currently selecting a new file to replace '<a href="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'.
+ You are currently selecting a new file to replace '<a href="${h.url_for( controller='library_admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder_id, id=replace_dataset.library_dataset_dataset_association.id )}">${replace_dataset.name}</a>'.
<div style="clear: both"></div>
</div>
%endif
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_folder.mako
--- a/templates/admin/library/new_folder.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/new_folder.mako Mon Sep 14 11:05:36 2009 -0400
@@ -4,7 +4,7 @@
<br/<br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -15,7 +15,7 @@
<div class="toolForm">
<div class="toolFormTitle">Create a new folder</div>
<div class="toolFormBody">
- <form name="folder" action="${h.url_for( controller='admin', action='folder', id=folder.id, library_id=library_id )}" method="post" >
+ <form name="folder" action="${h.url_for( controller='library_admin', action='folder', id=folder.id, library_id=library_id )}" method="post" >
<div class="form-row">
<label>Name:</label>
<div style="float: left; width: 250px; margin-right: 10px;">
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/new_library.mako
--- a/templates/admin/library/new_library.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/new_library.mako Mon Sep 14 11:05:36 2009 -0400
@@ -8,7 +8,7 @@
<div class="toolForm">
<div class="toolFormTitle">Create a new data library</div>
<div class="toolFormBody">
- <form name="library" action="${h.url_for( controller='admin', action='library' )}" method="post" >
+ <form name="library" action="${h.url_for( controller='library_admin', action='library' )}" method="post" >
<div class="form-row">
<label>Name:</label>
<div style="float: left; width: 250px; margin-right: 10px;">
diff -r f2af04af3caa -r d301a67eda40 templates/admin/library/select_info_template.mako
--- a/templates/admin/library/select_info_template.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/library/select_info_template.mako Mon Sep 14 11:05:36 2009 -0400
@@ -4,7 +4,7 @@
<br/><br/>
<ul class="manage-table-actions">
<li>
- <a class="action-button" href="${h.url_for( controller='admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
+ <a class="action-button" href="${h.url_for( controller='library_admin', action='browse_library', id=library_id )}"><span>Browse this data library</span></a>
</li>
</ul>
@@ -14,7 +14,7 @@
<div class="toolForm">
<div class="toolFormTitle">Select a form on which to base the template for the ${library_item_desc} '${library_item_name}'</div>
- <form name="new_info_template" action="${h.url_for( controller='admin', action='info_template', add=True )}" method="post" >
+ <form name="new_info_template" action="${h.url_for( controller='library_admin', action='info_template', add=True )}" method="post" >
<div class="toolFormBody">
<div class="form-row">
<input type="hidden" name="library_id" value="${library_id}"/>
diff -r f2af04af3caa -r d301a67eda40 templates/admin/requests/show_request.mako
--- a/templates/admin/requests/show_request.mako Fri Sep 11 16:09:02 2009 -0400
+++ b/templates/admin/requests/show_request.mako Mon Sep 14 11:05:36 2009 -0400
@@ -80,7 +80,7 @@
<i>None</i>
%else:
%if rd['label'] == 'Data library':
- <a href="${h.url_for( controller='admin', action='browse_library', id=request.library.id )}">${rd['value']}</a>
+ <a href="${h.url_for( controller='library_admin', action='browse_library', id=request.library.id )}">${rd['value']}</a>
%else:
${rd['value']}
%endif
diff -r f2af04af3caa -r d301a67eda40 test/base/twilltestcase.py
--- a/test/base/twilltestcase.py Fri Sep 11 16:09:02 2009 -0400
+++ b/test/base/twilltestcase.py Mon Sep 14 11:05:36 2009 -0400
@@ -1139,14 +1139,14 @@
def create_library( self, name='Library One', description='This is Library One' ):
"""Create a new library"""
self.home()
- self.visit_url( "%s/admin/library?new=True" % self.url )
+ self.visit_url( "%s/library_admin/library?new=True" % self.url )
self.check_page_for_string( 'Create a new data library' )
tc.fv( "1", "1", name ) # form field 1 is the field named name...
tc.fv( "1", "2", description ) # form field 1 is the field named name...
tc.submit( "create_library_button" )
self.home()
def set_library_permissions( self, library_id, library_name, role_id, permissions_in, permissions_out ):
- url = "admin/library?id=%s&permissions=True&update_roles_button=Save" % ( library_id )
+ url = "library_admin/library?id=%s&permissions=True&update_roles_button=Save" % ( library_id )
for po in permissions_out:
key = '%s_out' % po
url ="%s&%s=%s" % ( url, key, str( role_id ) )
@@ -1161,10 +1161,10 @@
def rename_library( self, library_id, old_name, name='Library One Renamed', description='This is Library One Re-described' ):
"""Rename a library"""
self.home()
- self.visit_url( "%s/admin/library?information=True&id=%s" % ( self.url, library_id ) )
+ self.visit_url( "%s/library_admin/library?information=True&id=%s" % ( self.url, library_id ) )
self.check_page_for_string( 'Change library name and description' )
# Since twill barfs on the form submisson, we ar forced to simulate it
- url = "%s/admin/library?information=True&id=%s&rename_library_button=Save&description=%s&name=%s" % \
+ url = "%s/library_admin/library?information=True&id=%s&rename_library_button=Save&description=%s&name=%s" % \
( self.url, library_id, description.replace( ' ', '+' ), name.replace( ' ', '+' ) )
self.home()
self.visit_url( url )
@@ -1174,7 +1174,7 @@
def add_library_info_template( self, library_id, library_name, form_id, form_name ):
"""Add a new info template to a library"""
self.home()
- url = "%s/admin/info_template?library_id=%s&add=True" % ( self.url, library_id )
+ url = "%s/library_admin/info_template?library_id=%s&add=True" % ( self.url, library_id )
self.visit_url( url )
self.check_page_for_string ( "Select a form on which to base the template" )
tc.fv( '1', 'library_id', library_id )
@@ -1184,7 +1184,7 @@
def edit_library_info( self, library_id, library_name, ele_1_field_name, ele_1_contents, ele_2_field_name, ele_2_contents ):
"""Add information to a library using an existing template with 2 elements"""
self.home()
- self.visit_url( "%s/admin/library?information=True&id=%s" % ( self.url, library_id ) )
+ self.visit_url( "%s/library_admin/library?information=True&id=%s" % ( self.url, library_id ) )
check_str = 'Other information about library %s' % library_name
self.check_page_for_string( check_str )
tc.fv( '2', ele_1_field_name, ele_1_contents )
@@ -1195,7 +1195,7 @@
ele_desc_1, desc_1, ele_name_2, name_2, ele_desc_2, desc_2 ):
"""Edit an existing library info template"""
self.home()
- url = "%s/admin/info_template?library_id=%s&id=%s&edit_template=True" % ( self.url, library_id, id )
+ url = "%s/library_admin/info_template?library_id=%s&id=%s&edit_template=True" % ( self.url, library_id, id )
self.visit_url( url )
self.check_page_for_string ( 'Edit template' )
tc.fv( '1', 'id', id )
@@ -1213,7 +1213,7 @@
name='Folder Template 1', ele_name_0='Fu', ele_help_0='', ele_name_1='Bar', ele_help_1='' ):
"""Add a new info template to a folder"""
self.home()
- url = "%s/admin/info_template?library_id=%s&folder_id=%s&new_template=True&num_fields=2&create_info_template_button=Go" % \
+ url = "%s/library_admin/info_template?library_id=%s&folder_id=%s&new_template=True&num_fields=2&create_info_template_button=Go" % \
( self.url, library_id, folder_id )
self.home()
self.visit_url( url )
@@ -1232,7 +1232,7 @@
def add_folder( self, library_id, folder_id, name='Folder One', description='This is Folder One' ):
"""Create a new folder"""
self.home()
- self.visit_url( "%s/admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) )
+ self.visit_url( "%s/library_admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) )
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/355b6844b123
changeset: 2684:355b6844b123
user: jeremy goecks <jeremy.goecks(a)emory.edu>
date: Fri Sep 11 15:04:53 2009 -0400
description:
Merge
0 file(s) affected in this change:
diffs (878 lines):
diff -r 032478337b82 -r 355b6844b123 eggs.ini
--- a/eggs.ini Fri Sep 11 14:57:02 2009 -0400
+++ b/eggs.ini Fri Sep 11 15:04:53 2009 -0400
@@ -31,7 +31,7 @@
elementtree = 1.2.6_20050316
lrucache = 0.2
;lsprof - james
-Mako = 0.2.4
+Mako = 0.2.5
MyghtyUtils = 0.52
nose = 0.9.1
NoseHTML = 0.2
@@ -79,7 +79,7 @@
docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz
elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz
lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz
-Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz
+Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz
MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52…
nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz
NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2
diff -r 032478337b82 -r 355b6844b123 scripts/cleanup_datasets/cleanup_datasets.py
--- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 14:57:02 2009 -0400
+++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 15:04:53 2009 -0400
@@ -1,4 +1,8 @@
#!/usr/bin/env python
+
+from galaxy import eggs
+import pkg_resources
+pkg_resources.require( "SQLAlchemy >= 0.4" )
import sys, os, time, ConfigParser, shutil
from datetime import datetime, timedelta
@@ -9,12 +13,7 @@
new_path.extend( sys.path[1:] ) # remove scripts/ from the path
sys.path = new_path
-from galaxy import eggs
import galaxy.model.mapping
-import pkg_resources
-
-pkg_resources.require( "SQLAlchemy >= 0.4" )
-
from galaxy.model.orm import and_, eagerload
assert sys.version_info[:2] >= ( 2, 4 )
diff -r 032478337b82 -r 355b6844b123 templates/workflow/run.mako
--- a/templates/workflow/run.mako Fri Sep 11 14:57:02 2009 -0400
+++ b/templates/workflow/run.mako Fri Sep 11 15:04:53 2009 -0400
@@ -87,8 +87,7 @@
${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )}
<input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" />
%endif
- %elif isinstance( value, RuntimeValue ) or \
- ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
+ %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
## On the first load we may see a RuntimeValue, so we write
## an input field using the initial value for the param.
## Subsequents posts will no longer have the runtime value
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in1.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,5 @@
+@HWI-EAS91_1_30788AAXX:1:1:1513:715/1
+GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG
++/1
+IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I
+
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in2.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/1
+TAGACTACGAAAGTGACTTTAATACCTCTGACTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in3.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in3.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/2
+ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG
++
+IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2)
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out1.sam Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,1 @@
+HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out2.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out2.sam Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,2 @@
+HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36
+HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18
diff -r 032478337b82 -r 355b6844b123 tool-data/bowtie_indices.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/bowtie_indices.loc.sample Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,28 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Bowtie indexed sequences data files. You will need
+#to create these data files and then create a bowtie_indices.loc file
+#similar to this one (store it in this directory ) that points to
+#the directories in which those files are stored. The bowtie_indices.loc
+#file has this format (white space characters are TAB characters):
+#
+#<build> <file_base>
+#
+#So, for example, if you had hg18 indexed stored in
+#/depot/data2/galaxy/bowtie/hg18/,
+#then the bowtie_indices.loc entry would look like this:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
+#
+#and your /depot/data2/galaxy/bowtie/hg18/ directory
+#would contain hg18.*.ebwt files:
+#
+#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt
+#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt
+#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt
+#...etc...
+#
+#Your bowtie_indices.loc file should include an entry per line for
+#each index set you have stored. The "file" in the path does not actually
+#exist, but it is the prefix for the actual index files. For example:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
diff -r 032478337b82 -r 355b6844b123 tool_conf.xml.sample
--- a/tool_conf.xml.sample Fri Sep 11 14:57:02 2009 -0400
+++ b/tool_conf.xml.sample Fri Sep 11 15:04:53 2009 -0400
@@ -332,7 +332,8 @@
<tool file="metag_tools/megablast_xml_parser.xml" />
<tool file="metag_tools/blat_wrapper.xml" />
<tool file="metag_tools/mapping_to_ucsc.xml" />
- </section>
+ <tool file="sr_mapping/bowtie_wrapper.xml" />
+ </section>
<section name="Tracks" id="tracks">
<tool file="visualization/genetrack.xml" />
</section>
diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.py Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,174 @@
+#! /usr/bin/python
+
+"""
+Runs Bowtie on single-end or paired-end data.
+"""
+
+import optparse, os, sys, tempfile
+
+def stop_err( msg ):
+ sys.stderr.write( "%s\n" % msg )
+ sys.exit()
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format')
+ parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format')
+ parser.add_option('', '--output', dest='output', help='The output file')
+ parser.add_option('', '--paired', dest='paired', help='Whether the data is single- or paired-end')
+ parser.add_option('', '--genomeSource', dest='genomeSource', help='The type of reference provided')
+ parser.add_option('', '--ref', dest='ref', help='The reference genome to use or index')
+ parser.add_option('', '--skip', dest='skip', help='Skip the first n reads')
+ parser.add_option('', '--alignLimit', dest='alignLimit', help='Only align the first n reads')
+ parser.add_option('', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment')
+ parser.add_option('', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment')
+ parser.add_option('', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed')
+ parser.add_option('', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions')
+ parser.add_option('', '--seedLen', dest='seedLen', help='Seed length')
+ parser.add_option('', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30')
+ parser.add_option('', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy')
+ parser.add_option('', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist')
+ parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read')
+ parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read')
+ parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist')
+ parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments')
+ parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions")
+ parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read')
+ parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode')
+ parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable')
+ parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments')
+ parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments')
+ parser.add_option('', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand')
+ parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate')
+ parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand')
+ parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand')
+ parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time')
+ parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n')
+ parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index')
+ parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator')
+ parser.add_option('', '--dbkey', dest='dbkey', help='')
+ parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters')
+ parser.add_option('', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior')
+ parser.add_option('', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings')
+ parser.add_option('', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block')
+ parser.add_option('', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference')
+ parser.add_option('', '--idcv', dest='idcv', help='The period for the difference-cover sample')
+ parser.add_option('', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample')
+ parser.add_option('', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paried-end alignment')
+ parser.add_option('', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows')
+ parser.add_option('', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query')
+ parser.add_option('', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As')
+ parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file')
+ parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator')
+ parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index')
+ parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8')
+ parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set')
+ (options, args) = parser.parse_args()
+
+ # index if necessary
+ if options.genomeSource == 'history':
+ # set up commands
+ if options.index_settings =='index_pre_set':
+ indexing_cmds = ''
+ else:
+ try:
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ (('','--noauto')[options.iauto_b=='set'],
+ ('','--packed')[options.ipacked=='packed'],
+ ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1],
+ ('','--bmaxdivn %s'%options.ibmaxdivn)[options.ibmaxdivn!='None'],
+ ('','--dcv %s'%options.idcv)[options.idcv!='None'],
+ ('','--nodc')[options.inodc=='nodc'],
+ ('','--noref')[options.inoref=='noref'], options.ioffrate,
+ ('','--ftabchars %s'%options.iftab)[int(options.iftab)>=0],
+ ('','--ntoa')[options.intoa=='yes'],
+ ('--little','--big')[options.iendian=='big'],
+ ('','--seed %s'%options.iseed)[int(options.iseed)>0],
+ ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0],
+ ('','--oldpmap')[options.ioldpmap=='yes'])
+ except ValueError:
+ indexing_cmds = ''
+
+ # make temp directory for placement of indices and copy reference file there
+ tmp_dir = tempfile.gettempdir()
+ try:
+ os.system('cp %s %s' % (options.ref, tmp_dir))
+ except Exception, erf:
+ stop_err('Error creating temp directory for indexing purposes\n' + str(erf))
+ options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1])
+ cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref)
+ try:
+ os.system(cmd1)
+ except Exception, erf:
+ stop_err('Error indexing reference sequence\n' + str(erf))
+
+ # set up aligning and generate aligning command options
+ # automatically set threads to 8 in both cases
+ if options.params == 'pre_set':
+ aligning_cmds = '-p 8'
+ else:
+ try:
+ aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \
+ '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \
+ (('','-s %s'%options.skip)[options.skip!='None'],
+ ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0],
+ ('','-5 %s'%options.trimH)[int(options.trimH)>=0],
+ ('','-3 %s'%options.trimL)[int(options.trimL)>=0],
+ ('','-n %s'%options.mismatchSeed)[options.mismatchSeed=='0' or options.mismatchSeed=='1' or options.mismatchSeed=='2' or options.mismatchSeed=='3'],
+ ('','-e %s'%options.mismatchQual)[int(options.mismatchQual)>=0],
+ ('','-l %s'%options.seedLen)[int(options.seedLen)>=5],
+ ('','--nomaqround')[options.rounding=='noRound'],
+ ('','-v %s'%options.maqSoapAlign)[options.maqSoapAlign!='-1'],
+ ('','-I %s'%options.minInsert)[options.minInsert!='None'],
+ ('','-X %s'%options.maxInsert)[options.maxInsert!='None'],
+ ('','--%s'%options.mateOrient)[options.mateOrient!='None'],
+ ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0],
+ ('','--nofw')[options.forwardAlign=='noForward'],
+ ('','--norc')[options.reverseAlign=='noReverse'],
+ ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')],
+ ('','-y')[options.tryHard=='doTryHard'],
+ ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0],
+ ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0],
+ ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0],
+ ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0],
+ ('','--best')[options.best=='doBest'],
+ ('','--strata')[options.strata=='doStrata'],
+ ('','-B %s'%options.offbase)[int(options.offbase)>=0],
+ ('','-z %s'%options.phased)[options.phased!='None'],
+ ('','-o %s'%options.offrate)[int(options.offrate)>=0],
+ ('','--mm')[options.mm=='doMm'],
+ ('','--seed %s'%options.seed)[int(options.seed)>=0])
+ except ValueError:
+ aligning_cmds = '-p 8'
+
+ tmp_out = tempfile.NamedTemporaryFile()
+
+ # prepare actual aligning commands
+ if options.paired == 'paired':
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
+ else:
+ cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
+ # prepare command to convert bowtie output to sam and alternative
+ cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output)
+ cmd4 = 'cp %s %s' % (tmp_out.name, options.output)
+
+ # align
+ try:
+ os.system(cmd2)
+ except Exception, erf:
+ stop_err("Error aligning sequence\n" + str(erf))
+ if len(file(tmp_out.name,'r').read()) > 0:
+ #convert
+ try:
+ os.system(cmd3)
+ except Exception, erf:
+ stop_err('Error converting output to sam format\n' + str(erf))
+ else:
+ try:
+ os.system(cmd4)
+ sys.stdout.write('Alignment file contained no data')
+ except Exception, erf:
+ stop_err('Error producing alignment file. File contained no data.\n' + str(erf))
+
+if __name__=="__main__": __main__()
diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.xml Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,556 @@
+<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0">
+ <description> fast alignment of reads against reference sequence </description>
+ <command interpreter="python">
+ bowtie_wrapper.py
+ --input1=$singlePaired.input1
+ #if $singlePaired.sPaired == "paired":
+ --input2=$singlePaired.input2
+ #else:
+ --input2="None"
+ #end if
+ --output=$output
+ --paired=$singlePaired.sPaired
+ --genomeSource=$refGenomeSource.genomeSource
+ #if $refGenomeSource.genomeSource == "history":
+ --ref=$refGenomeSource.ownFile
+ #else:
+ --ref=$refGenomeSource.indices.value
+ #end if
+ --params=$singlePaired.params.settings_type
+ #if $singlePaired.params.settings_type == "full":
+ --skip=$singlePaired.params.skip
+ --alignLimit=$singlePaired.params.alignLimit
+ --trimH=$singlePaired.params.trimH
+ --trimL=$singlePaired.params.trimL
+ --mismatchSeed=$singlePaired.params.mismatchSeed
+ --mismatchQual=$singlePaired.params.mismatchQual
+ --seedLen=$singlePaired.params.seedLen
+ --rounding=$singlePaired.params.rounding
+ --maqSoapAlign=$singlePaired.params.maqSoapAlign
+ --tryHard=$singlePaired.params.tryHard
+ --valAlign=$singlePaired.params.valAlign
+ --allValAligns=$singlePaired.params.allValAligns
+ --suppressAlign=$singlePaired.params.suppressAlign
+ --offbase=$singlePaired.params.offbase
+ --offrate=$singlePaired.params.offrate
+ --mm=$singlePaired.params.mm
+ --seed=$singlePaired.params.seed
+ --best=$singlePaired.params.bestOption.best
+ #if $singlePaired.params.bestOption.best == "doBest":
+ --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks
+ --threadMem=$singlePaired.params.bestOption.threadMem
+ --strata=$singlePaired.params.bestOption.strata
+ --phased="None"
+ #else:
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ #if $singlePaired.sPaired =="single":
+ --phased=$singlePaired.params.bestOption.phased
+ #else:
+ --phased="None"
+ #end if
+ #end if
+ #if $singlePaired.sPaired == "single":
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ #else:
+ --minInsert=$singlePaired.params.minInsert
+ --maxInsert=$singlePaired.params.maxInsert
+ --mateOrient=$singlePaired.params.mateOrient
+ --maxAlignAttempt=$singlePaired.params.maxAlignAttempt
+ --forwardAlign=$singlePaired.params.forwardAlign
+ --reverseAlign=$singlePaired.params.reverseAlign
+ #end if
+ #else
+ --skip="None"
+ --alignLimit="None"
+ --trimH="None"
+ --trimL="None"
+ --mismatchSeed="None"
+ --mismatchQual="None"
+ --seedLen="None"
+ --rounding="None"
+ --maqSoapAlign="None"
+ --tryHard="None"
+ --valAlign="None"
+ --allValAligns="None"
+ --suppressAlign="None"
+ --offbase="None"
+ --best="None"
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ --phased="None"
+ --offrate="None"
+ --mm="None"
+ --seed="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --dbkey=$dbkey
+ #else:
+ --dbkey="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --indexSettings=$refGenomeSource.indexParams.index_settings
+ #else:
+ --indexSettings="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history" and $refGenomeSource.indexParams.index_settings == "index_full":
+ --iauto_b=$refGenomeSource.indexParams.auto_behavior.auto_b
+ #if $refGenomeSource.indexParams.auto_behavior.auto_b == "set":
+ --ipacked=$refGenomeSource.indexParams.auto_behavior.packed
+ --ibmax=$refGenomeSource.indexParams.auto_behavior.bmax
+ --ibmaxdivn=$refGenomeSource.indexParams.auto_behavior.bmaxdivn
+ --idcv=$refGenomeSource.indexParams.auto_behavior.dcv
+ #else:
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ #end if
+ --inodc=$refGenomeSource.indexParams.nodc
+ --inoref=$refGenomeSource.indexParams.noref
+ --ioffrate=$refGenomeSource.indexParams.offrate
+ --iftab=$refGenomeSource.indexParams.ftab
+ --intoa=$refGenomeSource.indexParams.ntoa
+ --iendian=$refGenomeSource.indexParams.endian
+ --iseed=$refGenomeSource.indexParams.seed
+ --icutoff=$refGenomeSource.indexParams.cutoff
+ --ioldpmap=$refGenomeSource.indexParams.oldpmap
+ #else:
+ --iauto_b="None"
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ --inodc="None"
+ --inoref="None"
+ --ioffrate="None"
+ --iftab="None"
+ --intoa="None"
+ --iendian="None"
+ --iseed="None"
+ --icutoff="None"
+ --ioldpmap="None"
+ #end if
+ </command>
+ <inputs>
+ <conditional name="refGenomeSource">
+ <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+ <option value="indexed">Use a built-in index</option>
+ <option value="history">Use one from the history</option>
+ </param>
+ <when value="indexed">
+ <param name="indices" type="select" label="Select a reference genome">
+ <options from_file="bowtie_indices.loc">
+ <column name="value" index="1" />
+ <column name="name" index="0" />
+ <filter type="sort_by" column="0" />
+ </options>
+ </param>
+ </when>
+ <when value="history">
+ <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" />
+ <conditional name="indexParams">
+ <param name="index_settings" type="select" label="Choose whether to use default options or to set your own">
+ <option value="index_pre_set">Commonly Used</option>
+ <option value="index_full">Full Parameter List</option>
+ </param>
+ <when value="index_pre_set" />
+ <when value="index_full">
+ <conditional name="auto_behavior">
+ <param name="auto_b" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv">
+ <option value="auto">Automatic behavior</option>
+ <option value="set">Set values (sets --noauto and allows others to be set)</option>
+ </param>
+ <when value="auto" />
+ <when value="set">
+ <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)">
+ <option value="unpacked">Use regular representation</option>
+ <option value="packed">Use packed representation</option>
+ </param>
+ <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" />
+ <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" />
+ <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" />
+ </when>
+ </conditional>
+ <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetetive reference)">
+ <option value="dc">Use difference-cover sample</option>
+ <option value="nodc">Disable difference-cover sample</option>
+ </param>
+ <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)">
+ <option value="ref">Build all index files</option>
+ <option value="noref">Do not build paired-end alignment index files</option>
+ </param>
+ <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" />
+ <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" />
+ <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)">
+ <option value="no">Do not convert Ns</option>
+ <option value="yes">Convert Ns to As</option>
+ </param>
+ <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture">
+ <option value="little">Little</option>
+ <option value="big">Big</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" />
+ <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" />
+ <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't">
+ <option value="no">Use the new scheme</option>
+ <option value="yes">Use the old scheme</option>
+ </param>
+ </when> <!-- index_full -->
+ </conditional>
+ </when>
+ </conditional> <!-- refGenomeSource -->
+ <conditional name="singlePaired">
+ <param name="sPaired" type="select" label="Is this library mate-paired?">
+ <option value="single">Single-end</option>
+ <option value="paired">Paired-end</option>
+ </param>
+ <when value="single">
+ <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n reads (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)">
+ <option value="noPhased">Don't alternate</option>
+ <option value="doPhased">Do alternate</option>
+ </param>
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional> <!-- bestOption -->
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- single -->
+ <when value="paired">
+ <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
+ <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="BWA settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n pairs (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" />
+ <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" />
+ <param name="mateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
+ <option value="fr">FR (for Illumina)</option>
+ <option value="rf">RF</option>
+ <option value="ff">FF</option>
+ </param>
+ <param name="maxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" />
+ <param name="forwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)">
+ <option value="forward">Align against the forward reference strand</option>
+ <option value="noForward">Do not align against the forward reference strand</option>
+ </param>
+ <param name="reverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)">
+ <option value="reverse">Align against the reverse-complement reference strand</option>
+ <option value="noReverse">Do not align against the reverse-complement reference strand</option>
+ </param>
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional>
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- paired -->
+ </conditional> <!-- singlePaired -->
+ </inputs>
+ <outputs>
+ <data format="sam" name="output" />
+ </outputs>
+ <tests>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_pre_set" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_full" />
+ <param name="auto_b" value="set" />
+ <param name="packed" value="unpacked" />
+ <param name="bmax" value="-1" />
+ <param name="bmaxdivn" value="4" />
+ <param name="dcv" value="2048" />
+ <param name="nodc" value="dc" />
+ <param name="noref" value="noref" />
+ <param name="offrate" value="6" />
+ <param name="ftab" value="10" />
+ <param name="ntoa" value="yes" />
+ <param name="endian" value="little" />
+ <param name="seed" value="-1" />
+ <param name="cutoff" value="-1" />
+ <param name="oldpmap" value="no" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="full" />
+ <param name="skip" value="0" />
+ <param name="alignLimit" value="-1" />
+ <param name="trimL" value="0" />
+ <param name="trimH" value="0" />
+ <param name="mismatchSeed" value="3" />
+ <param name="mismatchQual" value="50" />
+ <param name="seedLen" value="10" />
+ <param name="rounding" value="round" />
+ <param name="maqSoapAlign" value="-1" />
+ <param name="minInsert" value="0" />
+ <param name="maxInsert" value="250" />
+ <param name="mateOrient" value="fr" />
+ <param name="maxAlignAttempt" value="100" />
+ <param name="forwardAlign" value="forward" />
+ <param name="reverseAlign" value="reverse" />
+ <param name="tryHard" value="doTryHard" />
+ <param name="valAlign" value="1" />
+ <param name="allValAligns" value="noAllValAligns" />
+ <param name="suppressAlign" value="-1" />
+ <param name="offbase" value="0" />
+ <param name="best" value="doBest" />
+ <param name="maxBacktracks" value="800" />
+ <param name="threadMem" value="32" />
+ <param name="strata" value="noStrata" />
+ <param name="offrate" value="-1" />
+ <param name="mm" value="noMm" />
+ <param name="seed" value="403" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ </tests>
+ <help>
+
+**What it does**
+
+Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool.
+
+.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
+
+------
+
+**Input formats**
+
+Bowtie accepts files in Sanger FASTQ format.
+
+------
+
+**Outputs**
+
+The output is in SAM format, and has the following columns::
+
+ 1 QNAME - Query (pair) NAME
+ 2 FLAG - bitwise FLAG
+ 3 RNAME - Reference sequence NAME
+ 4 POS - 1-based leftmost POSition/coordinate of clipped sequence
+ 5 MAPQ - MAPping Quality (Phred-scaled)
+ 6 CIGAR - extended CIGAR string
+ 7 MRNM - Mate Reference sequence NaMe ('=' if same as RNAME)
+ 8 MPOS - 1-based Mate POSition
+ 9 ISIZE - Inferred insert SIZE
+ 10 SEQ - query SEQuence on the same strand as the reference
+ 11 QUAL - query QUALity (ASCII-33 gives the Phred base quality)
+ 12 OPT - variable OPTional fields in the format TAG:VTYPE:VALU
+
+The flags are as follows::
+
+ Flag - Description
+ 0x0001 - the read is paired in sequencing
+ 0x0002 - the read is mapped in a proper pair
+ 0x0004 - the query sequence itself is unmapped
+ 0x0008 - the mate is unmapped
+ 0x0010 - strand of the query (1 for reverse)
+ 0x0020 - strand of the mate
+ 0x0040 - the read is the first read in a pair
+ 0x0080 - the read is the second read in a pair
+ 0x0100 - the alignment is not primary
+
+It looks like this (scroll sideways to see the entire example)::
+
+ QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT
+ HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh
+ HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh
+
+-------
+
+**Bowtie settings**
+
+All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here.
+
+------
+
+**Bowtie parameter list**
+
+This is an exhaustive list of Bowtie options:
+
+For indexing (bowtie-build)::
+ -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off]
+ -p Packing. Use a packed representation for DNA strings. [auto]
+ --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto]
+ --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4]
+ --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024]
+ --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off]
+ -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off]
+ -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5]
+ -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10]
+ --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off]
+ --big Endianness. Endianness to use when serializing integers to the index file. [off]
+ --little Endianness. [--little]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+ --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off]
+ --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off]
+
+For aligning (bowtie)::
+ -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off]
+ -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit]
+ -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0]
+ -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0]
+ -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2]
+ -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70]
+ -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28]
+ --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off]
+ -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off]
+ -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0]
+ --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr]
+ --rf Mate orientation. [off]
+ --ff Mate orientation. [off]
+ -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250]
+ --pairtries <int> Maximum alignment attempts for paired-end data. [100]
+ --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off]
+ --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off]
+ --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best]
+ -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off]
+ --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32]
+ -k <int> Valid alignments. The number of valid alignments per read or pair. [off]
+ -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off]
+ -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit]
+ --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off]
+ --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off]
+ -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0]
+ -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off]
+ -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off]
+ --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+
+ </help>
+</tool>
1
0
14 Sep '09
details: http://www.bx.psu.edu/hg/galaxy/rev/032478337b82
changeset: 2683:032478337b82
user: jeremy goecks <jeremy.goecks(a)emory.edu>
date: Fri Sep 11 14:57:02 2009 -0400
description:
(1) Unicode support for tagging and (2) added tagging_common mako file to support creation and standardization of tagging elements across all pages.
9 file(s) affected in this change:
lib/galaxy/web/controllers/history.py
lib/galaxy/web/controllers/tag.py
static/scripts/autocomplete_tagging.js
static/scripts/packed/autocomplete_tagging.js
templates/dataset/edit_attributes.mako
templates/history/grid.mako
templates/root/history.mako
templates/tagging_common.mako
tool_conf.xml.main
diffs (781 lines):
diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/history.py
--- a/lib/galaxy/web/controllers/history.py Fri Sep 11 09:00:36 2009 -0400
+++ b/lib/galaxy/web/controllers/history.py Fri Sep 11 14:57:02 2009 -0400
@@ -38,6 +38,17 @@
if item.users_shared_with or item.importable:
return dict( operation="sharing" )
return None
+ class TagsColumn( grids.GridColumn ):
+ def __init__(self, col_name):
+ grids.GridColumn.__init__(self, col_name)
+ self.tag_elt_id_gen = 0
+
+ def get_value( self, trans, grid, history ):
+ self.tag_elt_id_gen += 1
+ return trans.fill_template( "/tagging_common.mako", trans=trans,
+ tagged_item=history,
+ elt_id="tagging-elt" + str(self.tag_elt_id_gen) )
+
# Grid definition
title = "Stored histories"
model_class = model.History
@@ -48,6 +59,7 @@
link=( lambda item: iff( item.deleted, None, dict( operation="switch", id=item.id ) ) ),
attach_popup=True ),
DatasetsByStateColumn( "Datasets (by state)", ncells=4 ),
+ #TagsColumn( "Tags" ),
StatusColumn( "Status", attach_popup=False ),
grids.GridColumn( "Created", key="create_time", format=time_ago ),
grids.GridColumn( "Last Updated", key="update_time", format=time_ago ),
diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/tag.py
--- a/lib/galaxy/web/controllers/tag.py Fri Sep 11 09:00:36 2009 -0400
+++ b/lib/galaxy/web/controllers/tag.py Fri Sep 11 14:57:02 2009 -0400
@@ -4,7 +4,6 @@
from galaxy.model import History, HistoryTagAssociation, Dataset, DatasetTagAssociation, \
HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation, Page, PageTagAssociation
-
from galaxy.web.base.controller import *
from galaxy.tags.tag_handler import *
from sqlalchemy.sql.expression import func, and_
@@ -15,65 +14,68 @@
def __init__(self, app):
BaseController.__init__(self, app)
- # Set up dict for mapping from short-hand to full item class.
- self.shorthand_to_item_class_dict = dict()
- self.shorthand_to_item_class_dict["history"] = History
- self.shorthand_to_item_class_dict["hda"] = HistoryDatasetAssociation
+ # Keep a list of taggable classes.
+ self.taggable_classes = dict()
+ self.taggable_classes[History.__name__] = History
+ self.taggable_classes[HistoryDatasetAssociation.__name__] = HistoryDatasetAssociation
+ self.taggable_classes[Page.__name__] = Page
- # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, ...
+ # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, Page, ...
self.tag_handler = TagHandler()
self.tag_handler.add_tag_assoc_class(History, HistoryTagAssociation)
self.tag_handler.add_tag_assoc_class(HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation)
-
+ self.tag_handler.add_tag_assoc_class(Page, PageTagAssociation)
+
@web.expose
- def add_tag_async( self, trans, id=None, item_type=None, new_tag=None ):
+ @web.require_login( "Add tag to an item." )
+ def add_tag_async( self, trans, id=None, item_class=None, new_tag=None ):
""" Add tag to an item. """
- item = self._get_item(trans, item_type, trans.security.decode_id(id))
+ item = self._get_item(trans, item_class, trans.security.decode_id(id))
self._do_security_check(trans, item)
- self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag)
+ self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tag).encode('utf-8') )
trans.sa_session.flush()
@web.expose
- def remove_tag_async( self, trans, id=None, item_type=None, tag_name=None ):
+ @web.require_login( "Remove tag from an item." )
+ def remove_tag_async( self, trans, id=None, item_class=None, tag_name=None ):
""" Remove tag from an item. """
- item = self._get_item(trans, item_type, trans.security.decode_id(id))
+ item = self._get_item(trans, item_class, trans.security.decode_id(id))
self._do_security_check(trans, item)
- self.tag_handler.remove_item_tag(item, tag_name)
+ self.tag_handler.remove_item_tag( item, unicode(tag_name).encode('utf-8') )
+ #print tag_name
+ #print unicode(tag_name)
trans.sa_session.flush()
# Retag an item. All previous tags are deleted and new tags are applied.
@web.expose
- def retag_async( self, trans, id=None, item_type=None, new_tags=None ):
+ @web.require_login( "Apply a new set of tags to an item; previous tags are deleted." )
+ def retag_async( self, trans, id=None, item_class=None, new_tags=None ):
""" Apply a new set of tags to an item; previous tags are deleted. """
- item = self._get_item(trans, item_type, trans.security.decode_id(id))
+ item = self._get_item(trans, item_class, trans.security.decode_id(id))
self._do_security_check(trans, item)
tag_handler.delete_item_tags(item)
- self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag)
+ self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tags).encode('utf-8') )
trans.sa_session.flush()
-
- tag_handler.delete_item_tags(history)
- tag_handler.apply_item_tags(trans.sa_session, history, new_tags)
- # Flush to complete changes.
- trans.sa_session.flush()
-
+
@web.expose
@web.require_login( "get autocomplete data for an item's tags" )
- def tag_autocomplete_data(self, trans, id=None, item_type=None, q=None, limit=None, timestamp=None):
+ def tag_autocomplete_data(self, trans, id=None, item_class=None, q=None, limit=None, timestamp=None):
""" Get autocomplete data for an item's tags. """
#
# Get item, do security check, and get autocomplete data.
#
- item = self._get_item(trans, item_type, trans.security.decode_id(id))
+ item = self._get_item(trans, item_class, trans.security.decode_id(id))
self._do_security_check(trans, item)
+ q = unicode(q).encode('utf-8')
if q.find(":") == -1:
return self._get_tag_autocomplete_names(trans, item, q, limit, timestamp)
else:
@@ -184,9 +186,9 @@
# Use the user_id associated with the HDA's history.
return History.table.c.user_id
- def _get_item(self, trans, item_type, id):
+ def _get_item(self, trans, item_class_name, id):
""" Get an item based on type and id. """
- item_class = self.shorthand_to_item_class_dict[item_type]
+ item_class = self.taggable_classes[item_class_name]
item = trans.sa_session.query(item_class).filter("id=" + str(id))[0]
return item;
diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/autocomplete_tagging.js
--- a/static/scripts/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400
+++ b/static/scripts/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400
@@ -187,13 +187,14 @@
// Tag button is image's parent.
var tag_button = $(this).parent();
- // Get tag name.
+ // Get tag name, value.
var tag_name_elt = tag_button.find(".tag-name").eq(0);
var tag_str = tag_name_elt.text();
- var tag_name = get_tag_name_and_value(tag_str)[0];
+ var tag_name_and_value = get_tag_name_and_value(tag_str);
+ var tag_name = tag_name_and_value[0];
+ var tag_value = tag_name_and_value[1];
- // TODO: should remove succeed if tag is not already applied to
- // history?
+ var prev_button = tag_button.prev();
tag_button.remove();
// Remove tag from local list for consistency.
@@ -209,12 +210,28 @@
data: { tag_name: tag_name },
error: function()
{
- // Failed.
- alert( "Remove tag failed" );
+ // Failed. Roll back changes and show alert.
+ settings.tags[tag_name] = tag_value;
+ if (prev_button.hasClass("tag-button"))
+ prev_button.after(tag_button);
+ else
+ tag_area.prepend(tag_button);
+ var new_text = settings.get_toggle_link_text_fn(settings.tags);
+ alert( "Remove tag failed" );
+
+ toggle_link.text(new_text);
+
+ // TODO: no idea why it's necessary to set this up again.
+ delete_img.mouseenter( function ()
+ {
+ $(this).attr("src", settings.delete_tag_img_rollover);
+ });
+ delete_img.mouseleave( function ()
+ {
+ $(this).attr("src", settings.delete_tag_img);
+ });
},
- success: function()
- {
- }
+ success: function() {}
});
return true;
@@ -323,8 +340,9 @@
data: { new_tag: new_value },
error: function()
{
- // Remove tag and show alert.
+ // Failed. Roll back changes and show alert.
new_tag_button.remove();
+ delete settings.tags[tag_name_and_value[0]];
var new_text = settings.get_toggle_link_text_fn(settings.tags);
toggle_link.text(new_text);
alert( "Add tag failed" );
diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/packed/autocomplete_tagging.js
--- a/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400
+++ b/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400
@@ -1,1 +1,1 @@
-var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b();
if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var B=$(this).parent();var A=B.find(".tag-name").eq(0);var z=A.text();var C=h(z)[0];B.remove();delete p.tags[C];var y=p.get_toggle_link_text_fn(p.tags);s.text(y);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:C},error:function(){alert("Remove tag failed")},success:function(){}});return true});var w=$("<span>"+u+"
</span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){this.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag
-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClas
s("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")};
\ No newline at end of file
+var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b();
if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var D=$(this).parent();var C=D.find(".tag-name").eq(0);var B=C.text();var z=h(B);var F=z[0];var y=z[1];var E=D.prev();D.remove();delete p.tags[F];var A=p.get_toggle_link_text_fn(p.tags);s.text(A);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:F},error:function(){p.tags[F]=y;if(E.hasClass("tag-button")){E.after(D)
}else{m.prepend(D)}var G=p.get_toggle_link_text_fn(p.tags);alert("Remove tag failed");s.text(G);v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)})},success:function(){}});return true});var w=$("<span>"+u+"</span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){thi
s.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();delete p.tags[y[0]];var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input
");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClass("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")};
\ No newline at end of file
diff -r ed4cbaf23c88 -r 032478337b82 templates/dataset/edit_attributes.mako
--- a/templates/dataset/edit_attributes.mako Fri Sep 11 09:00:36 2009 -0400
+++ b/templates/dataset/edit_attributes.mako Fri Sep 11 14:57:02 2009 -0400
@@ -9,43 +9,8 @@
<% user, user_roles = trans.get_user_and_roles() %>
<%def name="javascripts()">
- ## <!--[if lt IE 7]>
- ## <script type='text/javascript' src="/static/scripts/IE7.js"> </script>
- ## <![endif]-->
- ${h.js( "jquery", "galaxy.base", "jquery.autocomplete", "autocomplete_tagging" )}
- <script type="text/javascript">
- $( document ).ready( function() {
- // Set up autocomplete tagger.
-<%
- ## Build string of tag name, values.
- tag_names_and_values = list()
- for tag in data.tags:
- tag_name = tag.user_tname
- tag_value = ""
- if tag.value is not None:
- tag_value = tag.user_value
- tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"")
-%>
- var options = {
- tags : {${", ".join(tag_names_and_values)}},
- tag_click_fn: function(tag) { /* Do nothing. */ },
- use_toggle_link: false,
- input_size: 30,
- in_form: true,
- <% encoded_data_id = trans.security.encode_id(data.id) %>
- ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_data_id, item_type="hda" )}",
- ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_data_id, item_type="hda" )}",
- ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_data_id, item_type="hda" )}",
- delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}",
- delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}",
- add_tag_img: "${h.url_for('/static/images/add_icon.png')}",
- add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}",
- };
-% if trans.get_user() is not None:
- $("#dataset-tag-area").autocomplete_tagging(options);
-% endif
-});
- </script>
+ ${parent.javascripts()}
+ ${h.js( "jquery.autocomplete", "autocomplete_tagging" )}
</%def>
<%def name="datatype( dataset, datatypes )">
@@ -84,16 +49,18 @@
<div style="clear: both"></div>
</div>
%if trans.get_user() is not None:
- <div class="form-row">
- <label>
- Tags:
- </label>
- <div id="dataset-tag-area"
+ <%namespace file="../tagging_common.mako" import="render_tagging_element" />
+ <div class="form-row">
+ <label>
+ Tags:
+ </label>
+ <div id="dataset-tag-area"
style="float: left; margin-left: 1px; width: 295px; margin-right: 10px; border-style: inset; border-color: #ddd; border-width: 1px">
- </div>
- <div style="clear: both"></div>
- </div>
- %endif
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ ${render_tagging_element(data, "dataset-tag-area", use_toggle_link="false", in_form="true", input_size="30")}
+ %endif
%for name, spec in data.metadata.spec.items():
%if spec.visible:
<div class="form-row">
diff -r ed4cbaf23c88 -r 032478337b82 templates/history/grid.mako
--- a/templates/history/grid.mako Fri Sep 11 09:00:36 2009 -0400
+++ b/templates/history/grid.mako Fri Sep 11 14:57:02 2009 -0400
@@ -10,6 +10,7 @@
<%def name="javascripts()">
${parent.javascripts()}
+ ${h.js("jquery.autocomplete", "autocomplete_tagging" )}
<script type="text/javascript">
## TODO: generalize and move into galaxy.base.js
$(document).ready(function() {
@@ -58,7 +59,7 @@
</%def>
<%def name="stylesheets()">
- <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" />
+ ${h.css( "base", "autocomplete_tagging" )}
<style>
## Not generic to all grids -- move to base?
.count-box {
diff -r ed4cbaf23c88 -r 032478337b82 templates/root/history.mako
--- a/templates/root/history.mako Fri Sep 11 09:00:36 2009 -0400
+++ b/templates/root/history.mako Fri Sep 11 14:57:02 2009 -0400
@@ -77,83 +77,6 @@
<% updateable = [data for data in reversed( datasets ) if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]] %>
${ ",".join( map(lambda data: "\"%s\" : \"%s\"" % (data.id, data.state), updateable) ) }
});
-
- // Set up autocomplete tagger.
-<%
- ## Build string of tag name, values.
- tag_names_and_values = list()
- for tag in history.tags:
- tag_name = tag.user_tname
- tag_value = ""
- if tag.value is not None:
- tag_value = tag.user_value
- tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"")
-%>
- // Returns the number of keys (elements) in an array/dictionary.
- var array_length = function(an_array)
- {
- if (an_array.length)
- return an_array.length;
-
- var count = 0;
- for (element in an_array)
- count++;
- return count;
- };
-
- // Function get text to display on the toggle link.
- var get_toggle_link_text = function(tags)
- {
- var text = "";
- var num_tags = array_length(tags);
- if (num_tags != 0) {
- text = num_tags + (num_tags != 1 ? " Tags" : " Tag");
- /*
- // Show first N tags; hide the rest.
- var max_to_show = 1;
-
- // Build tag string.
- var tag_strs = new Array();
- var count = 0;
- for (tag_name in tags)
- {
- tag_value = tags[tag_name];
- tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value);
- if (++count == max_to_show)
- break;
- }
- tag_str = tag_strs.join(", ");
-
- // Finalize text.
- var num_tags_hiding = num_tags - max_to_show;
- text = "Tags: " + tag_str +
- (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : "");
- */
- } else {
- // No tags.
- text = "Add tags to this history";
- }
- return text;
- };
-
- var options = {
- tags : {${", ".join(tag_names_and_values)}},
- get_toggle_link_text_fn: get_toggle_link_text,
- input_size: 15,
- tag_click_fn: function(tag) { /* Do nothing. */ },
- <% encoded_history_id = trans.security.encode_id(history.id) %>
- ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_history_id, item_type="history" )}",
- ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_history_id, item_type="history" )}",
- ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_history_id, item_type="history" )}",
- delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}",
- delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}",
- add_tag_img: "${h.url_for('/static/images/add_icon.png')}",
- add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}",
- };
-% if trans.get_user() is not None:
- $("#history-tag-area").autocomplete_tagging(options);
-% endif
-
});
// Functionized so AJAX'd datasets can call them
function initShowHide() {
@@ -361,7 +284,13 @@
<div id="history-tag-area" style="margin-bottom: 1em">
</div>
+<%namespace file="../tagging_common.mako" import="render_tagging_element" />
<%namespace file="history_common.mako" import="render_dataset" />
+
+%if trans.get_user() is not None:
+ <div id='history-tag-area' class="tag-element"></div>
+ ${render_tagging_element(history, "history-tag-area")}
+%endif
%if not datasets:
diff -r ed4cbaf23c88 -r 032478337b82 templates/tagging_common.mako
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/templates/tagging_common.mako Fri Sep 11 14:57:02 2009 -0400
@@ -0,0 +1,92 @@
+## Render the tags 'tags' as an autocomplete element.
+<%def name="render_tagging_element(tagged_item, elt_id, use_toggle_link='true', in_form='false', input_size='15')">
+ <script type="text/javascript">
+
+ //
+ // Set up autocomplete tagger.
+ //
+ <%
+ ## Build string of tag name, values.
+ tag_names_and_values = list()
+ for tag in tagged_item.tags:
+ tag_name = tag.user_tname
+ tag_value = ""
+ if tag.value is not None:
+ tag_value = tag.user_value
+ tag_names_and_values.append( ("\"" + tag_name + "\" : \"" + tag_value + "\"") )
+ %>
+ //
+ // Returns the number of keys (elements) in an array/dictionary.
+ //
+ var array_length = function(an_array)
+ {
+ if (an_array.length)
+ return an_array.length;
+
+ var count = 0;
+ for (element in an_array)
+ count++;
+ return count;
+ };
+
+ //
+ // Function get text to display on the toggle link.
+ //
+ var get_toggle_link_text = function(tags)
+ {
+ var text = "";
+ var num_tags = array_length(tags);
+ if (num_tags != 0)
+ {
+ text = num_tags + (num_tags != 1 ? " Tags" : " Tag");
+ /*
+ // Show first N tags; hide the rest.
+ var max_to_show = 1;
+
+ // Build tag string.
+ var tag_strs = new Array();
+ var count = 0;
+ for (tag_name in tags)
+ {
+ tag_value = tags[tag_name];
+ tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value);
+ if (++count == max_to_show)
+ break;
+ }
+ tag_str = tag_strs.join(", ");
+
+ // Finalize text.
+ var num_tags_hiding = num_tags - max_to_show;
+ text = "Tags: " + tag_str +
+ (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : "");
+ */
+ }
+ else
+ {
+ // No tags.
+ text = "Add tags to history";
+ }
+ return text;
+ };
+
+ var options =
+ {
+ tags : {${unicode(", ".join(tag_names_and_values), 'utf-8')}},
+ get_toggle_link_text_fn: get_toggle_link_text,
+ tag_click_fn: function(tag) { /* Do nothing. */ },
+ <% tagged_item_id = trans.security.encode_id(tagged_item.id) %>
+ ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}",
+ ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}",
+ ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}",
+ delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}",
+ delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}",
+ add_tag_img: "${h.url_for('/static/images/add_icon.png')}",
+ add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}",
+ input_size: ${input_size},
+ in_form: ${in_form},
+ use_toggle_link: ${use_toggle_link}
+ };
+
+ $("#${elt_id}").autocomplete_tagging(options)
+ </script>
+</%def>
\ No newline at end of file
diff -r ed4cbaf23c88 -r 032478337b82 tool_conf.xml.main
--- a/tool_conf.xml.main Fri Sep 11 09:00:36 2009 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,263 +0,0 @@
-<?xml version="1.0"?>
-<toolbox>
- <section name="Get Data" id="getext">
- <tool file="data_source/upload.xml"/>
- <tool file="data_source/ucsc_tablebrowser.xml" />
- <tool file="data_source/ucsc_tablebrowser_archaea.xml" />
- <tool file="data_source/microbial_import.xml" />
- <tool file="data_source/biomart.xml" />
- <tool file="data_source/gramene_mart.xml" />
- <tool file="data_source/flymine.xml" />
- <tool file="data_source/encode_db.xml" />
- <tool file="data_source/epigraph_import.xml" />
- </section>
- <section name="Send Data" id="send">
- <tool file="data_destination/epigraph.xml" />
- </section>
- <section name="ENCODE Tools" id="EncodeTools">
- <tool file="encode/gencode_partition.xml" />
- <tool file="encode/random_intervals.xml" />
- </section>
- <section name="Lift-Over" id="liftOver">
- <tool file="extract/liftOver_wrapper.xml" />
- </section>
- <section name="Text Manipulation" id="textutil">
- <tool file="filters/fixedValueColumn.xml" />
- <tool file="stats/column_maker.xml" />
- <tool file="filters/catWrapper.xml" />
- <tool file="filters/condense_characters.xml" />
- <tool file="filters/convert_characters.xml" />
- <tool file="filters/CreateInterval.xml" />
- <tool file="filters/cutWrapper.xml" />
- <tool file="filters/changeCase.xml" />
- <tool file="filters/pasteWrapper.xml" />
- <tool file="filters/remove_beginning.xml" />
- <tool file="filters/headWrapper.xml" />
- <tool file="filters/tailWrapper.xml" />
- </section>
- <section name="Convert Formats" id="convert">
- <tool file="filters/bed2gff.xml" />
- <tool file="fasta_tools/fasta_to_tabular.xml" />
- <tool file="filters/gff2bed.xml" />
- <tool file="maf/maf_to_bed.xml" />
- <tool file="maf/maf_to_fasta.xml" />
- <tool file="fasta_tools/tabular_to_fasta.xml" />
- </section>
- <section name="FASTA manipulation" id="fasta_manipulation">
- <tool file="fasta_tools/fasta_compute_length.xml" />
- <tool file="fasta_tools/fasta_filter_by_length.xml" />
- <tool file="fasta_tools/fasta_concatenate_by_species.xml" />
- <tool file="fasta_tools/fasta_to_tabular.xml" />
- <tool file="fasta_tools/tabular_to_fasta.xml" />
- </section>
- <section name="Filter and Sort" id="filter">
- <tool file="stats/filtering.xml" />
- <tool file="filters/sorter.xml" />
- <tool file="filters/grep.xml" />
- </section>
- <section name="Join, Subtract and Group" id="group">
- <tool file="filters/joiner.xml" />
- <tool file="filters/compare.xml"/>
- <tool file="new_operations/subtract_query.xml"/>
- <tool file="stats/grouping.xml" />
- </section>
- <section name="Extract Features" id="features">
- <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" />
- <tool file="extract/extract_GFF_Features.xml" />
- </section>
- <section name="Fetch Sequences" id="fetchSeq">
- <tool file="extract/extract_genomic_dna.xml" />
- </section>
- <section name="Fetch Alignments" id="fetchAlign">
- <tool file="maf/interval2maf_pairwise.xml" />
- <tool file="maf/interval2maf.xml" />
- <tool file="maf/interval_maf_to_merged_fasta.xml" />
- <tool file="maf/genebed_maf_to_fasta.xml"/>
- <tool file="maf/maf_stats.xml"/>
- <tool file="maf/maf_thread_for_species.xml"/>
- <tool file="maf/maf_limit_to_species.xml"/>
- <tool file="maf/maf_limit_size.xml"/>
- <tool file="maf/maf_by_block_number.xml"/>
- <tool file="maf/maf_filter.xml"/>
- <!--
- <tool file="maf/maf_reverse_complement.xml"/>
- -->
- </section>
- <section name="Get Genomic Scores" id="scores">
- <tool file="stats/wiggle_to_simple.xml" />
- <tool file="stats/aggregate_binned_scores_in_intervals.xml" />
- <tool file="extract/phastOdds/phastOdds_tool.xml" />
- </section>
- <section name="Operate on Genomic Intervals" id="bxops">
- <tool file="new_operations/intersect.xml" />
- <tool file="new_operations/subtract.xml" />
- <tool file="new_operations/merge.xml" />
- <tool file="new_operations/concat.xml" />
- <tool file="new_operations/basecoverage.xml" />
- <tool file="new_operations/coverage.xml" />
- <tool file="new_operations/complement.xml" />
- <tool file="new_operations/cluster.xml" id="cluster" />
- <tool file="new_operations/join.xml" />
- <tool file="new_operations/get_flanks.xml" />
- <tool file="new_operations/flanking_features.xml" />
- <tool file="annotation_profiler/annotation_profiler.xml" />
- </section>
- <section name="Statistics" id="stats">
- <tool file="stats/gsummary.xml" />
- <tool file="filters/uniq.xml" />
- <tool file="stats/cor.xml" />
- </section>
- <section name="Graph/Display Data" id="plots">
- <tool file="plotting/histogram2.xml" />
- <tool file="plotting/scatterplot.xml" />
- <tool file="plotting/xy_plot.xml" />
- <tool file="visualization/GMAJ.xml" />
- <tool file="visualization/build_ucsc_custom_track.xml" />
- </section>
- <section name="Regional Variation" id="regVar">
- <tool file="regVariation/windowSplitter.xml" />
- <tool file="regVariation/featureCounter.xml" />
- <tool file="regVariation/quality_filter.xml" />
- <tool file="regVariation/maf_cpg_filter.xml" />
- <tool file="regVariation/getIndels_2way.xml" />
- <tool file="regVariation/getIndels_3way.xml" />
- <tool file="regVariation/getIndelRates_3way.xml" />
- <tool file="regVariation/substitutions.xml" />
- <tool file="regVariation/substitution_rates.xml" />
- <tool file="regVariation/microsats_alignment_level.xml" />
- <tool file="regVariation/microsats_mutability.xml" />
- </section>
- <section name="Multiple regression" id="multReg">
- <tool file="regVariation/linear_regression.xml" />
- <tool file="regVariation/best_regression_subsets.xml" />
- <tool file="regVariation/rcve.xml" />
- </section>
- <section name="Evolution: HyPhy" id="hyphy">
- <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" />
- <tool file="hyphy/hyphy_nj_tree_wrapper.xml" />
- <tool file="hyphy/hyphy_dnds_wrapper.xml" />
- </section>
- <section name="Metagenomic analyses" id="tax_manipulation">
- <tool file="taxonomy/gi2taxonomy.xml" />
- <tool file="taxonomy/t2t_report.xml" />
- <tool file="taxonomy/t2ps_wrapper.xml" />
- <tool file="taxonomy/find_diag_hits.xml" />
- <tool file="taxonomy/lca.xml" />
- <tool file="taxonomy/poisson2test.xml" />
- </section>
- <section name="Short Read Analysis" id="short_read_analysis">
- <tool file="metag_tools/short_reads_figure_score.xml" />
- <tool file="metag_tools/short_reads_trim_seq.xml" />
- <tool file="metag_tools/megablast_wrapper.xml" />
- <tool file="metag_tools/megablast_xml_parser.xml" />
- </section>
- <section name="EMBOSS" id="EMBOSSLite">
- <tool file="emboss_5/emboss_antigenic.xml" />
- <tool file="emboss_5/emboss_backtranseq.xml" />
- <tool file="emboss_5/emboss_banana.xml" />
- <tool file="emboss_5/emboss_biosed.xml" />
- <tool file="emboss_5/emboss_btwisted.xml" />
- <tool file="emboss_5/emboss_cai_custom.xml" />
- <tool file="emboss_5/emboss_cai.xml" />
- <tool file="emboss_5/emboss_chaos.xml" />
- <tool file="emboss_5/emboss_charge.xml" />
- <tool file="emboss_5/emboss_checktrans.xml" />
- <tool file="emboss_5/emboss_chips.xml" />
- <tool file="emboss_5/emboss_cirdna.xml" />
- <tool file="emboss_5/emboss_codcmp.xml" />
- <tool file="emboss_5/emboss_coderet.xml" />
- <tool file="emboss_5/emboss_compseq.xml" />
- <tool file="emboss_5/emboss_cpgplot.xml" />
- <tool file="emboss_5/emboss_cpgreport.xml" />
- <tool file="emboss_5/emboss_cusp.xml" />
- <tool file="emboss_5/emboss_cutseq.xml" />
- <tool file="emboss_5/emboss_dan.xml" />
- <tool file="emboss_5/emboss_degapseq.xml" />
- <tool file="emboss_5/emboss_descseq.xml" />
- <tool file="emboss_5/emboss_diffseq.xml" />
- <tool file="emboss_5/emboss_digest.xml" />
- <tool file="emboss_5/emboss_dotmatcher.xml" />
- <tool file="emboss_5/emboss_dotpath.xml" />
- <tool file="emboss_5/emboss_dottup.xml" />
- <tool file="emboss_5/emboss_dreg.xml" />
- <tool file="emboss_5/emboss_einverted.xml" />
- <tool file="emboss_5/emboss_epestfind.xml" />
- <tool file="emboss_5/emboss_equicktandem.xml" />
- <tool file="emboss_5/emboss_est2genome.xml" />
- <tool file="emboss_5/emboss_etandem.xml" />
- <tool file="emboss_5/emboss_extractfeat.xml" />
- <tool file="emboss_5/emboss_extractseq.xml" />
- <tool file="emboss_5/emboss_freak.xml" />
- <tool file="emboss_5/emboss_fuzznuc.xml" />
- <tool file="emboss_5/emboss_fuzzpro.xml" />
- <tool file="emboss_5/emboss_fuzztran.xml" />
- <tool file="emboss_5/emboss_garnier.xml" />
- <tool file="emboss_5/emboss_geecee.xml" />
- <tool file="emboss_5/emboss_getorf.xml" />
- <tool file="emboss_5/emboss_helixturnhelix.xml" />
- <tool file="emboss_5/emboss_hmoment.xml" />
- <tool file="emboss_5/emboss_iep.xml" />
- <tool file="emboss_5/emboss_infoseq.xml" />
- <tool file="emboss_5/emboss_isochore.xml" />
- <tool file="emboss_5/emboss_lindna.xml" />
- <tool file="emboss_5/emboss_marscan.xml" />
- <tool file="emboss_5/emboss_maskfeat.xml" />
- <tool file="emboss_5/emboss_maskseq.xml" />
- <tool file="emboss_5/emboss_matcher.xml" />
- <tool file="emboss_5/emboss_megamerger.xml" />
- <tool file="emboss_5/emboss_merger.xml" />
- <tool file="emboss_5/emboss_msbar.xml" />
- <tool file="emboss_5/emboss_needle.xml" />
- <tool file="emboss_5/emboss_newcpgreport.xml" />
- <tool file="emboss_5/emboss_newcpgseek.xml" />
- <tool file="emboss_5/emboss_newseq.xml" />
- <tool file="emboss_5/emboss_noreturn.xml" />
- <tool file="emboss_5/emboss_notseq.xml" />
- <tool file="emboss_5/emboss_nthseq.xml" />
- <tool file="emboss_5/emboss_octanol.xml" />
- <tool file="emboss_5/emboss_oddcomp.xml" />
- <tool file="emboss_5/emboss_palindrome.xml" />
- <tool file="emboss_5/emboss_pasteseq.xml" />
- <tool file="emboss_5/emboss_patmatdb.xml" />
- <tool file="emboss_5/emboss_pepcoil.xml" />
- <tool file="emboss_5/emboss_pepinfo.xml" />
- <tool file="emboss_5/emboss_pepnet.xml" />
- <tool file="emboss_5/emboss_pepstats.xml" />
- <tool file="emboss_5/emboss_pepwheel.xml" />
- <tool file="emboss_5/emboss_pepwindow.xml" />
- <tool file="emboss_5/emboss_pepwindowall.xml" />
- <tool file="emboss_5/emboss_plotcon.xml" />
- <tool file="emboss_5/emboss_plotorf.xml" />
- <tool file="emboss_5/emboss_polydot.xml" />
- <tool file="emboss_5/emboss_preg.xml" />
- <tool file="emboss_5/emboss_prettyplot.xml" />
- <tool file="emboss_5/emboss_prettyseq.xml" />
- <tool file="emboss_5/emboss_primersearch.xml" />
- <tool file="emboss_5/emboss_revseq.xml" />
- <tool file="emboss_5/emboss_seqmatchall.xml" />
- <tool file="emboss_5/emboss_seqret.xml" />
- <tool file="emboss_5/emboss_showfeat.xml" />
- <tool file="emboss_5/emboss_shuffleseq.xml" />
- <tool file="emboss_5/emboss_sigcleave.xml" />
- <tool file="emboss_5/emboss_sirna.xml" />
- <tool file="emboss_5/emboss_sixpack.xml" />
- <tool file="emboss_5/emboss_skipseq.xml" />
- <tool file="emboss_5/emboss_splitter.xml" />
- <tool file="emboss_5/emboss_supermatcher.xml" />
- <tool file="emboss_5/emboss_syco.xml" />
- <tool file="emboss_5/emboss_tcode.xml" />
- <tool file="emboss_5/emboss_textsearch.xml" />
- <tool file="emboss_5/emboss_tmap.xml" />
- <tool file="emboss_5/emboss_tranalign.xml" />
- <tool file="emboss_5/emboss_transeq.xml" />
- <tool file="emboss_5/emboss_trimest.xml" />
- <tool file="emboss_5/emboss_trimseq.xml" />
- <tool file="emboss_5/emboss_twofeat.xml" />
- <tool file="emboss_5/emboss_union.xml" />
- <tool file="emboss_5/emboss_vectorstrip.xml" />
- <tool file="emboss_5/emboss_water.xml" />
- <tool file="emboss_5/emboss_wobble.xml" />
- <tool file="emboss_5/emboss_wordcount.xml" />
- <tool file="emboss_5/emboss_wordmatch.xml" />
- </section>
-</toolbox>
1
0
details: http://www.bx.psu.edu/hg/galaxy/rev/a7b1304e736f
changeset: 2682:a7b1304e736f
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Fri Sep 11 14:38:05 2009 -0400
description:
Added Bowtie wrapper tool
9 file(s) affected in this change:
test-data/bowtie_in1.fastq
test-data/bowtie_in2.fastq
test-data/bowtie_in3.fastq
test-data/bowtie_out1.sam
test-data/bowtie_out2.sam
tool-data/bowtie_indices.loc.sample
tool_conf.xml.sample
tools/sr_mapping/bowtie_wrapper.py
tools/sr_mapping/bowtie_wrapper.xml
diffs (819 lines):
diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in1.fastq Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,5 @@
+@HWI-EAS91_1_30788AAXX:1:1:1513:715/1
+GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG
++/1
+IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I
+
diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in2.fastq Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/1
+TAGACTACGAAAGTGACTTTAATACCTCTGACTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3
diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in3.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in3.fastq Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/2
+ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG
++
+IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2)
diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_out1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out1.sam Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,1 @@
+HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_out2.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out2.sam Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,2 @@
+HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36
+HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18
diff -r e7b899fb4462 -r a7b1304e736f tool-data/bowtie_indices.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/bowtie_indices.loc.sample Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,28 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Bowtie indexed sequences data files. You will need
+#to create these data files and then create a bowtie_indices.loc file
+#similar to this one (store it in this directory ) that points to
+#the directories in which those files are stored. The bowtie_indices.loc
+#file has this format (white space characters are TAB characters):
+#
+#<build> <file_base>
+#
+#So, for example, if you had hg18 indexed stored in
+#/depot/data2/galaxy/bowtie/hg18/,
+#then the bowtie_indices.loc entry would look like this:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
+#
+#and your /depot/data2/galaxy/bowtie/hg18/ directory
+#would contain hg18.*.ebwt files:
+#
+#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt
+#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt
+#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt
+#...etc...
+#
+#Your bowtie_indices.loc file should include an entry per line for
+#each index set you have stored. The "file" in the path does not actually
+#exist, but it is the prefix for the actual index files. For example:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
diff -r e7b899fb4462 -r a7b1304e736f tool_conf.xml.sample
--- a/tool_conf.xml.sample Fri Sep 11 12:48:33 2009 -0400
+++ b/tool_conf.xml.sample Fri Sep 11 14:38:05 2009 -0400
@@ -332,7 +332,8 @@
<tool file="metag_tools/megablast_xml_parser.xml" />
<tool file="metag_tools/blat_wrapper.xml" />
<tool file="metag_tools/mapping_to_ucsc.xml" />
- </section>
+ <tool file="sr_mapping/bowtie_wrapper.xml" />
+ </section>
<section name="Tracks" id="tracks">
<tool file="visualization/genetrack.xml" />
</section>
diff -r e7b899fb4462 -r a7b1304e736f tools/sr_mapping/bowtie_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.py Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,174 @@
+#! /usr/bin/python
+
+"""
+Runs Bowtie on single-end or paired-end data.
+"""
+
+import optparse, os, sys, tempfile
+
+def stop_err( msg ):
+ sys.stderr.write( "%s\n" % msg )
+ sys.exit()
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format')
+ parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format')
+ parser.add_option('', '--output', dest='output', help='The output file')
+ parser.add_option('', '--paired', dest='paired', help='Whether the data is single- or paired-end')
+ parser.add_option('', '--genomeSource', dest='genomeSource', help='The type of reference provided')
+ parser.add_option('', '--ref', dest='ref', help='The reference genome to use or index')
+ parser.add_option('', '--skip', dest='skip', help='Skip the first n reads')
+ parser.add_option('', '--alignLimit', dest='alignLimit', help='Only align the first n reads')
+ parser.add_option('', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment')
+ parser.add_option('', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment')
+ parser.add_option('', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed')
+ parser.add_option('', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions')
+ parser.add_option('', '--seedLen', dest='seedLen', help='Seed length')
+ parser.add_option('', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30')
+ parser.add_option('', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy')
+ parser.add_option('', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist')
+ parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read')
+ parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read')
+ parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist')
+ parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments')
+ parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions")
+ parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read')
+ parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode')
+ parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable')
+ parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments')
+ parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments')
+ parser.add_option('', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand')
+ parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate')
+ parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand')
+ parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand')
+ parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time')
+ parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n')
+ parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index')
+ parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator')
+ parser.add_option('', '--dbkey', dest='dbkey', help='')
+ parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters')
+ parser.add_option('', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior')
+ parser.add_option('', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings')
+ parser.add_option('', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block')
+ parser.add_option('', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference')
+ parser.add_option('', '--idcv', dest='idcv', help='The period for the difference-cover sample')
+ parser.add_option('', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample')
+ parser.add_option('', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paried-end alignment')
+ parser.add_option('', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows')
+ parser.add_option('', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query')
+ parser.add_option('', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As')
+ parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file')
+ parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator')
+ parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index')
+ parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8')
+ parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set')
+ (options, args) = parser.parse_args()
+
+ # index if necessary
+ if options.genomeSource == 'history':
+ # set up commands
+ if options.index_settings =='index_pre_set':
+ indexing_cmds = ''
+ else:
+ try:
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ (('','--noauto')[options.iauto_b=='set'],
+ ('','--packed')[options.ipacked=='packed'],
+ ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1],
+ ('','--bmaxdivn %s'%options.ibmaxdivn)[options.ibmaxdivn!='None'],
+ ('','--dcv %s'%options.idcv)[options.idcv!='None'],
+ ('','--nodc')[options.inodc=='nodc'],
+ ('','--noref')[options.inoref=='noref'], options.ioffrate,
+ ('','--ftabchars %s'%options.iftab)[int(options.iftab)>=0],
+ ('','--ntoa')[options.intoa=='yes'],
+ ('--little','--big')[options.iendian=='big'],
+ ('','--seed %s'%options.iseed)[int(options.iseed)>0],
+ ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0],
+ ('','--oldpmap')[options.ioldpmap=='yes'])
+ except ValueError:
+ indexing_cmds = ''
+
+ # make temp directory for placement of indices and copy reference file there
+ tmp_dir = tempfile.gettempdir()
+ try:
+ os.system('cp %s %s' % (options.ref, tmp_dir))
+ except Exception, erf:
+ stop_err('Error creating temp directory for indexing purposes\n' + str(erf))
+ options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1])
+ cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref)
+ try:
+ os.system(cmd1)
+ except Exception, erf:
+ stop_err('Error indexing reference sequence\n' + str(erf))
+
+ # set up aligning and generate aligning command options
+ # automatically set threads to 8 in both cases
+ if options.params == 'pre_set':
+ aligning_cmds = '-p 8'
+ else:
+ try:
+ aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \
+ '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \
+ (('','-s %s'%options.skip)[options.skip!='None'],
+ ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0],
+ ('','-5 %s'%options.trimH)[int(options.trimH)>=0],
+ ('','-3 %s'%options.trimL)[int(options.trimL)>=0],
+ ('','-n %s'%options.mismatchSeed)[options.mismatchSeed=='0' or options.mismatchSeed=='1' or options.mismatchSeed=='2' or options.mismatchSeed=='3'],
+ ('','-e %s'%options.mismatchQual)[int(options.mismatchQual)>=0],
+ ('','-l %s'%options.seedLen)[int(options.seedLen)>=5],
+ ('','--nomaqround')[options.rounding=='noRound'],
+ ('','-v %s'%options.maqSoapAlign)[options.maqSoapAlign!='-1'],
+ ('','-I %s'%options.minInsert)[options.minInsert!='None'],
+ ('','-X %s'%options.maxInsert)[options.maxInsert!='None'],
+ ('','--%s'%options.mateOrient)[options.mateOrient!='None'],
+ ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0],
+ ('','--nofw')[options.forwardAlign=='noForward'],
+ ('','--norc')[options.reverseAlign=='noReverse'],
+ ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')],
+ ('','-y')[options.tryHard=='doTryHard'],
+ ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0],
+ ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0],
+ ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0],
+ ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0],
+ ('','--best')[options.best=='doBest'],
+ ('','--strata')[options.strata=='doStrata'],
+ ('','-B %s'%options.offbase)[int(options.offbase)>=0],
+ ('','-z %s'%options.phased)[options.phased!='None'],
+ ('','-o %s'%options.offrate)[int(options.offrate)>=0],
+ ('','--mm')[options.mm=='doMm'],
+ ('','--seed %s'%options.seed)[int(options.seed)>=0])
+ except ValueError:
+ aligning_cmds = '-p 8'
+
+ tmp_out = tempfile.NamedTemporaryFile()
+
+ # prepare actual aligning commands
+ if options.paired == 'paired':
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
+ else:
+ cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
+ # prepare command to convert bowtie output to sam and alternative
+ cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output)
+ cmd4 = 'cp %s %s' % (tmp_out.name, options.output)
+
+ # align
+ try:
+ os.system(cmd2)
+ except Exception, erf:
+ stop_err("Error aligning sequence\n" + str(erf))
+ if len(file(tmp_out.name,'r').read()) > 0:
+ #convert
+ try:
+ os.system(cmd3)
+ except Exception, erf:
+ stop_err('Error converting output to sam format\n' + str(erf))
+ else:
+ try:
+ os.system(cmd4)
+ sys.stdout.write('Alignment file contained no data')
+ except Exception, erf:
+ stop_err('Error producing alignment file. File contained no data.\n' + str(erf))
+
+if __name__=="__main__": __main__()
diff -r e7b899fb4462 -r a7b1304e736f tools/sr_mapping/bowtie_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.xml Fri Sep 11 14:38:05 2009 -0400
@@ -0,0 +1,556 @@
+<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0">
+ <description> fast alignment of reads against reference sequence </description>
+ <command interpreter="python">
+ bowtie_wrapper.py
+ --input1=$singlePaired.input1
+ #if $singlePaired.sPaired == "paired":
+ --input2=$singlePaired.input2
+ #else:
+ --input2="None"
+ #end if
+ --output=$output
+ --paired=$singlePaired.sPaired
+ --genomeSource=$refGenomeSource.genomeSource
+ #if $refGenomeSource.genomeSource == "history":
+ --ref=$refGenomeSource.ownFile
+ #else:
+ --ref=$refGenomeSource.indices.value
+ #end if
+ --params=$singlePaired.params.settings_type
+ #if $singlePaired.params.settings_type == "full":
+ --skip=$singlePaired.params.skip
+ --alignLimit=$singlePaired.params.alignLimit
+ --trimH=$singlePaired.params.trimH
+ --trimL=$singlePaired.params.trimL
+ --mismatchSeed=$singlePaired.params.mismatchSeed
+ --mismatchQual=$singlePaired.params.mismatchQual
+ --seedLen=$singlePaired.params.seedLen
+ --rounding=$singlePaired.params.rounding
+ --maqSoapAlign=$singlePaired.params.maqSoapAlign
+ --tryHard=$singlePaired.params.tryHard
+ --valAlign=$singlePaired.params.valAlign
+ --allValAligns=$singlePaired.params.allValAligns
+ --suppressAlign=$singlePaired.params.suppressAlign
+ --offbase=$singlePaired.params.offbase
+ --offrate=$singlePaired.params.offrate
+ --mm=$singlePaired.params.mm
+ --seed=$singlePaired.params.seed
+ --best=$singlePaired.params.bestOption.best
+ #if $singlePaired.params.bestOption.best == "doBest":
+ --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks
+ --threadMem=$singlePaired.params.bestOption.threadMem
+ --strata=$singlePaired.params.bestOption.strata
+ --phased="None"
+ #else:
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ #if $singlePaired.sPaired =="single":
+ --phased=$singlePaired.params.bestOption.phased
+ #else:
+ --phased="None"
+ #end if
+ #end if
+ #if $singlePaired.sPaired == "single":
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ #else:
+ --minInsert=$singlePaired.params.minInsert
+ --maxInsert=$singlePaired.params.maxInsert
+ --mateOrient=$singlePaired.params.mateOrient
+ --maxAlignAttempt=$singlePaired.params.maxAlignAttempt
+ --forwardAlign=$singlePaired.params.forwardAlign
+ --reverseAlign=$singlePaired.params.reverseAlign
+ #end if
+ #else
+ --skip="None"
+ --alignLimit="None"
+ --trimH="None"
+ --trimL="None"
+ --mismatchSeed="None"
+ --mismatchQual="None"
+ --seedLen="None"
+ --rounding="None"
+ --maqSoapAlign="None"
+ --tryHard="None"
+ --valAlign="None"
+ --allValAligns="None"
+ --suppressAlign="None"
+ --offbase="None"
+ --best="None"
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ --phased="None"
+ --offrate="None"
+ --mm="None"
+ --seed="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --dbkey=$dbkey
+ #else:
+ --dbkey="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --indexSettings=$refGenomeSource.indexParams.index_settings
+ #else:
+ --indexSettings="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history" and $refGenomeSource.indexParams.index_settings == "index_full":
+ --iauto_b=$refGenomeSource.indexParams.auto_behavior.auto_b
+ #if $refGenomeSource.indexParams.auto_behavior.auto_b == "set":
+ --ipacked=$refGenomeSource.indexParams.auto_behavior.packed
+ --ibmax=$refGenomeSource.indexParams.auto_behavior.bmax
+ --ibmaxdivn=$refGenomeSource.indexParams.auto_behavior.bmaxdivn
+ --idcv=$refGenomeSource.indexParams.auto_behavior.dcv
+ #else:
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ #end if
+ --inodc=$refGenomeSource.indexParams.nodc
+ --inoref=$refGenomeSource.indexParams.noref
+ --ioffrate=$refGenomeSource.indexParams.offrate
+ --iftab=$refGenomeSource.indexParams.ftab
+ --intoa=$refGenomeSource.indexParams.ntoa
+ --iendian=$refGenomeSource.indexParams.endian
+ --iseed=$refGenomeSource.indexParams.seed
+ --icutoff=$refGenomeSource.indexParams.cutoff
+ --ioldpmap=$refGenomeSource.indexParams.oldpmap
+ #else:
+ --iauto_b="None"
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ --inodc="None"
+ --inoref="None"
+ --ioffrate="None"
+ --iftab="None"
+ --intoa="None"
+ --iendian="None"
+ --iseed="None"
+ --icutoff="None"
+ --ioldpmap="None"
+ #end if
+ </command>
+ <inputs>
+ <conditional name="refGenomeSource">
+ <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+ <option value="indexed">Use a built-in index</option>
+ <option value="history">Use one from the history</option>
+ </param>
+ <when value="indexed">
+ <param name="indices" type="select" label="Select a reference genome">
+ <options from_file="bowtie_indices.loc">
+ <column name="value" index="1" />
+ <column name="name" index="0" />
+ <filter type="sort_by" column="0" />
+ </options>
+ </param>
+ </when>
+ <when value="history">
+ <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" />
+ <conditional name="indexParams">
+ <param name="index_settings" type="select" label="Choose whether to use default options or to set your own">
+ <option value="index_pre_set">Commonly Used</option>
+ <option value="index_full">Full Parameter List</option>
+ </param>
+ <when value="index_pre_set" />
+ <when value="index_full">
+ <conditional name="auto_behavior">
+ <param name="auto_b" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv">
+ <option value="auto">Automatic behavior</option>
+ <option value="set">Set values (sets --noauto and allows others to be set)</option>
+ </param>
+ <when value="auto" />
+ <when value="set">
+ <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)">
+ <option value="unpacked">Use regular representation</option>
+ <option value="packed">Use packed representation</option>
+ </param>
+ <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" />
+ <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" />
+ <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" />
+ </when>
+ </conditional>
+ <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetetive reference)">
+ <option value="dc">Use difference-cover sample</option>
+ <option value="nodc">Disable difference-cover sample</option>
+ </param>
+ <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)">
+ <option value="ref">Build all index files</option>
+ <option value="noref">Do not build paired-end alignment index files</option>
+ </param>
+ <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" />
+ <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" />
+ <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)">
+ <option value="no">Do not convert Ns</option>
+ <option value="yes">Convert Ns to As</option>
+ </param>
+ <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture">
+ <option value="little">Little</option>
+ <option value="big">Big</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" />
+ <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" />
+ <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't">
+ <option value="no">Use the new scheme</option>
+ <option value="yes">Use the old scheme</option>
+ </param>
+ </when> <!-- index_full -->
+ </conditional>
+ </when>
+ </conditional> <!-- refGenomeSource -->
+ <conditional name="singlePaired">
+ <param name="sPaired" type="select" label="Is this library mate-paired?">
+ <option value="single">Single-end</option>
+ <option value="paired">Paired-end</option>
+ </param>
+ <when value="single">
+ <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n reads (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)">
+ <option value="noPhased">Don't alternate</option>
+ <option value="doPhased">Do alternate</option>
+ </param>
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional> <!-- bestOption -->
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- single -->
+ <when value="paired">
+ <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
+ <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="BWA settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n pairs (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" />
+ <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" />
+ <param name="mateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
+ <option value="fr">FR (for Illumina)</option>
+ <option value="rf">RF</option>
+ <option value="ff">FF</option>
+ </param>
+ <param name="maxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" />
+ <param name="forwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)">
+ <option value="forward">Align against the forward reference strand</option>
+ <option value="noForward">Do not align against the forward reference strand</option>
+ </param>
+ <param name="reverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)">
+ <option value="reverse">Align against the reverse-complement reference strand</option>
+ <option value="noReverse">Do not align against the reverse-complement reference strand</option>
+ </param>
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional>
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- paired -->
+ </conditional> <!-- singlePaired -->
+ </inputs>
+ <outputs>
+ <data format="sam" name="output" />
+ </outputs>
+ <tests>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_pre_set" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_full" />
+ <param name="auto_b" value="set" />
+ <param name="packed" value="unpacked" />
+ <param name="bmax" value="-1" />
+ <param name="bmaxdivn" value="4" />
+ <param name="dcv" value="2048" />
+ <param name="nodc" value="dc" />
+ <param name="noref" value="noref" />
+ <param name="offrate" value="6" />
+ <param name="ftab" value="10" />
+ <param name="ntoa" value="yes" />
+ <param name="endian" value="little" />
+ <param name="seed" value="-1" />
+ <param name="cutoff" value="-1" />
+ <param name="oldpmap" value="no" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="full" />
+ <param name="skip" value="0" />
+ <param name="alignLimit" value="-1" />
+ <param name="trimL" value="0" />
+ <param name="trimH" value="0" />
+ <param name="mismatchSeed" value="3" />
+ <param name="mismatchQual" value="50" />
+ <param name="seedLen" value="10" />
+ <param name="rounding" value="round" />
+ <param name="maqSoapAlign" value="-1" />
+ <param name="minInsert" value="0" />
+ <param name="maxInsert" value="250" />
+ <param name="mateOrient" value="fr" />
+ <param name="maxAlignAttempt" value="100" />
+ <param name="forwardAlign" value="forward" />
+ <param name="reverseAlign" value="reverse" />
+ <param name="tryHard" value="doTryHard" />
+ <param name="valAlign" value="1" />
+ <param name="allValAligns" value="noAllValAligns" />
+ <param name="suppressAlign" value="-1" />
+ <param name="offbase" value="0" />
+ <param name="best" value="doBest" />
+ <param name="maxBacktracks" value="800" />
+ <param name="threadMem" value="32" />
+ <param name="strata" value="noStrata" />
+ <param name="offrate" value="-1" />
+ <param name="mm" value="noMm" />
+ <param name="seed" value="403" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ </tests>
+ <help>
+
+**What it does**
+
+Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool.
+
+.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
+
+------
+
+**Input formats**
+
+Bowtie accepts files in Sanger FASTQ format.
+
+------
+
+**Outputs**
+
+The output is in SAM format, and has the following columns::
+
+ 1 QNAME - Query (pair) NAME
+ 2 FLAG - bitwise FLAG
+ 3 RNAME - Reference sequence NAME
+ 4 POS - 1-based leftmost POSition/coordinate of clipped sequence
+ 5 MAPQ - MAPping Quality (Phred-scaled)
+ 6 CIGAR - extended CIGAR string
+ 7 MRNM - Mate Reference sequence NaMe ('=' if same as RNAME)
+ 8 MPOS - 1-based Mate POSition
+ 9 ISIZE - Inferred insert SIZE
+ 10 SEQ - query SEQuence on the same strand as the reference
+ 11 QUAL - query QUALity (ASCII-33 gives the Phred base quality)
+ 12 OPT - variable OPTional fields in the format TAG:VTYPE:VALU
+
+The flags are as follows::
+
+ Flag - Description
+ 0x0001 - the read is paired in sequencing
+ 0x0002 - the read is mapped in a proper pair
+ 0x0004 - the query sequence itself is unmapped
+ 0x0008 - the mate is unmapped
+ 0x0010 - strand of the query (1 for reverse)
+ 0x0020 - strand of the mate
+ 0x0040 - the read is the first read in a pair
+ 0x0080 - the read is the second read in a pair
+ 0x0100 - the alignment is not primary
+
+It looks like this (scroll sideways to see the entire example)::
+
+ QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT
+ HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh
+ HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh
+
+-------
+
+**Bowtie settings**
+
+All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here.
+
+------
+
+**Bowtie parameter list**
+
+This is an exhaustive list of Bowtie options:
+
+For indexing (bowtie-build)::
+ -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off]
+ -p Packing. Use a packed representation for DNA strings. [auto]
+ --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto]
+ --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4]
+ --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024]
+ --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off]
+ -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off]
+ -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5]
+ -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10]
+ --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off]
+ --big Endianness. Endianness to use when serializing integers to the index file. [off]
+ --little Endianness. [--little]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+ --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off]
+ --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off]
+
+For aligning (bowtie)::
+ -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off]
+ -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit]
+ -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0]
+ -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0]
+ -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2]
+ -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70]
+ -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28]
+ --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off]
+ -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off]
+ -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0]
+ --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr]
+ --rf Mate orientation. [off]
+ --ff Mate orientation. [off]
+ -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250]
+ --pairtries <int> Maximum alignment attempts for paired-end data. [100]
+ --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off]
+ --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off]
+ --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best]
+ -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off]
+ --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32]
+ -k <int> Valid alignments. The number of valid alignments per read or pair. [off]
+ -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off]
+ -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit]
+ --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off]
+ --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off]
+ -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0]
+ -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off]
+ -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off]
+ --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+
+ </help>
+</tool>
1
0
14 Sep '09
details: http://www.bx.psu.edu/hg/galaxy/rev/e7b899fb4462
changeset: 2681:e7b899fb4462
user: James Taylor <james(a)jamestaylor.org>
date: Fri Sep 11 12:48:33 2009 -0400
description:
Fix syntax error when running workflows. This is actually a regression in Mako, the multiline conditional in the elif was somehow causing it to improperly nest the if statements
2 file(s) affected in this change:
eggs.ini
templates/workflow/run.mako
diffs (34 lines):
diff -r 8877ef766447 -r e7b899fb4462 eggs.ini
--- a/eggs.ini Fri Sep 11 11:26:26 2009 -0400
+++ b/eggs.ini Fri Sep 11 12:48:33 2009 -0400
@@ -31,7 +31,7 @@
elementtree = 1.2.6_20050316
lrucache = 0.2
;lsprof - james
-Mako = 0.2.4
+Mako = 0.2.5
MyghtyUtils = 0.52
nose = 0.9.1
NoseHTML = 0.2
@@ -79,7 +79,7 @@
docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz
elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz
lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz
-Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz
+Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz
MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52…
nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz
NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2
diff -r 8877ef766447 -r e7b899fb4462 templates/workflow/run.mako
--- a/templates/workflow/run.mako Fri Sep 11 11:26:26 2009 -0400
+++ b/templates/workflow/run.mako Fri Sep 11 12:48:33 2009 -0400
@@ -87,8 +87,7 @@
${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )}
<input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" />
%endif
- %elif isinstance( value, RuntimeValue ) or \
- ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
+ %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
## On the first load we may see a RuntimeValue, so we write
## an input field using the initial value for the param.
## Subsequents posts will no longer have the runtime value
1
0