- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2641: web controller to handle tagging (add/remove/a...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/6b66a5e142ab changeset: 2641:6b66a5e142ab user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:27:01 2009 -0400 description: web controller to handle tagging (add/remove/autocomplete) 1 file(s) affected in this change: lib/galaxy/web/controllers/tag.py diffs (151 lines): diff -r b85cb0a65f46 -r 6b66a5e142ab lib/galaxy/web/controllers/tag.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/web/controllers/tag.py Fri Aug 28 15:27:01 2009 -0400 @@ -0,0 +1,147 @@ +""" +Tags Controller: handles tagging/untagging of entities and provides autocomplete support. +""" + +from galaxy.web.base.controller import * +from galaxy.tags.tag_handler import * +from sqlalchemy.sql.expression import func, and_ +from sqlalchemy.sql import select + +class TagsController ( BaseController ): + + def __init__(self, app): + BaseController.__init__(self, app) + + # Set up dict for mapping from short-hand to full item class. + self.shorthand_to_item_class_dict = dict() + self.shorthand_to_item_class_dict["history"] = History + self.shorthand_to_item_class_dict["hda"] = HistoryDatasetAssociation + + # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, ... + self.tag_handler = TagHandler() + self.tag_handler.add_tag_assoc_class(History, HistoryTagAssociation) + self.tag_handler.add_tag_assoc_class(HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation) + + @web.expose + def add_tag_async( self, trans, id=None, item_type=None, new_tag=None ): + """ Add tag to an item. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + trans.sa_session.flush() + + @web.expose + def remove_tag_async( self, trans, id=None, item_type=None, tag_name=None ): + """ Remove tag from an item. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + self.tag_handler.remove_item_tag(item, tag_name) + trans.sa_session.flush() + + # Retag an item. All previous tags are deleted and new tags are applied. + @web.expose + def retag_async( self, trans, id=None, item_type=None, new_tags=None ): + """ Apply a new set of tags to an item; previous tags are deleted. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + tag_handler.delete_item_tags(item) + self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + trans.sa_session.flush() + + tag_handler.delete_item_tags(history) + tag_handler.apply_item_tags(trans.sa_session, history, new_tags) + # Flush to complete changes. + trans.sa_session.flush() + + @web.expose + @web.require_login( "get autocomplete data for an item's tags" ) + def tag_autocomplete_data(self, trans, id=None, item_type=None, q=None, limit=None, timestamp=None): + """ Get autocomplete data for an item's tags. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + # + # Get user's item tags and usage counts. + # + + # Get item-tag association class. + item_tag_assoc_class = self.tag_handler.get_tag_assoc_class(item.__class__) + + # Build select statement. + cols_to_select = [ item_tag_assoc_class.table.c.tag_id, item_tag_assoc_class.table.c.user_tname, item_tag_assoc_class.table.c.user_value, func.count('*') ] + from_obj = item_tag_assoc_class.table.join(item.table).join(Tag) + where_clause = self._get_column_for_filtering_item_by_user_id(item)==trans.get_user().id + order_by = [ func.count("*").desc() ] + ac_for_names = not q.endswith(":") + if ac_for_names: + # Autocomplete for tag names. + where_clause = and_(where_clause, Tag.table.c.name.like(q + "%")) + group_by = item_tag_assoc_class.table.c.tag_id + else: + # Autocomplete for tag values. + tag_name_and_value = q.split(":") + tag_name = tag_name_and_value[0] + tag_value = tag_name_and_value[1] + where_clause = and_(where_clause, Tag.table.c.name==tag_name) + where_clause = and_(where_clause, item_tag_assoc_class.table.c.value.like(tag_value + "%")) + group_by = item_tag_assoc_class.table.c.value + + # Do query and get result set. + query = select(columns=cols_to_select, from_obj=from_obj, + whereclause=where_clause, group_by=group_by, order_by=order_by) + result_set = trans.sa_session.execute(query) + + # Create and return autocomplete data. + if ac_for_names: + # Autocomplete for tag names. + ac_data = "#Header|Your Tags\n" + for row in result_set: + # Exclude tags that are already applied to the history. + if self.tag_handler.item_has_tag(item, row[1]): + continue + # Add tag to autocomplete data. + ac_data += row[1] + "|" + row[1] + "\n" + else: + # Autocomplete for tag values. + ac_data = "#Header|Your Values for '%s'\n" % (tag_name) + for row in result_set: + ac_data += tag_name + ":" + row[2] + "|" + row[2] + "\n" + + return ac_data + + def _get_column_for_filtering_item_by_user_id(self, item): + """ Returns the column to use when filtering by user id. """ + if isinstance(item, History): + return item.table.c.user_id + elif isinstance(item, HistoryDatasetAssociation): + # Use the user_id associated with the HDA's history. + history = item.history + return history.table.c.user_id + + def _get_item(self, trans, item_type, id): + """ Get an item based on type and id. """ + item_class = self.shorthand_to_item_class_dict[item_type] + item = trans.sa_session.query(item_class).filter("id=" + str(id))[0] + return item; + + def _do_security_check(self, trans, item): + """ Do security check on an item. """ + if isinstance(item, History): + history = item; + # Check that the history exists, and is either owned by the current + # user (if logged in) or the current history + assert history is not None + if history.user is None: + assert history == trans.get_history() + else: + assert history.user == trans.user + elif isinstance(item, HistoryDatasetAssociation): + # TODO. + pass

1 0

[hg] galaxy 2639: Added samtools-based tools (sam_to_bam, sam_me...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/36f438ce1f82 changeset: 2639:36f438ce1f82 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Fri Aug 28 15:59:16 2009 -0400 description: Added samtools-based tools (sam_to_bam, sam_merge, sam_pileup) with their supporting files and modified Bam datatype so temp files are properly cleaned up 15 file(s) affected in this change: lib/galaxy/datatypes/images.py test-data/chrM.fa test-data/sam_to_bam_in1.sam test-data/sam_to_bam_in2.sam test-data/sam_to_bam_out1.bam test-data/sam_to_bam_out2.bam tool-data/sam_fa_indices.loc.sample tool_conf.xml.sample tools/samtools/sam_merge.py tools/samtools/sam_merge.xml tools/samtools/sam_merge_code.py tools/samtools/sam_pileup.py tools/samtools/sam_pileup.xml tools/samtools/sam_to_bam.py tools/samtools/sam_to_bam.xml diffs (843 lines): diff -r d261f41a2a03 -r 36f438ce1f82 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Fri Aug 28 15:29:53 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Fri Aug 28 15:59:16 2009 -0400 @@ -252,14 +252,17 @@ index_file = dataset.metadata.spec['bam_index'].param.new_file( dataset = dataset ) tmp_dir = tempfile.gettempdir() tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1bai = '%s.bai' % tmpf1.name try: subprocess.check_call(['cd', tmp_dir], shell=True) subprocess.check_call('cp %s %s' % (dataset.file_name, tmpf1.name), shell=True) subprocess.check_call('samtools index %s' % tmpf1.name, shell=True) - subprocess.check_call('cp %s.bai %s' % (tmpf1.name, index_file.file_name), shell=True) + subprocess.check_call('cp %s %s' % (tmpf1bai, index_file.file_name), shell=True) except subprocess.CalledProcessError: sys.stderr.write('There was a problem creating the index for the BAM file\n') tmpf1.close() + if os.path.exists(tmpf1bai): + os.remove(tmpf1bai) dataset.metadata.bam_index = index_file def set_peek( self, dataset ): if not dataset.dataset.purged: diff -r d261f41a2a03 -r 36f438ce1f82 test-data/chrM.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/chrM.fa Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,335 @@ +>chrM +GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA +GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT +TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT +CTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATCAAGCACACTAGAA +AGTAGCTCATAACACCTTGCTCAGCCACACCCCCACGGGACACAGCAGTG +ATAAAAATTAAGCTATGAACGAAAGTTCGACTAAGTCATATTAAATAAGG +GTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTA +ATAAATCTCCGGCGTAAAGCGTGTCAAAGACTAATACCAAAATAAAGTTA +AAACCCAGTTAAGCCGTAAAAAGCTACAACCAAAGTAAAATAGACTACGA +AAGTGACTTTAATACCTCTGACTACACGATAGCTAAGACCCAAACTGGGA +TTAGATACCCCACTATGCTTAGCCCTAAACTAAAATAGCTTACCACAACA +AAGCTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTT +GGCGGTGCTTTACATCCCTCTAGAGGAGCCTGTTCCATAATCGATAAACC +CCGATAAACCCCACCATCCCTTGCTAATTCAGCCTATATACCGCCATCTT +CAGCAAACCCTAAACAAGGTACCGAAGTAAGCACAAATATCCAACATAAA +AACGTTAGGTCAAGGTGTAGCCCATGGGATGGAGAGAAATGGGCTACATT +TTCTACCCTAAGAACAAGAACTTTAACCCGGACGAAAGTCTCCATGAAAC +TGGAGACTAAAGGAGGATTTAGCAGTAAATTAAGAATAGAGAGCTTAATT +GAATCAGGCCATGAAGCGCGCACACACCGCCCGTCACCCTCCTTAAATAT +CACAAATCATAACATAACATAAAACCGTGACCCAAACATATGAAAGGAGA +CAAGTCGTAACAAGGTAAGTATACCGGAAGGTGTACTTGGATAACCAAAG +TGTAGCTTAAACAAAGCATCCAGCTTACACCTAGAAGATTTCACTCAAAA +TGAACACTTTGAACTAAAGCTAGCCCAAACAATACCTAATTCAATTACCC +TTAGTCACTTAACTAAAACATTCACCAAACCATTAAAGTATAGGAGATAG +AAATTTTAACTTGGCGCTATAGAGAAAGTACCGTAAGGGAACGATGAAAG +ATGCATTAAAAGTACTAAACAGCAAAGCTTACCCCTTTTACCTTTTGCAT +AATGATTTAACTAGAATAAACTTAGCAAAGAGAACTTAAGCTAAGCACCC +CGAAACCAGACGAGCTACCTATGAACAGTTACAAATGAACCAACTCATCT +ATGTCGCAAAATAGTGAGAAGATTCGTAGGTAGAGGTGAAAAGCCCAACG +AGCCTGGTGATAGCTGGTTGTCCAGAAACAGAATTTCAGTTCAAATTTAA +ATTTACCTAAAAACTACTCAATTCTAATGTAAATTTAAATTATAGTCTAA +AAAGGTACAGCTTTTTAGATACAGGTTACAACCTTCATTAGAGAGTAAGA +ACAAGATAAACCCATAGTTGGCTTAAAAGCAGCCATCAATTAAGAAAGCG +TTCAAGCTCAACGACACATCTATCTTAATCCCAACAATCAACCCAAACTA +ACTCCTAATCTCATACTGGACTATTCTATCAACACATAGAAGCAATAATG +TTAATATGAGTAACAAGAATTATTTCTCCTTGCATAAGCTTATATCAGAA +CGAATACTCACTGATAGTTAACAACAAGATAGGGATAATCCAAAAACTAA +TCATCTATTTAAACCATTGTTAACCCAACACAGGCATGCATCTATAAGGA +AAGATTAAAAGAAGTAAAAGGAACTCGGCAAACACAAACCCCGCCTGTTT +ACCAAAAACATCACCTCTAGCATTTCCAGTATTAGAGGCACTGCCTGCCC +AGTGACATCTGTTtaaacggccgcggtatcctaaccgtgcaaaggtagca +taatcacttgttccctaaatagggacttgtatgaatggccacacgagggt +tttactgtctcttacttccaatcagtgaaattgaccttcccgtgaagagg +cgggaatgactaaataagacgagaagaccctatggagcttTAATTAACTG +ATTCACAAAAAACAACACACAAACCTTAACCTTCAGGGACAACAAAACTT +TTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAAC +CTCCGAGTGATTTAAATCCAGACTAACCAGTCAAAATATATAATCACTTA +TTGATCCAAACCATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCG +CAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATG +TTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTT +CAACGATTAAAGTCTTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGT +CGGTTTCTATCTATTCTATACTTTTCCCAGTACGAAAGGACAAGAAAAGT +AGGGCCCACTTTACAAGAAGCGCCCTCAAACTAATAGATGACATAATCTA +AATCTAACTAATTTATAACTTCTACCGCCCTAGAACAGGGCTCgttaggg +tggcagagcccggaaattgcataaaacttaaacctttacactcagaggtt +caactcctctccctaacaacaTGTTCATAATTAACGTCCTCCTCCTAATT +GTCCCAATCTTGCTCGCCGTAGCATTCCTCACACTAGTTGAACGAAAAGT +CTTAGGCTATATGCAACTTCGCAAAGGACCCAACATCGTAGGCCCCTATG +GCCTACTACAACCTATTGCCGATGCCCTCAAACTATTTATCAAAGAGCCA +CTACAACCACTAACATCATCGACATCCATATTCATCATCGCACCAATCCT +AGCCCTAACCCTGGCCTTAACCATATGAATCCCTCTGCCCATACCATACC +CACTAATCAACATAAACCTAGGAATTCTATTCATACTAGCCATGTCCAGC +CTAGCTGTCTACTCAATCCTTTGATCAGGATGGGCCTCAAACTCAAAATA +CGCCCTAATTGGAGCTCTACGAGCAGTAGCACAAACCATCTCATACGAAG +TAACTCTAGCAATCATCCTACTCTCAGTCCTCCTAATAAGCGGATCATTC +ACATTATCAACACTTATTATTACCCAAGAATACCTCTGATTAATCTTCCC +ATCATGACCCTTAGCCATAATGTGATTCATCTCAACATTAGCCGAAACCA +ACCGAGCTCCATTTGACCTAACAGAAGGAGAATCAGAACTCGTCTCTGGA +TTCAACGTTGAATACGCAGCCGGCCCATTTGCTCTATTCTTCCTAGCAGA +ATACGCAAACATCATCATGATAAACATCTTCACAACAACCCTATTTCTAG +GAGCATTTCACAACCCCTACCTGCCAGAACTCTACTCAATTAATTTCACC +ATTAAAGCTCTCCTTCTAACATGTTCCTTCCTATGAATCCGAGCATCCTA +CCCACGATTCCGATATGACCAACTTATACACCTCCTATGAAAGAACTTCC +TACCACTCACACTAGCCCTCTGCATATGACACGTCTCACTTCCAATCATA +CTATCCAGCATCCCACCACAAACATAGGAAATATGTCTGACAAAAGAGTT +ACTTTGATAGAGTAAAACATAGAGGCTCAAACCCTCTTATTTctagaact +acaggaattgaacctgctcctgagaattcaaaatcctccgtgctaccgaa +ttacaccatgtcctaCAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCAT +ACCCCGAAAATGTTGGATTACACCCTTCCCGTACTAATAAATCCCCTTAT +CTTCACAACTATTCTAATAACAGTTCTTCTAGGAACTATAATCGTTATAA +TAAGCTCACACTGACTAATAATCTGAATCGGATTTGAAATAAATCTACTA +GCCATTATCCCTATCCTAATAAAAAAGTACAATCCCCGAACCATAGAAGC +CTCCACCAAATATTTTCTAACCCAAGCCACCGCATCAATACTCCTCATAA +TAGCGATCATCATTAACCTCATACACTCAGGCCAATGAACAATCACAAAA +GTCTTCAACCCCACAGCGTCCATCATTATAACTTCAGCTCTCGCCATAAA +ACTTGGACTCACACCATTCCACTTCTGAGTACCCGAAGTCACACAGGGCA +TCTCATTAACATCAGGTCTCATCCTACTTACATGACAAAAACTAGCCCCA +ATATCAATCCTATATCAAATCTCACCCTCAATTAACCTAAATATCTTATT +AACTATAGCCGTACTGTCAATCCTAGTAGGAGGCTGAGGCGGTCTCAACC +AAACCCAACTACGAAAAATCATAGCATACTCGTCAATCGCGCATATAGGA +TGAATAACAGCTGTCCTAGTATATAACCCAACACTAACAATACTAAACAT +ATTAATTTACATTATAATAACACTCACAATATTCATACTATTTATCCACA +GCTCCTCTACTACAACACTATCACTCTCCCACACATGAAACAAAATACCT +CTAACCACTACACTAATCTTAATTACCTTACTATCCATAGGAGGCCTCCC +CCCACTATCAGGATTCATACCCAAATGAATAATCATTCAAGAGCTCACCA +AAAATAGCAGCATCATCCTCCCCACACTAATAGCCATTATAGCACTACTC +AACCTCTACTTCTACATACGACTAACCTATTCCACCTCACTGACCATATT +CCCATCCACAAACAACATAAAAATAAAATGACAATTCGAAACCAAACGAA +TTACTCTCTTACCCCCGTTAATTGTTATATCCTCCCTACTCCTCCCCCTA +ACCCCCATACTATCAATTTTGGACTAGGAATTTAGGTTAACATCCCAGAC +CAAGAGCCTTCAAAGCTCTAAGCAAGTGAATCCACTTAATTCCTGCATAC +TAAGGACTGCGAGACTCTATCTCACATCAATTGAACGCAAATCAAACTCT +TTTATTAAGCTAAGCCCTTACTAGATTGGTGGGCTACCATCCCACGAAAT +TTTAGTTAACAGCTAAATACCCTAATCAACTGGCTTCAATCTACTTCTCC +CGCCGCCTAGAAAAAAAGGCGGGAGAAGCCCCGGCAGAAATTGAAGCTGC +TCCTTTGAATTTGCAATTCAATGTGAAAATTCACCACGGGACTTGATAAG +AAGAGGATTCCAACCCCTGTCTTTAGATTTACAGTCTAATGCTTACTCAG +CCATCTTACCTATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAA +GACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGG +AACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCC +TACTAGGAGATGATCAGATCTACAATGTCATTGTAACCGCCCATGCATTC +GTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAA +CTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAA +TAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTC +GCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCC +TCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCA +TTTTCTCTCTCCACCTAGCTGGGGTGTCCTCGATTTTAGGTGCCATCAAC +TTTATTACCACAATCATTAACATAAAACCACCAGCCCTATCCCAATATCA +AACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCC +TAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGT +AACCTGAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCT +TTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTA +TCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGT +AAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCAT +TGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGA +TAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCT +ATCCCTACTGGTGTAAAAGTATTCAGCTGACTAGCCACCCTGCACGGAGG +AAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCT +TATTCACAGTAGGAGGTCTAACAGGAATCGTCCTAGCTAACTCATCCCTA +GATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGT +CCTGTCTATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTACACTGAT +TCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCAC +TTTACAATTATATTCGTAGGGGTAAATATAACCTTCTTCCCACAACATTT +CCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTATCCAGACGCAT +ATACAACATGAAATACCATCTCATCCATAGGATCTTTTATCTCACTTACA +GCAGTGATACTAATAATTTTCATAATTTGAGAAGCGTTCGCATCCAAACG +AGAAGTGTCTACAGTAGAATTAACCTCAACTAATCTGGAATGACTACACG +GATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTA +AAAtaagaaaggaaggaatcgaaccccctctaactggtttcaagccaata +tcataaccactatgtctttctcCATCAATTGAGGTATTAGTAAAAATTAC +ATGACTTTGTCAAAGTTAAATTATAGGTTAAACCCCTATATACCTCTATG +GCCTACCCCTTCCAACTAGGATTCCAAGACGCAACATCCCCTATTATAGA +AGAACTCCTACACTTCCACGACCACACACTAATAATCGTATTCCTAATTA +GCTCTCTAGTATTATATATTATCTCATCAATACTAACAACTAAATTAACC +CATACCAGCACCATAGATGCTCAAGAAGTAGAGACAATTTGAACGATTTT +ACCAGCCATCATCCTTATTCTAATCGCCCTCCCATCCCTACGAATTCTAT +ATATAATAGATGAAATCAATAATCCGTCCCTCACAGTCAAAACAATAGGC +CACCAATGATACTGAAGCTACGAGTATACCGATTACGAAGACTTGACCTT +TGACTCCTACATGATCCCCACATCAGACCTAAAACCAGGAGAATTACGTC +TTCTAGAAGTCGACAATCGAGTGGTTCTCCCCATAGAAATAACCATCCGA +ATGCTAATTTCATCCGAAGACGTCCTACACTCATGAGCTGTGCCCTCCCT +AGGCCTAAAAACAGACGCTATCCCTGGGCGCCTAAATCAGACAACTCTCG +TGGCCTCTCGACCAGGACTTTACTACGGTCAATGCTCAGAGATCTGCGGA +TCAAACCACAGCTTTATACCAATTGTCCTTGAACTAGTTCCACTGAAACA +CTTCGAAGAATGATCTGCATCAATATTATAAAGTCACTAAGAAGCTATTA +TAGCATTAACCTTTTAAGTTAAAGATTGAGGGTTCAACCCCCTCCCTAGT +GATATGCCACAGTTGGATACATCAACATGATTTATTAATATCGTCTCAAT +AATCCTAACTCTATTTATTGTATTTCAACTAAAAATCTCAAAGCACTCCT +ATCCGACACACCCAGAAGTAAAGACAACCAAAATAACAAAACACTCTGCC +CCTTGAGAATCAAAATGAACGAAAATCTATTCGCCTCTTTCGCTACCCCA +ACAATAGTAGGCCTCCCTATTGTAATTCTGATCATCATATTTCCCAGCAT +CCTATTCCCCTCACCCAACCGACTAATCAACAATCGCCTAATCTCAATTC +AACAATGGCTAGTCCAACTTACATCAAAACAAATAATAGCTATCCATAAC +AGCAAAGGACAAACCTGAACTCTTATACTCATATCACTGATCCTATTCAT +TGGCTCAACAAACTTATTAGGCCTACTACCTCACTCATTTACACCAACAA +CACAACTATCAATAAACCTAGGCATAGCTATTCCCCTATGGGCAGGGACA +GTATTCATAGGCTTTCGTCACAAAACAAAAGCAGCCCTAGCCCACTTTCT +ACCTCAAGGGACGCCCATTTTCCTCATCCCCATACTAGTAATTATCGAGA +CTATCAGCCTATTTATTCAACCTGTAGCCCTAGCCGTGCGGCTAACCGCT +AACATTACCGCCGGACACCTCCTAATACACCTCATCGGAGGGGCAACACT +AGCCCTCATAAGCATCAGCCCCTCAACAGCCCTTATTACGTTTATCATCC +TAATTCTACTAACTATCCTCGAATTCGCAGTAGCTATAATCCAAGCCTAC +GTATTCACTCTCCTGGTAAGCCTTTACTTACACGACAACACCTAATGACC +CACCAAACCCACGCTTACCACATAGTAAACCCCAGCCCATGACCACTTAC +AGGAGCCCTATCAGCCCTCCTGATAACATCAGGACTAGCCATGTGATTTC +ACTTTAACTCAACCTTACTTCTAGCTATAGGGCTATTAACTAACATCCTT +ACCATATATCAATGATGACGAGACATCATCCGAGAAAGCACATTCCAAGG +CCATCACACATCAATCGTTCAAAAGGGACTCCGATATGGCATAATCCTTT +TTATTATCTCAGAAGTCTTCTTCTTCTCTGGCTTCTTCTGAGCCTTTTAC +CACTCAAGCCTAGCCCCCACACCCGAACTAGGCGGCTGCTGACCACCCAC +AGGTATCCACCCCTTAAACCCCCTAGAAGTCCCCTTACTCAACACCTCAG +TGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCACCATAGCCTAATA +GAAGGAAACCGTAAAAATATGCTCCAAGGCCTATTCATCACAATTTCACT +AGGCGTATACTTCACCCTTCTCCAAGCCTCAGAATACTATGAAGCCTCAT +TTACTATTTCAGATGGAGTATACGGATCAACATTTTTCGTAGCAACAGGG +TTCCACGGACTACACGTAATTATCGGATCTACCTTCCTCATTGTATGTTT +CCTACGCCAACTAAAATTCCACTTTACATCCAGCCACCACTTCGGATTCG +AAGCAGCCGCTTGATACTGACACTTCGTCGACGTAGTCTGACTATTCTTG +TACGTCTCTATTTATTGATGAGGATCCTATTCTTTTAGTATTGACCAGTA +CAATTGACTTCCAATCAATCAGCTTCGGTATAACCCGAAAAAGAATAATA +AACCTCATACTGACACTCCTCACTAACACATTACTAGCCTCGCTACTCGT +ACTCATCGCATTCTGACTACCACAACTAAACATCTATGCAGAAAAAACCA +GCCCATATGAATGCGGATTTGACCCTATAGGGTCAGCACGCCTCCCCTTC +TCAATAAAATTTTTCTTAGTGGCCATTACATTTCTGCTATTCGACTTAGA +AATTGCCCTCCTATTACCCCTTCCATGAGCATCCCAAACAACTAACCTAA +ACACTATACTTATCATAGCACTAGTCCTAATCTCTCTTCTAGCCATCAGC +CTAGCCTACGAATGAACCCAAAAAGGACTAGAATGAACTGAGTATGGTAA +TTAGTTTAAACCAAAACAAATGATTTCGACTCATTAAACTATGATTAACT +TCATAATTACCAACATGTCACTAGTCCATATTAATATCTTCCTAGCATTC +ACAGTATCCCTCGTAGGCCTACTAATGTACCGATCCCACCTAATATCCTC +ACTCCTATGCCTAGAAGGAATAATACTATCACTATTCGTCATAGCAACCA +TAATAGTCCTAAACACCCACTTCACACTAGCTAGTATAATACCTATCATC +TTACTAGTATTTGCTGCCTGCGAACGAGCTCTAGGATTATCCCTACTAGT +CATAGTCTCCAATACTTATGGAGTAGACCACGTACAAAACCTTAACCTCC +TCCAATGCTAAAAATTATCATTCCCACAATCATACTTATGCCCCTTACAT +GACTATCAAAAAAGAATATAATCTGAATCAACACTACAACCTATAGTCTA +TTAATCAGCCTTATCAGCCTATCCCTCCTAAACCAACCTAGCAACAATAG +CCTAAACTTCTCACTAATATTCTTCTCCGATCCCCTATCAGCCCCACTTC +TGGTGTTGACAACATGACTACTGCCACTAATACTCATAGCCAGCCAACAC +CATCTATCTAAGGAACCACTAATCCGAAAAAAACTCTACATCACCATGCT +AACCATACTTCAAACTTTCCTAATCATGACTTTTACCGCCACAGAACTAA +TCTCCTTCTACATCCTATTTGAAGCCACATTAGTTCCAACACTAATTATC +ATCACCCGCTGAGGCAACCAAACAGAACGCCTGAACGCAGGCCTCTACTT +CCTATTCTACACACTAATAGGTTCCCTCCCACTCTTAGTTGCACTAATCT +CTATCCAAAACCTAACAGGCTCACTAAACTTCCTATTAATTCAATACTGA +AACCAAGCACTACCCGACTCTTGATCCAATATTTTCCTATGACTAGCATG +TATAATAGCATTCATAGTCAAAATACCGGTATATGGTCTTCACCTCTGAC +TCCCAAAAGCCCATGTAGAAGCCCCAATTGCCGGATCCATAGTGCTAGCA +GCCATTCTACTAAAACTAGGAGGCTACGGAATACTACGAATTACAACAAT +ACTAAACCCCCAAACTAGCTTTATAGCCTACCCCTTCCTCATACTATCCC +TGTGAGGAATAATCATAACTAGTTCCATCTGCTTGCGACAAACCGATCTA +AAATCACTTATTGCATACTCCTCTGTCAGCCACATAGCCCTAGTAATCGT +AGCCGTCCTCATCCAAACACCATGAAGTTATATAGGAGCTACAGCCCTAA +TAATCGCTCACGGCCTTACATCATCAATACTATTCTGCCTGGCAAACTCA +AATTACGAACGTACCCATAGCCGAACTATAATCCTAGCCCGCGGGCTTCA +AACACTTCTTCCCCTTATAGCAGCCTGATGACTATTAGCCAGCCTAACCA +ACCTGGCCCTCCCTCCCAGCATTAACCTAATTGGAGAGCTATTCGTAGTA +ATATCATCATTCTCATGATCAAATATTACCATTATCCTAATAGGAGCCAA +TATCACCATCACCGCCCTCTACTCCCTATACATACTAATCACAACACAAC +GAGGGAAATACACACACCATATCAACAGCATTAAACCTTCATTTACACGA +GAAAACGCACTCATGGCCCTCCACATGACTCCCCTACTACTCCTATCACT +TAACCCTAAAATTATCCTAGGCTTTACGTACTGTAAATATAGTTTAACAA +AAACACTAGATTGTGGATCTAGAAACAGAAACTTAATATTTCTTATTTAC +CGAGAAAGTATGCAAGAACTGCTAATTCATGCCCCCATGTCCAACAAACA +TGGCTCTCTCAAACTTTTAAAGGATAGGAGCTATCCGTTGGTCTTAGGAA +CCAAAAAATTGGTGCAACTCCAAATAAAAGTAATCAACATGTTCTCCTCC +CTCATACTAGTTTCACTATTAGTACTAACCCTCCCAATCATATTATCAAT +CTTCAATACCTACAAAAACAGCACGTTCCCGCATCATGTAAAAAACACTA +TCTCATATGCCTTCATTACTAGCCTAATTCCCACTATAATATTTATTCAC +TCTGGACAAGAAACAATTATCTCAAACTGACACTGAATAACCATACAAAC +CCTCAAACTATCCCTAAGCTTCAAACTAGATTACTTCTCAATAATTTTCG +TACCAGTAGCCCTATTCGTAACATGATCTATTATGGAATTCTCCCTATGA +TACATGCACTCAGATCCTTACATTACTCGATTTTTTAAATACTTACTTAC +ATTCCTCATCACTATAATAATTCTAGTCACAGCTAACAACCTTTTCCAAC +TGTTCATCGGATGGGAGGGAGTAGGCATCATGTCATTCTTACTAATCGGA +TGATGATACGGCCGAACAGATGCCAACACCGCGGCCCTTCAAGCAATCCT +TTATAACCGCATCGGGGATATCGGCTTCATCATGGCCATAGCCTGATTCC +TATTCAACACCAACACATGAGACCTCCAACAAATCTTCATACTCGACCCC +AACCTTACCAACCTCCCGCTCCTAGGCCTCCTCCTAGCCGCAACTGGCAA +ATCCGCTCAATTTGGACTCCACCCATGACTTCCTTCAGCCATAGAGGGCC +CTACACCAGTCTCAGCCCTACTCCACTCCAGCACAATAGTTGTAGCAGGC +GTCTTCCTGCTAATCCGCTTCCATCCACTAATAGAAAACAACAAAACAAT +CCAGTCACTTACCCTATGCCTAGGAGCCATCACCACACTATTCACAGCAA +TCTGCGCACTCACTCAAAACGATATCAAAAAAATCATTGCTTTCTCCACC +TCCAGCCAACTAGGCCTGATAATCGTAACCATCGGTATCAATCAACCCTA +CCTAGCATTCCTCCACATTTGCACTCACGCATTCTTCAAAGCTATACTAT +TTATATGTTCCGGATCCATTATCCACAGCCTAAATGACGAGCAAGATATC +CGAAAAATAGGCGGACTATTTAATGCAATACCCTTCACCACCACATCTCT +AATTATTGGCAGCCTTGCACTCACCGGAATTCCTTTCCTCACAGGCTTCT +ACTCCAAAGACCTCATCATCGAAACCGCCAACACATCGTACACCAACGCC +TGAGCCCTACTAATAACTCTCATTGCCACATCCCTCACAGCTGTCTACAG +TACCCGAATCATCTTCTTTGCACTCCTAGGGCAACCCCGCTTCCTCCCTC +TGACCTCAATCAACGAAAATAACCCCTTTCTAATTAACTCCATCAAACGC +CTCTTAATTGGCAGCATTTTTGCCGGATTCTTCATCTCCAACAATATCTA +CCCCACAACCGTCCCAGAAATAACCATACCTACTTACATAAAACTCACCG +CCCTCGCAGTAACCATCCTAGGATTTACACTAGCCCTAGAACTAAGCTTG +ATAACCCATAACTTAAAACTAGAACACTCCACCAACGTATTCAAATTCTC +CAACCTCCTAGGATACTACCCAACAATTATACACCGACTCCCACCGCTCG +CTAACCTATCAATAAGCCAAAAATCAGCATCACTTCTACTAGACTCAATC +TGACTAGAAAACATCCTGCCAAAATCTATCTCCCAGTTCCAAATAAAAAC +CTCGATCCTAATTTCCACCCAAAAAGGACAAATCAAATTATATTTCCTCT +CATTCCTCATCACCCTTACCCTAAGCATACTACTTTTTAATCTCCACGAG +TAACCTCTAAAATTACCAAGACCCCAACAAGCAACGATCAACCAGTCACA +ATCACAACCCAAGCCCCATAACTATACAATGCAGCAGCCCCTATAATTTC +CTCACTAAACGCCCCAGAATCTCCAGTATCATAAATAGCTCAAGCCCCCA +CACCACTAAACTTAAACACTACCCCCACTTCCTCACTCTTCAGAACATAT +AAAACCAACATAACCTCCATCAACAACCCTAAAAGAAATACCCCCATAAC +AGTCGTATTAGACACCCATACCTCAGGATACTGCTCAGTAGCCATAGCCG +TTGTATAACCAAAAACAACCAACATTCCTCCCAAATAAATCAAAAACACC +ATCAACCCCAAAAAGGACCCTCCAAAATTCATAATAATACCACAACCTAC +CCCTCCACTTACAATCAGCACTAAACCCCCATAAATAGGTGAAGGTTTTG +AAGAAAACCCCACAAAACTAACAACAAAAATAACACTCAAAATAAACACA +ATATATGTCATCATTATTCCCACGTGGAATCTAACCACGACCAATGACAT +GAAAAATCATCGTTGTATTTCAACTATAAGAACACCAATGACAAACATCC +GGAAATCTCACCCACTAATTAAAATCATCAATCACTCTTTTATTGACCTA +CCAGCCCCCTCAAACATTTCATCATGATGAAACTTCGGCTCCCTCCTAGG +AATCTGCCTAATCCTCCAAATCTTAACAGGCCTATTCCTAGCCATACACT +ACACATCAGACACGACAACTGCCTTCTCATCCGTCACTCACATCTGCCGA +GACGTTAACTACGGATGAATTATTCGCTACCTCCATGCCAACGGAGCATC +AATATTTTTTATCTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTACG +GCTCTTACACATTCCTAGAGACATGAAACATTGGAATCATCCTACTTTTC +ACAGTTATAGCTACAGCATTCATGGGCTATGTCCTACCATGAGGCCAAAT +ATCCTTTTGAGGAGCAACAGTCATCACGAACCTCCTATCAGCAATTCCCT +ACATCGGTACTACCCTCGTCGAGTGAATCTGAGGTGGATTCTCAGTAGAC +AAAGCCACCCTTACCCGATTTTTTGCTTTCCACTTCATCCTACCCTTCAT +CATCACAGCCCTGGTAGTCGTACATTTACTATTTCTTCACGAAACAGGAT +CTAATAACCCCTCAGGAATCCCATCCGATATGGACAAAATCCCATTCCAC +CCATATTATACAATTAAAGACATCCTAGGACTCCTCCTCCTGATCTTGCT +CCTACTAACTCTAGTATTATTCTCCCCCGACCTCCTAGGAGACCCAGACA +ACTACACCCCAGCTAACCCTCTCAGCACTCCCCCTCATATTAAACCAGAA +TGGTACTTCCTGTTTGCCTACGCCATCCTACGCTCCATTCCCAACAAACT +AGGCGGCGTATTAGCCCTAATCCTCTCCATCCTGATCCTAGCACTCATCC +CCACCCTCCACATATCAAAACAACGAAGCATAATATTCCGGCCTCTCAGC +CAATGCGTATTCTGACTCTTAGTGGCAGACTTACTGACACTAACATGAAT +CGGCGGACAGCCAGTGGAACACCCATACGTAATTATCGGCCAACTGGCCT +CAATCCTCTACTTCTCCCTAATTCTCATTTTTATACCACTCGCAAGCACC +ATCGAAAACAATCTTCTAAAATGAAGAGTCCCTGTAGTATATCGCACATT +ACCCTGGTCTTGTAAACCAGAAAAGGGGGAAAACGTTTCCTCCCAAGGAC +TATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTC +TACTTAAACTATTCCTTGATTTCTTCCCCTAAACGACAACAATTTACCCT +CATGTGCTATGTCAGTATCAGATTATACCCCCACATAACACCATACCCAC +CTGACATGCAATATCTTATGAATGGCCTATGTACGTCGTGCATTAAATTG +TCTGCCCCATGAATAATAAGCATGTACATAATATCATTTATCTTACATAA +GTACATTATATTATTGATCGTGCATACCCCATCCAAGTCAAATCATTTCC +AGTCAACACGCATATCACAGCCCATGTTCCACGAGCTTAATCACCAAGCC +GCGGGAAATCAGCAACCCTCCCAACTACGTGTCCCAATCCTCGCTCCGGG +CCCATCCAAACGTGGGGGTTTCTACAATGAAACTATACCTGGCATCTGGT +TCTTTCTTCAGGGCCATTCCCACCCAACCTCGCCCATTCTTTCCCCTTAA +ATAAGACATCTCGATGGACTAATGACTAATCAGCCCATGCTCACACATAA +CTGTGATTTCATGCATTTGGTATCTTTTTATATTTGGGGATGCTATGACT +CAGCTATGGCCGTCAAAGGCCTCGACGCAGTCAATTAAATTGAAGCTGGA +CTTAAATTGAACGTTATTCCTCCGCATCAGCAACCATAAGGTGTTATTCA +GTCCATGGTAGCGGGACATAGGAAACAAgtgcacctgtgcacctgtgcac +ctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacct +gtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgt +gcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgc +acctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcac +ctgtgcacctACCCGCGCAGTAAGCAAGTAATATAGCTTTCTTAATCAAA +CCCCCCCTACCCCCCATTAAACTCCACATATGTACATTCAACACAATCTT +GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT +AACCCTCGCATGCCAACCATAATAACTCAACACACCTAACAATCTTAACA +GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT +TTCCATAGACAGGCATCCCCCTAGATCTAATTTTCTAAATCTGTCAACCC +TTCTTCCCCC diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_in1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_to_bam_in1.sam Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,10 @@ +HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1698:516 16 chrM 2735 25 36M * 0 0 TTTACACTCAGAGGTTCAACTCCTCTCNNTAACAAC I9IIIII5IIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1491:637 16 chrM 10864 25 36M * 0 0 TGTAGAAGCCCCAATTGCCGGATCCATNNTGCTAGC DBAIIIIIIIIIIIFIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1711:249 16 chrM 10617 25 36M * 0 0 ACCAAACAGAACGCCTGAACGCAGGCCNNTACTTCC IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1634:211 0 chrM 9350 25 36M * 0 0 GAAGCAGNNGCTTGATACTGACACTTCGTCGACGTA IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1218:141 16 chrM 14062 25 36M * 0 0 ACAAAACTAACAACAAAAATAACACTCNNAATAAAC I+IIII1IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1398:854 16 chrM 3921 25 36M * 0 0 CACCCTTCCCGTACTAATAAATCCCCTNNTCTTCAC IIIII=AIIIIIIIIIIIIIIBIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1310:991 16 chrM 10002 25 36M * 0 0 CTCCTATGCCTAGAAGGAATAATACTANNACTATTC I:2IEI:IIDIIIIII4IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1716:413 0 chrM 6040 25 36M * 0 0 GATCCAANNCTTTATCAACACCTATTCTGATTCTTC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1630:59 16 chrM 12387 25 36M * 0 0 TCATACTCGACCCCAACCTTACCAACCNNCCGCTCC FIIHII;IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_in2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_to_bam_in2.sam Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,10 @@ +HWI-EAS91_1_30788AAXX:1:1:1095:605 0 chrM 23 25 36M * 0 0 AAGCAAGNNACTGAAAATGCCTAGATGAGTATTCTT IIIIIII""IIIIIIIIIIIIIIIEIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1650:1185 0 chrM 14956 25 36M * 0 0 ACCCCAGNNAACCCTCTCAGCACTCCCCCTCATATT IIIIIII""IIIIIIIIIIII6IIIIIIIII5I-II NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:799:192 16 chrM 8421 25 36M * 0 0 CCTGTAGCCCTAGCCGTGCGGCTAACCNNTAACATT II%::I<IIIIIEIII8IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1082:719 16 chrM 7191 25 36M * 0 0 TAAATTAACCCATACCAGCACCATAGANNCTCAAGA <III0EII3+3I29I>III8AIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1746:1180 16 chrM 12013 25 36M * 0 0 CCTAAGCTTCAAACTAGATTACTTCTCNNTAATTTT IIIIIIIIFIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:606:460 0 chrM 4552 25 36M * 0 0 TTAATTTNNATTATAATAACACTCACAATATTCATA IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1059:362 16 chrM 7348 25 36M * 0 0 GGCCACCAATGATACTGAAGCTACGAGNNTACCGAT II/<)2IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1483:1161 16 chrM 15080 25 36M * 0 0 TCCTGATCCTAGCACTCATCCCCACCCNNCACATAT HIIIIIFIIAIHIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1273:600 16 chrM 13855 25 36M * 0 0 GTATTAGACACCCATACCTCAGGATACNNCTCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1190:1283 16 chrM 15338 25 36M * 0 0 TATATCGCACATTACCCTGGTCTTGTANNCCAGAAA EIII?-IIIIIAIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_out1.bam Binary file test-data/sam_to_bam_out1.bam has changed diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_out2.bam Binary file test-data/sam_to_bam_out2.bam has changed diff -r d261f41a2a03 -r 36f438ce1f82 tool-data/sam_fa_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/sam_fa_indices.loc.sample Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a sam_fa_indices.loc file +#similar to this one (store it in this directory ) that points to +#the directories in which those files are stored. The sam_fa_indices.loc +#file has this format (white space characters are TAB characters): +# +#<index> <seq> <location> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/sam/, +#then the sam_fa_indices.loc entry would look like this: +# +#hg18 /depot/data2/galaxy/sam/hg18.fa +# +#and your /depot/data2/galaxy/sam/ directory +#would contain hg18.fa and hg18.fa.fai files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai +# +#Your sam_fa_indices.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18 /depot/data2/galaxy/sam/hg18.fa diff -r d261f41a2a03 -r 36f438ce1f82 tool_conf.xml.sample --- a/tool_conf.xml.sample Fri Aug 28 15:29:53 2009 -0400 +++ b/tool_conf.xml.sample Fri Aug 28 15:59:16 2009 -0400 @@ -331,9 +331,13 @@ <tool file="metag_tools/megablast_xml_parser.xml" /> <tool file="metag_tools/blat_wrapper.xml" /> <tool file="metag_tools/mapping_to_ucsc.xml" /> - <tool file="sr_mapping/bwa_wrapper.xml" /> </section> <section name="Tracks" id="tracks"> <tool file="visualization/genetrack.xml" /> </section> + <section name="SAM Tools" id="samtools"> + <tool file="samtools/sam_to_bam.xml" /> + <tool file="samtools/sam_merge.xml" /> + <tool file="samtools/sam_pileup.xml" /> + </section> </toolbox> diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,21 @@ +#! /usr/bin/python + +import os, sys + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def __main__(): + infile = sys.argv[1] + outfile = sys.argv[2] + if len( sys.argv ) < 3: + stop_err( 'No files to merge' ) + filenames = sys.argv[3:] + cmd1 = 'samtools merge %s %s %s' % (outfile, infile, ' '.join(filenames)) + try: + os.system(cmd1) + except Exception, eq: + stop_err('Error running SAMtools merge tool\n' + str(eq)) + +if __name__ == "__main__" : __main__() \ No newline at end of file diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,32 @@ +<tool id="sam_merge" name="Merge BAM Files" version="1.0.0"> + <description>merges BAM files together</description> + <command interpreter="python"> + sam_merge.py + $input1 + $output1 + $input2 + #for $i in $inputs + ${i.input} + #end for + </command> + <inputs> + <param name="input1" label="First file" type="data" format="bam" /> + <param name="input2" label="with file" type="data" format="bam" help="Need to add more files? Use controls below." /> + <repeat name="inputs" title="Input Files"> + <param name="input" label="Add file" type="data" format="bam" /> + </repeat> + </inputs> + <outputs> + <data name="output1" format="bam" /> + </outputs> +  + <help> + +**What it does** + +This tool uses SAMTools_' merge command to merge any number of BAM files together into one BAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool> diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge_code.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge_code.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,35 @@ +import sets +from galaxy.tools.parameters import DataToolParameter + +def validate_input( trans, error_map, param_values, page_param_map ): + dbkeys = sets.Set() + data_param_names = sets.Set() + data_params = 0 + for name, param in page_param_map.iteritems(): + if isinstance( param, DataToolParameter ): + # for each dataset parameter + if param_values.get(name, None) != None: + dbkeys.add( param_values[name].dbkey ) + data_params += 1 + # check meta data +# try: +# param = param_values[name] +# startCol = int( param.metadata.startCol ) +# endCol = int( param.metadata.endCol ) +# chromCol = int( param.metadata.chromCol ) +# if param.metadata.strandCol is not None: +# strandCol = int ( param.metadata.strandCol ) +# else: +# strandCol = 0 +# except: +# error_msg = "The attributes of this dataset are not properly set. " + \ +# "Click the pencil icon in the history item to set the chrom, start, end and strand columns." +# error_map[name] = error_msg + data_param_names.add( name ) + if len( dbkeys ) > 1: + for name in data_param_names: + error_map[name] = "All datasets must belong to same genomic build, " \ + "this dataset is linked to build '%s'" % param_values[name].dbkey + if data_params != len(data_param_names): + for name in data_param_names: + error_map[name] = "A dataset of the appropriate type is required" \ No newline at end of file diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_pileup.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_pileup.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,89 @@ +#! /usr/bin/python + +""" +Creates a pileup file from a bam file and a reference. + +usage: %prog [options] + -i, --input1=i: bam file + -o, --output1=o: Output pileup + -r, --ref=r: Reference file type + -n, --ownFile=n: User-supplied fasta reference file + -d, --dbkey=d: dbkey of user-supplied file + -x, --indexDir=x: Index directory + -b, --bamIndex=b: BAM index file + +usage: %prog input1 output1 ref_type refFile ownFile dbkey index_dir bam_index +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seq_file = "%s/sam_fa_indices.loc" % GALAXY_DATA_INDEX_DIR + seq_path = '' + for line in open( seq_file ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( "#" ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seq_path = fields[2].strip() + break + return seq_path + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + seq_path = check_seq_file( options.dbkey, options.indexDir ) + tmp_dir = tempfile.gettempdir() + os.chdir(tmp_dir) + tmpf0 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf0bam = '%s.bam' % tmpf0.name + tmpf0bambai = '%s.bam.bai' % tmpf0.name + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1fai = '%s.fai' % tmpf1.name + cmd1 = None + cmd2 = 'cp %s %s; cp %s %s' % (options.input1, tmpf0bam, options.bamIndex, tmpf0bambai) + cmd3 = 'samtools pileup -f %s %s > %s 2> /dev/null' + if options.ref =='indexed': + full_path = "%s.fai" % seq_path + if not os.path.exists( full_path ): + stop_err( "No sequences are available for '%s', request them by reporting this error." % options.dbkey ) + cmd3 = cmd3 % (seq_path, tmpf0bam, options.output1) + elif options.ref == 'history': + cmd1 = 'cp %s %s; cp %s.fai %s' % (options.ownFile, tmpf1.name, options.ownFile, tmpf1fai) + cmd3 = cmd3 % (tmpf1.name, tmpf0bam, options.output1) + # index reference if necessary + if cmd1: + try: + os.system(cmd1) + except Exception, eq: + stop_err('Error moving reference sequence\n' + str(eq)) + # copy bam index to working directory + try: + os.system(cmd2) + except Exception, eq: + stop_err('Error moving files to temp directory\n' + str(eq)) + # perform pileup command + try: + os.system(cmd3) + except Exception, eq: + stop_err('Error running SAMtools merge tool\n' + str(eq)) + # clean up temp files + tmpf1.close() + tmpf0.close() + if os.path.exists(tmpf0bam): + os.remove(tmpf0bam) + if os.path.exists(tmpf0bambai): + os.remove(tmpf0bambai) + if os.path.exists(tmpf1fai): + os.remove(tmpf0bambai) + +if __name__ == "__main__" : __main__() diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_pileup.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_pileup.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,50 @@ +<tool id="sam_pileup" name="SAM Pileup Format" version="1.0.0"> + <description>generates the pileup format for a provided BAM file</description> + <command interpreter="python"> + sam_pileup.py + --input1=$input1 + --output=$output1 + --ref=$refOrHistory.reference + #if $refOrHistory.reference == "history": + --ownFile=$refOrHistory.ownFile + #else: + --ownFile="None" + #end if + --dbkey=${input1.metadata.dbkey} + --indexDir=${GALAXY_DATA_INDEX_DIR} + --bamIndex=${input1.metadata.bam_index} + </command> + <inputs> + <conditional name="refOrHistory"> + <param name="reference" type="select" label="Will you select a reference genome from your history or use a built-in index?"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="sam, bam" label="Select the BAM file to generate the pileup file for" /> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="tabular" name="output1" /> + </outputs> +  + <help> + +**What it does** + +Uses SAMTools_' pileup command to produce a file in the pileup format based on the provided BAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool> + + diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_to_bam.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_to_bam.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,85 @@ +#! /usr/bin/python + +""" +Converts SAM data to BAM format. + +usage: %prog [options] + -i, --input1=i: SAM file to be converted + -d, --dbkey=d: dbkey value + -r, --ref_file=r: Reference file if choosing from history + -o, --output1=o: BAM output + -x, --index_dir=x: Index directory + +usage: %prog input_file dbkey ref_list output_file +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seq_file = "%s/sam_fa_indices.loc" % GALAXY_DATA_INDEX_DIR + seq_path = '' + for line in open( seq_file ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( "#" ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seq_path = fields[2].strip() + break + return seq_path + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + seq_path = check_seq_file( options.dbkey, options.index_dir ) + tmp_dir = tempfile.gettempdir() + os.chdir(tmp_dir) + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1fai = '%s.fai' % tmpf1.name + tmpf2 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf3 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf3bam = '%s.bam' % tmpf3.name + if options.ref_file == "None": + full_path = "%s.fai" % seq_path + if not os.path.exists( full_path ): + stop_err( "No sequences are available for '%s', request them by reporting this error." % options.dbkey ) + cmd1 = "cp %s %s; cp %s %s" % (seq_path, tmpf1.name, full_path, tmpf1fai) + else: + cmd1 = "cp %s %s; samtools faidx %s 2>/dev/null" % (options.ref_file, tmpf1.name, tmpf1.name) + cmd2 = "samtools view -bt %s -o %s %s 2>/dev/null" % (tmpf1fai, tmpf2.name, options.input1) + cmd3 = "samtools sort %s %s 2>/dev/null" % (tmpf2.name, tmpf3.name) + cmd4 = "cp %s %s" % (tmpf3bam, options.output1) + # either create index based on fa file or copy provided index to temp directory + try: + os.system(cmd1) + except Exception, eq: + stop_err("Error creating the reference list index.\n" + str(eq)) + # create original bam file + try: + os.system(cmd2) + except Exception, eq: + stop_err("Error running view command.\n" + str(eq)) + # sort original bam file to produce sorted output bam file + try: + os.system(cmd3) + os.system(cmd4) + except Exception, eq: + stop_err("Error sorting data and creating output file.\n" + str(eq)) + # cleanup temp files + tmpf1.close() + tmpf2.close() + tmpf3.close() + if os.path.exists(tmpf1fai): + os.remove(tmpf1fai) + if os.path.exists(tmpf3bam): + os.remove(tmpf3bam) + +if __name__=="__main__": __main__() diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_to_bam.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_to_bam.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,59 @@ +<tool id="sam_to_bam" name="SAM-to-BAM" version="1.0.0"> + <description>converts SAM format to BAM format</description> + <command interpreter="python"> + sam_to_bam.py + --input1=$source.input1 + --dbkey=${input1.metadata.dbkey} + #if $source.indexSource == "history": + --ref_file=$ref_file + #else + --ref_file="None" + #end if + --output1=$output1 + --index_dir=${GALAXY_DATA_INDEX_DIR} + </command> + <inputs> + <conditional name="source"> + <param name="indexSource" type="select" label="Choose the source for the reference list"> + <option value="built_in">Built-in</option> + <option value="history">History</option> + </param> + <when value="built_in"> + <param name="input1" type="data" format="sam" label="SAM File to Convert"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="sam" label="SAM File to Convert" /> + <param name="ref_file" type="data" format="fasta" label="Choose the reference file" /> + </when> + </conditional> + </inputs> + <outputs> + <data name="output1" format="bam"/> + </outputs> + <tests> + <test> + <param name="indexSource" value="history" /> + <param name="input1" value="sam_to_bam_in1.sam" ftype="sam" /> + <param name="ref_file" value="chrM.fa" ftype="fasta" /> + <output name="output1" file="sam_to_bam_out1.bam" /> + </test> + <test> + <param name="indexSource" value="built_in" /> + <param name="input1" value="sam_to_bam_in2.sam" ftype="sam" dbkey="chrM" /> + <param name="ref_file" value="chrM.fa" ftype="fasta" /> + <output name="output1" file="sam_to_bam_out2.bam" /> + </test> + </tests> + <help> + +**What it does** + +This tool uses the SAMTools_ toolkit to produce a BAM file based on a sorted input SAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool>

1 0

[hg] galaxy 2640: Performance improvements in the GalaxyRBACAgen...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/cc4944a62b66 changeset: 2640:cc4944a62b66 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Aug 28 16:52:58 2009 -0400 description: Performance improvements in the GalaxyRBACAgent for checking access permissions on libraries. Also added information to main config regarding mysql timeouts ( resolves ticket # 132 ). 27 file(s) affected in this change: lib/galaxy/model/__init__.py lib/galaxy/model/mapping.py lib/galaxy/security/__init__.py lib/galaxy/tools/actions/__init__.py lib/galaxy/tools/parameters/basic.py lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/dataset.py lib/galaxy/web/controllers/history.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/root.py templates/admin/library/browse_library.mako templates/dataset/edit_attributes.mako templates/library/browse_library.mako templates/library/common.mako templates/library/folder_info.mako templates/library/folder_permissions.mako templates/library/ldda_edit_info.mako templates/library/ldda_info.mako templates/library/library_dataset_info.mako templates/library/library_dataset_permissions.mako templates/library/library_info.mako templates/library/library_permissions.mako templates/mobile/history/detail.mako templates/mobile/manage_library.mako templates/root/history_common.mako test/base/twilltestcase.py universe_wsgi.ini.sample diffs (1463 lines): diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/model/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -723,15 +723,19 @@ return None @property def active_components( self ): - return list( self.active_folders ) + list( self.active_datasets ) + return list( self.active_folders ) + list( self.active_library_datasets ) + @property + def active_library_datasets( self ): + # This needs to be a list + return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] + @property + def activatable_library_datasets( self ): + # This needs to be a list + return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.dataset.deleted ] @property def active_datasets( self ): # This needs to be a list - return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] - @property - def activatable_datasets( self ): - # This needs to be a list - return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.dataset.deleted ] + return [ ld.library_dataset_dataset_association.dataset for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] @property #make this a relation def activatable_folders( self ): # This needs to be a list diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/model/mapping.py Fri Aug 28 16:52:58 2009 -0400 @@ -740,7 +740,7 @@ assign_mapper( context, DatasetPermissions, DatasetPermissions.table, properties=dict( dataset=relation( Dataset, backref="actions" ), - role=relation( Role, backref="actions" ) + role=relation( Role, backref="dataset_actions" ) ) ) diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/security/__init__.py --- a/lib/galaxy/security/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/security/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -33,8 +33,10 @@ def get_actions( self ): """Get all permitted actions as a list of Action objects""" return self.permitted_actions.__dict__.values() - def allow_action( self, user, action, **kwd ): + def allow_action( self, user, roles, action, **kwd ): raise 'No valid method of checking action (%s) on %s for user %s.' % ( action, kwd, user ) + def get_item_action( self, action, item ): + raise 'No valid method of retrieving action (%s) for item %s.' % ( action, item ) def guess_derived_permissions_for_datasets( self, datasets = [] ): raise "Unimplemented Method" def associate_components( self, **kwd ): @@ -79,40 +81,48 @@ ( self.model.LibraryFolder, self.model.LibraryFolderPermissions ), ( self.model.LibraryDataset, self.model.LibraryDatasetPermissions ), ( self.model.LibraryDatasetDatasetAssociation, self.model.LibraryDatasetDatasetAssociationPermissions ) ) - def allow_action( self, user, action, **kwd ): + @property + def sa_session( self ): + """ + Returns a SQLAlchemy session -- currently just gets the current + session from the threadlocal session context, but this is provided + to allow migration toward a more SQLAlchemy 0.4 style of use. + """ + return self.model.context.current + def allow_action( self, user, roles, action, **kwd ): if 'dataset' in kwd: - return self.allow_dataset_action( user, action, kwd[ 'dataset' ] ) + return self.allow_dataset_action( user, roles, action, kwd[ 'dataset' ] ) elif 'library_item' in kwd: - return self.allow_library_item_action( user, action, kwd[ 'library_item' ] ) + return self.allow_library_item_action( user, roles, action, kwd[ 'library_item' ] ) raise 'No valid method of checking action (%s) for user %s using kwd %s' % ( action, str( user ), str( kwd ) ) - def allow_dataset_action( self, user, action, dataset ): + def allow_dataset_action( self, user, roles, action, dataset ): """Returns true when user has permission to perform an action""" - if not isinstance( dataset, self.model.Dataset ): - dataset = dataset.dataset if not user: if action == self.permitted_actions.DATASET_ACCESS and action.action not in [ dp.action for dp in dataset.actions ]: - return True # anons only get access, and only if there are no roles required for the access action - # other actions (or if the dataset has roles defined for the access action) fall through to the false below + # anons only get access, and only if there are no roles required for the access action + # Other actions (or if the dataset has roles defined for the access action) fall through + # to the false below + return True elif action.action not in [ dp.action for dp in dataset.actions ]: if action.model == 'restrict': - return True # implicit access to restrict-style actions if the dataset does not have the action - # grant-style actions fall through to the false below + # Implicit access to restrict-style actions if the dataset does not have the action + # Grant style actions fall through to the false below + return True else: - user_role_ids = sorted( [ r.id for r in user.all_roles() ] ) perms = self.get_dataset_permissions( dataset ) if action in perms.keys(): # The filter() returns a list of the dataset's role ids of which the user is not a member, # so an empty list means the user has all of the required roles. - if not filter( lambda x: x not in user_role_ids, [ r.id for r in perms[ action ] ] ): - return True # user has all of the roles required to perform the action - # Fall through to the false because the user is missing at least one required role - return False # default is to reject - def allow_library_item_action( self, user, action, library_item ): + if not filter( lambda x: x not in roles, [ r for r in perms[ action ] ] ): + # User has all of the roles required to perform the action + return True + # The user is missing at least one required role + return False + def allow_library_item_action( self, user, roles, action, library_item ): if user is None: # All permissions are granted, so non-users cannot have permissions return False if action.model == 'grant': - user_role_ids = [ r.id for r in user.all_roles() ] # Check to see if user has access to any of the roles allowed_role_assocs = [] for item_class, permission_class in self.library_item_assocs: @@ -126,11 +136,17 @@ elif permission_class == self.model.LibraryDatasetDatasetAssociationPermissions: allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_dataset_association_id=library_item.id ).all() for allowed_role_assoc in allowed_role_assocs: - if allowed_role_assoc.role_id in user_role_ids: + if allowed_role_assoc.role in roles: return True return False else: raise 'Unimplemented model (%s) specified for action (%s)' % ( action.model, action.action ) + def get_item_action( self, action, item ): + # item must be one of: Dataset, Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation + for permission in item.actions: + if permission.action == action: + return permission + return None def guess_derived_permissions_for_datasets( self, datasets=[] ): """Returns a dict of { action : [ role, role, ... ] } for the output dataset based upon provided datasets""" perms = {} @@ -260,7 +276,10 @@ if [ assoc for assoc in dataset.history_associations if assoc.history not in user.histories ]: # Don't change permissions on a dataset associated with a history not owned by the user continue - if bypass_manage_permission or self.allow_action( user, self.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=dataset ): + if bypass_manage_permission or self.allow_action( user, + user.all_roles(), + self.permitted_actions.DATASET_MANAGE_PERMISSIONS, + dataset=dataset ): self.set_all_dataset_permissions( dataset, permissions ) def history_get_default_permissions( self, history ): permissions = {} @@ -402,17 +421,18 @@ lp = permission_class( action.action, target_library_item, private_role ) lp.flush() else: - raise 'Invalid class (%s) specified for target_library_item (%s)' % ( target_library_item.__class__, target_library_item.__class__.__name__ ) - def show_library_item( self, user, library_item ): - if self.allow_action( user, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \ - self.allow_action( user, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \ - self.allow_action( user, self.permitted_actions.LIBRARY_ADD, library_item=library_item ): + raise 'Invalid class (%s) specified for target_library_item (%s)' % \ + ( target_library_item.__class__, target_library_item.__class__.__name__ ) + def show_library_item( self, user, roles, library_item ): + if self.allow_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \ + self.allow_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \ + self.allow_action( user, roles, self.permitted_actions.LIBRARY_ADD, library_item=library_item ): return True if isinstance( library_item, self.model.Library ): - return self.show_library_item( user, library_item.root_folder ) + return self.show_library_item( user, roles, library_item.root_folder ) elif isinstance( library_item, self.model.LibraryFolder ): for folder in library_item.folders: - if self.show_library_item( user, folder ): + if self.show_library_item( user, roles, folder ): return True return False def set_entity_user_associations( self, users=[], roles=[], groups=[], delete_existing_assocs=True ): @@ -462,26 +482,30 @@ if 'role' in kwd: return self.model.GroupRoleAssociation.filter_by( role_id = kwd['role'].id, group_id = kwd['group'].id ).first() raise 'No valid method of associating provided components: %s' % kwd - def check_folder_contents( self, user, entry ): + def check_folder_contents( self, user, roles, folder ): """ - Return true if there are any datasets under 'folder' that the - user has access permission on. We do this a lot and it's a - pretty inefficient method, optimizations are welcomed. + Return true if there are any datasets under 'folder' that are public or that the + user has access permission on. """ - if isinstance( entry, self.model.Library ): - return self.check_folder_contents( user, entry.root_folder ) - elif isinstance( entry, self.model.LibraryFolder ): - for library_dataset in entry.active_datasets: - if self.allow_action( user, self.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): - return True - for folder in entry.active_folders: - if self.check_folder_contents( user, folder ): - return True - return False - elif isinstance( entry, self.model.LibraryDatasetDatasetAssociation ): - return self.allow_action( user, self.permitted_actions.DATASET_ACCESS, dataset=entry.dataset ) - else: - raise 'Passed an illegal object to check_folder_contents: %s' % type( entry ) + action = self.permitted_actions.DATASET_ACCESS.action + lddas = self.sa_session.query( self.model.LibraryDatasetDatasetAssociation ) \ + .join( "library_dataset" ) \ + .filter( self.model.LibraryDataset.folder == folder ) \ + .join( "dataset" ) \ + .options( eagerload_all( "dataset.actions" ) ) \ + .all() + for ldda in lddas: + ldda_access = self.get_item_action( action, ldda.dataset ) + if ldda_access is None: + # Dataset is public + return True + if ldda_access.role in roles: + # The current user has access permission on the dataset + return True + for sub_folder in folder.active_folders: + if self.check_folder_contents( user, roles, sub_folder ): + return True + return False class HostAgent( RBACAgent ): """ diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/tools/actions/__init__.py --- a/lib/galaxy/tools/actions/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/tools/actions/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -47,8 +47,15 @@ assoc.dataset = new_data assoc.flush() data = new_data - # TODO, Nate: Make sure the permitted actions here are appropriate. - if data and not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset=data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if data and not trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id return data if isinstance( input, DataToolParameter ): @@ -261,10 +268,17 @@ # parameters to the command as a special case. for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): job.add_parameter( name, value ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for name, dataset in inp_data.iteritems(): if dataset: - # TODO, Nate: Make sure the permitted actions here are appropriate. - if not trans.app.security_agent.allow_action( trans.user, dataset.permitted_actions.DATASET_ACCESS, dataset=dataset ): + if not trans.app.security_agent.allow_action( user, + roles, + dataset.permitted_actions.DATASET_ACCESS, + dataset=dataset.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id job.add_input_dataset( name, dataset ) else: diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/tools/parameters/basic.py --- a/lib/galaxy/tools/parameters/basic.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/tools/parameters/basic.py Fri Aug 28 16:52:58 2009 -0400 @@ -1137,6 +1137,11 @@ field = form_builder.SelectField( self.name, self.multiple, None, self.refresh_on_change, refresh_on_change_values = self.refresh_on_change_values ) # CRUCIAL: the dataset_collector function needs to be local to DataToolParameter.get_html_field() def dataset_collector( hdas, parent_hid ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for i, hda in enumerate( hdas ): if len( hda.name ) > 30: hda_name = '%s..%s' % ( hda.name[:17], hda.name[-11:] ) @@ -1148,12 +1153,18 @@ hid = str( hda.hid ) if not hda.dataset.state in [galaxy.model.Dataset.states.ERROR, galaxy.model.Dataset.states.DISCARDED] and \ hda.visible and \ - trans.app.security_agent.allow_action( trans.user, hda.permitted_actions.DATASET_ACCESS, dataset=hda ): + trans.app.security_agent.allow_action( user, + roles, + hda.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): # If we are sending data to an external application, then we need to make sure there are no roles # associated with the dataset that restrict it's access from "public". We determine this by sending # None as the user to the allow_action method. if self.tool and self.tool.tool_type == 'data_destination': - if not trans.app.security_agent.allow_action( None, hda.permitted_actions.DATASET_ACCESS, dataset=hda ): + if not trans.app.security_agent.allow_action( None, + None, + hda.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): continue if self.options and hda.get_dbkey() != filter_value: continue @@ -1165,7 +1176,10 @@ if target_ext: if converted_dataset: hda = converted_dataset - if not trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=hda.dataset ): + if not trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): continue selected = ( value and ( hda in value ) ) field.add_option( "%s: (as %s) %s" % ( hid, target_ext, hda_name ), hda.id, selected ) diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Fri Aug 28 16:52:58 2009 -0400 @@ -269,7 +269,7 @@ gra.delete() gra.flush() # Delete DatasetPermissionss - for dp in role.actions: + for dp in role.dataset_actions: dp.delete() dp.flush() msg = "The following have been purged from the database for role '%s': " % role.name @@ -997,16 +997,8 @@ msg=msg, messagetype=messagetype ) elif action == 'delete': - def delete_folder( folder ): - folder.refresh() - for subfolder in folder.active_folders: - delete_folder( subfolder ) - for ldda in folder.active_datasets: - ldda.deleted = True - ldda.flush() - folder.deleted = True - folder.flush() - delete_folder( folder ) + folder.deleted = True + folder.flush() msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name return trans.response.send_redirect( web.url_for( action='browse_library', id=library_id, diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Fri Aug 28 16:52:58 2009 -0400 @@ -108,7 +108,15 @@ data = trans.app.model.HistoryDatasetAssociation.get( dataset_id ) if not data: raise paste.httpexceptions.HTTPRequestRangeNotSatisfiable( "Invalid reference dataset id: %s." % str( dataset_id ) ) - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to view it." ) if filename is None or filename.lower() == "index": @@ -142,9 +150,17 @@ if 'display_url' not in kwd or 'redirect_url' not in kwd: return trans.show_error_message( 'Invalid parameters specified for "display at" link, please contact a Galaxy administrator' ) redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] ) - if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( None, None, data.permitted_actions.DATASET_ACCESS, dataset=data.dataset ): return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site ) return trans.response.send_redirect( redirect_url ) else: diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Aug 28 16:52:58 2009 -0400 @@ -411,6 +411,7 @@ err_msg=err_msg, share_button=True ) ) user = trans.get_user() + user_roles = user.all_roles() histories, send_to_users, send_to_err = self._get_histories_and_users( trans, user, id, email ) send_to_err = '' # The user has made a choice, so dictionaries will be built for sharing @@ -442,13 +443,15 @@ for hda in history.activatable_datasets: # If the current dataset is not public, we may need to perform an action on it to # make it accessible by the other user. - if not trans.app.security_agent.allow_action( send_to_user, + if not trans.app.security_agent.allow_action( send_to_user, + send_to_user.all_roles(), trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda ): + dataset=hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, + if trans.app.security_agent.allow_action( user, + user_roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda ) and not hda.dataset.library_associations: + dataset=hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. @@ -525,6 +528,7 @@ cannot_change = {} no_change_needed = {} unique_no_change_needed = {} + user_roles = user.all_roles() for history in histories: for send_to_user in send_to_users: # Make sure the current history has not already been shared with the current send_to_user @@ -552,13 +556,15 @@ no_change_needed[ send_to_user ][ history ] = [ hda ] else: no_change_needed[ send_to_user ][ history ].append( hda ) - elif not trans.app.security_agent.allow_action( send_to_user, + elif not trans.app.security_agent.allow_action( send_to_user, + send_to_user.all_roles(), trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda ): + dataset=hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, + if trans.app.security_agent.allow_action( user, + user_roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda ) and not hda.dataset.library_associations: + dataset=hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Fri Aug 28 16:52:58 2009 -0400 @@ -62,14 +62,29 @@ params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) messagetype = params.get( 'messagetype', 'done' ) - all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ).order_by( trans.app.model.Library.name ).all() + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \ + .order_by( trans.app.model.Library.name ).all() authorized_libraries = [] for library in all_libraries: - if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ) or \ - trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ) or \ - trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ) or \ - trans.app.security_agent.check_folder_contents( trans.user, library ) or \ - trans.app.security_agent.show_library_item( trans.user, library ): + if trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_ADD, + library_item=library ) or \ + trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + library_item=library ) or \ + trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, + library_item=library ) or \ + trans.app.security_agent.check_folder_contents( user, roles, library.root_folder ) or \ + trans.app.security_agent.show_library_item( user, roles, library ): authorized_libraries.append( library ) return trans.fill_template( '/library/browse_libraries.mako', libraries=authorized_libraries, @@ -264,9 +279,15 @@ msg=util.sanitize_text( msg ), messagetype='error' ) ) seen = [] + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for id in ldda_ids: ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if not ldda or not trans.app.security_agent.allow_action( trans.user, + if not ldda or not trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset = ldda.dataset ): continue @@ -363,9 +384,15 @@ id=library_id, msg=util.sanitize_text( msg ), messagetype='error' ) ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None if action == 'information': if params.get( 'edit_attributes_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): if params.get( 'edit_attributes_button', False ): @@ -391,7 +418,8 @@ messagetype=messagetype ) elif action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library_dataset ): # The user clicked the Save button on the 'Associate With Roles' form @@ -436,6 +464,11 @@ last_used_build = replace_dataset.library_dataset_dataset_association.dbkey else: replace_dataset = None + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] @@ -479,10 +512,12 @@ if action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): permissions = {} @@ -523,7 +558,8 @@ elif action == 'edit_info': if params.get( 'change', False ): # The user clicked the Save button on the 'Change data type' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: @@ -546,7 +582,8 @@ messagetype=messagetype ) elif params.get( 'save', False ): # The user clicked the Save button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): old_name = ldda.name @@ -587,7 +624,8 @@ messagetype=messagetype ) elif params.get( 'detect', False ): # The user clicked the Auto-detect button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): for name, spec in ldda.datatype.metadata_spec.items(): @@ -611,7 +649,8 @@ msg=msg, messagetype=messagetype ) elif params.get( 'delete', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): ldda.deleted = True @@ -628,7 +667,8 @@ widgets=widgets, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): ldda.datatype.before_edit( ldda ) @@ -668,10 +708,12 @@ messagetype='error' ) ) if action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): permissions = {} @@ -704,10 +746,12 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): # Ensure that the permissions across all library items are identical, otherwise we can't update them together. @@ -741,10 +785,12 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ) or \ - ( replace_dataset and trans.app.security_agent.allow_action( trans.user, + ( replace_dataset and trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=replace_dataset ) ): if params.get( 'new_dataset_button', False ): @@ -769,7 +815,8 @@ # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=check_ldda ): if replace_dataset: @@ -892,7 +939,13 @@ # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) - if trans.app.security_agent.allow_action( trans.user, + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=check_ldda ): if replace_dataset: @@ -957,6 +1010,11 @@ id=library_id, msg=util.sanitize_text( msg ), messagetype='error' ) ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None if action == 'new': if params.new == 'submitted': new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ), @@ -994,7 +1052,8 @@ else: widgets = [] if params.get( 'rename_folder_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): old_name = folder.name @@ -1037,7 +1096,8 @@ elif action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): permissions = {} @@ -1162,12 +1222,24 @@ msg=util.sanitize_text( msg ), messagetype='done' ) ) - -def get_authorized_libs(trans, user): - all_libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() +def get_authorized_libs( trans, user ): + # TODO: this is a mis-named function - the name should reflect the authorization policy + # If user is not authenticated, this method should not even be called. Also, it looks + # like all that is using this is the new request stuff, so it should be placed there. + if not user: + return [] + roles = user.all_roles() + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ + .order_by( trans.app.model.Library.name ).all() authorized_libraries = [] for library in all_libraries: - if trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) \ - or trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library): - authorized_libraries.append(library) - return authorized_libraries \ No newline at end of file + if trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_ADD, + library_item=library ) \ + or trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + library_item=library ): + authorized_libraries.append( library ) + return authorized_libraries diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Fri Aug 28 16:52:58 2009 -0400 @@ -152,7 +152,15 @@ except: return "Dataset id '%s' is invalid" %str( id ) if data: - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset = data.dataset ): mime = trans.app.datatypes_registry.get_mimetype_by_extension( data.extension.lower() ) trans.response.set_content_type(mime) if tofile: @@ -184,7 +192,15 @@ if data: child = data.get_child_by_designation( designation ) if child: - if trans.app.security_agent.allow_action( trans.user, child.permitted_actions.DATASET_ACCESS, dataset = child ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + child.permitted_actions.DATASET_ACCESS, + dataset = child ): return self.display( trans, id=child.id, tofile=tofile, toext=toext ) else: return "You are not privileged to access this dataset." @@ -200,11 +216,21 @@ if 'authz_method' in kwd: authz_method = kwd['authz_method'] if data: - if authz_method == 'rbac' and trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if authz_method == 'rbac' and trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset = data ): trans.response.set_content_type( data.get_mime() ) trans.log_event( "Formatted dataset id %s for display at %s" % ( str( id ), display_app ) ) return data.as_display_type( display_app, **kwd ) - elif authz_method == 'display_at' and trans.app.host_security_agent.allow_action( trans.request.remote_addr, data.permitted_actions.DATASET_ACCESS, dataset = data ): + elif authz_method == 'display_at' and trans.app.host_security_agent.allow_action( trans.request.remote_addr, + data.permitted_actions.DATASET_ACCESS, + dataset = data ): trans.response.set_content_type( data.get_mime() ) return data.as_display_type( display_app, **kwd ) else: @@ -247,7 +273,15 @@ return trans.show_error_message( "Problem retrieving dataset." ) if id is not None and data.history.user is not None and data.history.user != trans.user: return trans.show_error_message( "This instance of a dataset (%s) in a history does not belong to you." % ( data.id ) ) - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset=data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to edit its metadata." ) params = util.Params( kwd, safe=False ) @@ -313,7 +347,10 @@ elif params.update_roles_button: if not trans.user: return trans.show_error_message( "You must be logged in if you want to change permissions." ) - if trans.app.security_agent.allow_action( trans.user, data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data.dataset ): + if trans.app.security_agent.allow_action( user, + roles, + data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS, + dataset = data.dataset ): permissions = {} for k, v in trans.app.model.Dataset.permitted_actions.items(): in_roles = params.get( k + '_in', [] ) diff -r 36f438ce1f82 -r cc4944a62b66 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/admin/library/browse_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -138,12 +138,12 @@ %if show_deleted: <% parent_folders = folder.activatable_folders - parent_datasets = folder.activatable_datasets + parent_datasets = folder.activatable_library_datasets %> %else: <% parent_folders = folder.active_folders - parent_datasets = folder.active_datasets + parent_datasets = folder.active_library_datasets %> %endif %for folder in name_sorted( parent_folders ): diff -r 36f438ce1f82 -r cc4944a62b66 templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Fri Aug 28 16:52:58 2009 -0400 @@ -3,6 +3,13 @@ <%def name="title()">${_('Edit Dataset Attributes')}</%def> +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> <%def name="datatype( dataset, datatypes )"> <select name="datatype"> @@ -134,9 +141,9 @@ </div> <p /> -%if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ): +%if trans.app.security_agent.allow_action( user, user_roles, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=data.dataset ): <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> - ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), trans.user.all_roles() )} + ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), user_roles )} %elif trans.user: <div class="toolForm"> <div class="toolFormTitle">View Permissions</div> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/browse_library.mako --- a/templates/library/browse_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/browse_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,15 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<% from galaxy import util %> +<% + from galaxy import util + from time import strftime + + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <%def name="title()">Browse data library</%def> <%def name="stylesheets()"> @@ -110,14 +119,14 @@ <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> %endif %endif @@ -126,24 +135,26 @@ <a class="action-button" href="${h.url_for( controller='library', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> %endif </div> - </td> <td>${ldda.message}</td> <td>${uploaded_by}</td> <td>${ldda.create_time.strftime( "%Y-%m-%d" )}</td> - </tr> - + </tr> <% my_row = row_counter.count row_counter.increment() %> </%def> - <%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, parent=None, row_counter=None )"> <% def show_folder(): - if trans.app.security_agent.check_folder_contents( trans.user, folder ) or trans.app.security_agent.show_library_item( trans.user, folder ): + ## TODO: instead of calling check_folder_contents(), which we've already done prior to getting here, + ## add a new method that will itself call check_folder_contents() and build a list of accessible folders + ## for each library - this should improve performance dor large libraries where the current user can only + ## access a small number of folders. + if trans.app.security_agent.check_folder_contents( user, roles, folder ) or \ + trans.app.security_agent.show_library_item( user, roles, folder ): return True return False if not show_folder: @@ -179,21 +190,21 @@ %endif <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="folder_img-${folder.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">View this folder's information</a> %endif %if forms and not folder.info_association: - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a> %endif </div> @@ -208,11 +219,11 @@ %for child_folder in name_sorted( folder.active_folders ): ${render_folder( child_folder, pad, created_ldda_ids, library_id, my_row, row_counter )} %endfor - %for library_dataset in name_sorted( folder.active_datasets ): + %for library_dataset in name_sorted( folder.active_library_datasets ): <% selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids %> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): ${render_dataset( library_dataset, selected, library, pad, my_row, row_counter )} %endif %endfor @@ -221,7 +232,7 @@ <h2>Data Library “${library.name}”</h2> <ul class="manage-table-actions"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): %if not deleted: <li> <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a> @@ -231,17 +242,17 @@ </li> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">Edit this library's information</a></li> %else: <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">View this library's information</a></li> %endif %if forms and not library.info_association: - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <li><a class="action-button" href="${h.url_for( controller='library', action='library', permissions=True, id=library.id )}">Edit this library's permissions</a></li> %endif </ul> @@ -265,7 +276,7 @@ </thead> </tr> <% row_counter = RowCounter() %> - ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, Nonw, row_counter )} + ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, None, row_counter )} <tfoot> <tr> <td colspan="4" style="padding-left: 42px;"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/common.mako --- a/templates/library/common.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/common.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,65 +1,3 @@ -<% from time import strftime %> - -<%def name="render_dataset( library_dataset, selected, library )"> - <% - ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu - ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always - ## lddas ). We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes - ## from the ldda. - ldda = library_dataset.library_dataset_dataset_association - if ldda.user: - uploaded_by = ldda.user.email - else: - uploaded_by = 'anonymous' - if ldda == ldda.library_dataset.library_dataset_dataset_association: - current_version = True - else: - current_version = False - %> - <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}"> - ## Header row for library items (name, state, action buttons) - <div class="historyItemTitleBar"> - <table cellspacing="0" cellpadding="0" border="0" width="100%"> - <tr> - <td width="*"> - %if selected: - <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/> - %else: - <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> - %endif - <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> - <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> - <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> - %else: - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> - %endif - ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use - ##%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=ldda.library_dataset ): - ## <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> - ##%endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> - %endif - %endif - %if ldda.has_data: - <a class="action-button" href="${h.url_for( controller='library', action='datasets', library_id=library.id, ldda_ids=str( ldda.id ), do_action='add' )}">Import this dataset into your current history</a> - <a class="action-button" href="${h.url_for( controller='library', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> - %endif - </div> - </td> - <td width="500">${ldda.message}</td> - <td width="150">${uploaded_by}</td> - <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td> - </tr> - </table> - </div> - </div> -</%def> - <%def name="render_template_info( library_item, library_id, widgets, editable=True )"> <% library_item_type = 'unknown type' @@ -76,13 +14,18 @@ elif isinstance( library_item, trans.app.model.LibraryDatasetDatasetAssociation ): library_item_type = 'library_dataset_dataset_association' library_item_desc = 'library dataset' + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> %if widgets: <p/> <div class="toolForm"> <div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div> <div class="toolFormBody"> - %if editable and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ): + %if editable and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ): <form name="edit_info" action="${h.url_for( controller='library', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post"> <input type="hidden" name="library_item_id" value="${library_item.id}"/> <input type="hidden" name="library_item_type" value="${library_item_type}"/> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/folder_info.mako --- a/templates/library/folder_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/folder_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -16,7 +24,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit folder name and description</div> <div class="toolFormBody"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): <form name="folder" action="${h.url_for( controller='library', action='folder', rename=True, id=folder.id, library_id=library_id )}" method="post" > <div class="form-row"> <label>Name:</label> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/folder_permissions.mako --- a/templates/library/folder_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/folder_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,6 +21,6 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): ${render_permission_form( folder, folder.name, h.url_for( controller='library', action='folder', id=folder.id, library_id=library_id, permissions=True ), trans.user.all_roles() )} %endif diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -2,6 +2,14 @@ <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> <% from galaxy import util %> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> %if ldda == ldda.library_dataset.library_dataset_dataset_association: <b><i>This is the latest version of this library dataset</i></b> @@ -32,7 +40,7 @@ </select> </%def> -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${ldda.name}</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/ldda_info.mako --- a/templates/library/ldda_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/ldda_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -8,6 +8,11 @@ current_version = True else: current_version = False + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> %if current_version: @@ -39,15 +44,15 @@ Information about ${ldda.name} <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %endif - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: @@ -92,6 +97,8 @@ <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div> %endif ## Recurse for child datasets + ## TODO: eliminate this - child datasets are deprecated, and where does + ## render_dataset() come from anyway - it's not imported! %if len( ldda.visible_children ) > 0: <div> There are ${len( ldda.visible_children )} secondary datasets. diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_dataset_info.mako --- a/templates/library/library_dataset_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_dataset_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> %if library_dataset == library_dataset.library_dataset_dataset_association.library_dataset: <b><i>This is the latest version of this library dataset</i></b> @@ -19,7 +27,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_dataset_permissions.mako --- a/templates/library/library_dataset_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_dataset_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" />> + +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> %if library_dataset == library_dataset.library_dataset_dataset_association.library_dataset: <b><i>This is the latest version of this library dataset</i></b> @@ -19,7 +27,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ): +%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_info.mako --- a/templates/library/library_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_permissions.mako --- a/templates/library/library_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> + +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/mobile/history/detail.mako --- a/templates/mobile/history/detail.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/mobile/history/detail.mako Fri Aug 28 16:52:58 2009 -0400 @@ -36,8 +36,14 @@ <div class="secondary"> ## Body for history items, extra info and actions, data "peek" - - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + <% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + %> + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "queued": <div>Job is waiting to run</div> diff -r 36f438ce1f82 -r cc4944a62b66 templates/mobile/manage_library.mako --- a/templates/mobile/manage_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/mobile/manage_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -3,11 +3,19 @@ <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> <%namespace file="/library/common.mako" import="render_template_info" /> +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> + %if msg: ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> @@ -53,7 +61,7 @@ </div> </div> %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/root/history_common.mako --- a/templates/root/history_common.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/root/history_common.mako Fri Aug 28 16:52:58 2009 -0400 @@ -2,12 +2,17 @@ ## Render the dataset `data` as history item, using `hid` as the displayed id <%def name="render_dataset( data, hid, show_deleted_on_refresh = False )"> <% - if data.state in ['no state','',None]: - data_state = "queued" - else: - data_state = data.state + if data.state in ['no state','',None]: + data_state = "queued" + else: + data_state = data.state + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div class="historyItemWrapper historyItem historyItem-${data_state} historyItem-noPermission" id="historyItem-${data.id}"> %else: <div class="historyItemWrapper historyItem historyItem-${data_state}" id="historyItem-${data.id}"> @@ -41,7 +46,7 @@ ## Body for history items, extra info and actions, data "peek" <div id="info${data.id}" class="historyItemBody"> - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "upload": <div>Dataset is uploading</div> diff -r 36f438ce1f82 -r cc4944a62b66 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Fri Aug 28 15:59:16 2009 -0400 +++ b/test/base/twilltestcase.py Fri Aug 28 16:52:58 2009 -0400 @@ -1229,7 +1229,7 @@ tc.fv( '1', 'new_element_description_1', ele_help_1.replace( '+', ' ' ) ) tc.submit( 'new_info_template_button' ) self.home() - def add_folder( self, library_id, folder_id, name='Folder One', description='NThis is Folder One' ): + def add_folder( self, library_id, folder_id, name='Folder One', description='This is Folder One' ): """Create a new folder""" self.home() self.visit_url( "%s/admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) ) diff -r 36f438ce1f82 -r cc4944a62b66 universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample Fri Aug 28 15:59:16 2009 -0400 +++ b/universe_wsgi.ini.sample Fri Aug 28 16:52:58 2009 -0400 @@ -25,6 +25,11 @@ #database_engine_option_echo_pool = true #database_engine_option_pool_size = 10 #database_engine_option_max_overflow = 20 + +# If using MySQL, see: +# http://rapd.wordpress.com/2008/03/02/sqlalchemy-sqlerror-operationalerror-2… +# To handle this issue, try the following setting: +#database_engine_option_pool_recycle = 7200 # Where dataset files are saved file_path = database/files

1 0

[hg] galaxy 2638: One more flup reference
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d261f41a2a03 changeset: 2638:d261f41a2a03 user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 15:29:53 2009 -0400 description: One more flup reference 1 file(s) affected in this change: lib/galaxy/web/framework/base.py diffs (11 lines): diff -r 0fd76a02c2b2 -r d261f41a2a03 lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Fri Aug 28 15:12:55 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Fri Aug 28 15:29:53 2009 -0400 @@ -13,7 +13,6 @@ import pkg_resources; pkg_resources.require( "Paste" ) pkg_resources.require( "Routes" ) -pkg_resources.require( "flup" ) pkg_resources.require( "WebOb" ) import routes

1 0

[hg] galaxy 2633: Migration script to handle mysql index error i...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/b85cb0a65f46 changeset: 2633:b85cb0a65f46 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 13:13:18 2009 -0400 description: Migration script to handle mysql index error in previous migration script ( 0015_tagging.py ) 1 file(s) affected in this change: lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py diffs (56 lines): diff -r 31150f0b216d -r b85cb0a65f46 lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py Fri Aug 28 13:13:18 2009 -0400 @@ -0,0 +1,51 @@ +""" +This script fixes a problem introduced in 0015_tagging.py. MySQL has a name length +limit and thus the index "ix_hda_ta_history_dataset_association_id" has to be +manually created. +""" + +from sqlalchemy import * +from migrate import * + +import datetime +now = datetime.datetime.utcnow + +# Need our custom types, but don't import anything else from model +from galaxy.model.custom_types import * + +import logging +log = logging.getLogger( __name__ ) + +metadata = MetaData( migrate_engine ) + +def display_migration_details(): + print "" + print "This script fixes a problem introduced in 0015_tagging.py. MySQL has a" + print "name length limit and thus the index 'ix_hda_ta_history_dataset_association_id'" + print "has to be manually created." + +HistoryDatasetAssociationTagAssociation_table = Table( "history_dataset_association_tag_association", metadata, + Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +def upgrade(): + display_migration_details() + metadata.reflect() + i = Index( "ix_hda_ta_history_dataset_association_id", HistoryDatasetAssociationTagAssociation_table.c.history_dataset_association_id ) + try: + i.create() + except Exception, e: + print str(e) + log.debug( "Adding index 'ix_hdata_history_dataset_association_id' to table 'history_dataset_association_tag_association' table failed: %s" % str( e ) ) + +def downgrade(): + metadata.reflect() + i = Index( "ix_hda_ta_history_dataset_association_id", HistoryDatasetAssociationTagAssociation_table.c.history_dataset_association_id ) + try: + i.drop() + except Exception, e: + print str(e) + log.debug( "Removing index 'ix_hdata_history_dataset_association_id' to table 'history_dataset_association_tag_association' table failed: %s" % str( e ) ) \ No newline at end of file

1 0

[hg] galaxy 2634: Fix for unicode filenames in upload.
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e87013fd0716 changeset: 2634:e87013fd0716 user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 14:53:51 2009 -0400 description: Fix for unicode filenames in upload. 3 file(s) affected in this change: eggs.ini lib/galaxy/web/framework/__init__.py templates/root/history_common.mako diffs (55 lines): diff -r b85cb0a65f46 -r e87013fd0716 eggs.ini --- a/eggs.ini Fri Aug 28 13:13:18 2009 -0400 +++ b/eggs.ini Fri Aug 28 14:53:51 2009 -0400 @@ -32,7 +32,7 @@ flup = 0.5 lrucache = 0.2 ;lsprof - james -Mako = 0.1.10 +Mako = 0.2.4 MyghtyUtils = 0.52 nose = 0.9.1 NoseHTML = 0.2 @@ -81,7 +81,7 @@ elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz flup = http://www.saddi.com/software/flup/dist/archive/flup-r2311.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz -Mako = http://www.makotemplates.org/downloads/Mako-0.1.10.tar.gz +Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2 diff -r b85cb0a65f46 -r e87013fd0716 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Fri Aug 28 13:13:18 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Fri Aug 28 14:53:51 2009 -0400 @@ -583,12 +583,12 @@ data.update( kwargs ) ## return template.render( **data ) def render( environ, start_response ): - response_write = start_response( self.response.wsgi_status(), - self.response.wsgi_headeritems() ) - class C: - def write( self, *args, **kwargs ): - response_write( *args, **kwargs ) - context = mako.runtime.Context( C(), **data ) + response_write = start_response( self.response.wsgi_status(), self.response.wsgi_headeritems() ) + class StreamBuffer( object ): + def write( self, d ): + response_write( d.encode( 'utf-8' ) ) + buffer = StreamBuffer() + context = mako.runtime.Context( buffer, **data ) template.render_context( context ) return [] return render diff -r b85cb0a65f46 -r e87013fd0716 templates/root/history_common.mako --- a/templates/root/history_common.mako Fri Aug 28 13:13:18 2009 -0400 +++ b/templates/root/history_common.mako Fri Aug 28 14:53:51 2009 -0400 @@ -35,7 +35,7 @@ <a class="icon-button delete" title="delete" href="${h.url_for( action='delete', id=data.id, show_deleted_on_refresh=show_deleted_on_refresh )}" id="historyItemDeleter-${data.id}"></a> </div> <span class="state-icon"></span> - <span class="historyItemTitle"><b>${hid}: ${data.display_name()}</b></span> + <span class="historyItemTitle"><b>${hid}: ${data.display_name().decode('utf-8')}</b></span> </div> ## Body for history items, extra info and actions, data "peek"

1 0

[hg] galaxy 2635: Updating version of Beaker egg (needed by Mako...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3df00582ca44 changeset: 2635:3df00582ca44 user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 15:06:41 2009 -0400 description: Updating version of Beaker egg (needed by Mako, no longer used by Galaxy directly) 1 file(s) affected in this change: eggs.ini diffs (21 lines): diff -r e87013fd0716 -r 3df00582ca44 eggs.ini --- a/eggs.ini Fri Aug 28 14:53:51 2009 -0400 +++ b/eggs.ini Fri Aug 28 15:06:41 2009 -0400 @@ -26,7 +26,7 @@ numpy = 1.2.1 [eggs:noplatform] -Beaker = 0.5 +Beaker = 1.4 docutils = 0.4 elementtree = 1.2.6_20050316 flup = 0.5 @@ -76,7 +76,7 @@ python_lzo = http://www.oberhumer.com/opensource/lzo/download/LZO-v1/python-lzo-1.08.tar… http://www.oberhumer.com/opensource/lzo/download/LZO-v1/lzo-1.08.tar.gz threadframe = http://www.majid.info/python/threadframe/threadframe-0.2.tar.gz guppy = http://pypi.python.org/packages/source/g/guppy/guppy-0.1.8.tar.gz -Beaker = http://cheeseshop.python.org/packages/source/B/Beaker/Beaker-0.5.tar.gz +Beaker = http://cheeseshop.python.org/packages/source/B/Beaker/Beaker-1.4.tar.gz docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz flup = http://www.saddi.com/software/flup/dist/archive/flup-r2311.tar.gz

1 0

[hg] galaxy 2636: Merge
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/b7a3a82b71ce changeset: 2636:b7a3a82b71ce user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 15:07:48 2009 -0400 description: Merge 0 file(s) affected in this change: diffs (44 lines): diff -r 3df00582ca44 -r b7a3a82b71ce lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Fri Aug 28 15:06:41 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Fri Aug 28 15:07:48 2009 -0400 @@ -9,6 +9,7 @@ from galaxy.datatypes.sniff import * from urllib import urlencode, quote_plus import zipfile +import os, subprocess, tempfile log = logging.getLogger(__name__) @@ -240,6 +241,26 @@ """Class describing a BAM binary file""" file_ext = "bam" MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True ) + def init_meta( self, dataset, copy_from=None ): + data.Binary.init_meta( self, dataset, copy_from=copy_from ) + def set_meta( self, dataset, overwrite = True, **kwd ): + """ + Sets index for BAM file. + """ + index_file = dataset.metadata.bam_index + if not index_file: + index_file = dataset.metadata.spec['bam_index'].param.new_file( dataset = dataset ) + tmp_dir = tempfile.gettempdir() + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + try: + subprocess.check_call(['cd', tmp_dir], shell=True) + subprocess.check_call('cp %s %s' % (dataset.file_name, tmpf1.name), shell=True) + subprocess.check_call('samtools index %s' % tmpf1.name, shell=True) + subprocess.check_call('cp %s.bai %s' % (tmpf1.name, index_file.file_name), shell=True) + except subprocess.CalledProcessError: + sys.stderr.write('There was a problem creating the index for the BAM file\n') + tmpf1.close() + dataset.metadata.bam_index = index_file def set_peek( self, dataset ): if not dataset.dataset.purged: export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey}) @@ -256,4 +277,3 @@ def get_mime(self): """Returns the mime type of the datatype""" return 'application/octet-stream' - \ No newline at end of file

1 0

[hg] galaxy 2637: Purge references to Beaker and flup from buildapp
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/0fd76a02c2b2 changeset: 2637:0fd76a02c2b2 user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 15:12:55 2009 -0400 description: Purge references to Beaker and flup from buildapp 2 file(s) affected in this change: eggs.ini lib/galaxy/web/buildapp.py diffs (48 lines): diff -r b7a3a82b71ce -r 0fd76a02c2b2 eggs.ini --- a/eggs.ini Fri Aug 28 15:07:48 2009 -0400 +++ b/eggs.ini Fri Aug 28 15:12:55 2009 -0400 @@ -29,7 +29,6 @@ Beaker = 1.4 docutils = 0.4 elementtree = 1.2.6_20050316 -flup = 0.5 lrucache = 0.2 ;lsprof - james Mako = 0.2.4 @@ -79,7 +78,6 @@ Beaker = http://cheeseshop.python.org/packages/source/B/Beaker/Beaker-1.4.tar.gz docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz -flup = http://www.saddi.com/software/flup/dist/archive/flup-r2311.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… diff -r b7a3a82b71ce -r 0fd76a02c2b2 lib/galaxy/web/buildapp.py --- a/lib/galaxy/web/buildapp.py Fri Aug 28 15:07:48 2009 -0400 +++ b/lib/galaxy/web/buildapp.py Fri Aug 28 15:12:55 2009 -0400 @@ -11,7 +11,6 @@ from paste.util import import_string from paste import httpexceptions from paste.deploy.converters import asbool -import flup.middleware.session as flup_session import pkg_resources log = logging.getLogger( __name__ ) @@ -116,17 +115,6 @@ from paste import recursive app = recursive.RecursiveMiddleware( app, conf ) log.debug( "Enabling 'recursive' middleware" ) - ## # Session middleware puts a session factory into the environment - ## if asbool( conf.get( 'use_session', True ) ): - ## store = flup_session.MemorySessionStore() - ## app = flup_session.SessionMiddleware( store, app ) - ## log.debug( "Enabling 'flup session' middleware" ) - # Beaker session middleware - if asbool( conf.get( 'use_beaker_session', False ) ): - pkg_resources.require( "Beaker" ) - import beaker.session - app = beaker.session.SessionMiddleware( app, conf ) - log.debug( "Enabling 'beaker session' middleware" ) # Various debug middleware that can only be turned on if the debug # flag is set, either because they are insecure or greatly hurt # performance

1 0

[hg] galaxy 2629: Updated the Bam datatype so that the file is i...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d8240234bd10 changeset: 2629:d8240234bd10 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Aug 27 10:04:01 2009 -0400 description: Updated the Bam datatype so that the file is indexed and the index is stored as metadata 1 file(s) affected in this change: lib/galaxy/datatypes/images.py diffs (44 lines): diff -r d99cee3a4efd -r d8240234bd10 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Wed Aug 26 07:12:04 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Thu Aug 27 10:04:01 2009 -0400 @@ -9,6 +9,7 @@ from galaxy.datatypes.sniff import * from urllib import urlencode, quote_plus import zipfile +import os, subprocess, tempfile log = logging.getLogger(__name__) @@ -240,6 +241,26 @@ """Class describing a BAM binary file""" file_ext = "bam" MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True ) + def init_meta( self, dataset, copy_from=None ): + data.Binary.init_meta( self, dataset, copy_from=copy_from ) + def set_meta( self, dataset, overwrite = True, **kwd ): + """ + Sets index for BAM file. + """ + index_file = dataset.metadata.bam_index + if not index_file: + index_file = dataset.metadata.spec['bam_index'].param.new_file( dataset = dataset ) + tmp_dir = tempfile.gettempdir() + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + try: + subprocess.check_call(['cd', tmp_dir], shell=True) + subprocess.check_call('cp %s %s' % (dataset.file_name, tmpf1.name), shell=True) + subprocess.check_call('samtools index %s' % tmpf1.name, shell=True) + subprocess.check_call('cp %s.bai %s' % (tmpf1.name, index_file.file_name), shell=True) + except subprocess.CalledProcessError: + sys.stderr.write('There was a problem creating the index for the BAM file\n') + tmpf1.close() + dataset.metadata.bam_index = index_file def set_peek( self, dataset ): if not dataset.dataset.purged: export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey}) @@ -256,4 +277,3 @@ def get_mime(self): """Returns the mime type of the datatype""" return 'application/octet-stream' - \ No newline at end of file

1 0