- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2593: Fixed a bug in rendering form wrt AddressField
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/fc4c0c7e5da9 changeset: 2593:fc4c0c7e5da9 user: rc date: Thu Aug 20 16:54:44 2009 -0400 description: Fixed a bug in rendering form wrt AddressField Fixed other bugs admin's request UI 6 file(s) affected in this change: lib/galaxy/web/controllers/forms.py lib/galaxy/web/controllers/requests_admin.py lib/galaxy/web/framework/__init__.py templates/admin/requests/grid.mako test/base/twilltestcase.py test/functional/test_forms_and_requests.py diffs (290 lines): diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/forms.py --- a/lib/galaxy/web/controllers/forms.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/controllers/forms.py Thu Aug 20 16:54:44 2009 -0400 @@ -421,12 +421,14 @@ return [ fdc.latest_form for fdc in fdc_list ] -def get_form_widgets( trans, form, contents=[], **kwd ): +def get_form_widgets( trans, form, contents=[], user=None, **kwd ): ''' Return the list of widgets that comprise a form definition, including field contents if any. ''' params = util.Params( kwd ) + if not user: + user = trans.user widgets = [] for index, field in enumerate( form.fields ): field_name = 'field_%i' % index @@ -458,7 +460,7 @@ field_widget.set_size( 3, 40 ) field_widget.value = value elif field['type'] == 'AddressField': - field_widget.user = trans.user + field_widget.user = user field_widget.value = value field_widget.params = params elif field[ 'type' ] == 'SelectField': diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400 @@ -177,10 +177,9 @@ widget=TextField('desc', 40, desc), helptext='(Optional)')) # libraries selectbox - libraries = get_authorized_libs(trans, trans.user) - libui = self.__library_ui(libraries, request, **kwd) + libui = self.__library_ui(trans, trans.user, request, **kwd) widgets = widgets + libui - widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd) + widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd) return trans.fill_template( '/admin/requests/edit_request.mako', select_request_type=select_request_type, request_type=request.type, @@ -673,13 +672,9 @@ util.restore_text( params.get( 'desc', '' ) )), helptext='(Optional)')) # libraries selectbox - if not user: - libraries = [] - else: - libraries = get_authorized_libs(trans, user) - libui = self.__library_ui(libraries, **kwd) + libui = self.__library_ui(trans, user, **kwd) widgets = widgets + libui - widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd) + widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], user=user, **kwd) return trans.fill_template( '/admin/requests/new_request.mako', select_request_type=select_request_type, request_type=request_type, @@ -706,9 +701,13 @@ select_user.add_option(user.email, user.id) return select_user - def __library_ui(self, libraries, request=None, **kwd): + def __library_ui(self, trans, user, request=None, **kwd): params = util.Params( kwd ) lib_id = params.get( 'library_id', 'none' ) + if not user: + libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() + else: + libraries = get_authorized_libs(trans, user) lib_list = SelectField('library_id', refresh_on_change=True, refresh_on_change_values=['new']) if request and lib_id == 'none': @@ -724,13 +723,12 @@ else: lib_list.add_option(lib.name, lib.id) if lib_id == 'new': - lib_list.add_option('Create a new library', 'new', selected=True) + lib_list.add_option('Create a new data library', 'new', selected=True) else: - lib_list.add_option('Create a new library', 'new') - widget = dict(label='Library', + lib_list.add_option('Create a new data library', 'new') + widget = dict(label='Data library', widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored.') + helptext='Data library where the resultant dataset will be stored.') if lib_id == 'new': new_lib = dict(label='Create a new Library', widget=TextField('new_library_name', 40, diff -r a7f9325bb319 -r fc4c0c7e5da9 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Thu Aug 20 11:43:28 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Thu Aug 20 16:54:44 2009 -0400 @@ -641,7 +641,6 @@ self.name = name self.action = action self.submit_text = submit_text - #self.submit_name = submit_text+"_button" self.inputs = [] def add_input( self, type, name, label, value=None, error=None, help=None, use_label=True ): self.inputs.append( FormInput( type, label, name, value, error, help, use_label ) ) diff -r a7f9325bb319 -r fc4c0c7e5da9 templates/admin/requests/grid.mako --- a/templates/admin/requests/grid.mako Thu Aug 20 11:43:28 2009 -0400 +++ b/templates/admin/requests/grid.mako Thu Aug 20 16:54:44 2009 -0400 @@ -76,7 +76,7 @@ <div class="grid-header"> <h2>${grid.title}</h2> - %if len(trans.user.requests): + %if len(trans.app.model.Request.query().all()): ##<span class="title">Filter:</span> %for i, filter in enumerate( grid.standard_filters ): %if i > 0: diff -r a7f9325bb319 -r fc4c0c7e5da9 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Aug 20 11:43:28 2009 -0400 +++ b/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400 @@ -1077,6 +1077,17 @@ for index, field_value in enumerate(fields): tc.fv( "1", "field_%i" % index, field_value ) tc.submit( "create_request_button" ) + def create_request_admin( self, request_type_id, user_id, name, desc, library_id, fields ): + self.home() + self.visit_url( "%s/requests_admin/new?create=True&select_request_type=%i" % (self.url, request_type_id) ) + self.check_page_for_string( 'Add a new request' ) + tc.fv( "1", "select_user", str(user_id) ) + tc.fv( "1", "name", name ) + tc.fv( "1", "desc", desc ) + tc.fv( "1", "library_id", str(library_id) ) + for index, field_value in enumerate(fields): + tc.fv( "1", "field_%i" % index, field_value ) + tc.submit( "create_request_button" ) def add_samples( self, request_id, request_name, samples ): self.home() self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) )) diff -r a7f9325bb319 -r fc4c0c7e5da9 test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Thu Aug 20 11:43:28 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400 @@ -100,28 +100,13 @@ global request_type request_type = galaxy.model.RequestType.filter( and_( galaxy.model.RequestType.table.c.name==request_type_name ) ).all()[-1] assert request_type is not None, 'Problem retrieving request type named "%s" from the database' % request_type_name - def test_025_create_address( self ): - """Testing address creation""" - #self.create_address( user_address1 ) - #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) - ## TODO: FIX HACK - ## the user address creation should be done as a test. - global user_address - user_address = galaxy.model.UserAddress() - user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test(a)bx.psu.edu' ).first() - user_address.desc = address1[ 'short_desc' ] - user_address.name = address1[ 'name' ] - user_address.institution = address1[ 'institution' ] - user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] - user_address.city = address1[ 'city' ] - user_address.state = address1[ 'state' ] - user_address.postal_code = address1[ 'postal_code' ] - user_address.country = address1[ 'country' ] - user_address.phone = address1[ 'phone' ] - user_address.flush() - user_address.user.refresh() - def test_030_create_request( self ): - """Testing creating and submitting a request""" + def test_025_create_address_and_library( self ): + """Testing address & library creation""" + # first create a regular user + self.logout() + self.login( email='test1(a)bx.psu.edu' ) + self.logout() + self.login( email='test(a)bx.psu.edu' ) # first create a library for the request so that it can be submitted later lib_name = 'TestLib001' self.create_library( lib_name, '' ) @@ -144,12 +129,48 @@ break if not admin_user_private_role: raise AssertionError( "Private role not found for user '%s'" % admin_user.email ) + global regular_user1 + regular_user1 = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() + assert regular_user1 is not None, 'Problem retrieving user with email "test1(a)bx.psu.edu" from the database' + # Get the regular user's private role for later use + global regular_user1_private_role + regular_user1_private_role = None + for role in regular_user1.all_roles(): + if role.name == regular_user1.email and role.description == 'Private Role for %s' % regular_user1.email: + regular_user1_private_role = role + break + if not regular_user1_private_role: + raise AssertionError( "Private role not found for user '%s'" % regular_user1.email ) # Set permissions on the library, sort for later testing permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] permissions_out = [] - # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted to + # Role one members are: admin_user, regular_user1. Each of these users will be permitted to # LIBRARY_ADD, LIBRARY_MODIFY, LIBRARY_MANAGE for library items. - self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) + self.set_library_permissions( str( library_one.id ), library_one.name, str( regular_user1_private_role.id ), permissions_in, permissions_out ) + # create address + #self.create_address( user_address1 ) + #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) + ## TODO: FIX HACK + ## the user address creation should be done as a test. + global user_address + user_address = galaxy.model.UserAddress() + user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() + user_address.desc = address1[ 'short_desc' ] + user_address.name = address1[ 'name' ] + user_address.institution = address1[ 'institution' ] + user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] + user_address.city = address1[ 'city' ] + user_address.state = address1[ 'state' ] + user_address.postal_code = address1[ 'postal_code' ] + user_address.country = address1[ 'country' ] + user_address.phone = address1[ 'phone' ] + user_address.flush() + user_address.user.refresh() + def test_030_create_request( self ): + """Testing creating and submitting a request as a regular user""" + # login as a regular user + self.logout() + self.login( email='test1(a)bx.psu.edu' ) # set field values fields = ['field one value', 'field two value', str(user_address.id)] # create the request @@ -162,7 +183,6 @@ galaxy.model.Request.table.c.deleted==False ) ).first() # check if the request's state is now set to 'unsubmitted' assert request_one.state is not request_one.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.UNSUBMITTED ) - # sample fields samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] @@ -181,6 +201,8 @@ def test_035_request_lifecycle( self ): """Testing request lifecycle as it goes through all the states""" # goto admin manage requests page + self.logout() + self.login( email='test(a)bx.psu.edu' ) self.home() self.visit_page( 'requests_admin/list' ) self.check_page_for_string( request_one.name ) @@ -203,10 +225,43 @@ request_one.refresh() # check if the request's state is now set to 'complete' assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.COMPLETE ) +# def test_40_admin_create_request_on_behalf_of_regular_user( self ): +# """Testing creating and submitting a request as an admin on behalf of a regular user""" +# self.logout() +# self.login( email='test(a)bx.psu.edu' ) +## permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] +## permissions_out = [] +## self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) +# # set field values +# fields = ['field one value', 'field two value', str(user_address.id)] +# # create the request +# request_name, request_desc = 'Request Two', 'Request Two Description' +# self.create_request_admin(request_type.id, regular_user1.id, request_name, request_desc, library_one.id, fields) +# self.check_page_for_string( request_name ) +# self.check_page_for_string( request_desc ) +# global request_two +# request_one = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name, +# galaxy.model.Request.table.c.deleted==False ) ).first() +# # check if the request's state is now set to 'unsubmitted' +# assert request_two.state is not request_two.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.UNSUBMITTED ) +# # sample fields +# samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), +# ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] +# # add samples to this request +# self.add_samples( request_two.id, request_two.name, samples ) +# for sample_name, fields in samples: +# self.check_page_for_string( sample_name ) +# self.check_page_for_string( 'Unsubmitted' ) +# for field_value in fields: +# self.check_page_for_string( field_value ) +# # submit the request +# self.submit_request( request_two.id, request_two.name ) +# request_two.refresh() +# # check if the request's state is now set to 'submitted' +# assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.SUBMITTED ) - \ No newline at end of file

1 0

[hg] galaxy 2595: Merge with 2c1916d89194f6802102cab13e67bebcf68...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/108533bf35b8 changeset: 2595:108533bf35b8 user: rc date: Fri Aug 21 15:18:17 2009 -0400 description: Merge with 2c1916d89194f6802102cab13e67bebcf68d1d75 0 file(s) affected in this change: diffs (131 lines): diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:17:26 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Fri Aug 21 15:18:17 2009 -0400 @@ -20,12 +20,10 @@ for upload_dataset in incoming['files']: f = upload_dataset['file_data'] if isinstance( f, FieldStorage ): - # very small files can be StringIOs - if 'name' in dir( f.file ) and f.file.name != '<fdopen>': - local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) - f.file.close() - else: - local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0] + assert not isinstance( f.file, StringIO.StringIO ) + assert f.file.name != '<fdopen>' + local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) + f.file.close() upload_dataset['file_data'] = dict( filename = f.filename, local_filename = local_filename ) if upload_dataset['url_paste'].strip() != '': diff -r 55b0c25aa164 -r 108533bf35b8 lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Fri Aug 21 15:17:26 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Fri Aug 21 15:18:17 2009 -0400 @@ -216,11 +216,18 @@ # tempfiles. Necessary for externalizing the upload tool. It's a little hacky # but for performance reasons it's way better to use Paste's tempfile than to # create a new one and copy. -import cgi +import cgi, tempfile class FieldStorage( cgi.FieldStorage ): def make_file(self, binary=None): - import tempfile return tempfile.NamedTemporaryFile() + def read_lines(self): + # Always make a new file + self.file = self.make_file() + self.__file = None + if self.outerboundary: + self.read_lines_to_outerboundary() + else: + self.read_lines_to_eof() cgi.FieldStorage = FieldStorage class Request( webob.Request ): diff -r 55b0c25aa164 -r 108533bf35b8 static/welcome.html --- a/static/welcome.html Fri Aug 21 15:17:26 2009 -0400 +++ b/static/welcome.html Fri Aug 21 15:18:17 2009 -0400 @@ -71,7 +71,7 @@ <table border="0" cellpadding="0" cellspacing="0" width="100%"> <tr> <td> - <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:500,scroll:'no'})"> + <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/quickie1_TabSeq.flv',width:640,height:500,scroll:'no'})"> <div class="quickie"> <img src="images/qk/quickie1_small.png" border="0"> </div> diff -r 55b0c25aa164 -r 108533bf35b8 tools/extract/liftOver_wrapper_code.py --- a/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/extract/liftOver_wrapper_code.py Fri Aug 21 15:18:17 2009 -0400 @@ -3,7 +3,6 @@ to_dbkey = param_dict['to_dbkey'].split('.')[0].split('To')[1] to_dbkey = to_dbkey[0].lower()+to_dbkey[1:] out_data['out_file1'].set_dbkey(to_dbkey) - out_data['out_file2'].set_dbkey(to_dbkey) out_data['out_file1'].name = out_data['out_file1'].name + " [ MAPPED COORDINATES ]" out_data['out_file2'].name = out_data['out_file2'].name + " [ UNMAPPED COORDINATES ]" diff -r 55b0c25aa164 -r 108533bf35b8 tools/metag_tools/split_paired_reads.py --- a/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/metag_tools/split_paired_reads.py Fri Aug 21 15:18:17 2009 -0400 @@ -1,7 +1,7 @@ #! /usr/bin/python """ -Split Solexa paired end reads +Split fixed length paired end reads """ import os, sys @@ -12,9 +12,13 @@ outfile_end1 = open(sys.argv[2], 'w') outfile_end2 = open(sys.argv[3], 'w') - for i, line in enumerate(file(infile)): + i = 0 + + for line in file( infile ): line = line.rstrip() - if not line or line.startswith('#'): continue + + if not line: + continue end1 = '' end2 = '' @@ -42,5 +46,9 @@ outfile_end1.write('%s\n' %(end1)) outfile_end2.write('%s\n' %(end2)) + i += 1 + + if i % 4 != 0 : + sys.stderr.write("WARNING: Number of lines in the input file was not divisible by 4.\nCheck consistency of the input fastq file.\n") outfile_end1.close() outfile_end2.close() \ No newline at end of file diff -r 55b0c25aa164 -r 108533bf35b8 tools/solid_tools/maq_cs_wrapper.py --- a/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:17:26 2009 -0400 +++ b/tools/solid_tools/maq_cs_wrapper.py Fri Aug 21 15:18:17 2009 -0400 @@ -48,9 +48,9 @@ cmd1 = "solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,tmps.name,f3_read_fname,f3_qual_fname,r3_read_fname,r3_qual_fname) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpffastq.name)) - os.system('zcat -f %s >> %s' %(tmpr.name,tmprfastq.name)) - os.system('zcat -f %s >> %s' %(tmps.name,tmpsfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpffastq.name)) + os.system('gunzip -c %s >> %s' %(tmpr.name,tmprfastq.name)) + os.system('gunzip -c %s >> %s' %(tmps.name,tmpsfastq.name)) except Exception, eq: stop_err("Error converting data to fastq format." + str(eq)) @@ -135,7 +135,7 @@ cmd1 = "solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,None,None,f3_read_fname,f3_qual_fname,None,None) try: os.system(cmd1) - os.system('zcat -f %s >> %s' %(tmpf.name,tmpfastq.name)) + os.system('gunzip -c %s >> %s' %(tmpf.name,tmpfastq.name)) tmpf.close() except: stop_err("Error converting data to fastq format.")

1 0

[hg] galaxy 2594: Added request editing functional test
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/55b0c25aa164 changeset: 2594:55b0c25aa164 user: rc date: Fri Aug 21 15:17:26 2009 -0400 description: Added request editing functional test Fixed a few bugs on the admin side request error handling and editing 6 file(s) affected in this change: lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py templates/admin/requests/show_request.mako templates/user/address.mako test/base/twilltestcase.py test/functional/test_forms_and_requests.py diffs (353 lines): diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Aug 20 16:54:44 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Fri Aug 21 15:17:26 2009 -0400 @@ -141,6 +141,9 @@ helptext='')) request_details.append(dict(label='Type', value=request.type.name, + helptext='')) + request_details.append(dict(label='State', + value=request.state, helptext='')) request_details.append(dict(label='Date created', value=request.create_time, diff -r fc4c0c7e5da9 -r 55b0c25aa164 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 16:54:44 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Fri Aug 21 15:17:26 2009 -0400 @@ -32,7 +32,7 @@ ] operations = [ grids.GridOperation( "Submit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() and item.samples ) ), - grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), + grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), grids.GridOperation( "Delete", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), ] @@ -71,14 +71,15 @@ ''' List all request made by the current user ''' - status = message = None + message = util.restore_text( kwargs.get( 'message', '' ) ) + status = kwargs.get( 'status', 'done' ) self.request_grid.default_filter = dict(state=trans.app.model.Request.states.SUBMITTED, deleted=False) if 'operation' in kwargs: operation = kwargs['operation'].lower() if operation == "show_request": id = trans.security.decode_id(kwargs['id']) - return self.__show_request(trans, id) + return self.__show_request(trans, id, status, message) elif operation == "submit": id = trans.security.decode_id(kwargs['id']) return self.__submit(trans, id) @@ -110,7 +111,7 @@ try: request = trans.app.model.Request.get(int(params.get('request_id', None))) except: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", @@ -125,13 +126,13 @@ kwd['messagetype'] = 'error' kwd['msg'] = msg kwd['show'] = 'True' - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='edit', **kwd) ) request = self.__save_request(trans, request, **kwd) msg = 'The changes made to the request named %s has been saved' % request.name if params.get('save_changes_request_button', False) == 'Save changes': - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', message=msg , status='done') ) @@ -139,7 +140,7 @@ new_kwd = {} new_kwd['request_id'] = request.id new_kwd['edit_samples_button'] = 'Edit samples' - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='show_request', msg=msg , messagetype='done', @@ -177,7 +178,7 @@ widget=TextField('desc', 40, desc), helptext='(Optional)')) # libraries selectbox - libui = self.__library_ui(trans, trans.user, request, **kwd) + libui = self.__library_ui(trans, request.user, request, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, request.user, **kwd) return trans.fill_template( '/admin/requests/edit_request.mako', @@ -212,6 +213,7 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', + show_filter=trans.app.model.Request.states.UNSUBMITTED, status='done', message='The request <b>%s</b> has been deleted.' % request.name, **kwd) ) @@ -233,6 +235,7 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', + show_filter=trans.app.model.Request.states.UNSUBMITTED, status='done', message='The request <b>%s</b> has been undeleted.' % request.name, **kwd) ) @@ -290,7 +293,7 @@ if msg: return trans.response.send_redirect( web.url_for( controller='requests_admin', action='edit', - messagetype = 'error', + messagetype='error', msg=msg, request_id=request.id, show='True') ) @@ -328,11 +331,11 @@ for field_index in range(len(request.type.sample_form.fields)): sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) self.current_samples.append([sample_name, sample_values]) - def __show_request(self, trans, id): + def __show_request(self, trans, id, messagetype, msg): try: request = trans.app.model.Request.get(id) except: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", @@ -348,7 +351,8 @@ current_samples = self.current_samples, sample_copy=self.__copy_sample(), details_state=self.details_state, - edit_mode=self.edit_mode) + edit_mode=self.edit_mode, + msg=msg, messagetype=messagetype) @web.expose @web.require_admin def show_request(self, trans, **kwd): @@ -381,7 +385,9 @@ return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', - message='Error in importing <b>%s</b> samples file' % file_obj.file, + operation='show_request', + id=trans.security.encode_id(request.id), + message='Error in importing samples from the given file.', **kwd)) elif params.get('add_sample_button', False) == 'Add New': # save the all (saved+unsaved) sample info in 'current_samples' @@ -526,20 +532,20 @@ # list of widgets to be rendered on the request form request_details = [] # main details + request_details.append(dict(label='User', + value=str(request.user.email), + helptext='')) request_details.append(dict(label='Description', value=request.desc, helptext='')) request_details.append(dict(label='Type', value=request.type.name, helptext='')) + request_details.append(dict(label='State', + value=request.state, + helptext='')) request_details.append(dict(label='Date created', value=request.create_time, - helptext='')) - request_details.append(dict(label='Date updated', - value=request.create_time, - helptext='')) - request_details.append(dict(label='User', - value=str(request.user.email), helptext='')) # library associated if request.library: @@ -778,7 +784,7 @@ value = util.restore_text(params.get('field_%i' % index, '')) if value == 'new': # save this new address in the list of this user's addresses - user_address = trans.app.model.UserAddress( user=trans.user ) + user_address = trans.app.model.UserAddress( user=user ) user_address.desc = util.restore_text(params.get('field_%i_short_desc' % index, '')) user_address.name = util.restore_text(params.get('field_%i_name' % index, '')) user_address.institution = util.restore_text(params.get('field_%i_institution' % index, '')) @@ -812,7 +818,6 @@ request.user = user request.values = form_values request.library = library - request.state = trans.app.model.Request.states.UNSUBMITTED request.flush() return request @web.expose diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Thu Aug 20 16:54:44 2009 -0400 +++ b/templates/admin/requests/show_request.mako Fri Aug 21 15:17:26 2009 -0400 @@ -162,7 +162,7 @@ <tr> <div class="form-row"> <td> - %if current_samples: + %if current_samples and not request.complete(): <input type="submit" name="edit_samples_button" value="Edit samples"/> %endif </td> diff -r fc4c0c7e5da9 -r 55b0c25aa164 templates/user/address.mako --- a/templates/user/address.mako Thu Aug 20 16:54:44 2009 -0400 +++ b/templates/user/address.mako Fri Aug 21 15:17:26 2009 -0400 @@ -33,51 +33,48 @@ </div> - -<div class="toolForm"> - ##<div class="toolFormTitle">Addresses</div> - <div class="toolFormBody"> - <% trans.user.refresh() %> - %if not trans.user.addresses: - <label>There are no addresses</label> - %else: - <table class="grid"> - <tbody> - %for index, address in enumerate(addresses): - <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - - <td> - <div class="form-row"> - <label>${address.desc}</label> - ${address.display()} - </div> - <div class="form-row"> - <ul class="manage-table-actions"> - <li> - %if not address.deleted: - <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id, - short_desc=address.desc, - name=address.name, institution=address.institution, - address1=address.address, city=address.city, - state=address.state, postal_code=address.postal_code, - country=address.country, phone=address.phone)}"> - <span>Edit</span></a> - <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}"> - <span>Delete address</span></a> - %else: - <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}"> - <span>Undelete address</span></a> - %endif - - </li> - </ul> - </div> - </td> - </tr> - %endfor - </tbody> - </table> - %endif +%if not addresses: + <label>There are no addresses</label> +%else: + <div class="toolForm"> + <div class="toolFormBody"> + <% trans.user.refresh() %> + <table class="grid"> + <tbody> + %for index, address in enumerate(addresses): + <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> + <td> + <div class="form-row"> + <label>${address.desc}</label> + ${address.display()} + </div> + <div class="form-row"> + <ul class="manage-table-actions"> + <li> + %if not address.deleted: + <a class="action-button" href="${h.url_for( controller='user', action='edit_address', address_id=address.id, + short_desc=address.desc, + name=address.name, institution=address.institution, + address1=address.address, city=address.city, + state=address.state, postal_code=address.postal_code, + country=address.country, phone=address.phone)}"> + <span>Edit</span></a> + <a class="action-button" href="${h.url_for( controller='user', action='delete_address', address_id=address.id)}"> + <span>Delete</span></a> + %else: + <a class="action-button" href="${h.url_for( controller='user', action='undelete_address', address_id=address.id)}"> + <span>Undelete</span></a> + %endif + + </li> + </ul> + </div> + </td> + </tr> + %endfor + </tbody> + </table> + %endif + </div> </div> -</div> %endif \ No newline at end of file diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Aug 20 16:54:44 2009 -0400 +++ b/test/base/twilltestcase.py Fri Aug 21 15:17:26 2009 -0400 @@ -1088,6 +1088,16 @@ for index, field_value in enumerate(fields): tc.fv( "1", "field_%i" % index, field_value ) tc.submit( "create_request_button" ) + def edit_request( self, request_id, name, new_name, new_desc, new_library_id, new_fields): + self.home() + self.visit_url( "%s/requests/edit?request_id=%i&show=True" % (self.url, request_id) ) + self.check_page_for_string( 'Edit request "%s"' % name ) + tc.fv( "1", "name", new_name ) + tc.fv( "1", "desc", new_desc ) + tc.fv( "1", "library_id", str(new_library_id) ) + for index, field_value in enumerate(new_fields): + tc.fv( "1", "field_%i" % index, field_value ) + tc.submit( "save_changes_request_button" ) def add_samples( self, request_id, request_name, samples ): self.home() self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) )) diff -r fc4c0c7e5da9 -r 55b0c25aa164 test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Thu Aug 20 16:54:44 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Fri Aug 21 15:17:26 2009 -0400 @@ -167,7 +167,7 @@ user_address.flush() user_address.user.refresh() def test_030_create_request( self ): - """Testing creating and submitting a request as a regular user""" + """Testing creating, editing and submitting a request as a regular user""" # login as a regular user self.logout() self.login( email='test1(a)bx.psu.edu' ) @@ -193,6 +193,12 @@ self.check_page_for_string( 'Unsubmitted' ) for field_value in fields: self.check_page_for_string( field_value ) + # edit this request + fields = ['field one value (editted)', 'field two value (editted)', str(user_address.id)] + self.edit_request(request_one.id, request_one.name, request_one.name+' (Renamed)', request_one.desc+' (Re-described)', library_one.id, fields) + request_one.refresh() + self.check_page_for_string( request_name+' (Renamed)' ) + self.check_page_for_string( request_desc+' (Re-described)' ) # submit the request self.submit_request( request_one.id, request_one.name ) request_one.refresh() @@ -264,4 +270,5 @@ + \ No newline at end of file

1 0

[hg] galaxy 2589: Merge with f6e0863862efe02bb416596b08010b513f9...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/a7f9325bb319 changeset: 2589:a7f9325bb319 user: rc date: Thu Aug 20 11:43:28 2009 -0400 description: Merge with f6e0863862efe02bb416596b08010b513f9ffdf7 2 file(s) affected in this change: templates/base_panels.mako test/base/twilltestcase.py diffs (1505 lines): diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/jobs/__init__.py Thu Aug 20 11:43:28 2009 -0400 @@ -6,6 +6,8 @@ from galaxy.datatypes.tabular import * from galaxy.datatypes.interval import * from galaxy.datatypes import metadata +from galaxy.util.json import from_json_string +from galaxy.util.expressions import ExpressionContext import pkg_resources pkg_resources.require( "PasteDeploy" ) @@ -18,6 +20,12 @@ # States for running a job. These are NOT the same as data states JOB_WAIT, JOB_ERROR, JOB_INPUT_ERROR, JOB_INPUT_DELETED, JOB_OK, JOB_READY, JOB_DELETED, JOB_ADMIN_DELETED = 'wait', 'error', 'input_error', 'input_deleted', 'ok', 'ready', 'deleted', 'admin_deleted' + +# This file, if created in the job's working directory, will be used for +# setting advanced metadata properties on the job and its associated outputs. +# This interface is currently experimental, is only used by the upload tool, +# and should eventually become API'd +TOOL_PROVIDED_JOB_METADATA_FILE = 'galaxy.json' class JobManager( object ): """ @@ -320,6 +328,7 @@ self.working_directory = \ os.path.join( self.app.config.job_working_directory, str( self.job_id ) ) self.output_paths = None + self.tool_provided_job_metadata = None self.external_output_metadata = metadata.JobExternalOutputMetadataWrapper( job ) #wrapper holding the info required to restore and clean up from files used for setting metadata externally def get_param_dict( self ): @@ -422,6 +431,8 @@ dataset.blurb = 'tool error' dataset.info = message dataset.set_size() + if dataset.ext == 'auto': + dataset.extension = 'data' dataset.flush() job.state = model.Job.states.ERROR job.command_line = self.command_line @@ -486,16 +497,28 @@ except ( IOError, OSError ): self.fail( "Job %s's output dataset(s) could not be read" % job.id ) return + job_context = ExpressionContext( dict( stdout = stdout, stderr = stderr ) ) for dataset_assoc in job.output_datasets: + context = self.get_dataset_finish_context( job_context, dataset_assoc.dataset.dataset ) #should this also be checking library associations? - can a library item be added from a history before the job has ended? - lets not allow this to occur for dataset in dataset_assoc.dataset.dataset.history_associations: #need to update all associated output hdas, i.e. history was shared with job running + if context.get( 'path', None ): + # The tool can set an alternate output path for the dataset. + try: + shutil.move( context['path'], dataset.file_name ) + except ( IOError, OSError ): + if not context['stderr']: + context['stderr'] = 'This dataset could not be processed' dataset.blurb = 'done' dataset.peek = 'no peek' - dataset.info = stdout + stderr + dataset.info = context['stdout'] + context['stderr'] dataset.set_size() - if stderr: + if context['stderr']: dataset.blurb = "error" elif dataset.has_data(): + # If the tool was expected to set the extension, attempt to retrieve it + if dataset.ext == 'auto': + dataset.extension = context.get( 'ext', 'data' ) #if a dataset was copied, it won't appear in our dictionary: #either use the metadata from originating output dataset, or call set_meta on the copies #it would be quicker to just copy the metadata from the originating output dataset, @@ -510,18 +533,39 @@ #the metadata that was stored to disk for use via the external process, #and the changes made by the user will be lost, without warning or notice dataset.metadata.from_JSON_dict( self.external_output_metadata.get_output_filenames_by_dataset( dataset ).filename_out ) - if self.tool.is_multi_byte: - dataset.set_multi_byte_peek() - else: - dataset.set_peek() + try: + assert context.get( 'line_count', None ) is not None + if self.tool.is_multi_byte: + dataset.set_multi_byte_peek( line_count=context['line_count'] ) + else: + dataset.set_peek( line_count=context['line_count'] ) + except: + if self.tool.is_multi_byte: + dataset.set_multi_byte_peek() + else: + dataset.set_peek() + try: + # set the name if provided by the tool + dataset.name = context['name'] + except: + pass else: dataset.blurb = "empty" + if dataset.ext == 'auto': + dataset.extension = 'txt' dataset.flush() - if stderr: + if context['stderr']: dataset_assoc.dataset.dataset.state = model.Dataset.states.ERROR else: dataset_assoc.dataset.dataset.state = model.Dataset.states.OK - dataset_assoc.dataset.dataset.flush() + # If any of the rest of the finish method below raises an + # exception, the fail method will run and set the datasets to + # ERROR. The user will never see that the datasets are in error if + # they were flushed as OK here, since upon doing so, the history + # panel stops checking for updates. So allow the + # mapping.context.current.flush() at the bottom of this method set + # the state instead. + #dataset_assoc.dataset.dataset.flush() # Save stdout and stderr if len( stdout ) > 32768: @@ -591,7 +635,8 @@ return self.output_paths class DatasetPath( object ): - def __init__( self, real_path, false_path = None ): + def __init__( self, dataset_id, real_path, false_path = None ): + self.dataset_id = dataset_id self.real_path = real_path self.false_path = false_path def __str__( self ): @@ -605,10 +650,55 @@ self.output_paths = [] for name, data in [ ( da.name, da.dataset.dataset ) for da in job.output_datasets ]: false_path = os.path.abspath( os.path.join( self.working_directory, "galaxy_dataset_%d.dat" % data.id ) ) - self.output_paths.append( DatasetPath( data.file_name, false_path ) ) + self.output_paths.append( DatasetPath( data.id, data.file_name, false_path ) ) else: - self.output_paths = [ DatasetPath( da.dataset.file_name ) for da in job.output_datasets ] + self.output_paths = [ DatasetPath( da.dataset.dataset.id, da.dataset.file_name ) for da in job.output_datasets ] return self.output_paths + + def get_output_file_id( self, file ): + if self.output_paths is None: + self.get_output_fnames() + for dp in self.output_paths: + if self.app.config.outputs_to_working_directory and os.path.basename( dp.false_path ) == file: + return dp.dataset_id + elif os.path.basename( dp.real_path ) == file: + return dp.dataset_id + return None + + def get_tool_provided_job_metadata( self ): + if self.tool_provided_job_metadata is not None: + return self.tool_provided_job_metadata + + # Look for JSONified job metadata + self.tool_provided_job_metadata = [] + meta_file = os.path.join( self.working_directory, TOOL_PROVIDED_JOB_METADATA_FILE ) + if os.path.exists( meta_file ): + for line in open( meta_file, 'r' ): + try: + line = from_json_string( line ) + assert 'type' in line + except: + log.exception( '(%s) Got JSON data from tool, but data is improperly formatted or no "type" key in data' % self.job_id ) + log.debug( 'Offending data was: %s' % line ) + continue + # Set the dataset id if it's a dataset entry and isn't set. + # This isn't insecure. We loop the job's output datasets in + # the finish method, so if a tool writes out metadata for a + # dataset id that it doesn't own, it'll just be ignored. + if line['type'] == 'dataset' and 'dataset_id' not in line: + try: + line['dataset_id'] = self.get_output_file_id( line['dataset'] ) + except KeyError: + log.warning( '(%s) Tool provided job dataset-specific metadata without specifying a dataset' % self.job_id ) + continue + self.tool_provided_job_metadata.append( line ) + return self.tool_provided_job_metadata + + def get_dataset_finish_context( self, job_context, dataset ): + for meta in self.get_tool_provided_job_metadata(): + if meta['type'] == 'dataset' and meta['dataset_id'] == dataset.id: + return ExpressionContext( meta, job_context ) + return job_context def check_output_sizes( self ): sizes = [] diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Aug 20 11:43:28 2009 -0400 @@ -5,7 +5,7 @@ pkg_resources.require( "simplejson" ) -import logging, os, string, sys, tempfile, glob, shutil +import logging, os, string, sys, tempfile, glob, shutil, types import simplejson import binascii from UserDict import DictMixin @@ -415,6 +415,7 @@ output.metadata_source = data_elem.get("metadata_source", "") output.parent = data_elem.get("parent", None) output.label = util.xml_text( data_elem, "label" ) + output.count = int( data_elem.get("count", 1) ) output.filters = data_elem.findall( 'filter' ) self.outputs[ output.name ] = output # Any extra generated config files for the tool @@ -816,7 +817,11 @@ # If we've completed the last page we can execute the tool elif state.page == self.last_page: out_data = self.execute( trans, incoming=params ) - return 'tool_executed.mako', dict( out_data=out_data ) + try: + assert type( out_data ) is types.DictType + return 'tool_executed.mako', dict( out_data=out_data ) + except: + return 'message.mako', dict( message_type='error', message=out_data, refresh_frames=[] ) # Otherwise move on to the next page else: state.page += 1 @@ -824,15 +829,26 @@ self.fill_in_new_state( trans, self.inputs_by_page[ state.page ], state.inputs ) return 'tool_form.mako', dict( errors=errors, tool_state=state ) else: - if filter( lambda x: isinstance( x, FieldStorage ) and x.file, state.inputs.values() ): + try: + self.find_fieldstorage( state.inputs ) + except InterruptedUpload: # If inputs contain a file it won't persist. Most likely this # is an interrupted upload. We should probably find a more # standard method of determining an incomplete POST. return self.handle_interrupted( trans, state.inputs ) - else: - # Just a refresh, render the form with updated state and errors. - return 'tool_form.mako', dict( errors=errors, tool_state=state ) + except: + pass + # Just a refresh, render the form with updated state and errors. + return 'tool_form.mako', dict( errors=errors, tool_state=state ) + def find_fieldstorage( self, x ): + if isinstance( x, FieldStorage ): + raise InterruptedUpload( None ) + elif type( x ) is types.DictType: + [ self.find_fieldstorage( y ) for y in x.values() ] + elif type( x ) is types.ListType: + [ self.find_fieldstorage( y ) for y in x ] + def handle_interrupted( self, trans, inputs ): """ Upon handling inputs, if it appears that we have received an incomplete @@ -1704,3 +1720,6 @@ return value else: return incoming.get( key, default ) + +class InterruptedUpload( Exception ): + pass diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 11:43:28 2009 -0400 @@ -1,8 +1,10 @@ import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile +from cgi import FieldStorage from __init__ import ToolAction from galaxy import datatypes, jobs from galaxy.datatypes import sniff from galaxy import model, util +from galaxy.util.json import to_json_string import sys, traceback @@ -11,14 +13,28 @@ class UploadToolAction( ToolAction ): # Action for uploading files - def __init__( self ): - self.empty = False - self.line_count = None - def remove_tempfile( self, filename ): - try: - os.unlink( filename ) - except: - log.exception( 'failure removing temporary file: %s' % filename ) + def persist_uploads( self, incoming ): + if 'files' in incoming: + new_files = [] + temp_files = [] + for upload_dataset in incoming['files']: + f = upload_dataset['file_data'] + if isinstance( f, FieldStorage ): + # very small files can be StringIOs + if 'name' in dir( f.file ) and f.file.name != '<fdopen>': + local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) + f.file.close() + else: + local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0] + upload_dataset['file_data'] = dict( filename = f.filename, + local_filename = local_filename ) + if upload_dataset['url_paste'].strip() != '': + upload_dataset['url_paste'] = datatypes.sniff.stream_to_file( StringIO.StringIO( upload_dataset['url_paste'] ), prefix="strio_url_paste_" )[0] + else: + upload_dataset['url_paste'] = None + new_files.append( upload_dataset ) + incoming['files'] = new_files + return incoming def execute( self, tool, trans, incoming={}, set_output_hid = True ): dataset_upload_inputs = [] for input_name, input in tool.inputs.iteritems(): @@ -42,330 +58,100 @@ log.error( 'Got a precreated dataset (%s) but it does not belong to current user (%s)' % ( data.id, trans.user.id ) ) else: self.precreated_datasets.append( data ) + data_list = [] + + incoming = self.persist_uploads( incoming ) + + json_file = tempfile.mkstemp() + json_file_path = json_file[1] + json_file = os.fdopen( json_file[0], 'w' ) for dataset_upload_input in dataset_upload_inputs: uploaded_datasets = dataset_upload_input.get_uploaded_datasets( trans, incoming ) for uploaded_dataset in uploaded_datasets: - precreated_dataset = self.get_precreated_dataset( uploaded_dataset.precreated_name ) - dataset = self.add_file( trans, uploaded_dataset.primary_file, uploaded_dataset.name, uploaded_dataset.file_type, uploaded_dataset.is_multi_byte, uploaded_dataset.dbkey, space_to_tab = uploaded_dataset.space_to_tab, info = uploaded_dataset.info, precreated_dataset = precreated_dataset, metadata = uploaded_dataset.metadata, uploaded_dataset = uploaded_dataset ) - #dataset state is now set, we should not do anything else to this dataset - data_list.append( dataset ) - #clean up extra temp names - uploaded_dataset.clean_up_temp_files() - + data = self.get_precreated_dataset( uploaded_dataset.name ) + if not data: + data = trans.app.model.HistoryDatasetAssociation( history = trans.history, create_dataset = True ) + data.name = uploaded_dataset.name + data.state = data.states.QUEUED + data.extension = uploaded_dataset.file_type + data.dbkey = uploaded_dataset.dbkey + data.flush() + trans.history.add_dataset( data, genome_build = uploaded_dataset.dbkey ) + permissions = trans.app.security_agent.history_get_default_permissions( trans.history ) + trans.app.security_agent.set_all_dataset_permissions( data.dataset, permissions ) + else: + data.extension = uploaded_dataset.file_type + data.dbkey = uploaded_dataset.dbkey + data.flush() + trans.history.genome_build = uploaded_dataset.dbkey + if uploaded_dataset.type == 'composite': + # we need to init metadata before the job is dispatched + data.init_meta() + for meta_name, meta_value in uploaded_dataset.metadata.iteritems(): + setattr( data.metadata, meta_name, meta_value ) + data.flush() + json = dict( file_type = uploaded_dataset.file_type, + dataset_id = data.dataset.id, + dbkey = uploaded_dataset.dbkey, + type = uploaded_dataset.type, + metadata = uploaded_dataset.metadata, + primary_file = uploaded_dataset.primary_file, + extra_files_path = data.extra_files_path, + composite_file_paths = uploaded_dataset.composite_files, + composite_files = dict( [ ( k, v.__dict__ ) for k, v in data.datatype.get_composite_files( data ).items() ] ) ) + else: + try: + is_binary = uploaded_dataset.datatype.is_binary + except: + is_binary = None + json = dict( file_type = uploaded_dataset.file_type, + name = uploaded_dataset.name, + dataset_id = data.dataset.id, + dbkey = uploaded_dataset.dbkey, + type = uploaded_dataset.type, + is_binary = is_binary, + space_to_tab = uploaded_dataset.space_to_tab, + path = uploaded_dataset.path ) + json_file.write( to_json_string( json ) + '\n' ) + data_list.append( data ) + json_file.close() + #cleanup unclaimed precreated datasets: for data in self.precreated_datasets: log.info( 'Cleaned up unclaimed precreated dataset (%s).' % ( data.id ) ) data.state = data.states.ERROR data.info = 'No file contents were available.' - if data_list: - trans.app.model.flush() + if not data_list: + try: + os.remove( json_file_path ) + except: + pass + return 'No data was entered in the upload form, please go back and choose data to upload.' # Create the job object job = trans.app.model.Job() job.session_id = trans.get_galaxy_session().id job.history_id = trans.history.id job.tool_id = tool.id - try: - # For backward compatibility, some tools may not have versions yet. - job.tool_version = tool.version - except: - job.tool_version = "1.0.1" + job.tool_version = tool.version job.state = trans.app.model.Job.states.UPLOAD job.flush() log.info( 'tool %s created job id %d' % ( tool.id, job.id ) ) trans.log_event( 'created job id %d' % job.id, tool_id=tool.id ) + + for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): + job.add_parameter( name, value ) + job.add_parameter( 'paramfile', to_json_string( json_file_path ) ) + for i, dataset in enumerate( data_list ): + job.add_output_dataset( i, dataset ) + trans.app.model.flush() - #if we could make a 'real' job here, then metadata could be set before job.finish() is called - hda = data_list[0] #only our first hda is being added as output for the job, why? - job.state = trans.app.model.Job.states.OK - file_size_str = datatypes.data.nice_size( hda.dataset.file_size ) - job.info = "%s, size: %s" % ( hda.info, file_size_str ) - job.add_output_dataset( hda.name, hda ) - job.flush() - log.info( 'job id %d ended ok, file size: %s' % ( job.id, file_size_str ) ) - trans.log_event( 'job id %d ended ok, file size: %s' % ( job.id, file_size_str ), tool_id=tool.id ) - return dict( output=hda ) - - def upload_empty(self, trans, job, err_code, err_msg, precreated_dataset = None): - if precreated_dataset is not None: - data = precreated_dataset - else: - data = trans.app.model.HistoryDatasetAssociation( create_dataset=True ) - trans.app.security_agent.set_all_dataset_permissions( data.dataset, trans.app.security_agent.history_get_default_permissions( trans.history ) ) - data.name = err_code - data.extension = "txt" - data.dbkey = "?" - data.info = err_msg - data.file_size = 0 - data.state = data.states.EMPTY - data.flush() - if precreated_dataset is None: - trans.history.add_dataset( data ) - trans.app.model.flush() - # Indicate job failure by setting state and info - job.state = trans.app.model.Job.states.ERROR - job.info = err_msg - job.add_output_dataset( data.name, data ) - job.flush() - log.info( 'job id %d ended with errors, err_msg: %s' % ( job.id, err_msg ) ) - trans.log_event( 'job id %d ended with errors, err_msg: %s' % ( job.id, err_msg ), tool_id=job.tool_id ) - return dict( output=data ) - - def add_file( self, trans, temp_name, file_name, file_type, is_multi_byte, dbkey, info=None, space_to_tab=False, precreated_dataset=None, metadata = {}, uploaded_dataset = None ): - def dataset_no_data_error( data, message = 'there was an error uploading your file' ): - data.info = "No data: %s." % message - data.state = data.states.ERROR - if data.extension is None: - data.extension = 'data' - return data - data_type = None - - if precreated_dataset is not None: - data = precreated_dataset - else: - data = trans.app.model.HistoryDatasetAssociation( history = trans.history, create_dataset = True ) - trans.app.security_agent.set_all_dataset_permissions( data.dataset, trans.app.security_agent.history_get_default_permissions( trans.history ) ) - - # See if we have an empty file - if not os.path.getsize( temp_name ) > 0: - return dataset_no_data_error( data, message = 'you attempted to upload an empty file' ) - #raise BadFileException( "you attempted to upload an empty file." ) - if is_multi_byte: - ext = sniff.guess_ext( temp_name, is_multi_byte=True ) - else: - if not data_type: #at this point data_type is always None (just initialized above), so this is always True...lots of cleanup needed here - # See if we have a gzipped file, which, if it passes our restrictions, - # we'll decompress on the fly. - is_gzipped, is_valid = self.check_gzip( temp_name ) - if is_gzipped and not is_valid: - return dataset_no_data_error( data, message = 'you attempted to upload an inappropriate file' ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - elif is_gzipped and is_valid: - # We need to uncompress the temp_name file - CHUNK_SIZE = 2**20 # 1Mb - fd, uncompressed = tempfile.mkstemp() - gzipped_file = gzip.GzipFile( temp_name ) - while 1: - try: - chunk = gzipped_file.read( CHUNK_SIZE ) - except IOError: - os.close( fd ) - os.remove( uncompressed ) - return dataset_no_data_error( data, message = 'problem decompressing gzipped data' ) - #raise BadFileException( 'problem decompressing gzipped data.' ) - if not chunk: - break - os.write( fd, chunk ) - os.close( fd ) - gzipped_file.close() - # Replace the gzipped file with the decompressed file - shutil.move( uncompressed, temp_name ) - file_name = file_name.rstrip( '.gz' ) - data_type = 'gzip' - ext = '' - if not data_type: - # See if we have a zip archive - is_zipped, is_valid, test_ext = self.check_zip( temp_name ) - if is_zipped and not is_valid: - return dataset_no_data_error( data, message = 'you attempted to upload an inappropriate file' ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - elif is_zipped and is_valid: - # Currently, we force specific tools to handle this case. We also require the user - # to manually set the incoming file_type - if ( test_ext == 'ab1' or test_ext == 'scf' ) and file_type != 'binseq.zip': - return dataset_no_data_error( data, message = "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'" ) - #raise BadFileException( "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'." ) - elif test_ext == 'txt' and file_type != 'txtseq.zip': - return dataset_no_data_error( data, message = "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'" ) - #raise BadFileException( "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'." ) - if not ( file_type == 'binseq.zip' or file_type == 'txtseq.zip' ): - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files" ) - #raise BadFileException( "you must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files." ) - data_type = 'zip' - ext = file_type - if not data_type: - if self.check_binary( temp_name ): - if uploaded_dataset and uploaded_dataset.datatype and uploaded_dataset.datatype.is_binary: - #we need a more generalized way of checking if a binary upload is of the right format for a datatype...magic number, etc - data_type = 'binary' - ext = uploaded_dataset.file_type - else: - parts = file_name.split( "." ) - if len( parts ) > 1: - ext = parts[1].strip().lower() - if not( ext == 'ab1' or ext == 'scf' ): - return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - if ext == 'ab1' and file_type != 'ab1': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) - elif ext == 'scf' and file_type != 'scf': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Scf' when uploading scf files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) - data_type = 'binary' - if not data_type: - # We must have a text file - if trans.app.datatypes_registry.get_datatype_by_extension( file_type ).composite_type != 'auto_primary_file' and self.check_html( temp_name ): - return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - #if data_type != 'binary' and data_type != 'zip' and not trans.app.datatypes_registry.get_datatype_by_extension( ext ).is_binary: - if data_type != 'binary' and data_type != 'zip': - if space_to_tab: - self.line_count = sniff.convert_newlines_sep2tabs( temp_name ) - else: - self.line_count = sniff.convert_newlines( temp_name ) - if file_type == 'auto': - ext = sniff.guess_ext( temp_name, sniff_order=trans.app.datatypes_registry.sniff_order ) - else: - ext = file_type - data_type = ext - if info is None: - info = 'uploaded %s file' %data_type - data.extension = ext - data.name = file_name - data.dbkey = dbkey - data.info = info - data.flush() - shutil.move( temp_name, data.file_name ) - dataset_state = data.states.OK #don't set actual state here, only set to OK when finished setting attributes of the dataset - data.set_size() - data.init_meta() - #need to set metadata, has to be done after extention is set - for meta_name, meta_value in metadata.iteritems(): - setattr( data.metadata, meta_name, meta_value ) - if self.line_count is not None: - try: - if is_multi_byte: - data.set_multi_byte_peek( line_count=self.line_count ) - else: - data.set_peek( line_count=self.line_count ) - except: - if is_multi_byte: - data.set_multi_byte_peek() - else: - data.set_peek() - else: - if is_multi_byte: - data.set_multi_byte_peek() - else: - data.set_peek() - - # validate incomming data - # Commented by greg on 3/14/07 - # for error in data.datatype.validate( data ): - # data.add_validation_error( - # model.ValidationError( message=str( error ), err_type=error.__class__.__name__, attributes=util.object_to_string( error.__dict__ ) ) ) - if data.missing_meta(): - data.datatype.set_meta( data ) - dbkey_to_store = dbkey - if type( dbkey_to_store ) == type( [] ): - dbkey_to_store = dbkey[0] - if precreated_dataset is not None: - trans.history.genome_build = dbkey_to_store - else: - trans.history.add_dataset( data, genome_build=dbkey_to_store ) - #set up composite files - if uploaded_dataset is not None: - composite_files = data.datatype.get_composite_files( data ) - if composite_files: - os.mkdir( data.extra_files_path ) #make extra files path - for name, value in composite_files.iteritems(): - if uploaded_dataset.composite_files[ value.name ] is None and not value.optional: - data.info = "A required composite data file was not provided (%s)" % name - dataset_state = data.states.ERROR - break - elif uploaded_dataset.composite_files[ value.name] is not None: - if not value.is_binary: - if uploaded_dataset.composite_files[ value.name ].space_to_tab: - sniff.convert_newlines_sep2tabs( uploaded_dataset.composite_files[ value.name ].filename ) - else: - sniff.convert_newlines( uploaded_dataset.composite_files[ value.name ].filename ) - shutil.move( uploaded_dataset.composite_files[ value.name ].filename, os.path.join( data.extra_files_path, name ) ) - if data.datatype.composite_type == 'auto_primary_file': - #now that metadata was set above, we should create the primary file as required - open( data.file_name, 'wb+' ).write( data.datatype.generate_primary_file( dataset = data ) ) - data.state = dataset_state #Always set dataset state LAST - trans.app.model.flush() - trans.log_event( "Added dataset %d to history %d" %( data.id, trans.history.id ), tool_id="upload" ) - return data - - def check_gzip( self, temp_name ): - temp = open( temp_name, "U" ) - magic_check = temp.read( 2 ) - temp.close() - if magic_check != util.gzip_magic: - return ( False, False ) - CHUNK_SIZE = 2**15 # 32Kb - gzipped_file = gzip.GzipFile( temp_name ) - chunk = gzipped_file.read( CHUNK_SIZE ) - gzipped_file.close() - if self.check_html( temp_name, chunk=chunk ) or self.check_binary( temp_name, chunk=chunk ): - return( True, False ) - return ( True, True ) - - def check_zip( self, temp_name ): - if not zipfile.is_zipfile( temp_name ): - return ( False, False, None ) - zip_file = zipfile.ZipFile( temp_name, "r" ) - # Make sure the archive consists of valid files. The current rules are: - # 1. Archives can only include .ab1, .scf or .txt files - # 2. All file extensions within an archive must be the same - name = zip_file.namelist()[0] - test_ext = name.split( "." )[1].strip().lower() - if not ( test_ext == 'scf' or test_ext == 'ab1' or test_ext == 'txt' ): - return ( True, False, test_ext ) - for name in zip_file.namelist(): - ext = name.split( "." )[1].strip().lower() - if ext != test_ext: - return ( True, False, test_ext ) - return ( True, True, test_ext ) - - def check_html( self, temp_name, chunk=None ): - if chunk is None: - temp = open(temp_name, "U") - else: - temp = chunk - regexp1 = re.compile( "<A\s+[^>]*HREF[^>]+>", re.I ) - regexp2 = re.compile( "<IFRAME[^>]*>", re.I ) - regexp3 = re.compile( "<FRAMESET[^>]*>", re.I ) - regexp4 = re.compile( "<META[^>]*>", re.I ) - lineno = 0 - for line in temp: - lineno += 1 - matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) - if matches: - if chunk is None: - temp.close() - return True - if lineno > 100: - break - if chunk is None: - temp.close() - return False - def check_binary( self, temp_name, chunk=None ): - if chunk is None: - temp = open( temp_name, "U" ) - else: - temp = chunk - lineno = 0 - for line in temp: - lineno += 1 - line = line.strip() - if line: - if util.is_multi_byte( line ): - return False - for char in line: - if ord( char ) > 128: - if chunk is None: - temp.close() - return True - if lineno > 10: - break - if chunk is None: - temp.close() - return False + # Queue the job for execution + trans.app.job_queue.put( job.id, tool ) + trans.log_event( "Added job to the job queue, id: %s" % str(job.id), tool_id=job.tool_id ) + return dict( [ ( i, v ) for i, v in enumerate( data_list ) ] ) def get_precreated_dataset( self, name ): """ @@ -378,7 +164,3 @@ return self.precreated_datasets.pop( names.index( name ) ) else: return None - -class BadFileException( Exception ): - pass - diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/tools/parameters/basic.py --- a/lib/galaxy/tools/parameters/basic.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/tools/parameters/basic.py Thu Aug 20 11:43:28 2009 -0400 @@ -304,21 +304,22 @@ def get_html_field( self, trans=None, value=None, other_values={} ): return form_builder.FileField( self.name, ajax = self.ajax, value = value ) def from_html( self, value, trans=None, other_values={} ): + # TODO: Fix nginx upload module support # Middleware or proxies may encode files in special ways (TODO: this # should be pluggable) - if type( value ) == dict: - upload_location = self.tool.app.config.nginx_upload_location - assert upload_location, \ - "Request appears to have been processed by nginx_upload_module \ - but Galaxy is not configured to recgonize it" - # Check that the file is in the right location - local_filename = os.path.abspath( value['path'] ) - assert local_filename.startswith( upload_location ), \ - "Filename provided by nginx is not in correct directory" - value = Bunch( - filename = value["name"], - local_filename = local_filename - ) + #if type( value ) == dict: + # upload_location = self.tool.app.config.nginx_upload_location + # assert upload_location, \ + # "Request appears to have been processed by nginx_upload_module \ + # but Galaxy is not configured to recgonize it" + # # Check that the file is in the right location + # local_filename = os.path.abspath( value['path'] ) + # assert local_filename.startswith( upload_location ), \ + # "Filename provided by nginx is not in correct directory" + # value = Bunch( + # filename = value["name"], + # local_filename = local_filename + # ) return value def get_required_enctype( self ): """ @@ -330,10 +331,18 @@ return None elif isinstance( value, unicode ) or isinstance( value, str ): return value + elif isinstance( value, dict ): + # or should we jsonify? + try: + return value['local_filename'] + except: + return None raise Exception( "FileToolParameter cannot be persisted" ) def to_python( self, value, app ): if value is None: return None + elif isinstance( value, unicode ) or isinstance( value, str ): + return value else: raise Exception( "FileToolParameter cannot be persisted" ) def get_initial_value( self, trans, context ): diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/tools/parameters/grouping.py --- a/lib/galaxy/tools/parameters/grouping.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/tools/parameters/grouping.py Thu Aug 20 11:43:28 2009 -0400 @@ -12,6 +12,7 @@ from galaxy.datatypes import sniff from galaxy.util.bunch import Bunch from galaxy.util.odict import odict +from galaxy.util import json class Group( object ): def __init__( self ): @@ -167,33 +168,30 @@ rval.append( rval_dict ) return rval def get_uploaded_datasets( self, trans, context, override_name = None, override_info = None ): - def get_data_file_filename( data_file, is_multi_byte = False, override_name = None, override_info = None ): + def get_data_file_filename( data_file, override_name = None, override_info = None ): dataset_name = override_name dataset_info = override_info def get_file_name( file_name ): file_name = file_name.split( '\\' )[-1] file_name = file_name.split( '/' )[-1] return file_name - if 'local_filename' in dir( data_file ): + try: # Use the existing file - return data_file.local_filename, get_file_name( data_file.filename ), is_multi_byte - elif 'filename' in dir( data_file ): - #create a new tempfile - try: - temp_name, is_multi_byte = sniff.stream_to_file( data_file.file, prefix='upload' ) - precreated_name = get_file_name( data_file.filename ) - if not dataset_name: - dataset_name = precreated_name - if not dataset_info: - dataset_info = 'uploaded file' - return temp_name, get_file_name( data_file.filename ), is_multi_byte, dataset_name, dataset_info - except Exception, e: - log.exception( 'exception in sniff.stream_to_file using file %s: %s' % ( data_file.filename, str( e ) ) ) - self.remove_temp_file( temp_name ) - return None, None, is_multi_byte, None, None - def filenames_from_url_paste( url_paste, group_incoming, override_name = None, override_info = None ): + if not dataset_name and 'filename' in data_file: + dataset_name = get_file_name( data_file['filename'] ) + if not dataset_info: + dataset_info = 'uploaded file' + return Bunch( type='file', path=data_file['local_filename'], name=get_file_name( data_file['filename'] ) ) + #return 'file', data_file['local_filename'], get_file_name( data_file.filename ), dataset_name, dataset_info + except: + # The uploaded file should've been persisted by the upload tool action + return Bunch( type=None, path=None, name=None ) + #return None, None, None, None, None + def get_url_paste_urls_or_filename( group_incoming, override_name = None, override_info = None ): filenames = [] - if url_paste not in [ None, "" ]: + url_paste_file = group_incoming.get( 'url_paste', None ) + if url_paste_file is not None: + url_paste = open( url_paste_file, 'r' ).read( 1024 ) if url_paste.lstrip().lower().startswith( 'http://' ) or url_paste.lstrip().lower().startswith( 'ftp://' ): url_paste = url_paste.replace( '\r', '' ).split( '\n' ) for line in url_paste: @@ -208,114 +206,54 @@ dataset_info = override_info if not dataset_info: dataset_info = 'uploaded url' - try: - temp_name, is_multi_byte = sniff.stream_to_file( urllib.urlopen( line ), prefix='url_paste' ) - except Exception, e: - temp_name = None - precreated_name = str( e ) - log.exception( 'exception in sniff.stream_to_file using url_paste %s: %s' % ( url_paste, str( e ) ) ) - try: - self.remove_temp_file( temp_name ) - except: - pass - yield ( temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info ) - #yield ( None, str( e ), False, dataset_name, dataset_info ) + yield Bunch( type='url', path=line, name=precreated_name ) + #yield ( 'url', line, precreated_name, dataset_name, dataset_info ) else: dataset_name = dataset_info = precreated_name = 'Pasted Entry' #we need to differentiate between various url pastes here if override_name: dataset_name = override_name if override_info: dataset_info = override_info - is_valid = False - for line in url_paste: #Trim off empty lines from begining - line = line.rstrip( '\r\n' ) - if line: - is_valid = True - break - if is_valid: - try: - temp_name, is_multi_byte = sniff.stream_to_file( StringIO.StringIO( url_paste ), prefix='strio_url_paste' ) - except Exception, e: - log.exception( 'exception in sniff.stream_to_file using StringIO.StringIO( url_paste ) %s: %s' % ( url_paste, str( e ) ) ) - temp_name = None - precreated_name = str( e ) - try: - self.remove_temp_file( temp_name ) - except: - pass - yield ( temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info ) - #yield ( None, str( e ), False, dataset_name, dataset_info ) - + yield Bunch( type='file', path=url_paste_file, name=precreated_name ) + #yield ( 'file', url_paste_file, precreated_name, dataset_name, dataset_info ) def get_one_filename( context ): data_file = context['file_data'] url_paste = context['url_paste'] name = context.get( 'NAME', None ) info = context.get( 'INFO', None ) warnings = [] - is_multi_byte = False space_to_tab = False if context.get( 'space_to_tab', None ) not in ["None", None]: space_to_tab = True - temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info = get_data_file_filename( data_file, is_multi_byte = is_multi_byte, override_name = name, override_info = info ) - if temp_name: + file_bunch = get_data_file_filename( data_file, override_name = name, override_info = info ) + if file_bunch.path: if url_paste.strip(): warnings.append( "All file contents specified in the paste box were ignored." ) else: #we need to use url_paste - #file_names = filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ) - for temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info in filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ):#file_names: - if temp_name: + for file_bunch in get_url_paste_urls_or_filename( context, override_name = name, override_info = info ): + if file_bunch.path: break - ###this check will cause an additional file to be retrieved and created...so lets not do that - #try: #check to see if additional paste contents were available - # file_names.next() - # warnings.append( "Additional file contents were specified in the paste box, but ignored." ) - #except StopIteration: - # pass - return temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings - + return file_bunch, warnings def get_filenames( context ): rval = [] data_file = context['file_data'] url_paste = context['url_paste'] name = context.get( 'NAME', None ) info = context.get( 'INFO', None ) - warnings = [] - is_multi_byte = False space_to_tab = False if context.get( 'space_to_tab', None ) not in ["None", None]: space_to_tab = True - temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info = get_data_file_filename( data_file, is_multi_byte = is_multi_byte, override_name = name, override_info = info ) - if temp_name: - rval.append( ( temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info ) ) - for temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info in filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ): - if temp_name: - rval.append( ( temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info ) ) + warnings = [] + file_bunch = get_data_file_filename( data_file, override_name = name, override_info = info ) + if file_bunch.path: + file_bunch.space_to_tab = space_to_tab + rval.append( file_bunch ) + #rval.append( ( type, temp_name, precreated_name, space_to_tab, dataset_name, dataset_info ) ) + for file_bunch in get_url_paste_urls_or_filename( context, override_name = name, override_info = info ): + if file_bunch.path: + file_bunch.space_to_tab = space_to_tab + rval.append( file_bunch ) return rval - class UploadedDataset( Bunch ): - def __init__( self, **kwd ): - Bunch.__init__( self, **kwd ) - self.primary_file = None - self.composite_files = odict() - self.dbkey = None - self.warnings = [] - self.metadata = {} - - self._temp_filenames = [] #store all created filenames here, delete on cleanup - def register_temp_file( self, filename ): - if isinstance( filename, list ): - self._temp_filenames.extend( filename ) - else: - self._temp_filenames.append( filename ) - def remove_temp_file( self, filename ): - try: - os.unlink( filename ) - except Exception, e: - pass - #log.warning( str( e ) ) - def clean_up_temp_files( self ): - for filename in self._temp_filenames: - self.remove_temp_file( filename ) - file_type = self.get_file_type( context ) d_type = self.get_datatype( trans, context ) dbkey = context.get( 'dbkey', None ) @@ -325,51 +263,50 @@ for group_incoming in context.get( self.name, [] ): i = int( group_incoming['__index__'] ) groups_incoming[ i ] = group_incoming - if d_type.composite_type is not None: #handle uploading of composite datatypes #Only one Dataset can be created + ''' dataset = UploadedDataset() + dataset.datatype = d_type + ''' + dataset = Bunch() + dataset.type = 'composite' dataset.file_type = file_type + dataset.dbkey = dbkey dataset.datatype = d_type - dataset.dbkey = dbkey + dataset.warnings = [] + dataset.metadata = {} + dataset.composite_files = {} #load metadata files_metadata = context.get( self.metadata_ref, {} ) - for meta_name, meta_spec in d_type.metadata_spec.iteritems(): + for meta_name, meta_spec in d_type.metadata_spec.iteritems(): if meta_spec.set_in_upload: if meta_name in files_metadata: dataset.metadata[ meta_name ] = files_metadata[ meta_name ] - - temp_name = None - precreated_name = None - is_multi_byte = False - space_to_tab = False - warnings = [] dataset_name = None dataset_info = None if dataset.datatype.composite_type == 'auto_primary_file': #replace sniff here with just creating an empty file temp_name, is_multi_byte = sniff.stream_to_file( StringIO.StringIO( d_type.generate_primary_file() ), prefix='upload_auto_primary_file' ) - precreated_name = dataset_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) + dataset.primary_file = temp_name + dataset.space_to_tab = False + dataset.precreated_name = dataset.name = 'Uploaded Composite Dataset (%s)' % ( file_type ) else: - temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings = get_one_filename( groups_incoming[ 0 ] ) + file_bunch, warnings = get_one_filename( groups_incoming[ 0 ] ) if dataset.datatype.composite_type: precreated_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) writable_files_offset = 1 - if temp_name is None:#remove this before finish, this should create an empty dataset + dataset.primary_file = file_bunch.path + dataset.space_to_tab = file_bunch.space_to_tab + dataset.precreated_name = file_bunch.precreated_name + dataset.name = file_bunch.precreated_name + dataset.warnings.extend( file_bunch.warnings ) + if dataset.primary_file is None:#remove this before finish, this should create an empty dataset raise Exception( 'No primary dataset file was available for composite upload' ) - dataset.primary_file = temp_name - dataset.is_multi_byte = is_multi_byte - dataset.space_to_tab = space_to_tab - dataset.precreated_name = precreated_name - dataset.name = dataset_name - dataset.info = dataset_info - dataset.warnings.extend( warnings ) - dataset.register_temp_file( temp_name ) - keys = [ value.name for value in writable_files.values() ] for i, group_incoming in enumerate( groups_incoming[ writable_files_offset : ] ): key = keys[ i + writable_files_offset ] @@ -377,37 +314,22 @@ dataset.warnings.append( "A required composite file (%s) was not specified." % ( key ) ) dataset.composite_files[ key ] = None else: - temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings = get_one_filename( group_incoming ) - if temp_name: - dataset.composite_files[ key ] = Bunch( filename = temp_name, precreated_name = precreated_name, is_multi_byte = is_multi_byte, space_to_tab = space_to_tab, warnings = warnings, info = dataset_info, name = dataset_name ) - dataset.register_temp_file( temp_name ) + file_bunch, warnings = get_one_filename( group_incoming ) + if file_bunch.path: + dataset.composite_files[ key ] = file_bunch.__dict__ else: dataset.composite_files[ key ] = None if not writable_files[ writable_files.keys()[ keys.index( key ) ] ].optional: dataset.warnings.append( "A required composite file (%s) was not specified." % ( key ) ) return [ dataset ] else: + datasets = get_filenames( context[ self.name ][0] ) rval = [] - for temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, in get_filenames( context[ self.name ][0] ): - dataset = UploadedDataset() + for dataset in datasets: dataset.file_type = file_type - dataset.datatype = d_type dataset.dbkey = dbkey - dataset.primary_file = temp_name - dataset.is_multi_byte = is_multi_byte - dataset.space_to_tab = space_to_tab - dataset.name = dataset_name - dataset.info = dataset_info - dataset.precreated_name = precreated_name - dataset.register_temp_file( temp_name ) rval.append( dataset ) - return rval - def remove_temp_file( self, filename ): - try: - os.unlink( filename ) - except Exception, e: - log.warning( str( e ) ) - + return rval class Conditional( Group ): type = "conditional" diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/util/__init__.py --- a/lib/galaxy/util/__init__.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/util/__init__.py Thu Aug 20 11:43:28 2009 -0400 @@ -3,7 +3,7 @@ """ import logging -import threading, random, string, re, binascii, pickle, time, datetime, math, re, os, sys +import threading, random, string, re, binascii, pickle, time, datetime, math, re, os, sys, tempfile # Older py compatibility try: @@ -454,6 +454,26 @@ out_dict[ str( key ) ] = value return out_dict +def mkstemp_ln( src, prefix='mkstemp_ln_' ): + """ + From tempfile._mkstemp_inner, generate a hard link in the same dir with a + random name. Created so we can persist the underlying file of a + NamedTemporaryFile upon its closure. + """ + dir = os.path.dirname(src) + names = tempfile._get_candidate_names() + for seq in xrange(tempfile.TMP_MAX): + name = names.next() + file = os.path.join(dir, prefix + name) + try: + linked_path = os.link( src, file ) + return (os.path.abspath(file)) + except OSError, e: + if e.errno == errno.EEXIST: + continue # try again + raise + raise IOError, (errno.EEXIST, "No usable temporary file name found") + galaxy_root_path = os.path.join(__path__[0], "..","..","..") dbnames = read_dbnames( os.path.join( galaxy_root_path, "tool-data", "shared", "ucsc", "builds.txt" ) ) #this list is used in edit attributes and the upload tool ucsc_build_sites = read_build_sites( os.path.join( galaxy_root_path, "tool-data", "shared", "ucsc", "ucsc_build_sites.txt" ) ) #this list is used in history.tmpl diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/web/controllers/tool_runner.py --- a/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 11:43:28 2009 -0400 @@ -136,6 +136,7 @@ """ Precreate datasets for asynchronous uploading. """ + permissions = trans.app.security_agent.history_get_default_permissions( trans.history ) def create_dataset( name, history ): data = trans.app.model.HistoryDatasetAssociation( create_dataset = True ) data.name = name @@ -143,6 +144,7 @@ data.history = history data.flush() history.add_dataset( data ) + trans.app.security_agent.set_all_dataset_permissions( data.dataset, permissions ) return data tool = self.get_toolbox().tools_by_id.get( tool_id, None ) if not tool: diff -r 070cf5f6f928 -r a7f9325bb319 lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Thu Aug 20 11:39:32 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Thu Aug 20 11:43:28 2009 -0400 @@ -212,6 +212,17 @@ else: return None +# For request.params, override cgi.FieldStorage.make_file to create persistent +# tempfiles. Necessary for externalizing the upload tool. It's a little hacky +# but for performance reasons it's way better to use Paste's tempfile than to +# create a new one and copy. +import cgi +class FieldStorage( cgi.FieldStorage ): + def make_file(self, binary=None): + import tempfile + return tempfile.NamedTemporaryFile() +cgi.FieldStorage = FieldStorage + class Request( webob.Request ): """ Encapsulates an HTTP request. diff -r 070cf5f6f928 -r a7f9325bb319 templates/base_panels.mako --- a/templates/base_panels.mako Thu Aug 20 11:39:32 2009 -0400 +++ b/templates/base_panels.mako Thu Aug 20 11:43:28 2009 -0400 @@ -72,9 +72,6 @@ <script type="text/javascript"> jQuery( function() { $("iframe#galaxy_main").load( function() { - ##$(this.contentDocument).find("input[galaxy-ajax-upload]").each( function() { - ##$("iframe")[0].contentDocument.body.innerHTML = "HELLO" - ##$(this.contentWindow.document).find("input[galaxy-ajax-upload]").each( function() { $(this).contents().find("form").each( function() { if ( $(this).find("input[galaxy-ajax-upload]").length > 0 ){ $(this).submit( function() { diff -r 070cf5f6f928 -r a7f9325bb319 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Thu Aug 20 11:39:32 2009 -0400 +++ b/test/base/twilltestcase.py Thu Aug 20 11:43:28 2009 -0400 @@ -93,6 +93,8 @@ valid_hid = int( hid ) except: raise AssertionError, "Invalid hid (%s) created when uploading file %s" % ( hid, filename ) + # Wait for upload processing to finish (TODO: this should be done in each test case instead) + self.wait() def upload_url_paste( self, url_paste, ftype='auto', dbkey='unspecified (?)' ): """Pasted data in the upload utility""" self.visit_page( "tool_runner/index?tool_id=upload1" ) @@ -112,6 +114,8 @@ valid_hid = int( hid ) except: raise AssertionError, "Invalid hid (%s) created when pasting %s" % ( hid, url_paste ) + # Wait for upload processing to finish (TODO: this should be done in each test case instead) + self.wait() # Functions associated with histories def check_history_for_errors( self ): diff -r 070cf5f6f928 -r a7f9325bb319 tools/data_source/upload.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/data_source/upload.py Thu Aug 20 11:43:28 2009 -0400 @@ -0,0 +1,280 @@ +#!/usr/bin/env python +#Processes uploads from the user. + +# WARNING: Changes in this tool (particularly as related to parsing) may need +# to be reflected in galaxy.web.controllers.tool_runner and galaxy.tools + +import urllib, sys, os, gzip, tempfile, shutil, re, gzip, zipfile +from galaxy import eggs +# need to import model before sniff to resolve a circular import dependency +import galaxy.model +from galaxy.datatypes import sniff +from galaxy import util +from galaxy.util.json import * + +assert sys.version_info[:2] >= ( 2, 4 ) + +def stop_err( msg, ret=1 ): + sys.stderr.write( msg ) + sys.exit( ret ) + +def file_err( msg, dataset, json_file ): + json_file.write( to_json_string( dict( type = 'dataset', + ext = 'data', + dataset_id = dataset.dataset_id, + stderr = msg ) ) + "\n" ) + try: + os.remove( dataset.path ) + except: + pass + +def safe_dict(d): + """ + Recursively clone json structure with UTF-8 dictionary keys + http://mellowmachines.com/blog/2009/06/exploding-dictionary-with-unicode-ke… + """ + if isinstance(d, dict): + return dict([(k.encode('utf-8'), safe_dict(v)) for k,v in d.iteritems()]) + elif isinstance(d, list): + return [safe_dict(x) for x in d] + else: + return d + +def check_html( temp_name, chunk=None ): + if chunk is None: + temp = open(temp_name, "U") + else: + temp = chunk + regexp1 = re.compile( "<A\s+[^>]*HREF[^>]+>", re.I ) + regexp2 = re.compile( "<IFRAME[^>]*>", re.I ) + regexp3 = re.compile( "<FRAMESET[^>]*>", re.I ) + regexp4 = re.compile( "<META[^>]*>", re.I ) + lineno = 0 + for line in temp: + lineno += 1 + matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) + if matches: + if chunk is None: + temp.close() + return True + if lineno > 100: + break + if chunk is None: + temp.close() + return False + +def check_binary( temp_name, chunk=None ): + if chunk is None: + temp = open( temp_name, "U" ) + else: + temp = chunk + lineno = 0 + for line in temp: + lineno += 1 + line = line.strip() + if line: + for char in line: + if ord( char ) > 128: + if chunk is None: + temp.close() + return True + if lineno > 10: + break + if chunk is None: + temp.close() + return False + +def check_gzip( temp_name ): + temp = open( temp_name, "U" ) + magic_check = temp.read( 2 ) + temp.close() + if magic_check != util.gzip_magic: + return ( False, False ) + CHUNK_SIZE = 2**15 # 32Kb + gzipped_file = gzip.GzipFile( temp_name ) + chunk = gzipped_file.read( CHUNK_SIZE ) + gzipped_file.close() + if check_html( temp_name, chunk=chunk ) or check_binary( temp_name, chunk=chunk ): + return( True, False ) + return ( True, True ) + +def check_zip( temp_name ): + if not zipfile.is_zipfile( temp_name ): + return ( False, False, None ) + zip_file = zipfile.ZipFile( temp_name, "r" ) + # Make sure the archive consists of valid files. The current rules are: + # 1. Archives can only include .ab1, .scf or .txt files + # 2. All file extensions within an archive must be the same + name = zip_file.namelist()[0] + test_ext = name.split( "." )[1].strip().lower() + if not ( test_ext == 'scf' or test_ext == 'ab1' or test_ext == 'txt' ): + return ( True, False, test_ext ) + for name in zip_file.namelist(): + ext = name.split( "." )[1].strip().lower() + if ext != test_ext: + return ( True, False, test_ext ) + return ( True, True, test_ext ) + +def add_file( dataset, json_file ): + data_type = None + line_count = None + + if dataset.type == 'url': + try: + temp_name, is_multi_byte = sniff.stream_to_file( urllib.urlopen( dataset.path ), prefix='url_paste' ) + except Exception, e: + file_err( 'Unable to fetch %s\n%s' % ( dataset.path, str( e ) ), dataset, json_file ) + return + dataset.path = temp_name + dataset.is_multi_byte = is_multi_byte + + # See if we have an empty file + if not os.path.exists( dataset.path ): + file_err( 'Uploaded temporary file (%s) does not exist. Please' % dataset.path, dataset, json_file ) + return + if not os.path.getsize( dataset.path ) > 0: + file_err( 'The uploaded file is empty', dataset, json_file ) + return + if 'is_multi_byte' not in dir( dataset ): + dataset.is_multi_byte = util.is_multi_byte( open( dataset.path, 'r' ).read( 1024 )[:100] ) + if dataset.is_multi_byte: + ext = sniff.guess_ext( dataset.path, is_multi_byte=True ) + data_type = ext + else: + # See if we have a gzipped file, which, if it passes our restrictions, we'll uncompress + is_gzipped, is_valid = check_gzip( dataset.path ) + if is_gzipped and not is_valid: + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + elif is_gzipped and is_valid: + # We need to uncompress the temp_name file + CHUNK_SIZE = 2**20 # 1Mb + fd, uncompressed = tempfile.mkstemp( prefix='data_id_%s_upload_gunzip_' % dataset.dataset_id, dir=os.path.dirname( dataset.path ) ) + gzipped_file = gzip.GzipFile( dataset.path ) + while 1: + try: + chunk = gzipped_file.read( CHUNK_SIZE ) + except IOError: + os.close( fd ) + os.remove( uncompressed ) + file_err( 'Problem decompressing gzipped data', dataset, json_file ) + return + if not chunk: + break + os.write( fd, chunk ) + os.close( fd ) + gzipped_file.close() + # Replace the gzipped file with the decompressed file + shutil.move( uncompressed, dataset.path ) + dataset.name = dataset.name.rstrip( '.gz' ) + data_type = 'gzip' + if not data_type: + # See if we have a zip archive + is_zipped, is_valid, test_ext = check_zip( dataset.path ) + if is_zipped and not is_valid: + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + elif is_zipped and is_valid: + # Currently, we force specific tools to handle this case. We also require the user + # to manually set the incoming file_type + if ( test_ext == 'ab1' or test_ext == 'scf' ) and dataset.file_type != 'binseq.zip': + file_err( "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'", dataset, json_file ) + return + elif test_ext == 'txt' and dataset.file_type != 'txtseq.zip': + file_err( "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'", dataset, json_file ) + return + if not ( dataset.file_type == 'binseq.zip' or dataset.file_type == 'txtseq.zip' ): + file_err( "You must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files", dataset, json_file ) + return + data_type = 'zip' + ext = dataset.file_type + if not data_type: + if check_binary( dataset.path ): + if dataset.is_binary is not None: + data_type = 'binary' + ext = dataset.file_type + else: + parts = dataset.name.split( "." ) + if len( parts ) > 1: + ext = parts[1].strip().lower() + if not( ext == 'ab1' or ext == 'scf' ): + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + if ext == 'ab1' and dataset.file_type != 'ab1': + file_err( "You must manually set the 'File Format' to 'Ab1' when uploading ab1 files.", dataset, json_file ) + return + elif ext == 'scf' and dataset.file_type != 'scf': + file_err( "You must manually set the 'File Format' to 'Scf' when uploading scf files.", dataset, json_file ) + return + data_type = 'binary' + if not data_type: + # We must have a text file + if check_html( dataset.path ): + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + if data_type != 'binary' and data_type != 'zip': + if dataset.space_to_tab: + line_count = sniff.convert_newlines_sep2tabs( dataset.path ) + else: + line_count = sniff.convert_newlines( dataset.path ) + if dataset.file_type == 'auto': + ext = sniff.guess_ext( dataset.path ) + else: + ext = dataset.file_type + data_type = ext + # Save job info for the framework + info = dict( type = 'dataset', + dataset_id = dataset.dataset_id, + path = dataset.path, + ext = ext, + stdout = 'uploaded %s file' % data_type, + name = dataset.name, + line_count = line_count ) + json_file.write( to_json_string( info ) + "\n" ) + +def add_composite_file( dataset, json_file ): + if dataset.composite_files: + os.mkdir( dataset.extra_files_path ) + for name, value in dataset.composite_files.iteritems(): + value = util.bunch.Bunch( **value ) + if dataset.composite_file_paths[ value.name ] is None and not value.optional: + file_err( 'A required composite data file was not provided (%s)' % name, dataset, json_file ) + break + elif dataset.composite_file_paths[value.name] is not None: + if not value.is_binary: + if uploaded_dataset.composite_files[ value.name ].space_to_tab: + sniff.convert_newlines_sep2tabs( dataset.composite_file_paths[ value.name ][ 'path' ] ) + else: + sniff.convert_newlines( dataset.composite_file_paths[ value.name ][ 'path' ] ) + shutil.move( dataset.composite_file_paths[ value.name ][ 'path' ], os.path.join( dataset.extra_files_path, name ) ) + info = dict( type = 'dataset', + dataset_id = dataset.dataset_id, + path = dataset.primary_file, + stdout = 'uploaded %s file' % dataset.file_type ) + json_file.write( to_json_string( info ) + "\n" ) + +def __main__(): + + if len( sys.argv ) != 2: + print >>sys.stderr, 'usage: upload.py <json paramfile>' + sys.exit( 1 ) + + json_file = open( 'galaxy.json', 'w' ) + + for line in open( sys.argv[1], 'r' ): + dataset = from_json_string( line ) + dataset = util.bunch.Bunch( **safe_dict( dataset ) ) + + if dataset.type == 'composite': + add_composite_file( dataset, json_file ) + else: + add_file( dataset, json_file ) + + # clean up paramfile + try: + os.remove( sys.argv[1] ) + except: + pass + +if __name__ == '__main__': + __main__() diff -r 070cf5f6f928 -r a7f9325bb319 tools/data_source/upload.xml --- a/tools/data_source/upload.xml Thu Aug 20 11:39:32 2009 -0400 +++ b/tools/data_source/upload.xml Thu Aug 20 11:43:28 2009 -0400 @@ -1,10 +1,13 @@ <?xml version="1.0"?> -<tool name="Upload File" id="upload1" version="1.0.2"> +<tool name="Upload File" id="upload1" version="1.0.3"> <description> from your computer </description> <action module="galaxy.tools.actions.upload" class="UploadToolAction"/> + <command interpreter="python"> + upload.py $paramfile + </command> <inputs> <param name="file_type" type="select" label="File Format" help="Which format? See help below"> <options from_parameter="tool.app.datatypes_registry.upload_file_formats" transform_lines="[ "%s%s%s" % ( line, self.separator, line ) for line in obj ]">

1 0

[hg] galaxy 2588: Merge with 5fa8803716fd7d3250a1a78f5521aa18b3e...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/070cf5f6f928 changeset: 2588:070cf5f6f928 user: rc date: Thu Aug 20 11:39:32 2009 -0400 description: Merge with 5fa8803716fd7d3250a1a78f5521aa18b3e519b0 13 file(s) affected in this change: lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py lib/galaxy/web/framework/__init__.py templates/admin/requests/grid.mako templates/admin/requests/show_request.mako templates/base_panels.mako templates/history/grid.mako templates/history/list_shared.mako templates/requests/show_request.mako test/base/twilltestcase.py test/functional/test_security_and_libraries.py diffs (truncated from 5056 to 3000 lines): diff -r 881dd4c2de9f -r 070cf5f6f928 datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Thu Aug 20 10:52:08 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Aug 20 11:39:32 2009 -0400 @@ -3,6 +3,7 @@ <registration converters_path="lib/galaxy/datatypes/converters"> <datatype extension="ab1" type="galaxy.datatypes.images:Ab1" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/> + <datatype extension="bam" type="galaxy.datatypes.images:Bam" mimetype="application/octet-stream"/> <datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true"> <converter file="bed_to_gff_converter.xml" target_datatype="gff"/> <converter file="interval_to_coverage.xml" target_datatype="coverage"/> @@ -49,6 +50,7 @@ <datatype extension="qualsolexa" type="galaxy.datatypes.qualityscore:QualityScoreSolexa" display_in_upload="true"/> <datatype extension="qualsolid" type="galaxy.datatypes.qualityscore:QualityScoreSOLiD" display_in_upload="true"/> <datatype extension="qual454" type="galaxy.datatypes.qualityscore:QualityScore454" display_in_upload="true"/> + <datatype extension="sam" type="galaxy.datatypes.tabular:Sam" display_in_upload="true"/> <datatype extension="scf" type="galaxy.datatypes.images:Scf" mimetype="application/octet-stream" display_in_upload="true"/> <datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/> <datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/> @@ -205,5 +207,6 @@ <sniffer type="galaxy.datatypes.interval:Gff"/> <sniffer type="galaxy.datatypes.interval:Gff3"/> <sniffer type="galaxy.datatypes.interval:Interval"/> + <sniffer type="galaxy.datatypes.tabular:Sam"/> </sniffers> </datatypes> diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/app.py --- a/lib/galaxy/app.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/app.py Thu Aug 20 11:39:32 2009 -0400 @@ -37,6 +37,8 @@ self.toolbox = tools.ToolBox( self.config.tool_config, self.config.tool_path, self ) # Load datatype converters self.datatypes_registry.load_datatype_converters( self.toolbox ) + #load external metadata tool + self.datatypes_registry.load_external_metadata_tool( self.toolbox ) # Load datatype indexers self.datatypes_registry.load_datatype_indexers( self.toolbox ) #Load security policy diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/coverage.py --- a/lib/galaxy/datatypes/coverage.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/coverage.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sys, time, sets, tempfile +import logging, os, sys, time, tempfile from galaxy import util from galaxy.util.odict import odict from galaxy.util.bunch import Bunch diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Thu Aug 20 11:39:32 2009 -0400 @@ -12,7 +12,7 @@ august 20 2007 """ -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from cgi import escape diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Thu Aug 20 11:39:32 2009 -0400 @@ -4,6 +4,8 @@ import data import logging +from galaxy.datatypes.metadata import MetadataElement +from galaxy.datatypes import metadata from galaxy.datatypes.sniff import * from urllib import urlencode, quote_plus import zipfile @@ -187,7 +189,7 @@ return 'text/html' def sniff( self, filename ): """ - Determines wether the file is in html format + Determines whether the file is in html format >>> fname = get_test_fname( 'complete.bed' ) >>> Html().sniff( fname ) @@ -233,3 +235,25 @@ return dataset.peek except: return "peek unavailable" + +class Bam( data.Binary ): + """Class describing a BAM binary file""" + file_ext = "bam" + MetadataElement( name="bam_index", desc="BAM Index File", param=metadata.FileParameter, readonly=True, no_value=None, visible=False, optional=True ) + def set_peek( self, dataset ): + if not dataset.dataset.purged: + export_url = "/history_add_to?" + urlencode({'history_id':dataset.history_id,'ext':'bam','name':'bam alignments','info':'Alignments file','dbkey':dataset.dbkey}) + dataset.peek = "Binary bam alignments file" + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def display_peek(self, dataset): + try: + return dataset.peek + except: + return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) ) + def get_mime(self): + """Returns the mime type of the datatype""" + return 'application/octet-stream' + \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/interval.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,7 +5,7 @@ import pkg_resources pkg_resources.require( "bx-python" ) -import logging, os, sys, time, sets, tempfile, shutil +import logging, os, sys, time, tempfile, shutil import data from galaxy import util from galaxy.datatypes.sniff import * diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/registry.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,7 +1,7 @@ """ Provides mapping between extensions and datatypes, mime-types, etc. """ -import os +import os, tempfile import logging import data, tabular, interval, images, sequence, qualityscore, genetics, xml, coverage, tracks, chrominfo import galaxy.util @@ -18,6 +18,7 @@ self.datatype_converters = odict() self.datatype_indexers = odict() self.converters = [] + self.set_external_metadata_tool = None self.indexers = [] self.sniff_order = [] self.upload_file_formats = [] @@ -110,6 +111,7 @@ self.datatypes_by_extension = { 'ab1' : images.Ab1(), 'axt' : sequence.Axt(), + 'bam' : images.Bam(), 'bed' : interval.Bed(), 'binseq.zip' : images.Binseq(), 'blastxml' : xml.BlastXml(), @@ -129,6 +131,7 @@ 'qualsolid' : qualityscore.QualityScoreSOLiD(), 'qualsolexa' : qualityscore.QualityScoreSolexa(), 'qual454' : qualityscore.QualityScore454(), + 'sam' : tabular.Sam(), 'scf' : images.Scf(), 'tabular' : tabular.Tabular(), 'taxonomy' : tabular.Taxonomy(), @@ -139,6 +142,7 @@ self.mimetypes_by_extension = { 'ab1' : 'application/octet-stream', 'axt' : 'text/plain', + 'bam' : 'application/octet-stream', 'bed' : 'text/plain', 'binseq.zip' : 'application/zip', 'blastxml' : 'text/plain', @@ -156,6 +160,7 @@ 'qualsolid' : 'text/plain', 'qualsolexa' : 'text/plain', 'qual454' : 'text/plain', + 'sam' : 'text/plain', 'scf' : 'application/octet-stream', 'tabular' : 'text/plain', 'taxonomy' : 'text/plain', @@ -183,7 +188,8 @@ interval.CustomTrack(), interval.Gff(), interval.Gff3(), - interval.Interval() + interval.Interval(), + tabular.Sam() ] def append_to_sniff_order(): # Just in case any supported data types are not included in the config's sniff_order section. @@ -251,6 +257,31 @@ self.datatype_converters[source_datatype][target_datatype] = converter self.log.debug( "Loaded converter: %s", converter.id ) + def load_external_metadata_tool( self, toolbox ): + """Adds a tool which is used to set external metadata""" + #we need to be able to add a job to the queue to set metadata. The queue will currently only accept jobs with an associated tool. + #We'll create a special tool to be used for Auto-Detecting metadata; this is less than ideal, but effective + #Properly building a tool without relying on parsing an XML file is near impossible...so we'll create a temporary file + tool_xml_text = """ + <tool id="__SET_METADATA__" name="Set External Metadata" version="1.0.0" tool_type="set_metadata"> + <type class="SetMetadataTool" module="galaxy.tools"/> + <action module="galaxy.tools.actions.metadata" class="SetMetadataToolAction"/> + <command>$__SET_EXTERNAL_METADATA_COMMAND_LINE__</command> + <inputs> + <param format="data" name="input1" type="data" label="File to set metadata on."/> + <param name="__ORIGINAL_DATASET_STATE__" type="hidden" value=""/> + <param name="__SET_EXTERNAL_METADATA_COMMAND_LINE__" type="hidden" value=""/> + </inputs> + </tool> + """ + tmp_name = tempfile.NamedTemporaryFile() + tmp_name.write( tool_xml_text ) + tmp_name.flush() + set_meta_tool = toolbox.load_tool( tmp_name.name ) + toolbox.tools_by_id[ set_meta_tool.id ] = set_meta_tool + self.set_external_metadata_tool = set_meta_tool + self.log.debug( "Loaded external metadata tool: %s", self.set_external_metadata_tool.id ) + def load_datatype_indexers( self, toolbox ): """Adds indexers from self.indexers to the toolbox from app""" for elem in self.indexers: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/tabular.py --- a/lib/galaxy/datatypes/tabular.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/datatypes/tabular.py Thu Aug 20 11:39:32 2009 -0400 @@ -11,6 +11,7 @@ from cgi import escape from galaxy.datatypes import metadata from galaxy.datatypes.metadata import MetadataElement +from sniff import * log = logging.getLogger(__name__) @@ -236,3 +237,84 @@ out = "Can't create peek %s" % exc return out +class Sam( Tabular ): + file_ext = 'sam' + def __init__(self, **kwd): + """Initialize taxonomy datatype""" + Tabular.__init__( self, **kwd ) + self.column_names = ['QNAME', 'FLAG', 'RNAME', 'POS', 'MAPQ', 'CIGAR', + 'MRNM', 'MPOS', 'ISIZE', 'SEQ', 'QUAL', 'OPT' + ] + def make_html_table( self, dataset, skipchars=[] ): + """Create HTML table, used for displaying peek""" + out = ['<table cellspacing="0" cellpadding="3">'] + try: + # Generate column header + out.append( '<tr>' ) + for i, name in enumerate( self.column_names ): + out.append( '<th>%s.%s</th>' % ( str( i+1 ), name ) ) + # This data type requires at least 11 columns in the data + if dataset.metadata.columns - len( self.column_names ) > 0: + for i in range( len( self.column_names ), dataset.metadata.columns ): + out.append( '<th>%s</th>' % str( i+1 ) ) + out.append( '</tr>' ) + out.append( self.make_html_peek_rows( dataset, skipchars=skipchars ) ) + out.append( '</table>' ) + out = "".join( out ) + except Exception, exc: + out = "Can't create peek %s" % exc + return out + def sniff( self, filename ): + """ + Determines whether the file is in SAM format + + A file in SAM format consists of lines of tab-separated data. + The following header line may be the first line: + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL + or + @QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT + Data in the OPT column is optional and can consist of tab-separated data + + For complete details see http://samtools.sourceforge.net/SAM1.pdf + + Rules for sniffing as True: + There must be 11 or more columns of data on each line + Columns 2 (FLAG), 4(POS), 5 (MAPQ), 8 (MPOS), and 9 (ISIZE) must be numbers (9 can be negative) + We will only check that up to the first 5 alignments are correctly formatted. + + >>> fname = get_test_fname( 'sequence.maf' ) + >>> Sam().sniff( fname ) + False + >>> fname = get_test_fname( '1.sam' ) + >>> Sam().sniff( fname ) + True + """ + try: + fh = open( filename ) + count = 0 + while True: + line = fh.readline() + line = line.strip() + if not line: + break #EOF + if line: + if line[0] != '@': + linePieces = line.split('\t') + if len(linePieces) < 11: + return False + try: + check = int(linePieces[1]) + check = int(linePieces[3]) + check = int(linePieces[4]) + check = int(linePieces[7]) + check = int(linePieces[8]) + except ValueError: + return False + count += 1 + if count == 5: + return True + if count < 5 and count > 0: + return True + except: + pass + return False diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/datatypes/test/1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/1.sam Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,97 @@ +@QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT +1378_11_329 69 * 0 0 * * 0 0 AGACCGGGCGGGGTGGCGTTCGGT %##+'#######%###$#$##$(# +1378_11_329 133 * 0 0 * * 0 0 GTTCGTGGCCGGTGGGTGTTTGGG ###$$#$#$&#####$'$#$###$ +1378_17_1788 69 * 0 0 * * 0 0 TGCCGTGTCTTGCTAACGCCGATT #'#$$#$###%%##$$$$###### +1378_17_1788 133 * 0 0 * * 0 0 TGGGTGGATGTGTTGTCGTTCATG #$#$###$#$#######$#$#### +1378_25_2035 69 * 0 0 * * 0 0 CTGCGTGTTGGTGTCTACTGGGGT #%#'##$#$##&%#%$$$%#%#'# +1378_25_2035 133 * 0 0 * * 0 0 GTGCGTCGGGGAGGGTGCTGTCGG ######%#$%#$$###($###&&% +1378_28_770 89 chr11.nib:1-134452384 72131356 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210!!44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_28_770 181 chr11.nib:1-134452384 72131356 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$### +1378_33_1945 113 chr2.nib:1-242951149 181247988 0 23M chr12.nib:1-132349534 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_33_1945 177 chr12.nib:1-132349534 41710908 0 23M chr2.nib:1-242951149 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_34_789 69 * 0 0 * * 0 0 ATGGTGGCTGACGCGTTTGACTGT #$##%#$##$&$#%##$##$###$ +1378_34_789 133 * 0 0 * * 0 0 GGGCTTGCGTTAGTGAGAGGTTGT ###%$%$%%###$####$###$#& +1378_35_263 115 chr16.nib:1-88827254 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_35_263 179 chr16.nib:1-88827254 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_43_186 69 * 0 0 * * 0 0 ATACTAGTTGGGACGCGTTGTGCT #$(4%$########$#$###$$$# +1378_43_186 133 * 0 0 * * 0 0 GCTAGGGTTTGGGTTTGCGGTGGG $%#$########%##%#$###'#' +1378_51_1671 117 chr2.nib:1-242951149 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$## +1378_51_1671 153 chr2.nib:1-242951149 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_324 117 chr2.nib:1-242951149 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/ +1378_56_324 153 chr2.nib:1-242951149 80324999 37 8M1I14M = 80324999 0 TTTAGCCCGAAATGCCTAGAGCA 4;6//11!"11100110////00 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_56_773 69 * 0 0 * * 0 0 TGTCGTGAGGTCACTTATCCCCAT &%#%##%%#####&#$%##$%##$ +1378_56_773 133 * 0 0 * * 0 0 TCTGGTCGGTTTCGGGGAGTGGAA ##%%#&$###$#$##%$####%%$ +1378_62_2027 69 * 0 0 * * 0 0 CTTCCACGATCTGCTCGCTGTGGT (#&&$##$$#$%#%$$$#$###'# +1378_62_2027 133 * 0 0 * * 0 0 GTTGGCCTGGCCTGCCGTGCTGCG *##),/%##$)#%##1$#'%.#&# +1378_62_2029 69 * 0 0 * * 0 0 TCTGGGCTGTCTTCGGGTCGGTGT $%$$####$##$$#)##%%#$### +1378_62_2029 133 * 0 0 * * 0 0 GGCGGTGTGTGGTGCGGCTGTGCG /$$$=(####%####)$$%$-&%# +1378_67_1795 81 chr16.nib:1-88827254 26739130 0 23M chrY.nib:1-57772954 57401793 0 TGGCATTCCTGTAGGCAGAGAGG AZWWZS]!"QNXZ]VQ]]]/2]] XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_67_1795 161 chrY.nib:1-57772954 57401793 37 23M chr16.nib:1-88827254 26739130 0 GATCACCCAGGTGATGTAACTCC ]WV]]]]WW]]]]]]]]]]PU]] XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_68_466 69 * 0 0 * * 0 0 GTGATCGTCGGTGCCAGTCCCTGT #(%)+##$#$#%#+$%##$##### +1378_68_466 133 * 0 0 * * 0 0 GTGTCATCTGAGGTAAAGCATTGT /##$09#$#.=$#$76+$%1'### +1378_68_1692 117 chr13.nib:1-114142980 36365609 0 24M = 36365609 0 TTGAACCGGGCACGGGTCTTCTGG #$#######%###$##%&'%)### +1378_68_1692 153 chr13.nib:1-114142980 36365609 37 10M1D13M = 36365609 0 CTGCACATACAGAATATTCATAG 0010/!"0/!!021/132231// XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:10^T13 +1378_80_664 69 * 0 0 * * 0 0 CTGCTTTGATCCCCGGTGGAGCAC 7#%###$$6#######$##$$$## +1378_80_664 133 * 0 0 * * 0 0 TGTCTGCGTTGTATCTCTGGTGTA %##%,%$$#&$$###$#$%##'%# +1378_85_1786 69 * 0 0 * * 0 0 ATACTATGTCGATCTGTAAAAAAA )&.)#3%(a)$&%-,2#&+.-%0&./ +1378_85_1786 133 * 0 0 * * 0 0 CCCTAGGAGCGTATACCGGACGAG ,'&/%/@,&1,&'/)&,6&&1)(( +1378_86_1011 69 * 0 0 * * 0 0 CTACGTTATTGCTCTGTTTGTCCT ######$%##$$$%###%#$#### +1378_86_1011 133 * 0 0 * * 0 0 AGGCGATGGGATATTATTTTACTT :$###)%##$9$###1$$#$2### +1378_86_1789 89 chr12.nib:1-132349534 39007065 37 23M = 39007065 0 GCTTTCCATAGATGTGTAATTTC J2K]]Z5!GN?@U]]]VX]UYYP XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_86_1789 181 chr12.nib:1-132349534 39007065 0 24M = 39007065 0 ACAACTTAAATAATCATGGACCGG 02,5$$0&6#%?*,$'#%&/15.1 +1378_91_1596 69 * 0 0 * * 0 0 TTAGCGGTTGACTATCTGCTGACA *&+'#9'(%*'#//,&<),/)'*# +1378_91_1596 133 * 0 0 * * 0 0 GCTTTTTCATTCGGTGCCTTTGGA '>%/3%=()8'#.%?50$&5>%)% +1378_94_1595 69 chr7.nib:1-158821424 127518258 0 24M = 127518258 0 CGTGCGACAGCCCATGTTTTCAGA -=..5,3826&*+.+#+#%%6;%# +1378_94_1595 137 chr7.nib:1-158821424 127518258 37 23M = 127518258 0 TGAGATAAACACCTAACATGCTC M]]FN]]\V]]]Q>T]KIG:LVN XT:A:U CM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1039 69 * 0 0 * * 0 0 CGGCGTCCATCTTCGCCTTGAGAT $##.#$##$$#%$#$%%$###$)$ +1378_95_1039 133 * 0 0 * * 0 0 GTTCTGTGCCAGGTGAGGTACGGA &##,./#$&)6##+,'#$$0(##$ +1378_95_1767 65 chr11.nib:1-134452384 65333552 25 23M chr3.nib:1-199501827 123725482 0 CAACTGGTGGCATCTGGACAAAC W[[TZYY]]RO<BI7!!:!!>@2 XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_95_1767 129 chr3.nib:1-199501827 123725482 37 6M1I16M chr11.nib:1-134452384 65333552 0 ATTTATCTGTCTCATTCATTATT <AGB8B"!V]]UO/&JB4DE88E XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_96_1037 69 * 0 0 * * 0 0 ATCCCCCAAGATGCCTGTTGATTG $#$'##$$$#%$$#%###+##$#$ +1378_96_1037 133 * 0 0 * * 0 0 CTGCTGGGCCATTTGACTTACTCA '$#+#(##-%5##+*&###-.$$$ +1378_96_1764 81 chr15.nib:1-100338915 89251272 25 23M chr7.nib:1-158821424 19412615 0 AGAAATGGTCGCACCCTCTGGTT E*2ZEHX\SN]O>SYRL):LIOL XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_96_1764 161 chr7.nib:1-158821424 19412615 37 23M chr15.nib:1-100338915 89251272 0 GTATAGCCCACAACGCCTAATAT ZMBS]UW]UYR\]QPZ[SMYL7C XT:A:U CM:i:0 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_98_1574 69 * 0 0 * * 0 0 GTTCTGCCGGTGTCTGTGGCGGGC $$#+&$$####%$$$###$%#%%# +1378_98_1574 133 * 0 0 * * 0 0 AGGCGAGTGTGGGGGTTGTTTGAG +%%$#)##%##$####%###$%$# +1378_107_1647 69 * 0 0 * * 0 0 AGGCCTACTACGCGTCATTGATAG &#$$#$(.#%#$$####&$%##($ +1378_107_1647 133 * 0 0 * * 0 0 GGTCTGGTTCTATGTTGGTCGACT ###'$$#$$$(#%###(#$##$%# +1378_111_829 69 chr9.nib:1-140273252 82506894 0 24M = 82506894 0 TGCGGCACTTGCTTCTTCGTATTT %#%##%#$%#$#%###$$##&#$$ +1378_111_829 137 chr9.nib:1-140273252 82506894 37 4M1I18M = 82506894 0 GATGCGTAATCTAGTAAAATAAG 0/362//00/5516500210451 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_111_1900 69 * 0 0 * * 0 0 TCCCCTCGCTCGGCTCTGTGCTGT $&%*$#(#)##$#'##%(##$#$% +1378_111_1900 133 * 0 0 * * 0 0 GCACGCCTTTGGGCTAAGCCGTAA )$)'#%$########$'#&%$#(# +1378_112_1483 69 * 0 0 * * 0 0 TGTCCAGCTATGCGGCTTCCTCCT %#$+#%#&#$#####%####%$## +1378_112_1483 133 * 0 0 * * 0 0 TGGAGTGGTGTGTTTGCTGAGCCA #$#)#############$#%#%'% +1378_125_1287 69 * 0 0 * * 0 0 TGTCTCTGGGGGGCCTGGTTAGGT $##13$'%#$###$$###$$$#&# +1378_125_1287 133 * 0 0 * * 0 0 TGACGTGGGTTGTCCCGTGAGATT ##$%%#$###$##$$#&%##$(%% +1378_126_468 117 chr11.nib:1-134452384 72541052 0 24M = 72541052 0 TGCCTCTATACAGATTAGTCCTCT )7,7..?97594@8=,=?813@>7 +1378_126_468 153 chr11.nib:1-134452384 72541052 0 23M = 72541052 0 AGGCAAGACTCTGTCTCAAAAAA PK5G]]PDT\]SEXY[]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:15713 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_127_664 69 * 0 0 * * 0 0 AGAGGTTGGTGTCTTGTCGCAGCT ##'#$######$$%######$$$# +1378_127_664 133 * 0 0 * * 0 0 TCGCTTTGCCTATGTTTGTTCGGA #%$%#&##$%#%%###$$###)-' +1378_129_463 97 chr8.nib:1-146274826 29931771 37 23M chr19.nib:1-63811651 5702213 0 GTAGCTCTGTTTCACATTAGGGG J>AQ[G>C?NM:GD=)*PLORIF XT:A:U CM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_129_463 145 chr19.nib:1-63811651 5702213 0 23M chr8.nib:1-146274826 29931771 0 AAAAAAAAAAAAAAAAAAAAAAA JOI:AHGD==@KQB78HF>KA8> XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:583698 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_129_875 69 * 0 0 * * 0 0 TTTCTATGGCTTACGCTGTCTGCC #$($##%####%$#$#####$### +1378_129_875 133 * 0 0 * * 0 0 GACCTTTACGTATTGGGGGTTGGC ###)###+###$##$#&%##$,#$ +1378_140_1251 69 * 0 0 * * 0 0 ATCCTAGCGCGGTGTCTTGGGGAC #$%1#$$$##$##$#$#$##$%$$ +1378_140_1251 133 * 0 0 * * 0 0 TTTCCTTCGTGTGCGTGCGGAGTG #%#%$##$$$######.$$$%#%( +1378_141_809 69 * 0 0 * * 0 0 TGTCCTCCAGTGTCTGTTGGGTGT %&,-##$$#(%###$#$$'###'# +1378_141_809 133 * 0 0 * * 0 0 TCTCGTGGTTTCTTTTTTATGTGT ##%)##$$#####%$#$#%%#'## +1378_144_983 69 * 0 0 * * 0 0 AGCGCCCGGTTGGTGCGGCTCGTC -$(&%*$#*#))#$$$#%%$#$## +1378_144_983 133 * 0 0 * * 0 0 GTTCGTTCGTGGTGTACGAGGGTG #(#%#####($#%##$$#%##%#) +1378_153_270 69 * 0 0 * * 0 0 AGTCCTTGTCCCCTGGGTTTTCCC +''$#&%$%#$##&$$($#&#$$# +1378_153_270 133 * 0 0 * * 0 0 GGCCGTGTGCGGGTGTAGATTGGA %$##($######&##$&$$$$%## +1378_155_1689 65 chrX.nib:1-154913754 106941539 37 23M = 106940385 -1154 ATCTCCTCTTCCTTCCATTCCAC \]]]Y]]]]]UV]]]ZYZZ]]RV XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_155_1689 129 chrX.nib:1-154913754 106940385 37 23M = 106941539 1154 GACTATGAGGTTTTCATTCAACA ]]]]\\]]]YW]]]WRZ]]WIOK XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_157_1580 69 * 0 0 * * 0 0 TGGGCCTCGGTGCCCTTGGTCTGT #%)$##'#$$$&#####%#$#$## +1378_157_1580 133 * 0 0 * * 0 0 GGGATTGAAGGGATGTATGCTAGG #%$&%#$$'%$%#$##*#%$$$$# +1378_161_317 69 * 0 0 * * 0 0 TTGGCCGGCAACCCCGGTACCTAA 7<,<'@)@>.)2@/')'&(?/-<( +1378_161_317 133 * 0 0 * * 0 0 AATCCATACCCACAAAAGCAGGCC .&%','(@''?7//+&)+2.+)0) +1378_177_735 113 chr2.nib:1-242951149 222173182 25 23M = 222173882 700 TTGTTCAGCGCCGATTGTCAATC KPNICFMS]]]Z]]]]Y]]]]]] XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:1G21 +1378_177_735 177 chr2.nib:1-242951149 222173882 37 23M = 222173182 -700 AGAATTCCTAACAAAATGTGAAG ES6-]]]]]]]]]]]]]]]]]]] XT:A:U CM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:23 +1378_181_1684 69 * 0 0 * * 0 0 CGACTCCCGCATTCACGGTCAAGT &*#,##$#&$*$$#$#$$$#%$## +1378_181_1684 133 * 0 0 * * 0 0 TTTCTGTTGTGGTTTTGTTGGGGT $##'$%'##%##$%$#$$####$* +1378_187_1407 69 * 0 0 * * 0 0 TGGCGTCCACTCGTGGGTCTATCG $#$'%#$%$%&$%#####$#$#%# +1378_187_1407 133 * 0 0 * * 0 0 TTGGGTGAAATCTTGTCGAGTGGA ####&##$$###$#####%##%%) +1378_203_721 97 chr1.nib:1-247249719 245680524 25 23M chr2.nib:1-242951149 213173999 0 GTAAAATTTGTGGAGATTTAAGT ]VEFFEZ]XPW]TOVINQ,;T!! XT:A:U CM:i:2 SM:i:25 AM:i:25 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:23 +1378_203_721 145 chr2.nib:1-242951149 213173999 37 4M1I18M chr1.nib:1-247249719 245680524 0 ACCTAACAAAATTGTTCAATATG F>8AWT<AV]Q9B"+]O@IF=K] XT:A:U CM:i:2 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22 +1378_206_2039 113 chr4.nib:1-191273063 103793427 0 23M chr18.nib:1-76117153 57165542 0 ACACACACACACACACACACACA NKWZVWZ]]XV[]]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 +1378_206_2039 177 chr18.nib:1-76117153 57165542 0 23M chr4.nib:1-191273063 103793427 0 CACACACACACACACACACACAC NAJ[SPT[]]]W[]]]]]]]]]] XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:1292040 XM:i:0 XO:i:0 XG:i:0 MD:Z:23 diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/jobs/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -274,7 +274,7 @@ elif idata.state == idata.states.ERROR: job_wrapper.fail( "input data %d is in error state" % ( idata.hid ) ) return JOB_INPUT_ERROR - elif idata.state != idata.states.OK: + elif idata.state != idata.states.OK and not ( idata.state == idata.states.SETTING_METADATA and job.tool_id is not None and job.tool_id == self.app.datatypes_registry.set_external_metadata_tool.id ): # need to requeue return JOB_WAIT return JOB_READY @@ -543,7 +543,7 @@ # Certain tools require tasks to be completed after job execution # ( this used to be performed in the "exec_after_process" hook, but hooks are deprecated ). if self.tool.tool_type is not None: - self.tool.exec_after_process( self.queue.app, inp_data, out_data, param_dict ) + self.tool.exec_after_process( self.queue.app, inp_data, out_data, param_dict, job = job ) # Call 'exec_after_process' hook self.tool.call_hook( 'exec_after_process', self.queue.app, inp_data=inp_data, out_data=out_data, param_dict=param_dict, diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/jobs/runners/local.py --- a/lib/galaxy/jobs/runners/local.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/jobs/runners/local.py Thu Aug 20 11:39:32 2009 -0400 @@ -104,7 +104,7 @@ #run the metadata setting script here #this is terminatable when output dataset/job is deleted #so that long running set_meta()s can be cancelled without having to reboot the server - if job_wrapper.get_state() not in [ model.Job.states.ERROR, model.Job.states.DELETED ] and self.app.config.set_metadata_externally: + if job_wrapper.get_state() not in [ model.Job.states.ERROR, model.Job.states.DELETED ] and self.app.config.set_metadata_externally and job_wrapper.output_paths: external_metadata_script = job_wrapper.setup_external_metadata( output_fnames = job_wrapper.get_output_fnames(), kwds = { 'overwrite' : False } ) #we don't want to overwrite metadata that was copied over in init_meta(), as per established behavior log.debug( 'executing external set_meta script for job %d: %s' % ( job_wrapper.job_id, external_metadata_script ) ) external_metadata_proc = subprocess.Popen( args = external_metadata_script, diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/model/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,8 +5,7 @@ the relationship cardinalities are obvious (e.g. prefer Dataset to Data) """ -import os.path, os, errno -import sha +import os.path, os, errno, sys import galaxy.datatypes from galaxy.util.bunch import Bunch from galaxy import util @@ -14,8 +13,7 @@ import galaxy.datatypes.registry from galaxy.datatypes.metadata import MetadataCollection from galaxy.security import RBACAgent, get_permitted_actions - - +from galaxy.util.hash_util import * import logging log = logging.getLogger( __name__ ) @@ -40,10 +38,10 @@ def set_password_cleartext( self, cleartext ): """Set 'self.password' to the digest of 'cleartext'.""" - self.password = sha.new( cleartext ).hexdigest() + self.password = new_secure_hash( text_type=cleartext ) def check_password( self, cleartext ): """Check if 'cleartext' matches 'self.password' when hashed.""" - return self.password == sha.new( cleartext ).hexdigest() + return self.password == new_secure_hash( text_type=cleartext ) def all_roles( self ): roles = [ ura.role for ura in self.roles ] for group in [ uga.group for uga in self.groups ]: @@ -330,7 +328,8 @@ OK = 'ok', EMPTY = 'empty', ERROR = 'error', - DISCARDED = 'discarded' ) + DISCARDED = 'discarded', + SETTING_METADATA = 'setting_metadata' ) permitted_actions = get_permitted_actions( filter='DATASET' ) file_path = "/tmp/" engine = None diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,15 +1,13 @@ """ Classes encapsulating galaxy tools and tool configuration. """ - import pkg_resources; pkg_resources.require( "simplejson" ) import logging, os, string, sys, tempfile, glob, shutil import simplejson -import sha, hmac, binascii - +import binascii from UserDict import DictMixin from galaxy.util.odict import odict from galaxy.util.bunch import Bunch @@ -26,6 +24,7 @@ from galaxy.util.none_like import NoneDataset from galaxy.datatypes import sniff from cgi import FieldStorage +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -211,7 +210,7 @@ value["__page__"] = self.page value = simplejson.dumps( value ) # Make it secure - a = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + a = hmac_new( app.config.tool_secret, value ) b = binascii.hexlify( value ) return "%s:%s" % ( a, b ) def decode( self, value, tool, app ): @@ -221,7 +220,7 @@ # Extract and verify hash a, b = value.split( ":" ) value = binascii.unhexlify( b ) - test = hmac.new( app.config.tool_secret, value, sha ).hexdigest() + test = hmac_new( app.config.tool_secret, value ) assert a == test # Restore from string values = json_fix( simplejson.loads( value ) ) @@ -453,7 +452,6 @@ self.tests = None # Determine if this tool can be used in workflows self.is_workflow_compatible = self.check_workflow_compatible() - def parse_inputs( self, root ): """ @@ -1468,7 +1466,7 @@ out_data[ name ] = data return out_data - def exec_after_process( self, app, inp_data, out_data, param_dict ): + def exec_after_process( self, app, inp_data, out_data, param_dict, job = None ): if self.tool_type == 'data_source': name, data = out_data.items()[0] data.set_size() @@ -1572,6 +1570,18 @@ dataset.history.add( new_data ) new_data.flush() return primary_datasets + +class SetMetadataTool( Tool ): + def exec_after_process( self, app, inp_data, out_data, param_dict, job = None ): + for name, dataset in inp_data.iteritems(): + external_metadata = galaxy.datatypes.metadata.JobExternalOutputMetadataWrapper( job ) + if external_metadata.external_metadata_set_successfully( dataset ): + dataset.metadata.from_JSON_dict( external_metadata.get_output_filenames_by_dataset( dataset ).filename_out ) + # If setting external metadata has failed, how can we inform the user? + # For now, we'll leave the default metadata and set the state back to its original. + dataset.datatype.after_edit( dataset ) + dataset.state = param_dict.get( '__ORIGINAL_DATASET_STATE__' ) + dataset.flush() # ---- Utility classes to be factored out ----------------------------------- diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/actions/metadata.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/tools/actions/metadata.py Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,48 @@ +from __init__ import ToolAction +from galaxy.datatypes.metadata import JobExternalOutputMetadataWrapper + +import logging +log = logging.getLogger( __name__ ) + +class SetMetadataToolAction( ToolAction ): + """Tool action used for setting external metadata on an existing dataset""" + + def execute( self, tool, trans, incoming = {}, set_output_hid = False ): + for name, value in incoming.iteritems(): + if isinstance( value, trans.app.model.HistoryDatasetAssociation ): + dataset = value + dataset_name = name + break + else: + raise Exception( 'The dataset to set metadata on could not be determined.' ) + + # Create the job object + job = trans.app.model.Job() + job.session_id = trans.get_galaxy_session().id + job.history_id = trans.history.id + job.tool_id = tool.id + try: + # For backward compatibility, some tools may not have versions yet. + job.tool_version = tool.version + except: + job.tool_version = "1.0.0" + job.flush() #ensure job.id is available + + #add parameters to job_parameter table + incoming[ '__ORIGINAL_DATASET_STATE__' ] = dataset.state #store original dataset state, so we can restore it. A seperate table might be better (no chance of 'loosing' the original state)? + external_metadata_wrapper = JobExternalOutputMetadataWrapper( job ) + cmd_line = external_metadata_wrapper.setup_external_metadata( dataset, exec_dir = None, tmp_dir = trans.app.config.new_file_path, dataset_files_path = trans.app.model.Dataset.file_path, output_fnames = None, config_root = None, datatypes_config = None, kwds = { 'overwrite' : True } ) + incoming[ '__SET_EXTERNAL_METADATA_COMMAND_LINE__' ] = cmd_line + for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): + job.add_parameter( name, value ) + #add the dataset to job_to_input_dataset table + job.add_input_dataset( dataset_name, dataset ) + #Need a special state here to show that metadata is being set and also allow the job to run + # i.e. if state was set to 'running' the set metadata job would never run, as it would wait for input (the dataset to set metadata on) to be in a ready state + dataset.state = dataset.states.SETTING_METADATA + trans.app.model.flush() + + # Queue the job for execution + trans.app.job_queue.put( job.id, tool ) + trans.log_event( "Added set external metadata job to the job queue, id: %s" % str(job.id), tool_id=job.tool_id ) + return [] diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,5 @@ import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile +from __init__ import ToolAction from galaxy import datatypes, jobs from galaxy.datatypes import sniff from galaxy import model, util @@ -8,7 +9,7 @@ import logging log = logging.getLogger( __name__ ) -class UploadToolAction( object ): +class UploadToolAction( ToolAction ): # Action for uploading files def __init__( self ): self.empty = False diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/util/hash_util.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/util/hash_util.py Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,28 @@ +import sys, logging +using_24 = sys.version_info[:2] < ( 2, 5 ) +if using_24: + import sha +else: + import hashlib +import hmac + +log = logging.getLogger( __name__ ) + +""" +Utility functions for bi-directional Python version compatibility. Python 2.5 +introduced hashlib which replaced sha in Python 2.4 and previous versions. +""" +def new_secure_hash( text_type=None ): + if using_24: + if text_type: + return sha.new( text_type ).hexdigest() + return sha.new() + else: + if text_type: + return hashlib.sha1( text_type ).hexdigest() + return hashlib.sha1() +def hmac_new( key, value ): + if using_24: + return hmac.new( key, value, sha ).hexdigest() + else: + return hmac.new( key, value, hashlib.sha1 ).hexdigest() diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,9 +1,14 @@ -import shutil, StringIO, operator, urllib, gzip, tempfile, sets, string, sys +import shutil, StringIO, operator, urllib, gzip, tempfile, string, sys from datetime import datetime, timedelta from galaxy import util, datatypes from galaxy.web.base.controller import * from galaxy.model.orm import * from galaxy.web.controllers.forms import get_all_forms, get_form_widgets +# Older py compatibility +try: + set() +except: + from sets import Set as set import logging log = logging.getLogger( __name__ ) @@ -1206,7 +1211,6 @@ template = info_association.template # See if we have any field contents info = info_association.info - log.debug("####In library_dataset_dataset_association, info.content: %s" % str( info.content)) if info: widgets = get_form_widgets( trans, template, info.content ) else: @@ -1225,16 +1229,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): @@ -1410,16 +1414,16 @@ if v == trans.app.security_agent.permitted_actions.DATASET_ACCESS: if len( in_roles ) > 1: # Get the set of all users that are being associated with the dataset - in_roles_set = sets.Set() + in_roles_set = set() for role in in_roles: in_roles_set.add( role ) - users_set = sets.Set() + users_set = set() for role in in_roles: for ura in role.users: users_set.add( ura.user ) # Make sure that at least 1 user has every role being associated with the dataset for user in users_set: - user_roles_set = sets.Set() + user_roles_set = set() for ura in user.roles: user_roles_set.add( ura.role ) if in_roles_set.issubset( user_roles_set ): diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/async.py --- a/lib/galaxy/web/controllers/async.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/async.py Thu Aug 20 11:39:32 2009 -0400 @@ -6,8 +6,8 @@ from galaxy import jobs, util, datatypes, web -import logging, urllib -import sha, hmac +import logging, urllib, sys +from galaxy.util.hash_util import * log = logging.getLogger( __name__ ) @@ -58,7 +58,7 @@ return "Data %s does not exist or has already been deleted" % data_id if STATUS == 'OK': - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) if key != data_secret: return "You do not have permission to alter data %s." % data_id # push the job into the queue @@ -116,7 +116,7 @@ trans.log_event( "Added dataset %d to history %d" %(data.id, trans.history.id ), tool_id=tool_id ) try: - key = hmac.new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id), sha ).hexdigest() + key = hmac_new( trans.app.config.tool_secret, "%d:%d" % ( data.id, data.history_id ) ) galaxy_url = trans.request.base + '/async/%s/%s/%s' % ( tool_id, data.id, key ) params.update( { 'GALAXY_URL' :galaxy_url } ) params.update( { 'data_id' :data.id } ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,4 +1,4 @@ -import logging, os, sets, string, shutil, re, socket, mimetypes, smtplib, urllib +import logging, os, string, shutil, re, socket, mimetypes, smtplib, urllib from galaxy.web.base.controller import * from galaxy import util, datatypes, jobs, web, model diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/genetrack.py --- a/lib/galaxy/web/controllers/genetrack.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/genetrack.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,11 +1,10 @@ -import time, glob, os +import time, glob, os, sys from itertools import cycle -import sha - from mako import exceptions from mako.template import Template from mako.lookup import TemplateLookup from galaxy.web.base.controller import * +from galaxy.util.hash_util import * try: import pkg_resources @@ -265,7 +264,7 @@ tmpl_name, track_maker = conf.PLOT_MAPPER[param.plot] # check against a hash, display an image that already exists if it was previously created. - hash = sha.new() + hash = new_secure_hash() hash.update(str(dataset_id)) for key in sorted(kwds.keys()): hash.update(str(kwds[key])) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Aug 20 11:39:32 2009 -0400 @@ -12,7 +12,6 @@ # States for passing messages SUCCESS, INFO, WARNING, ERROR = "done", "info", "warning", "error" - class HistoryListGrid( grids.Grid ): # Custom column types @@ -70,8 +69,43 @@ def apply_default_filter( self, trans, query ): return query.filter_by( user=trans.user, purged=False ) +class SharedHistoryListGrid( grids.Grid ): + # Custom column types + class DatasetsByStateColumn( grids.GridColumn ): + def get_value( self, trans, grid, history ): + rval = [] + for state in ( 'ok', 'running', 'queued', 'error' ): + total = sum( 1 for d in history.active_datasets if d.state == state ) + if total: + rval.append( '<div class="count-box state-color-%s">%s</div>' % ( state, total ) ) + else: + rval.append( '' ) + return rval + class SharedByColumn( grids.GridColumn ): + def get_value( self, trans, grid, history ): + return history.user.email + # Grid definition + title = "Histories shared with you by others" + model_class = model.History + default_sort_key = "-update_time" + columns = [ + grids.GridColumn( "Name", key="name" ), + DatasetsByStateColumn( "Datasets (by state)", ncells=4 ), + grids.GridColumn( "Created", key="create_time", format=time_ago ), + grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), + SharedByColumn( "Shared by", key="user_id" ) + ] + operations = [ + grids.GridOperation( "Clone" ), + grids.GridOperation( "Unshare" ) + ] + standard_filters = [] + def build_initial_query( self, session ): + return session.query( self.model_class ).join( 'users_shared_with' ) + def apply_default_filter( self, trans, query ): + return query.filter( model.HistoryUserShareAssociation.user == trans.user ) + class HistoryController( BaseController ): - @web.expose def index( self, trans ): return "" @@ -80,7 +114,8 @@ """XML history list for functional tests""" return trans.fill_template( "/history/list_as_xml.mako" ) - list_grid = HistoryListGrid() + stored_list_grid = HistoryListGrid() + shared_list_grid = SharedHistoryListGrid() @web.expose @web.require_login( "work with multiple histories" ) @@ -91,7 +126,6 @@ if 'operation' in kwargs: history_ids = util.listify( kwargs.get( 'id', [] ) ) histories = [] - shared_by_others = [] operation = kwargs['operation'].lower() if operation == "share": return self.share( trans, **kwargs ) @@ -127,7 +161,7 @@ status, message = self._list_undelete( trans, histories ) trans.sa_session.flush() # Render the list view - return self.list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) + return self.stored_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) def _list_delete( self, trans, histories ): """Delete histories""" n_deleted = 0 @@ -195,18 +229,38 @@ # No message return None, None @web.expose - def list_shared( self, trans, **kwd ): + def list_shared( self, trans, **kwargs ): """List histories shared with current user by others""" - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - shared_by_others = trans.sa_session \ - .query( model.HistoryUserShareAssociation ) \ - .filter_by( user=trans.user ) \ - .join( 'history' ) \ - .filter( model.History.deleted == False ) \ - .order_by( desc( model.History.update_time ) ) \ - .all() - return trans.fill_template( "/history/list_shared.mako", shared_by_others=shared_by_others, msg=msg, messagetype='done' ) + msg = util.restore_text( kwargs.get( 'msg', '' ) ) + status = message = None + if 'operation' in kwargs: + id = kwargs.get( 'id', None ) + operation = kwargs['operation'].lower() + if operation == "clone": + if not id: + message = "Select a history to clone" + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) + # When cloning shared histories, only copy active datasets + new_kwargs = { 'clone_choice' : 'active' } + return self.clone( trans, id, **new_kwargs ) + elif operation == 'unshare': + if not id: + message = "Select a history to unshare" + return self.shared_list_grid( trans, status='error', message=message, template='/history/grid.mako', **kwargs ) + ids = util.listify( id ) + histories = [] + for history_id in ids: + history = get_history( trans, history_id, check_ownership=False ) + histories.append( history ) + for history in histories: + # Current user is the user with which the histories were shared + association = trans.app.model.HistoryUserShareAssociation.filter_by( user=trans.user, history=history ).one() + association.delete() + association.flush() + message = "Unshared %d shared histories" % len( ids ) + status = 'done' + # Render the list view + return self.shared_list_grid( trans, status=status, message=message, template='/history/grid.mako', **kwargs ) @web.expose def delete_current( self, trans ): """Delete just the active history -- this does not require a logged in user.""" @@ -323,6 +377,9 @@ can_change, cannot_change, no_change_needed, unique_no_change_needed, send_to_err = \ self._populate_restricted( trans, user, histories, send_to_users, None, send_to_err, unique=True ) send_to_err += err_msg + if cannot_change and not no_change_needed and not can_change: + send_to_err = "The histories you are sharing do not contain any datasets that can be accessed by the users with which you are sharing." + return trans.fill_template( "/history/share.mako", histories=histories, email=email, send_to_err=send_to_err ) if can_change or cannot_change: return trans.fill_template( "/history/share.mako", histories=histories, @@ -350,8 +407,6 @@ email=email, err_msg=err_msg, share_button=True ) ) - if action == "no_share": - trans.response.send_redirect( url_for( controller='root', action='history_options' ) ) user = trans.get_user() histories, send_to_users, send_to_err = self._get_histories_and_users( trans, user, id, email ) send_to_err = '' @@ -629,29 +684,38 @@ @web.expose @web.require_login( "clone shared Galaxy history" ) def clone( self, trans, id, **kwd ): - history = get_history( trans, id, check_ownership=False ) + """Clone a list of histories""" params = util.Params( kwd ) + ids = util.listify( id ) + histories = [] + for history_id in ids: + history = get_history( trans, history_id, check_ownership=False ) + histories.append( history ) clone_choice = params.get( 'clone_choice', None ) if not clone_choice: return trans.fill_template( "/history/clone.mako", history=history ) user = trans.get_user() - if history.user == user: - owner = True + for history in histories: + if history.user == user: + owner = True + else: + if trans.sa_session.query( trans.app.model.HistoryUserShareAssociation ) \ + .filter_by( user=user, history=history ).count() == 0: + return trans.show_error_message( "The history you are attempting to clone is not owned by you or shared with you. " ) + owner = False + name = "Clone of '%s'" % history.name + if not owner: + name += " shared by '%s'" % history.user.email + if clone_choice == 'activatable': + new_history = history.copy( name=name, target_user=user, activatable=True ) + elif clone_choice == 'active': + name += " (active items only)" + new_history = history.copy( name=name, target_user=user ) + if len( histories ) == 1: + msg = 'Clone with name "%s" is now included in your previously stored histories.' % new_history.name else: - if trans.sa_session.query( trans.app.model.HistoryUserShareAssociation ) \ - .filter_by( user=user, history=history ).count() == 0: - return trans.show_error_message( "The history you are attempting to clone is not owned by you or shared with you. " ) - owner = False - name = "Clone of '%s'" % history.name - if not owner: - name += " shared by '%s'" % history.user.email - if clone_choice == 'activatable': - new_history = history.copy( name=name, target_user=user, activatable=True ) - elif clone_choice == 'active': - name += " (active items only)" - new_history = history.copy( name=name, target_user=user ) - # Render the list view - return trans.show_ok_message( 'Clone with name "%s" is now included in your list of stored histories.' % new_history.name ) + msg = '%d cloned histories are now included in your previously stored histories.' % len( histories ) + return trans.show_ok_message( msg ) ## ---- Utility methods ------------------------------------------------------- diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Thu Aug 20 11:39:32 2009 -0400 @@ -465,7 +465,7 @@ msg=util.sanitize_text( msg ), messagetype='error' ) ) # See if we have any associated templates - info_association = folder.get_info_association() + info_association = ldda.get_info_association() if info_association: template = info_association.template # See if we have any field contents diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Thu Aug 20 11:39:32 2009 -0400 @@ -147,16 +147,12 @@ helptext='')) # library associated if request.library: - request_details.append(dict(label='Library', - value=request.library.name, - helptext='Associated library where the resultant \ - dataset will be stored')) + value = request.library.name else: - request_details.append(dict(label='Library', - value=None, - helptext='Associated library where the resultant \ - dataset will be stored')) - + value = None + request_details.append( dict( label='Data library', + value=value, + helptext='Data library where the resultant dataset will be stored' ) ) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: @@ -489,18 +485,17 @@ else: lib_list.add_option(lib.name, lib.id) if lib_id == 'new': - lib_list.add_option('Create a new library', 'new', selected=True) + lib_list.add_option('Create a new data library', 'new', selected=True) else: - lib_list.add_option('Create a new library', 'new') - widget = dict(label='Library', + lib_list.add_option('Create a new data library', 'new') + widget = dict(label='Data library', widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored.') + helptext='Data library where the resultant dataset will be stored.') if lib_id == 'new': - new_lib = dict(label='Create a new Library', + new_lib = dict(label='Create a new data library', widget=TextField('new_library_name', 40, util.restore_text( params.get( 'new_library_name', '' ) )), - helptext='Enter a library name here to request a new library') + helptext='Enter a name here to request a new data library') return [widget, new_lib] else: return [widget] @@ -510,7 +505,7 @@ ''' empty_fields = [] # if not request.library: -# empty_fields.append('Library') +# empty_fields.append('Data library') # check rest of the fields of the form for index, field in enumerate(request.type.request_form.fields): if field['required'] == 'required' and request.values.content[index] in ['', None]: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 11:39:32 2009 -0400 @@ -544,15 +544,12 @@ helptext='')) # library associated if request.library: - request_details.append(dict(label='Library', - value=request.library.name, - helptext='Associated library where the resultant \ - dataset will be stored')) + value=request.library.name else: - request_details.append(dict(label='Library', - value=None, - helptext='Associated library where the resultant \ - dataset will be stored')) + value = None + request_details.append(dict(label='Data library', + value=value, + helptext='Data library where the resultant dataset will be stored')) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,7 +1,7 @@ """ Contains the main interface in the Universe class """ -import logging, os, sets, string, shutil, urllib, re, socket +import logging, os, string, shutil, urllib, re, socket from cgi import escape, FieldStorage from galaxy import util, datatypes, jobs, web, util from galaxy.web.base.controller import * @@ -60,7 +60,6 @@ trans.response.set_content_type('text/xml') return trans.fill_template_mako( "root/history_as_xml.mako", history=history, show_deleted=util.string_as_bool( show_deleted ) ) else: - template = "root/history.mako" show_deleted = util.string_as_bool( show_deleted ) query = trans.sa_session.query( model.HistoryDatasetAssociation ) \ .filter( model.HistoryDatasetAssociation.history == history ) \ @@ -297,10 +296,15 @@ if name not in [ 'name', 'info', 'dbkey' ]: if spec.get( 'default' ): setattr( data.metadata, name, spec.unwrap( spec.get( 'default' ) ) ) - data.set_meta() - data.datatype.after_edit( data ) + if trans.app.config.set_metadata_externally: + msg = 'Attributes have been queued to be updated' + trans.app.datatypes_registry.set_external_metadata_tool.tool_action.execute( trans.app.datatypes_registry.set_external_metadata_tool, trans, incoming = { 'input1':data } ) + else: + msg = 'Attributes updated' + data.set_meta() + data.datatype.after_edit( data ) trans.app.model.flush() - return trans.show_ok_message( "Attributes updated", refresh_frames=['history'] ) + return trans.show_ok_message( msg, refresh_frames=['history'] ) elif params.convert_data: target_type = kwd.get("target_type", None) if target_type: diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/controllers/tool_runner.py --- a/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 11:39:32 2009 -0400 @@ -5,6 +5,7 @@ from galaxy.web.base.controller import * from galaxy.util.bunch import Bunch from galaxy.tools import DefaultToolState +from galaxy.tools.parameters.basic import UnvalidatedValue import logging log = logging.getLogger( __name__ ) @@ -52,15 +53,84 @@ add_frame.wiki_url = trans.app.config.wiki_url add_frame.from_noframe = True return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) - + + @web.expose + def rerun( self, trans, id=None, from_noframe=None, **kwd ): + """ + Given a HistoryDatasetAssociation id, find the job and that created + the dataset, extract the parameters, and display the appropriate tool + form with parameters already filled in. + """ + if not id: + error( "'id' parameter is required" ); + try: + id = int( id ) + except: + error( "Invalid value for 'id' parameter" ) + # Get the dataset object + data = trans.app.model.HistoryDatasetAssociation.get( id ) + # Get the associated job, if any. If this hda was copied from another, + # we need to find the job that created the origial hda + job_hda = data + while job_hda.copied_from_history_dataset_association: + job_hda = job_hda.copied_from_history_dataset_association + if not job_hda.creating_job_associations: + error( "Could not find the job for this dataset" ) + # Get the job object + job = None + for assoc in job_hda.creating_job_associations: + job = assoc.job + break + if not job: + raise Exception("Failed to get job information for dataset hid %d" % hid) + # Get the tool object + tool_id = job.tool_id + try: + # Load the tool + toolbox = self.get_toolbox() + tool = toolbox.tools_by_id.get( tool_id, None ) + except: + #this is expected, so not an exception + error( "This dataset was created by an obsolete tool (%s). Can't re-run." % tool_id ) + # Can't rerun upload, external data sources, et cetera. Workflow + # compatible will proxy this for now + if not tool.is_workflow_compatible: + error( "The '%s' tool does not currently support rerunning." % tool.name ) + # Get the job's parameters + try: + params_objects = job.get_param_values( trans.app ) + except: + raise Exception( "Failed to get paramemeters for dataset id %d " % hid ) + # Unpack unvalidated values to strings, they'll be validated when the + # form is submitted (this happens when re-running a job that was + # initially run by a workflow) + validated_params = {} + for name, value in params_objects.items(): + if isinstance( value, UnvalidatedValue ): + validated_params [ str(name) ] = str(value) + else: + validated_params [ str(name) ] = value + params_objects = validated_params + # Create a fake tool_state for the tool, with the parameters values + state = tool.new_state( trans ) + state.inputs = params_objects + tool_state_string = util.object_to_string(state.encode(tool, trans.app)) + # Setup context for template + history = trans.get_history() + vars = dict( tool_state=state, errors = {} ) + # Is the "add frame" stuff neccesary here? + add_frame = AddFrameData() + add_frame.debug = trans.debug + if from_noframe is not None: + add_frame.wiki_url = trans.app.config.wiki_url + add_frame.from_noframe = True + return trans.fill_template( "tool_form.mako", history=history, toolbox=toolbox, tool=tool, util=util, add_frame=add_frame, **vars ) @web.expose def redirect( self, trans, redirect_url=None, **kwd ): if not redirect_url: return trans.show_error_message( "Required URL for redirection missing" ) trans.log_event( "Redirecting to: %s" % redirect_url ) return trans.fill_template( 'root/redirect.mako', redirect_url=redirect_url ) - - @web.json def upload_async_create( self, trans, tool_id=None, **kwd ): """ diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/form_builder.py --- a/lib/galaxy/web/form_builder.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/form_builder.py Thu Aug 20 11:39:32 2009 -0400 @@ -3,6 +3,7 @@ """ import logging,sys +from cgi import escape log = logging.getLogger(__name__) class BaseField(object): @@ -28,7 +29,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<input type="text" name="%s%s" size="%d" value="%s">' \ - % ( prefix, self.name, self.size, self.value ) + % ( prefix, self.name, self.size, escape(str(self.value), quote=True) ) def set_size(self, size): self.size = int( size ) @@ -49,7 +50,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<textarea name="%s%s" rows="%d" cols="%d">%s</textarea>' \ - % ( prefix, self.name, self.rows, self.cols, self.value ) + % ( prefix, self.name, self.rows, self.cols, escape(str(self.value), quote=True) ) def set_size(self, rows, cols): self.rows = rows self.cols = cols @@ -113,7 +114,7 @@ self.name = name self.value = value or "" def get_html( self, prefix="" ): - return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, self.value ) + return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, escape(str(self.value), quote=True) ) class SelectField(BaseField): """ @@ -190,9 +191,9 @@ if len(self.options) > 2 and ctr % 2 == 1: style = " class=\"odd_row\"" if selected: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) else: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) ctr += 1 return "\n".join( rval ) def get_html_radio( self, prefix="" ): @@ -204,7 +205,7 @@ style = " class=\"odd_row\"" if selected: selected_text = " checked" else: selected_text = "" - rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, value, selected_text, text ) ) + rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, escape(str(value), quote=True), selected_text, text ) ) ctr += 1 return "\n".join( rval ) def get_html_default( self, prefix="" ): @@ -217,9 +218,9 @@ selected_text = " selected" last_selected_value = value else: selected_text = "" - rval.append( '<option value="%s"%s>%s</option>' % ( value, selected_text, text ) ) + rval.append( '<option value="%s"%s>%s</option>' % ( escape(str(value), quote=True), selected_text, text ) ) if last_selected_value: - last_selected_value = ' last_selected_value="%s"' % last_selected_value + last_selected_value = ' last_selected_value="%s"' % escape(str(last_selected_value), quote=True) rval.insert( 0, '<select name="%s%s"%s%s%s>' % ( prefix, self.name, multiple, self.refresh_on_change_text, last_selected_value ) ) rval.append( '</select>' ) return "\n".join( rval ) @@ -326,12 +327,12 @@ if option['value'] in expanded_options: default_state = 'expanded' default_icon = '[-]' - html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '<ul class="toolParameterExpandableCollapsable" default_state="%s">' % default_state ) recurse_options( html, option['options'], expanded_options ) html.append( '</ul>') else: - html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '</li>' ) rval = [] rval.append( '<div><ul class="toolParameterExpandableCollapsable">' ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Thu Aug 20 11:39:32 2009 -0400 @@ -93,8 +93,8 @@ """ Exception to make throwing errors from deep in controllers easier """ - def __init__( self, message, type="info" ): - self.message = message + def __init__( self, err_msg, type="info" ): + self.err_msg = err_msg self.type = type def error( message ): @@ -117,7 +117,7 @@ self.security = galaxy_app.security def handle_controller_exception( self, e, trans, **kwargs ): if isinstance( e, MessageException ): - return trans.show_message( e.message, e.type ) + return trans.show_message( e.err_msg, e.type ) def make_body_iterable( self, trans, body ): if isinstance( body, FormBuilder ): body = trans.show_form( body ) diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/web/framework/helpers/grids.py Thu Aug 20 11:39:32 2009 -0400 @@ -156,9 +156,7 @@ elif column_filter == "All": del filter_args[self.key] return query - - - + class GridOperation( object ): def __init__( self, label, key=None, condition=None, allow_multiple=True ): self.label = label diff -r 881dd4c2de9f -r 070cf5f6f928 lib/galaxy/webapps/reports/controllers/root.py --- a/lib/galaxy/webapps/reports/controllers/root.py Thu Aug 20 10:52:08 2009 -0400 +++ b/lib/galaxy/webapps/reports/controllers/root.py Thu Aug 20 11:39:32 2009 -0400 @@ -1,8 +1,8 @@ -import sys, os, operator, sets, string, shutil, re, socket, urllib +import sys, os, operator, string, shutil, re, socket, urllib, time from galaxy import web from cgi import escape, FieldStorage from galaxy.webapps.reports.base.controller import * -import logging, sets, time +import logging log = logging.getLogger( __name__ ) class Report( BaseController ): diff -r 881dd4c2de9f -r 070cf5f6f928 static/jStore.Flash.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/jStore.Flash.html Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,19 @@ +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"> + <head> + <title>Flash External Object</title> + <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> + <script type="text/javascript"> + /** + * This function captures the flash_ready event. We need to relay this + * back to the parent so it knows flash is ready. + */ + function flash_ready(){ + parent.flash_ready(); + } + </script> + </head> + <body> + <object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#versi…" width="1" height="1" id="jStoreFlash"><param name="allowScriptAccess" value="always" /><param name="movie" value="jStore.swf" /><param name="quality" value="high" /><param name="bgcolor" value="#ffcc00" /><embed src="jStore.swf" quality="high" bgcolor="#ffcc00" width="1" height="1" name="jStoreFlash" align="middle" allowScriptAccess="always" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /></object> + </body> +</html> \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/jStore.swf Binary file static/jStore.swf has changed diff -r 881dd4c2de9f -r 070cf5f6f928 static/june_2007_style/blue/history.css --- a/static/june_2007_style/blue/history.css Thu Aug 20 10:52:08 2009 -0400 +++ b/static/june_2007_style/blue/history.css Thu Aug 20 11:39:32 2009 -0400 @@ -13,6 +13,8 @@ div.historyItem-empty .state-icon{background:url(history-states.png) no-repeat 0px -25px;} div.historyItem-running{border-color:#AAAA66;background:#FFFFCC;} div.historyItem-running .state-icon{background-image:url(data_running.gif);} +div.historyItem-setting_metadata{border-color:#AAAA66;background:#FFFFCC;} +div.historyItem-setting_metadata .state-icon{background-image:url(data_running.gif);} div.historyItem-upload{border-color:#6666AA;background:#CCCCFF;} div.historyItem-upload .state-icon{background-image:url(data_upload.gif);} div.historyItem-queued{background:#EEEEEE;} diff -r 881dd4c2de9f -r 070cf5f6f928 static/june_2007_style/history.css.tmpl --- a/static/june_2007_style/history.css.tmpl Thu Aug 20 10:52:08 2009 -0400 +++ b/static/june_2007_style/history.css.tmpl Thu Aug 20 11:39:32 2009 -0400 @@ -72,6 +72,14 @@ } div.historyItem-running { + border-color: $history_running_border; + background: $history_running_bg; + .state-icon { + background-image: url(data_running.gif); + } +} + +div.historyItem-setting_metadata { border-color: $history_running_border; background: $history_running_bg; .state-icon { diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/galaxy.workflow_editor.canvas.js --- a/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 10:52:08 2009 -0400 +++ b/static/scripts/galaxy.workflow_editor.canvas.js Thu Aug 20 11:39:32 2009 -0400 @@ -359,6 +359,7 @@ this.nodes = {}; this.name = null; this.has_changes = false; + this.active_form_has_changes = false; } $.extend( Workflow.prototype, { add_node : function( node ) { @@ -438,6 +439,14 @@ }); }); }, + check_changes_in_active_form : function() { + // If active form has changed, save it + if (this.active_form_has_changes) { + this.has_changes = true; + $("#right-content").find("form").submit(); + this.active_form_has_changes = false; + } + }, clear_active_node : function() { if ( this.active_node ) { this.active_node.make_inactive(); @@ -447,6 +456,7 @@ }, activate_node : function( node ) { if ( this.active_node != node ) { + this.check_changes_in_active_form(); this.clear_active_node(); parent.show_form_for_tool( node.form_html, node ); node.make_active(); @@ -461,6 +471,7 @@ } }, layout : function () { + this.check_changes_in_active_form(); // Prepare predecessor / successor tracking var n_pred = {}; var successors = {}; @@ -502,7 +513,7 @@ var v = level_parents[k]; delete n_pred[v]; for ( var sk in successors[v] ) { - n_pred[ sucessors[v][sk] ] -= 1; + n_pred[ successors[v][sk] ] -= 1; } } } @@ -805,6 +816,10 @@ self.draw_overview(); }); + /* Disable dragging for child element of the panel so that resizing can + only be done by dragging the borders */ + $("#overview-border div").bind("drag", function(e) { }); + }, update_viewport_overlay: function() { var cc = this.cc, diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/jquery.jstore-all.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,748 @@ +/*! + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + *//** + * Javascript Class Framework + * + * Copyright (c) 2008 John Resig (http://ejohn.org/blog/simple-javascript-inheritance/) + * Inspired by base2 and Prototype + */ +(function(){ + var initializing = false, fnTest = /xyz/.test(function(){xyz;}) ? /\b_super\b/ : /.*/; + + // The base Class implementation (does nothing) + this.Class = function(){}; + + // Create a new Class that inherits from this class + Class.extend = function(prop) { + var _super = this.prototype; + + // Instantiate a base class (but only create the instance, + // don't run the init constructor) + initializing = true; + var prototype = new this(); + initializing = false; + + // Copy the properties over onto the new prototype + for (var name in prop) { + // Check if we're overwriting an existing function + prototype[name] = typeof prop[name] == "function" && + typeof _super[name] == "function" && fnTest.test(prop[name]) ? + (function(name, fn){ + return function() { + var tmp = this._super; + + // Add a new ._super() method that is the same method + // but on the super-class + this._super = _super[name]; + + // The method only need to be bound temporarily, so we + // remove it when we're done executing + var ret = fn.apply(this, arguments); + this._super = tmp; + + return ret; + }; + })(name, prop[name]) : + prop[name]; + } + + // The dummy class constructor + function Class() { + // All construction is actually done in the init method + if ( !initializing && this.init ) + this.init.apply(this, arguments); + } + + // Populate our constructed prototype object + Class.prototype = prototype; + + // Enforce the constructor to be what we expect + Class.constructor = Class; + + // And make this class extendable + Class.extend = arguments.callee; + + return Class; + }; +})(); +/*! + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.jStoreDelegate = Class.extend({ + init: function(parent){ + // The Object this delgate operates for + this.parent = parent; + // Container for callbacks to dispatch. + // eventType => [ callback, callback, ... ] + this.callbacks = {}; + }, + bind: function(event, callback){ + if ( !$.isFunction(callback) ) return this; + if ( !this.callbacks[ event ] ) this.callbacks[ event ] = []; + + this.callbacks[ event ].push(callback); + + return this; + }, + trigger: function(){ + var parent = this.parent, + args = [].slice.call(arguments), + event = args.shift(), + handlers = this.callbacks[ event ]; + + if ( !handlers ) return false; + + $.each(handlers, function(){ this.apply(parent, args) }); + return this; + } + }); + +})(jQuery);/** + * jStore-jQuery Interface + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Setup the jStore namespace in jQuery for options storage + $.jStore = {}; + + // Seed the options in + $.extend($.jStore, { + EngineOrder: [], + // Engines should put their availability tests within jStore.Availability + Availability: {}, + // Defined engines should enter themselves into the jStore.Engines + Engines: {}, + // Instanciated engines should exist within jStore.Instances + Instances: {}, + // The current engine to use for storage + CurrentEngine: null, + // Provide global settings for overwriting + defaults: { + project: null, + engine: null, + autoload: true, + flash: 'jStore.Flash.html' + }, + // Boolean for ready state handling + isReady: false, + // Boolean for flash ready state handling + isFlashReady: false, + // An event delegate + delegate: new jStoreDelegate($.jStore) + .bind('jStore-ready', function(engine){ + $.jStore.isReady = true; + if ($.jStore.defaults.autoload) engine.connect(); + }) + .bind('flash-ready', function(){ + $.jStore.isFlashReady = true; + }) + }); + + // Enable ready callback for jStore + $.jStore.ready = function(callback){ + if ($.jStore.isReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('jStore-ready', callback); + } + + // Enable failure callback registration for jStore + $.jStore.fail = function(callback){ + $.jStore.delegate.bind('jStore-failure', callback); + } + + // Enable ready callback for Flash + $.jStore.flashReady = function(callback){ + if ($.jStore.isFlashReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('flash-ready', callback); + } + + // Enable and test an engine + $.jStore.use = function(engine, project, identifier){ + project = project || $.jStore.defaults.project || location.hostname.replace(/\./g, '-') || 'unknown'; + + var e = $.jStore.Engines[engine.toLowerCase()] || null, + name = (identifier ? identifier + '.' : '') + project + '.' + engine; + + if ( !e ) throw 'JSTORE_ENGINE_UNDEFINED'; + + // Instanciate the engine + e = new e(project, name); + + // Prevent against naming conflicts + if ($.jStore.Instances[name]) throw 'JSTORE_JRI_CONFLICT'; + + // Test the engine + if (e.isAvailable()){ + $.jStore.Instances[name] = e; // The Easy Way + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = e; + } + $.jStore.delegate.trigger('jStore-ready', e); + } else { + if (!e.autoload) // Not available + throw 'JSTORE_ENGINE_UNAVILABLE'; + else { // The hard way + e.included(function(){ + if (this.isAvailable()) { // Worked out + $.jStore.Instances[name] = this; + // If there is no current engine, use this one + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = this; + } + $.jStore.delegate.trigger('jStore-ready', this); + } + else $.jStore.delegate.trigger('jStore-failure', this); + }).include(); + } + } + } + + // Set the current storage engine + $.jStore.setCurrentEngine = function(name){ + if (!$.jStore.Instances.length ) // If no instances exist, attempt to load one + return $.jStore.FindEngine(); + + if (!name && $.jStore.Instances.length >= 1) { // If no name is specified, use the first engine + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[0]); + return $.jStore.CurrentEngine = $.jStore.Instances[0]; + } + + if (name && $.jStore.Instances[name]) { // If a name is specified and exists, use it + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[name]); + return $.jStore.CurrentEngine = $.jStore.Instances[name]; + } + + throw 'JSTORE_JRI_NO_MATCH'; + } + + // Test all possible engines for straightforward useability + $.jStore.FindEngine = function(){ + $.each($.jStore.EngineOrder, function(k){ + if ($.jStore.Availability[this]()){ // Find the first, easiest option and use it. + $.jStore.use(this, $.jStore.defaults.project, 'default'); + return false; + } + }) + } + + // Provide a simple interface for storing/getting values + $.jStore.store = function(key, value){ + if (!$.jStore.CurrentEngine) return false; + + if ( !value ) // Executing a get command + return $.jStore.CurrentEngine.get(key); + // Executing a set command + return $.jStore.CurrentEngine.set(key, value); + } + // Provide a simple interface for storing/getting values + $.jStore.remove = function(key){ + if (!$.jStore.CurrentEngine) return false; + + return $.jStore.CurrentEngine.rem(key); + } + + // Provide a chainable interface for storing values/getting a value at the end of a chain + $.fn.store = function(key, value){ + if (!$.jStore.CurrentEngine) return this; + + var result = $.jStore.store(key, value); + + return !value ? result : this; + } + + // Provide a chainable interface for removing values + $.fn.removeStore = function(key){ + $.jStore.remove(key); + + return this; + } + + // Provide a way for users to call for auto-loading + $.jStore.load = function(){ + if ($.jStore.defaults.engine) + return $.jStore.use($.jStore.defaults.engine, $.jStore.defaults.project, 'default'); + + // Attempt to find a valid engine, and catch any exceptions if we can't + try { + $.jStore.FindEngine(); + } catch (e) {} + } + +})(jQuery); +/** + * jStore Engine Core + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.StorageEngine = Class.extend({ + init: function(project, name){ + // Configure the project name + this.project = project; + // The JRI name given by the manager + this.jri = name; + // Cache the data so we can work synchronously + this.data = {}; + // The maximum limit of the storage engine + this.limit = -1; + // Third party script includes + this.includes = []; + // Create an event delegate for users to subscribe to event triggers + this.delegate = new jStoreDelegate(this) + .bind('engine-ready', function(){ + this.isReady = true; + }) + .bind('engine-included', function(){ + this.hasIncluded = true; + }); + // If enabled, the manager will check availability, then run include(), then check again + this.autoload = false; // This should be changed by the engines, if they have required includes + // When set, we're ready to transact data + this.isReady = false; + // When the includer is finished, it will set this to true + this.hasIncluded = false; + }, + // Performs all necessary script includes + include: function(){ + var self = this, + total = this.includes.length, + count = 0; + + $.each(this.includes, function(){ + $.ajax({type: 'get', url: this, dataType: 'script', cache: true, + success: function(){ + count++; + if (count == total) self.delegate.trigger('engine-included'); + } + }) + }); + }, + // This should be overloaded with an actual functionality presence check + isAvailable: function(){ + return false; + }, + /** Event Subscription Shortcuts **/ + ready: function(callback){ + if (this.isReady) callback.apply(this); + else this.delegate.bind('engine-ready', callback); + return this; + }, + included: function(callback){ + if (this.hasIncluded) callback.apply(this); + else this.delegate.bind('engine-included', callback); + return this; + }, + /** Cache Data Access **/ + get: function(key){ + return this.data[key] || null; + }, + set: function(key, value){ + this.data[key] = value; + return value; + }, + rem: function(key){ + var beforeDelete = this.data[key]; + this.data[key] = null; + return beforeDelete; + } + }); + +})(jQuery); +/*! + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var sessionAvailability = $.jStore.Availability.session = function(){ + return !!window.sessionStorage; + }, + localAvailability = $.jStore.Availability.local = function(){ + return !!(window.localStorage || window.globalStorage); + }; + + this.jStoreDom = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'DOM'; + + // Set the Database limit + this.limit = 5 * 1024 * 1024; + }, + connect: function(){ + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + get: function(key){ + var out = this.db.getItem(key); + // Gecko's getItem returns {value: 'the value'}, WebKit returns 'the value' + return out && out.value ? out.value : out + }, + set: function(key, value){ + this.db.setItem(key,value); + return value; + }, + rem: function(key){ + var out = this.get(key); + this.db.removeItem(key); + return out + } + }) + + this.jStoreLocal = jStoreDom.extend({ + connect: function(){ + // Gecko uses a non-standard globalStorage[ www.example.com ] DOM access object for persistant storage. + this.db = !window.globalStorage ? window.localStorage : window.globalStorage[location.hostname]; + this._super(); + }, + isAvailable: localAvailability + }) + + this.jStoreSession = jStoreDom.extend({ + connect: function(){ + this.db = sessionStorage; + this._super(); + }, + isAvailable: sessionAvailability + }) + + $.jStore.Engines.local = jStoreLocal; + $.jStore.Engines.session = jStoreSession; + + // Store the ordering preference + $.jStore.EngineOrder[ 1 ] = 'local'; + +})(jQuery); +/*! + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.flash = function(){ + return !!($.jStore.hasFlash('8.0.0')); + } + + this.jStoreFlash = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Flash'; + + // Bind our flashReady function to the jStore Delegate + var self = this; + $.jStore.flashReady(function(){ self.flashReady() }); + }, + connect: function(){ + var name = 'jstore-flash-embed-' + this.project; + + // To make Flash Storage work on IE, we have to load up an iFrame + // which contains an HTML page that embeds the object using an + // object tag wrapping an embed tag. Of course, this is unnecessary for + // all browsers except for IE, which, to my knowledge, is the only browser + // in existance where you need to complicate your code to fix bugs. Goddamnit. :( + $(document.body) + .append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" ' + + 'id="jStoreFlashFrame" src="' +$.jStore.defaults.flash + '"></iframe>'); + }, + flashReady: function(e){ + var iFrame = $('#jStoreFlashFrame')[0]; + + // IE + if (iFrame.Document && $.isFunction(iFrame.Document['jStoreFlash'].f_get_cookie)) this.db = iFrame.Document['jStoreFlash']; + // Safari && Firefox + else if (iFrame.contentWindow && iFrame.contentWindow.document){ + var doc = iFrame.contentWindow.document; + // Safari + if ($.isFunction($('object', $(doc))[0].f_get_cookie)) this.db = $('object', $(doc))[0]; + // Firefox + else if ($.isFunction($('embed', $(doc))[0].f_get_cookie)) this.db = $('embed', $(doc))[0]; + } + + // We're ready to process data + if (this.db) this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + var out = this.db.f_get_cookie(key); + return out == 'null' ? null : out; + }, + set: function(key, value){ + this.db.f_set_cookie(key, value); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.f_delete_cookie(key); + return beforeDelete; + } + }) + + $.jStore.Engines.flash = jStoreFlash; + + // Store the ordering preference + $.jStore.EngineOrder[ 2 ] = 'flash'; + + /** + * Flash Detection functions copied from the jQuery Flash Plugin + * Copyright (c) 2006 Luke Lutman (http://jquery.lukelutman.com/plugins/flash) + * Dual licensed under the MIT and GPL licenses. + * http://www.opensource.org/licenses/mit-license.php + * http://www.opensource.org/licenses/gpl-license.php + */ + $.jStore.hasFlash = function(version){ + var pv = $.jStore.flashVersion().match(/\d+/g), + rv = version.match(/\d+/g); + + for(var i = 0; i < 3; i++) { + pv[i] = parseInt(pv[i] || 0); + rv[i] = parseInt(rv[i] || 0); + // player is less than required + if(pv[i] < rv[i]) return false; + // player is greater than required + if(pv[i] > rv[i]) return true; + } + // major version, minor version and revision match exactly + return true; + } + + $.jStore.flashVersion = function(){ + // ie + try { + try { + // avoid fp6 minor version lookup issues + // see: http://blog.deconcept.com/2006/01/11/getvariable-setvariable-crash-internet… + var axo = new ActiveXObject('ShockwaveFlash.ShockwaveFlash.6'); + try { axo.AllowScriptAccess = 'always'; } + catch(e) { return '6,0,0'; } + } catch(e) {} + return new ActiveXObject('ShockwaveFlash.ShockwaveFlash').GetVariable('$version').replace(/\D+/g, ',').match(/^,?(.+),?$/)[1]; + // other browsers + } catch(e) { + try { + if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){ + return (navigator.plugins["Shockwave Flash 2.0"] || navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g, ",").match(/^,?(.+),?$/)[1]; + } + } catch(e) {} + } + return '0,0,0'; + } + +})(jQuery); + +// Callback fired when ExternalInterface is established +function flash_ready(){ + $.jStore.delegate.trigger('flash-ready'); +} +/*! + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.gears = function(){ + return !!(window.google && window.google.gears) + } + + this.jStoreGears = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Google Gears'; + + // Add required third-party scripts + this.includes.push('http://code.google.com/apis/gears/gears_init.js'); + + // Allow Autoloading on fail + this.autoload = true; + }, + connect: function(){ + // Create our database connection + var db = this.db = google.gears.factory.create('beta.database'); + db.open( 'jstore-' + this.project ); + db.execute( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + // Read the database into our cache object + var result = this.db.execute( 'SELECT k,v FROM jstore' ); + while (result.isValidRow()){ + this.data[result.field(0)] = result.field(1); + result.next(); + } result.close(); + + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value] ); + db.execute( 'COMMIT' ); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'DELETE FROM jstore WHERE k = ?', [key] ); + db.execute( 'COMMIT' ); + return this._super(key); + } + }) + + $.jStore.Engines.gears = jStoreGears; + + // Store the ordering preference + $.jStore.EngineOrder[ 3 ] = 'gears'; + +})(jQuery); +/*! + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.html5 = function(){ + return !!window.openDatabase + } + + this.jStoreHtml5 = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'HTML5'; + + // Set the Database limit + this.limit = 1024 * 200; + }, + connect: function(){ + // Create our database connection + var db = this.db = openDatabase('jstore-' + this.project, '1.0', this.project, this.limit); + if (!db) throw 'JSTORE_ENGINE_HTML5_NODB'; + db.transaction(function(db){ + db.executeSql( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + }); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + var self = this; + // Read the database into our cache object + this.db.transaction(function(db){ + db.executeSql( 'SELECT k,v FROM jstore', [], function(db, result){ + var rows = result.rows, i = 0, row; + for (; i < rows.length; ++i){ + row = rows.item(i); + self.data[row.k] = row.v; + } + + // Fire our delegate to indicate we're ready for data transactions + self.delegate.trigger('engine-ready'); + }); + }); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value]); + }); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'DELETE FROM jstore WHERE k = ?', [key] ) + }) + return this._super(key); + } + }) + + $.jStore.Engines.html5 = jStoreHtml5; + + // Store the ordering preference + $.jStore.EngineOrder[ 0 ] = 'html5'; + +})(jQuery); +/*!* + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.ie = function(){ + return !!window.ActiveXObject; + } + + this.jStoreIE = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'IE'; + + // Allow Autoloading on fail + this.limit = 64 * 1024; + }, + connect: function(){ + // Create a hidden div to store attributes in + this.db = $('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-' + this.project + '"></div>') + .appendTo(document.body).get(0); + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + this.db.load(this.project); + return this.db.getAttribute(key); + }, + set: function(key, value){ + this.db.setAttribute(key, value); + this.db.save(this.project); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.removeAttribute(key); + this.db.save(this.project); + return beforeDelete; + } + }) + + $.jStore.Engines.ie = jStoreIE; + + // Store the ordering preference + $.jStore.EngineOrder[ 4 ] = 'ie'; + +})(jQuery); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json2.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,476 @@ +/* + http://www.JSON.org/json2.js + 2009-06-29 + + Public Domain. + + NO WARRANTY EXPRESSED OR IMPLIED. USE AT YOUR OWN RISK. + + See http://www.JSON.org/js.html + + This file creates a global JSON object containing two methods: stringify + and parse. + + JSON.stringify(value, replacer, space) + value any JavaScript value, usually an object or array. + + replacer an optional parameter that determines how object + values are stringified for objects. It can be a + function or an array of strings. + + space an optional parameter that specifies the indentation + of nested structures. If it is omitted, the text will + be packed without extra whitespace. If it is a number, + it will specify the number of spaces to indent at each + level. If it is a string (such as '\t' or ' '), + it contains the characters used to indent at each level. + + This method produces a JSON text from a JavaScript value. + + When an object value is found, if the object contains a toJSON + method, its toJSON method will be called and the result will be + stringified. A toJSON method does not serialize: it returns the + value represented by the name/value pair that should be serialized, + or undefined if nothing should be serialized. The toJSON method + will be passed the key associated with the value, and this will be + bound to the object holding the key. + + For example, this would serialize Dates as ISO strings. + + Date.prototype.toJSON = function (key) { + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + return this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z'; + }; + + You can provide an optional replacer method. It will be passed the + key and value of each member, with this bound to the containing + object. The value that is returned from your method will be + serialized. If your method returns undefined, then the member will + be excluded from the serialization. + + If the replacer parameter is an array of strings, then it will be + used to select the members to be serialized. It filters the results + such that only members with keys listed in the replacer array are + stringified. + + Values that do not have JSON representations, such as undefined or + functions, will not be serialized. Such values in objects will be + dropped; in arrays they will be replaced with null. You can use + a replacer function to replace those with JSON values. + JSON.stringify(undefined) returns undefined. + + The optional space parameter produces a stringification of the + value that is filled with line breaks and indentation to make it + easier to read. + + If the space parameter is a non-empty string, then that string will + be used for indentation. If the space parameter is a number, then + the indentation will be that many spaces. + + Example: + + text = JSON.stringify(['e', {pluribus: 'unum'}]); + // text is '["e",{"pluribus":"unum"}]' + + + text = JSON.stringify(['e', {pluribus: 'unum'}], null, '\t'); + // text is '[\n\t"e",\n\t{\n\t\t"pluribus": "unum"\n\t}\n]' + + text = JSON.stringify([new Date()], function (key, value) { + return this[key] instanceof Date ? + 'Date(' + this[key] + ')' : value; + }); + // text is '["Date(---current time---)"]' + + + JSON.parse(text, reviver) + This method parses a JSON text to produce an object or array. + It can throw a SyntaxError exception. + + The optional reviver parameter is a function that can filter and + transform the results. It receives each of the keys and values, + and its return value is used instead of the original value. + If it returns what it received, then the structure is not modified. + If it returns undefined then the member is deleted. + + Example: + + // Parse the text. Values that look like ISO date strings will + // be converted to Date objects. + + myData = JSON.parse(text, function (key, value) { + var a; + if (typeof value === 'string') { + a = +/^(\d{4})-(\d{2})-(\d{2})T(\d{2}):(\d{2}):(\d{2}(?:\.\d*)?)Z$/.exec(value); + if (a) { + return new Date(Date.UTC(+a[1], +a[2] - 1, +a[3], +a[4], + +a[5], +a[6])); + } + } + return value; + }); + + myData = JSON.parse('["Date(09/09/2001)"]', function (key, value) { + var d; + if (typeof value === 'string' && + value.slice(0, 5) === 'Date(' && + value.slice(-1) === ')') { + d = new Date(value.slice(5, -1)); + if (d) { + return d; + } + } + return value; + }); + + + This is a reference implementation. You are free to copy, modify, or + redistribute. + + This code should be minified before deployment. + See http://javascript.crockford.com/jsmin.html + + USE YOUR OWN COPY. IT IS EXTREMELY UNWISE TO LOAD CODE FROM SERVERS YOU DO + NOT CONTROL. +*/ + +/*jslint evil: true */ + +/*members "", "\b", "\t", "\n", "\f", "\r", "\"", JSON, "\\", apply, + call, charCodeAt, getUTCDate, getUTCFullYear, getUTCHours, + getUTCMinutes, getUTCMonth, getUTCSeconds, hasOwnProperty, join, + lastIndex, length, parse, prototype, push, replace, slice, stringify, + test, toJSON, toString, valueOf +*/ + +// Create a JSON object only if one does not already exist. We create the +// methods in a closure to avoid creating global variables. + +var JSON = JSON || {}; + +(function () { + + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + if (typeof Date.prototype.toJSON !== 'function') { + + Date.prototype.toJSON = function (key) { + + return isFinite(this.valueOf()) ? + this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z' : null; + }; + + String.prototype.toJSON = + Number.prototype.toJSON = + Boolean.prototype.toJSON = function (key) { + return this.valueOf(); + }; + } + + var cx = /[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + escapable = /[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + gap, + indent, + meta = { // table of character substitutions + '\b': '\\b', + '\t': '\\t', + '\n': '\\n', + '\f': '\\f', + '\r': '\\r', + '"' : '\\"', + '\\': '\\\\' + }, + rep; + + + function quote(string) { + +// If the string contains no control characters, no quote characters, and no +// backslash characters, then we can safely slap some quotes around it. +// Otherwise we must also replace the offending characters with safe escape +// sequences. + + escapable.lastIndex = 0; + return escapable.test(string) ? + '"' + string.replace(escapable, function (a) { + var c = meta[a]; + return typeof c === 'string' ? c : + '\\u' + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }) + '"' : + '"' + string + '"'; + } + + + function str(key, holder) { + +// Produce a string from holder[key]. + + var i, // The loop counter. + k, // The member key. + v, // The member value. + length, + mind = gap, + partial, + value = holder[key]; + +// If the value has a toJSON method, call it to obtain a replacement value. + + if (value && typeof value === 'object' && + typeof value.toJSON === 'function') { + value = value.toJSON(key); + } + +// If we were called with a replacer function, then call the replacer to +// obtain a replacement value. + + if (typeof rep === 'function') { + value = rep.call(holder, key, value); + } + +// What happens next depends on the value's type. + + switch (typeof value) { + case 'string': + return quote(value); + + case 'number': + +// JSON numbers must be finite. Encode non-finite numbers as null. + + return isFinite(value) ? String(value) : 'null'; + + case 'boolean': + case 'null': + +// If the value is a boolean or null, convert it to a string. Note: +// typeof null does not produce 'null'. The case is included here in +// the remote chance that this gets fixed someday. + + return String(value); + +// If the type is 'object', we might be dealing with an object or an array or +// null. + + case 'object': + +// Due to a specification blunder in ECMAScript, typeof null is 'object', +// so watch out for that case. + + if (!value) { + return 'null'; + } + +// Make an array to hold the partial results of stringifying this object value. + + gap += indent; + partial = []; + +// Is the value an array? + + if (Object.prototype.toString.apply(value) === '[object Array]') { + +// The value is an array. Stringify every element. Use null as a placeholder +// for non-JSON values. + + length = value.length; + for (i = 0; i < length; i += 1) { + partial[i] = str(i, value) || 'null'; + } + +// Join all of the elements together, separated with commas, and wrap them in +// brackets. + + v = partial.length === 0 ? '[]' : + gap ? '[\n' + gap + + partial.join(',\n' + gap) + '\n' + + mind + ']' : + '[' + partial.join(',') + ']'; + gap = mind; + return v; + } + +// If the replacer is an array, use it to select the members to be stringified. + + if (rep && typeof rep === 'object') { + length = rep.length; + for (i = 0; i < length; i += 1) { + k = rep[i]; + if (typeof k === 'string') { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } else { + +// Otherwise, iterate through all of the keys in the object. + + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } + +// Join all of the member texts together, separated with commas, +// and wrap them in braces. + + v = partial.length === 0 ? '{}' : + gap ? '{\n' + gap + partial.join(',\n' + gap) + '\n' + + mind + '}' : '{' + partial.join(',') + '}'; + gap = mind; + return v; + } + } + +// If the JSON object does not yet have a stringify method, give it one. + + if (typeof JSON.stringify !== 'function') { + JSON.stringify = function (value, replacer, space) { + +// The stringify method takes a value and an optional replacer, and an optional +// space parameter, and returns a JSON text. The replacer can be a function +// that can replace values, or an array of strings that will select the keys. +// A default replacer method can be provided. Use of the space parameter can +// produce text that is more easily readable. + + var i; + gap = ''; + indent = ''; + +// If the space parameter is a number, make an indent string containing that +// many spaces. + + if (typeof space === 'number') { + for (i = 0; i < space; i += 1) { + indent += ' '; + } + +// If the space parameter is a string, it will be used as the indent string. + + } else if (typeof space === 'string') { + indent = space; + } + +// If there is a replacer, it must be a function or an array. +// Otherwise, throw an error. + + rep = replacer; + if (replacer && typeof replacer !== 'function' && + (typeof replacer !== 'object' || + typeof replacer.length !== 'number')) { + throw new Error('JSON.stringify'); + } + +// Make a fake root object containing our value under the key of ''. +// Return the result of stringifying the value. + + return str('', {'': value}); + }; + } + + +// If the JSON object does not yet have a parse method, give it one. + + if (typeof JSON.parse !== 'function') { + JSON.parse = function (text, reviver) { + +// The parse method takes a text and an optional reviver function, and returns +// a JavaScript value if the text is a valid JSON text. + + var j; + + function walk(holder, key) { + +// The walk method is used to recursively walk the resulting structure so +// that modifications can be made. + + var k, v, value = holder[key]; + if (value && typeof value === 'object') { + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = walk(value, k); + if (v !== undefined) { + value[k] = v; + } else { + delete value[k]; + } + } + } + } + return reviver.call(holder, key, value); + } + + +// Parsing happens in four stages. In the first stage, we replace certain +// Unicode characters with escape sequences. JavaScript handles many characters +// incorrectly, either silently deleting them, or treating them as line endings. + + cx.lastIndex = 0; + if (cx.test(text)) { + text = text.replace(cx, function (a) { + return '\\u' + + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }); + } + +// In the second stage, we run the text against regular expressions that look +// for non-JSON patterns. We are especially concerned with '()' and 'new' +// because they can cause invocation, and '=' because it can cause mutation. +// But just to be safe, we want to reject all unexpected forms. + +// We split the second stage into 4 regexp operations in order to work around +// crippling inefficiencies in IE's and Safari's regexp engines. First we +// replace the JSON backslash pairs with '@' (a non-JSON character). Second, we +// replace all simple value tokens with ']' characters. Third, we delete all +// open brackets that follow a colon or comma or that begin the text. Finally, +// we look to see that the remaining characters are only whitespace or ']' or +// ',' or ':' or '{' or '}'. If that is so, then the text is safe for eval. + + if (/^[\],:{}\s]*$/. +test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g, '@'). +replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g, ']'). +replace(/(?:^|:|,)(?:\s*\[)+/g, ''))) { + +// In the third stage we use the eval function to compile the text into a +// JavaScript structure. The '{' operator is subject to a syntactic ambiguity +// in JavaScript: it can begin a block or an object literal. We wrap the text +// in parens to eliminate the ambiguity. + + j = eval('(' + text + ')'); + +// In the optional fourth stage, we recursively walk the new structure, passing +// each name/value pair to a reviver function for possible transformation. + + return typeof reviver === 'function' ? + walk({'': j}, '') : j; + } + +// If the text is not JSON parseable, then a SyntaxError is thrown. + + throw new SyntaxError('JSON.parse'); + }; + } +}()); diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/json_cookie.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json_cookie.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,61 @@ +/* + JSONCookie: Uses JSON to allow the settings of multiple preferences in one cookie. + Kanwei Li, 2009 + + cookie = new JSONCookie("cookie_name"); // Pass in the name of the cookie + + // Gets the value of a preference, returns optional second argument if pref not found + cookie.get("pref", "val_if_not_found"); + + cookie.set("pref", "val"); // Sets a value for the preference and saves cookie + cookie.unset("pref"); // Unsets the preference and saves cookie + cookie.clear() // Deletes the cookie + +*/ + +function JSONCookie(name) { + this.cookie_name = name; + +} + +JSONCookie.prototype = { + json_data : function() { + cookie = $.cookie(this.cookie_name); + return cookie ? JSON.parse(cookie) : null; + }, + + save : function(data) { + $.cookie(this.cookie_name, JSON.stringify(data)); + }, + + get : function(attr, else_val) { + data = this.json_data(); + if (data && data[attr]) { return data[attr]; + } else if (else_val) { return else_val; + } else { return null; + } + }, + + set : function(attr, val) { + data = this.json_data(); + if (data) { + data[attr] = val; + } else { + data = { attr : val } + } + this.save(data); + }, + + unset : function(attr) { + data = this.json_data(); + if (data) { + delete data[attr]; + } + this.save(data); + }, + + clear : function() { + this.save(null); + } + +}; \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/galaxy.workflow_editor.canvas.js --- a/static/scripts/packed/galaxy.workflow_editor.canvas.js Thu Aug 20 10:52:08 2009 -0400 +++ b/static/scripts/packed/galaxy.workflow_editor.canvas.js Thu Aug 20 11:39:32 2009 -0400 @@ -1,1 +1,1 @@ -function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connectors,function(j,k){f[h.name]={id:k.ha ndle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.clear_active_node();parent.show_ form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){level_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[sucessors[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this.canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$( this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></div>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this).offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prot otype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.css("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this; var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({wi dth:f,height:f});b.draw_overview()})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewp ort_overlay()}}); \ No newline at end of file +function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false;this.active_form_has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connecto rs,function(j,k){f[h.name]={id:k.handle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},enable_auto_save:function(){outer_this=this;$(".toolFormBody").find("input,textarea,select").each(function(){$(this).focus(function(){outer_this.active_form_has_changes=true})})},check_changes_in_active_form:functio n(){if(this.active_form_has_changes){this.has_changes=true;$(".toolFormBody").find("form").each(function(){$(this).submit()});this.active_form_has_changes=false}},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.check_changes_in_active_form();this.clear_active_node();parent.show_form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){this.check_changes_in_active_form();var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){l evel_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[b[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this .canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$(this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></d iv>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this). offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prototype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.c ss("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this;var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_n odes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({width:f,height:f});b.draw_overview()});$("#overview-border div").bind("drag",function(f){})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewport_overlay()}}); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/jquery.jstore-all.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,41 @@ +/* + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + */ +(function(){var a=false,b=/xyz/.test(function(){xyz})?/\b_super\b/:/.*/;this.Class=function(){};Class.extend=function(g){var f=this.prototype;a=true;var e=new this();a=false;for(var d in g){e[d]=typeof g[d]=="function"&&typeof f[d]=="function"&&b.test(g[d])?(function(h,i){return function(){var k=this._super;this._super=f[h];var j=i.apply(this,arguments);this._super=k;return j}})(d,g[d]):g[d]}function c(){if(!a&&this.init){this.init.apply(this,arguments)}}c.prototype=e;c.constructor=c;c.extend=arguments.callee;return c}})(); +/* + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(a){this.jStoreDelegate=Class.extend({init:function(b){this.parent=b;this.callbacks={}},bind:function(b,c){if(!a.isFunction(c)){return this}if(!this.callbacks[b]){this.callbacks[b]=[]}this.callbacks[b].push(c);return this},trigger:function(){var d=this.parent,c=[].slice.call(arguments),e=c.shift(),b=this.callbacks[e];if(!b){return false}a.each(b,function(){this.apply(d,c)});return this}})})(jQuery);(function(a){a.jStore={};a.extend(a.jStore,{EngineOrder:[],Availability:{},Engines:{},Instances:{},CurrentEngine:null,defaults:{project:null,engine:null,autoload:true,flash:"jStore.Flash.html"},isReady:false,isFlashReady:false,delegate:new jStoreDelegate(a.jStore).bind("jStore-ready",function(b){a.jStore.isReady=true;if(a.jStore.defaults.autoload){b.connect()}}).bind("flash-ready",function(){a.jStore.isFlashReady=true})});a.jStore.ready=function(b){if(a.jStore.isReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("jStore-ready",b)}};a.jStore.fail =function(b){a.jStore.delegate.bind("jStore-failure",b)};a.jStore.flashReady=function(b){if(a.jStore.isFlashReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("flash-ready",b)}};a.jStore.use=function(d,g,c){g=g||a.jStore.defaults.project||location.hostname.replace(/\./g,"-")||"unknown";var f=a.jStore.Engines[d.toLowerCase()]||null,b=(c?c+".":"")+g+"."+d;if(!f){throw"JSTORE_ENGINE_UNDEFINED"}f=new f(g,b);if(a.jStore.Instances[b]){throw"JSTORE_JRI_CONFLICT"}if(f.isAvailable()){a.jStore.Instances[b]=f;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=f}a.jStore.delegate.trigger("jStore-ready",f)}else{if(!f.autoload){throw"JSTORE_ENGINE_UNAVILABLE"}else{f.included(function(){if(this.isAvailable()){a.jStore.Instances[b]=this;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=this}a.jStore.delegate.trigger("jStore-ready",this)}else{a.jStore.delegate.trigger("jStore-failure",this)}}).include()}}};a.jStore.setCurrentEngine=function(b){if(!a.jStore.Instanc es.length){return a.jStore.FindEngine()}if(!b&&a.jStore.Instances.length>=1){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[0]);return a.jStore.CurrentEngine=a.jStore.Instances[0]}if(b&&a.jStore.Instances[b]){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[b]);return a.jStore.CurrentEngine=a.jStore.Instances[b]}throw"JSTORE_JRI_NO_MATCH"};a.jStore.FindEngine=function(){a.each(a.jStore.EngineOrder,function(b){if(a.jStore.Availability[this]()){a.jStore.use(this,a.jStore.defaults.project,"default");return false}})};a.jStore.store=function(b,c){if(!a.jStore.CurrentEngine){return false}if(!c){return a.jStore.CurrentEngine.get(b)}return a.jStore.CurrentEngine.set(b,c)};a.jStore.remove=function(b){if(!a.jStore.CurrentEngine){return false}return a.jStore.CurrentEngine.rem(b)};a.fn.store=function(c,d){if(!a.jStore.CurrentEngine){return this}var b=a.jStore.store(c,d);return !d?b:this};a.fn.removeStore=function(b){a.jStore.remove(b);return this};a.jStore.load=f unction(){if(a.jStore.defaults.engine){return a.jStore.use(a.jStore.defaults.engine,a.jStore.defaults.project,"default")}try{a.jStore.FindEngine()}catch(b){}}})(jQuery);(function(a){this.StorageEngine=Class.extend({init:function(c,b){this.project=c;this.jri=b;this.data={};this.limit=-1;this.includes=[];this.delegate=new jStoreDelegate(this).bind("engine-ready",function(){this.isReady=true}).bind("engine-included",function(){this.hasIncluded=true});this.autoload=false;this.isReady=false;this.hasIncluded=false},include:function(){var b=this,d=this.includes.length,c=0;a.each(this.includes,function(){a.ajax({type:"get",url:this,dataType:"script",cache:true,success:function(){c++;if(c==d){b.delegate.trigger("engine-included")}}})})},isAvailable:function(){return false},ready:function(b){if(this.isReady){b.apply(this)}else{this.delegate.bind("engine-ready",b)}return this},included:function(b){if(this.hasIncluded){b.apply(this)}else{this.delegate.bind("engine-included",b)}return th is},get:function(b){return this.data[b]||null},set:function(b,c){this.data[b]=c;return c},rem:function(b){var c=this.data[b];this.data[b]=null;return c}})})(jQuery); +/* + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(c){var b=c.jStore.Availability.session=function(){return !!window.sessionStorage},a=c.jStore.Availability.local=function(){return !!(window.localStorage||window.globalStorage)};this.jStoreDom=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="DOM";this.limit=5*1024*1024},connect:function(){this.delegate.trigger("engine-ready")},get:function(e){var d=this.db.getItem(e);return d&&d.value?d.value:d},set:function(d,e){this.db.setItem(d,e);return e},rem:function(e){var d=this.get(e);this.db.removeItem(e);return d}});this.jStoreLocal=jStoreDom.extend({connect:function(){this.db=!window.globalStorage?window.localStorage:window.globalStorage[location.hostname];this._super()},isAvailable:a});this.jStoreSession=jStoreDom.extend({connect:function(){this.db=sessionStorage;this._super()},isAvailable:b});c.jStore.Engines.local=jStoreLocal;c.jStore.Engines.session=jStoreSession;c.jStore.EngineOrder[1]="local"})(jQuery); +/* + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function(b){var a=b.jStore.Availability.flash=function(){return !!(b.jStore.hasFlash("8.0.0"))};this.jStoreFlash=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="Flash";var c=this;b.jStore.flashReady(function(){c.flashReady()})},connect:function(){var c="jstore-flash-embed-"+this.project;b(document.body).append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" id="jStoreFlashFrame" src="'+b.jStore.defaults.flash+'"></iframe>')},flashReady:function(f){var c=b("#jStoreFlashFrame")[0];if(c.Document&&b.isFunction(c.Document.jStoreFlash.f_get_cookie)){this.db=c.Document.jStoreFlash}else{if(c.contentWindow&&c.contentWindow.document){var d=c.contentWindow.document;if(b.isFunction(b("object",b(d))[0].f_get_cookie)){this.db=b("object",b(d))[0]}else{if(b.isFunction(b("embed",b(d))[0].f_get_cookie)){this.db=b("embed",b(d))[0]}}}}if(this.db){this.delegate.trigger("engine-ready")}},isAvailable:a,get:function(d){var c=this.db.f_g et_cookie(d);return c=="null"?null:c},set:function(c,d){this.db.f_set_cookie(c,d);return d},rem:function(c){var d=this.get(c);this.db.f_delete_cookie(c);return d}});b.jStore.Engines.flash=jStoreFlash;b.jStore.EngineOrder[2]="flash";b.jStore.hasFlash=function(c){var e=b.jStore.flashVersion().match(/\d+/g),f=c.match(/\d+/g);for(var d=0;d<3;d++){e[d]=parseInt(e[d]||0);f[d]=parseInt(f[d]||0);if(e[d]<f[d]){return false}if(e[d]>f[d]){return true}}return true};b.jStore.flashVersion=function(){try{try{var c=new ActiveXObject("ShockwaveFlash.ShockwaveFlash.6");try{c.AllowScriptAccess="always"}catch(d){return"6,0,0"}}catch(d){}return new ActiveXObject("ShockwaveFlash.ShockwaveFlash").GetVariable("$version").replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}catch(d){try{if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){return(navigator.plugins["Shockwave Flash 2.0"]||navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}}catch(d){}}r eturn"0,0,0"}})(jQuery);function flash_ready(){$.jStore.delegate.trigger("flash-ready")} +/* + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.gears=function(){return !!(window.google&&window.google.gears)};this.jStoreGears=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="Google Gears";this.includes.push("http://code.google.com/apis/gears/gears_init.js");this.autoload=true},connect:function(){var c=this.db=google.gears.factory.create("beta.database");c.open("jstore-"+this.project);c.execute("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)");this.updateCache()},updateCache:function(){var c=this.db.execute("SELECT k,v FROM jstore");while(c.isValidRow()){this.data[c.field(0)]=c.field(1);c.next()}c.close();this.delegate.trigger("engine-ready")},isAvailable:a,set:function(d,e){var c=this.db;c.execute("BEGIN");c.execute("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[d,e]);c.execute("COMMIT");return this._super(d,e)},rem:function(d){var c=this.db;c.execute("BEGIN");c.execute("DELETE FROM jstore WHERE k = ?",[d]);c.ex ecute("COMMIT");return this._super(d)}});b.jStore.Engines.gears=jStoreGears;b.jStore.EngineOrder[3]="gears"})(jQuery); +/* + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.html5=function(){return !!window.openDatabase};this.jStoreHtml5=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="HTML5";this.limit=1024*200},connect:function(){var c=this.db=openDatabase("jstore-"+this.project,"1.0",this.project,this.limit);if(!c){throw"JSTORE_ENGINE_HTML5_NODB"}c.transaction(function(d){d.executeSql("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)")});this.updateCache()},updateCache:function(){var c=this;this.db.transaction(function(d){d.executeSql("SELECT k,v FROM jstore",[],function(f,e){var h=e.rows,g=0,j;for(;g<h.length;++g){j=h.item(g);c.data[j.k]=j.v}c.delegate.trigger("engine-ready")})})},isAvailable:a,set:function(c,d){this.db.transaction(function(e){e.executeSql("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[c,d])});return this._super(c,d)},rem:function(c){this.db.transaction(function(d){d.executeSql("DELETE FROM jstore WHERE k = ?",[c])});ret urn this._super(c)}});b.jStore.Engines.html5=jStoreHtml5;b.jStore.EngineOrder[0]="html5"})(jQuery); +/** + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.ie=function(){return !!window.ActiveXObject};this.jStoreIE=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="IE";this.limit=64*1024},connect:function(){this.db=b('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-'+this.project+'"></div>').appendTo(document.body).get(0);this.delegate.trigger("engine-ready")},isAvailable:a,get:function(c){this.db.load(this.project);return this.db.getAttribute(c)},set:function(c,d){this.db.setAttribute(c,d);this.db.save(this.project);return d},rem:function(c){var d=this.get(c);this.db.removeAttribute(c);this.db.save(this.project);return d}});b.jStore.Engines.ie=jStoreIE;b.jStore.EngineOrder[4]="ie"})(jQuery); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 static/scripts/packed/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/json2.js Thu Aug 20 11:39:32 2009 -0400 @@ -0,0 +1,1 @@ +var JSON=JSON||{};(function(){function f(n){return n<10?"0"+n:n}if(typeof Date.prototype.toJSON!=="function"){Date.prototype.toJSON=function(key){return isFinite(this.valueOf())?this.getUTCFullYear()+"-"+f(this.getUTCMonth()+1)+"-"+f(this.getUTCDate())+"T"+f(this.getUTCHours())+":"+f(this.getUTCMinutes())+":"+f(this.getUTCSeconds())+"Z":null};String.prototype.toJSON=Number.prototype.toJSON=Boolean.prototype.toJSON=function(key){return this.valueOf()}}var cx=/[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,escapable=/[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,gap,indent,meta={"\b":"\\b","\t":"\\t","\n":"\\n","\f":"\\f","\r":"\\r",'"':'\\"',"\\":"\\\\"},rep;function quote(string){escapable.lastIndex=0;return escapable.test(string)?'"'+string.replace(escapable,function(a){var c=meta[a];return typeof c==="string"?c:"\\u"+("0000"+a.charCodeAt(0) .toString(16)).slice(-4)})+'"':'"'+string+'"'}function str(key,holder){var i,k,v,length,mind=gap,partial,value=holder[key];if(value&&typeof value==="object"&&typeof value.toJSON==="function"){value=value.toJSON(key)}if(typeof rep==="function"){value=rep.call(holder,key,value)}switch(typeof value){case"string":return quote(value);case"number":return isFinite(value)?String(value):"null";case"boolean":case"null":return String(value);case"object":if(!value){return"null"}gap+=indent;partial=[];if(Object.prototype.toString.apply(value)==="[object Array]"){length=value.length;for(i=0;i<length;i+=1){partial[i]=str(i,value)||"null"}v=partial.length===0?"[]":gap?"[\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"]":"["+partial.join(",")+"]";gap=mind;return v}if(rep&&typeof rep==="object"){length=rep.length;for(i=0;i<length;i+=1){k=rep[i];if(typeof k==="string"){v=str(k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}else{for(k in value){if(Object.hasOwnProperty.call(value,k)){v=str( k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}v=partial.length===0?"{}":gap?"{\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"}":"{"+partial.join(",")+"}";gap=mind;return v}}if(typeof JSON.stringify!=="function"){JSON.stringify=function(value,replacer,space){var i;gap="";indent="";if(typeof space==="number"){for(i=0;i<space;i+=1){indent+=" "}}else{if(typeof space==="string"){indent=space}}rep=replacer;if(replacer&&typeof replacer!=="function"&&(typeof replacer!=="object"||typeof replacer.length!=="number")){throw new Error("JSON.stringify")}return str("",{"":value})}}if(typeof JSON.parse!=="function"){JSON.parse=function(text,reviver){var j;function walk(holder,key){var k,v,value=holder[key];if(value&&typeof value==="object"){for(k in value){if(Object.hasOwnProperty.call(value,k)){v=walk(value,k);if(v!==undefined){value[k]=v}else{delete value[k]}}}}return reviver.call(holder,key,value)}cx.lastIndex=0;if(cx.test(text)){text=text.replace(cx,function(a){return"\\u"+("000 0"+a.charCodeAt(0).toString(16)).slice(-4)})}if(/^[\],:{}\s]*$/.test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g,"@").replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g,"]").replace(/(?:^|:|,)(?:\s*\[)+/g,""))){j=eval("("+text+")");return typeof reviver==="function"?walk({"":j},""):j}throw new SyntaxError("JSON.parse")}}}()); \ No newline at end of file diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/center.mako --- a/templates/admin/center.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/center.mako Thu Aug 20 11:39:32 2009 -0400 @@ -17,7 +17,7 @@ <li> <strong>Manage groups</strong> - provides a view of all groups along with the members of the group and the roles associated with each group (both private and non-private roles). Non-private roles include a link to a page that allows you to manage the users - and groups that are associated with the role. The page also includes a view of the library datasets that are associated with the + and groups that are associated with the role. The page also includes a view of the data library datasets that are associated with the role and the permissions applied to each dataset. </li> <p/> @@ -32,9 +32,9 @@ <p/> <ul> <li> - <strong>Manage libraries</strong> - Dataset libraries enable a Galaxy administrator to upload datasets into a library. Currently, - only administrators can create dataset libraries, but permission to perform the following functions on the library can be granted to - users (a library item is one of: a library, a library folder, a library dataset). + <strong>Manage data libraries</strong> - Data libraries enable a Galaxy administrator to upload datasets into a data library. Currently, + only administrators can create data libraries, but permission to perform the following functions on the data library can be granted to + users (a library item is one of: a data library, a library folder, a library dataset). <p/> <ul> <li><strong>add library item</strong> - Role members can add library items to this library or folder</li> @@ -42,12 +42,12 @@ <li><strong>manage library permissions</strong> - Role members can manage permissions applied to this library item</li> </ul> <p/> - The default behavior is for no permissions to be applied to a library item, but applied permissions are inherited downward, so it is - important to set desired permissions on a new library when it is created. When this is done, new folders and datasets added to the - library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be + The default behavior is for no permissions to be applied to a data library item, but applied permissions are inherited downward, so it is + important to set desired permissions on a new data library when it is created. When this is done, new folders and datasets added to the + data library will automatically inherit those permissions. In the same way, permissions can be applied to a folder, which will be automatically inherited by all contained datasets and sub-folders. <p/> - The "Libraries" menu item allows users to access the datasets in a library as long as they are not restricted from accessing them. + The "Data Libraries" menu item allows users to access the datasets in a data library as long as they are not restricted from accessing them. Importing a library dataset into a history will not make a copy of the dataset, but will be a "pointer" to the dataset on disk. This approach allows for multiple users to use a single (possibly very large) dataset file. </li> @@ -72,7 +72,7 @@ </ul> </li> </ul> -<p><strong>Data Security and Dataset Libraries</strong></p> +<p><strong>Data Security and Data Libraries</strong></p> <p/> <strong>Security</strong> - Data security in Galaxy is a new feature, so familiarize yourself with the details which can be found here or in our <a href="http://g2.trac.bx.psu.edu/wiki/SecurityFeatures" target="_blank">data security page</a>. The data security @@ -121,8 +121,8 @@ <strong>access</strong> - users associated with the role can import this dataset into their history for analysis. <p> If no roles with the "access" permission are associated with a dataset, the dataset is "public" and may be accessed by - anyone. Public library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) - from the list of libraries displayed when the "Libraries" menu item is selected. + anyone. Public data library datasets will be accessible to all users (as well as anyone not logged in during a Galaxy session) + from the list of data libraries displayed when the "Data Libraries" menu item is selected. </p> <p> Associating a dataset with a role that includes the "access" permission restricts the set of users that can access it. diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/dataset_security/role.mako --- a/templates/admin/dataset_security/role.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/dataset_security/role.mako Thu Aug 20 11:39:32 2009 -0400 @@ -84,7 +84,7 @@ <br clear="left"/> <br/> %if len( library_dataset_actions ) > 0: - <h3>Library datasets associated with role '${role.name}'</h3> + <h3>Data library datasets associated with role '${role.name}'</h3> <table class="manage-table colored" border="0" cellspacing="0" cellpadding="0" width="100%"> <tr> <td> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/index.mako --- a/templates/admin/index.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/index.mako Thu Aug 20 11:39:32 2009 -0400 @@ -89,7 +89,7 @@ </div> <div class="toolSectionBody"> <div class="toolSectionBg"> - <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage libraries</a></div> + <div class="toolTitle"><a href="${h.url_for( controller='admin', action='browse_libraries' )}" target="galaxy_main">Manage data libraries</a></div> </div> </div> <div class="toolSectionPad"></div> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/library/browse_libraries.mako --- a/templates/admin/library/browse_libraries.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/library/browse_libraries.mako Thu Aug 20 11:39:32 2009 -0400 @@ -1,19 +1,19 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<%def name="title()">Browse Libraries</%def> +<%def name="title()">Browse Data Libraries</%def> <h2> %if deleted: Deleted %endif - Libraries + Data Libraries </h2> <ul class="manage-table-actions"> %if not deleted: <li> - <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new library</span></a> + <a class="action-button" href="${h.url_for( controller='admin', action='library', new=True )}"><span>Create a new data library</span></a> </li> <li> <a class="action-button" href="${h.url_for( controller='admin', action='deleted_libraries' )}"><span>Manage deleted libraries</span></a> diff -r 881dd4c2de9f -r 070cf5f6f928 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Thu Aug 20 10:52:08 2009 -0400 +++ b/templates/admin/library/browse_library.mako Thu Aug 20 11:39:32 2009 -0400 @@ -162,16 +162,16 @@ %if deleted: Deleted %endif - Library '${library.name}' + Data Library “${library.name}” </h2> <ul class="manage-table-actions"> %if not deleted: <li>

1 0

[hg] galaxy 2587: Fixed indentation
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/881dd4c2de9f changeset: 2587:881dd4c2de9f user: rc date: Thu Aug 20 10:52:08 2009 -0400 description: Fixed indentation 1 file(s) affected in this change: test/functional/test_security_and_libraries.py diffs (21 lines): diff -r 98fa3b9cd980 -r 881dd4c2de9f test/functional/test_security_and_libraries.py --- a/test/functional/test_security_and_libraries.py Thu Aug 20 10:46:52 2009 -0400 +++ b/test/functional/test_security_and_libraries.py Thu Aug 20 10:52:08 2009 -0400 @@ -196,7 +196,7 @@ dhps.sort() # Compare DefaultHistoryPermissions and actions_in - should be the same if dhps != actions_in: - raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \ + raise AssertionError( 'DefaultHistoryPermissions "%s" for history id %d differ from actions "%s" passed for changing' \ % ( str( dhps ), latest_history.id, str( actions_in ) ) ) # Make sure DatasetPermissionss are correct if len( latest_dataset.actions ) != len( latest_history.default_permissions ): @@ -209,7 +209,7 @@ dps.sort() # Compare DatasetPermissionss and DefaultHistoryPermissions - should be the same if dps != dhps: - raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \ + raise AssertionError( 'DatasetPermissionss "%s" for dataset id %d differ from DefaultHistoryPermissions "%s"' \ % ( str( dps ), latest_dataset.id, str( dhps ) ) ) self.logout() def test_020_create_new_user_account_as_admin( self ):

1 0

[hg] galaxy 2585: First pass of the functional tests for forms &...
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e66e1e99183c changeset: 2585:e66e1e99183c user: rc date: Fri Aug 14 15:47:13 2009 -0400 description: First pass of the functional tests for forms & requests 14 file(s) affected in this change: lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/forms.py lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py lib/galaxy/web/controllers/user.py lib/galaxy/web/framework/__init__.py templates/admin/forms/edit_form.mako templates/admin/requests/add_states.mako templates/admin/requests/grid.mako templates/admin/samples/bar_codes.mako templates/admin/samples/events.mako templates/base_panels.mako templates/requests/grid.mako test/base/twilltestcase.py diffs (493 lines): diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Fri Aug 14 15:47:13 2009 -0400 @@ -2011,7 +2011,7 @@ num_states = int( util.restore_text( params.get( 'num_states', 0 ) )) proceed = True for i in range( num_states ): - if not util.restore_text( params.get( 'new_element_name_%i' % i, None ) ): + if not util.restore_text( params.get( 'state_name_%i' % i, None ) ): proceed = False break if not proceed: @@ -2029,8 +2029,8 @@ ss.delete() ss.flush() for i in range( num_states ): - name = util.restore_text( params.get( 'new_element_name_%i' % i, None )) - desc = util.restore_text( params.get( 'new_element_description_%i' % i, None )) + name = util.restore_text( params.get( 'state_name_%i' % i, None )) + desc = util.restore_text( params.get( 'state_desc_%i' % i, None )) ss = trans.app.model.SampleState(name, desc, rt) ss.flush() msg = "The new request type named '%s' with %s state(s) has been created" % (rt.name, num_states) diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/controllers/forms.py --- a/lib/galaxy/web/controllers/forms.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/controllers/forms.py Fri Aug 14 15:47:13 2009 -0400 @@ -175,7 +175,7 @@ 'visible': True, 'required': False, 'type': BaseField.form_field_types()[0], - 'selectlist': '' } + 'selectlist': [] } self.current_form['fields'].append(empty_field) def __get_field(self, index, **kwd): params = util.Params( kwd ) @@ -183,10 +183,10 @@ # To reproduce, create a new form, click the "add field" button, click the # browser back arrow, then click the "add field" button again. # You should never attempt to "restore_text()" on a None object... - name = util.restore_text( params.get( 'field_name_%i' % index, None ) ) - helptext = util.restore_text( params.get( 'field_helptext_%i' % index, None ) ) + name = util.restore_text( params.get( 'field_name_%i' % index, '' ) ) + helptext = util.restore_text( params.get( 'field_helptext_%i' % index, '' ) ) required = params.get( 'field_required_%i' % index, False ) - field_type = util.restore_text( params.get( 'field_type_%i' % index, None ) ) + field_type = util.restore_text( params.get( 'field_type_%i' % index, '' ) ) if field_type == 'SelectField': selectlist = self.__get_selectbox_options(index, **kwd) return {'label': name, @@ -434,7 +434,10 @@ if field_name in kwd: # the user had already filled out this field and the same form is re-rendered # due to some reason like required fields have been left out. - value = util.restore_text( params.get( field_name, '' ) ) + if field[ 'type' ] == 'CheckboxField': + value = CheckboxField.is_checked( util.restore_text( params.get( field_name, False ) ) ) + else: + value = util.restore_text( params.get( field_name, '' ) ) elif contents: # this field has a saved value value = str(contents[ index ]) diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Fri Aug 14 15:47:13 2009 -0400 @@ -63,6 +63,7 @@ request_grid = RequestsListGrid() @web.expose + @web.require_login( "create/submit sequencing requests" ) def index( self, trans ): return trans.fill_template( "requests/index.mako" ) @@ -75,6 +76,7 @@ authorized_libraries.append(library) return authorized_libraries @web.expose + @web.require_login( "create/submit sequencing requests" ) def list( self, trans, **kwargs ): ''' List all request made by the current user @@ -206,6 +208,7 @@ copy_list.add_option(s[0], i) return copy_list @web.expose + @web.require_login( "create/submit sequencing requests" ) def show_request(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -331,6 +334,7 @@ @web.expose + @web.require_login( "create/submit sequencing requests" ) def delete_sample(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -353,6 +357,7 @@ edit_mode=self.edit_mode) @web.expose + @web.require_login( "create/submit sequencing requests" ) def toggle_request_details(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -389,6 +394,7 @@ select_reqtype.add_option(rt.name, rt.id) return select_reqtype @web.expose + @web.require_login( "create/submit sequencing requests" ) def new(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -581,6 +587,7 @@ request.flush() return request @web.expose + @web.require_login( "create/submit sequencing requests" ) def edit(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -742,10 +749,14 @@ request.flush() kwd = {} kwd['id'] = trans.security.encode_id(request.id) + kwd['status'] = 'done' + kwd['message'] = 'The request <b>%s</b> has been submitted.' % request.name return trans.response.send_redirect( web.url_for( controller='requests', action='list', + show_filter=trans.app.model.Request.states.SUBMITTED, **kwd) ) @web.expose + @web.require_login( "create/submit sequencing requests" ) def submit_request(self, trans, **kwd): params = util.Params( kwd ) try: @@ -775,13 +786,16 @@ # change request's submitted field request.state = request.states.SUBMITTED request.flush() - ## TODO kwd['id'] = trans.security.encode_id(request.id) + kwd['status'] = 'done' + kwd['message'] = 'The request <b>%s</b> has been submitted.' % request.name return trans.response.send_redirect( web.url_for( controller='requests', action='list', + show_filter=trans.app.model.Request.states.SUBMITTED, **kwd) ) @web.expose + @web.require_login( "create/submit sequencing requests" ) def show_events(self, trans, **kwd): params = util.Params( kwd ) try: diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Fri Aug 14 15:47:13 2009 -0400 @@ -172,6 +172,8 @@ @web.require_admin def bar_codes(self, trans, **kwd): params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) request_id = params.get( 'request_id', None ) if request_id: request = trans.app.model.Request.get( int( request_id )) @@ -192,7 +194,9 @@ bc)) return trans.fill_template( '/admin/samples/bar_codes.mako', samples_list=[s for s in request.samples], - user=request.user, request=request, widgets=widgets) + user=request.user, request=request, widgets=widgets, + messagetype=messagetype, + msg=msg) @web.expose @web.require_admin def save_bar_codes(self, trans, **kwd): @@ -256,9 +260,10 @@ sample.bar_code = bar_code sample.flush() return trans.response.send_redirect( web.url_for( controller='requests_admin', - action='list', - operation='show_request', - id=trans.security.encode_id(request.id)) ) + action='bar_codes', + request_id=request.id, + msg='Bar codes has been saved for this request', + messagetype='done')) def __set_request_state(self, request): # check if all the samples of the current request are in the final state complete = True diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/controllers/user.py --- a/lib/galaxy/web/controllers/user.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/controllers/user.py Fri Aug 14 15:47:13 2009 -0400 @@ -229,6 +229,8 @@ def manage_addresses(self, trans, **kwd): if trans.user: params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) show_filter = util.restore_text( params.get( 'show_filter', 'Active' ) ) if show_filter == 'All': addresses = [address for address in trans.user.addresses] @@ -238,7 +240,9 @@ addresses = [address for address in trans.user.addresses if not address.deleted] return trans.fill_template( 'user/address.mako', addresses=addresses, - show_filter=show_filter) + show_filter=show_filter, + msg=msg, + messagetype=messagetype) else: # User not logged in, history group must be only public return trans.show_error_message( "You must be logged in to change your default permitted actions." ) diff -r f3d25adcace6 -r e66e1e99183c lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Wed Aug 12 10:31:33 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Fri Aug 14 15:47:13 2009 -0400 @@ -641,6 +641,7 @@ self.name = name self.action = action self.submit_text = submit_text + #self.submit_name = submit_text+"_button" self.inputs = [] def add_input( self, type, name, label, value=None, error=None, help=None, use_label=True ): self.inputs.append( FormInput( type, label, name, value, error, help, use_label ) ) diff -r f3d25adcace6 -r e66e1e99183c templates/admin/forms/edit_form.mako --- a/templates/admin/forms/edit_form.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/admin/forms/edit_form.mako Fri Aug 14 15:47:13 2009 -0400 @@ -70,7 +70,7 @@ </%def> <div class="toolForm"> - <div class="toolFormTitle">Edit form definition '${form.name}'</div> + <div class="toolFormTitle">Edit form definition "${form.name}"</div> <form id="edit_form" name="edit_form" action="${h.url_for( controller='forms', action='edit', form_id=form.id, num_fields=len(form.fields) )}" method="post" > %for label, input in form_details: <div class="form-row"> diff -r f3d25adcace6 -r e66e1e99183c templates/admin/requests/add_states.mako --- a/templates/admin/requests/add_states.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/admin/requests/add_states.mako Fri Aug 14 15:47:13 2009 -0400 @@ -12,9 +12,9 @@ %for element_count in range( num_states ): <div class="form-row"> <label>${1+element_count}) State name:</label> - <input type="text" name="new_element_name_${element_count}" value="" size="40"/> + <input type="text" name="state_name_${element_count}" value="" size="40"/> <label>State help text (optional):</label> - <input type="text" name="new_element_description_${element_count}" value="" size="40"/> + <input type="text" name="state_desc_${element_count}" value="" size="40"/> </div> <div style="clear: both"></div> %endfor diff -r f3d25adcace6 -r e66e1e99183c templates/admin/requests/grid.mako --- a/templates/admin/requests/grid.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/admin/requests/grid.mako Fri Aug 14 15:47:13 2009 -0400 @@ -76,7 +76,7 @@ <div class="grid-header"> <h2>${grid.title}</h2> - ##%if len(query.all()): + %if len(trans.user.requests): ##<span class="title">Filter:</span> %for i, filter in enumerate( grid.standard_filters ): %if i > 0: @@ -96,7 +96,7 @@ %endif %endif %endfor - ##%endif + %endif </div> diff -r f3d25adcace6 -r e66e1e99183c templates/admin/samples/bar_codes.mako --- a/templates/admin/samples/bar_codes.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/admin/samples/bar_codes.mako Fri Aug 14 15:47:13 2009 -0400 @@ -40,7 +40,7 @@ </tbody> </table> <div class="form-row"> - <input type="submit" name="save_new_sample_type" value="Save"/> + <input type="submit" name="save_bar_codes" value="Save"/> </div> </form> </div> \ No newline at end of file diff -r f3d25adcace6 -r e66e1e99183c templates/admin/samples/events.mako --- a/templates/admin/samples/events.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/admin/samples/events.mako Fri Aug 14 15:47:13 2009 -0400 @@ -56,7 +56,7 @@ </div> %endfor <div class="form-row"> - <input type="submit" name="add_event" value="Save"/> + <input type="submit" name="add_event_button" value="Save"/> </div> </form> </div> diff -r f3d25adcace6 -r e66e1e99183c templates/base_panels.mako --- a/templates/base_panels.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/base_panels.mako Fri Aug 14 15:47:13 2009 -0400 @@ -150,12 +150,12 @@ ${tab( "libraries", "Libraries", h.url_for( controller='library', action='index' ))} - %if trans.request_types(): + %if trans.user and trans.request_types(): <td class="tab"> <a>Lab</a> <div class="submenu"> <ul> - <li><a target="requests" href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li> + <li><a href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li> </ul> </div> </td> diff -r f3d25adcace6 -r e66e1e99183c templates/requests/grid.mako --- a/templates/requests/grid.mako Wed Aug 12 10:31:33 2009 -0400 +++ b/templates/requests/grid.mako Fri Aug 14 15:47:13 2009 -0400 @@ -76,7 +76,7 @@ <div class="grid-header"> <h2>${grid.title}</h2> - ##%if len(query.all()): + %if len(trans.user.requests): ##<span class="title">Filter:</span> %for i, filter in enumerate( grid.standard_filters ): %if i > 0: @@ -88,7 +88,7 @@ <span class="filter"><a href="${h.url_for( controller='requests', action='list', show_filter=filter.label )}">${filter.label}</a></span> %endif %endfor - ##%endif + %endif </div> <ul class="manage-table-actions"> @@ -98,7 +98,6 @@ <span>New request</span></a> </li> </ul> - %if not len(query.all()): There are no request(s). @@ -215,4 +214,4 @@ </tfoot> </table> </form> -%endif \ No newline at end of file +%endif diff -r f3d25adcace6 -r e66e1e99183c test/base/twilltestcase.py --- a/test/base/twilltestcase.py Wed Aug 12 10:31:33 2009 -0400 +++ b/test/base/twilltestcase.py Fri Aug 14 15:47:13 2009 -0400 @@ -968,7 +968,7 @@ self.home() # Form stuff - def create_form( self, name='Form One', description='This is Form One', num_fields=1 ): + def create_form( self, name='Form One', desc='This is Form One', num_fields=1 ): """ Create a new form definition. Testing framework is still limited to only testing one instance for each repeat. This has to do with the 'flat' nature of defining @@ -984,7 +984,7 @@ self.visit_url( "%s/forms/new" % self.url ) self.check_page_for_string( 'Create a new form definition' ) tc.fv( "1", "name", name ) # form field 1 is the field named name... - tc.fv( "1", "description", description ) # form field 1 is the field named name... + tc.fv( "1", "description", desc ) # form field 1 is the field named name... tc.submit( "create_form_button" ) for index in range( num_fields ): field_name = 'field_name_%i' % index @@ -997,7 +997,119 @@ check_str = "The form '%s' has been updated with the changes." % name self.check_page_for_string( check_str ) self.home() - + def edit_form( self, form_id, form_name, new_form_name="Form One's Name (Renamed)", new_form_desc="This is Form One's description (Re-described)"): + """ + Edit form details; name & description + """ + self.home() + self.visit_url( "%s/forms/edit?form_id=%i&show_form=True" % (self.url, form_id) ) + self.check_page_for_string( 'Edit form definition "%s"' % form_name ) + tc.fv( "1", "name", new_form_name ) + tc.fv( "1", "description", new_form_desc ) + tc.submit( "save_changes_button" ) + self.check_page_for_string( "The form '%s' has been updated with the changes." % new_form_name ) + self.home() + def form_add_field( self, form_id, form_name, field_index, fields): + """ + Add a new fields to the form definition + """ + self.home() + self.visit_url( "%s/forms/edit?form_id=%i&show_form=True" % (self.url, form_id) ) + self.check_page_for_string( 'Edit form definition "%s"' % form_name) + for i, field in enumerate(fields): + index = i+field_index + tc.submit( "add_field_button" ) + tc.fv( "1", "field_name_%i" % index, field['name'] ) + tc.fv( "1", "field_helptext_%i" % index, field['desc'] ) + tc.fv( "1", "field_type_%i" % index, field['type'] ) + tc.fv( "1", "field_required_%i" % index, field['required'] ) +# if field['type'] == 'SelectField': +# for option_index, option in enumerate(field['selectlist']): +# self.visit_url( "%s/forms/edit?select_box_options=add&form_id=%i&field_index=%i" % \ +# (self.url, form_id, index)) +# #data = self.last_page() +# #file( "rc.html", 'wb' ).write(data) +# tc.fv( "1", "field_%i_option_%i" % (index, option_index), option ) + tc.submit( "save_changes_button" ) + check_str = "The form '%s' has been updated with the changes." % form_name + self.check_page_for_string( check_str ) + self.home() + def form_remove_field( self, form_id, form_name, field_name): + """ + Remove a field from the form definition + """ + self.home() + self.visit_url( "%s/forms/edit?form_id=%i&show_form=True" % (self.url, form_id) ) + self.check_page_for_string( 'Edit form definition "%s"' % form_name) + tc.submit( "remove_button" ) + tc.submit( "save_changes_button" ) + check_str = "The form '%s' has been updated with the changes." % form_name + self.check_page_for_string( check_str ) + self.home() + # Requests stuff + def create_request_type( self, name, desc, request_form_id, sample_form_id, states ): + self.home() + self.visit_url( "%s/admin/request_type?create=True" % self.url ) + self.check_page_for_string( 'Create a new request type' ) + tc.fv( "1", "name", name ) + tc.fv( "1", "description", desc ) + tc.fv( "1", "request_form_id", request_form_id ) + tc.fv( "1", "sample_form_id", sample_form_id ) + tc.fv( "1", "num_states", str( len( states ) ) ) + tc.submit( "define_states_button" ) + self.check_page_for_string( "Create %i states for the '%s' request type" % ( len(states), name )) + for index, state in enumerate(states): + tc.fv("1", "state_name_%i" % index, state[0]) + tc.fv("1", "state_desc_%i" % index, state[1]) + tc.submit( "save_request_type" ) + self.check_page_for_string( "Request type <b>%s</b> has been created" % name ) + def create_request( self, request_type_id, name, desc, library_id, fields ): + self.home() + self.visit_url( "%s/requests/new?create=True&select_request_type=%i" % (self.url, request_type_id) ) + self.check_page_for_string( 'Add a new request' ) + tc.fv( "1", "name", name ) + tc.fv( "1", "desc", desc ) + tc.fv( "1", "library_id", str(library_id) ) + for index, field_value in enumerate(fields): + tc.fv( "1", "field_%i" % index, field_value ) + tc.submit( "create_request_button" ) + def add_samples( self, request_id, request_name, samples ): + self.home() + self.visit_url( "%s/requests/list?sort=-create_time&operation=show_request&id=%s" % ( self.url, self.security.encode_id( request_id ) )) + self.check_page_for_string( 'Sequencing Request "%s"' % request_name ) + for sample_index, sample in enumerate(samples): + tc.submit( "add_sample_button" ) + sample_name, fields = sample + tc.fv( "1", "sample_%i_name" % sample_index, sample_name ) + for field_index, field_value in enumerate(fields): + tc.fv( "1", "sample_%i_field_%i" % ( sample_index, field_index ), field_value ) + tc.submit( "save_samples_button" ) + def submit_request( self, request_id, request_name ): + self.home() + self.visit_url( "%s/requests/submit_request?id=%i" % ( self.url, request_id )) + self.check_page_for_string( 'The request <b>%s</b> has been submitted.' % request_name ) + def add_bar_codes( self, request_id, request_name, bar_codes ): + self.home() + self.visit_url( "%s/requests_admin/bar_codes?request_id=%i" % (self.url, request_id) ) + self.check_page_for_string( 'Bar codes for Samples of Request "%s"' % request_name ) + for index, bar_code in enumerate(bar_codes): + tc.fv( "1", "sample_%i_bar_code" % index, bar_code ) + tc.submit( "save_bar_codes" ) + def change_sample_state( self, sample_name, sample_id, new_state_id, comment='' ): + self.home() + self.visit_url( "%s/requests_admin/show_events?sample_id=%i" % (self.url, sample_id) ) + self.check_page_for_string( 'Events for Sample "%s"' % sample_name ) + tc.fv( "1", "select_state", str(new_state_id) ) + tc.fv( "1", "comment", comment ) + tc.submit( "add_event_button" ) + # Address stuff + def create_address( self, address ): + self.home() + self.visit_url( "%s/user/new_address" % self.url ) + self.check_page_for_string( 'New address' ) + for name, value in address.iteritems(): + tc.fv( "1", name, value ) + tc.submit( "Save_button" ) # Library stuff def create_library( self, name='Library One', description='This is Library One' ): """Create a new library"""

1 0

[hg] galaxy 2586: Added functional tests for requests & forms
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/98fa3b9cd980 changeset: 2586:98fa3b9cd980 user: rc date: Thu Aug 20 10:46:52 2009 -0400 description: Added functional tests for requests & forms LIMS features: - admin can now edit other requests - admin can now submit requests on behalf of other users 11 file(s) affected in this change: lib/galaxy/model/migrate/versions/0009_request_table.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py templates/admin/requests/edit_request.mako templates/admin/requests/grid.mako templates/admin/requests/new_request.mako templates/admin/requests/show_request.mako templates/requests/grid.mako templates/requests/show_request.mako test/functional/test_forms_and_requests.py diffs (1566 lines): diff -r e66e1e99183c -r 98fa3b9cd980 lib/galaxy/model/migrate/versions/0009_request_table.py --- a/lib/galaxy/model/migrate/versions/0009_request_table.py Fri Aug 14 15:47:13 2009 -0400 +++ b/lib/galaxy/model/migrate/versions/0009_request_table.py Thu Aug 20 10:46:52 2009 -0400 @@ -9,6 +9,7 @@ from migrate.changeset import * import sys, logging from galaxy.model.custom_types import * +from sqlalchemy.exceptions import * log = logging.getLogger( __name__ ) log.setLevel(logging.DEBUG) diff -r e66e1e99183c -r 98fa3b9cd980 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Fri Aug 14 15:47:13 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Thu Aug 20 10:46:52 2009 -0400 @@ -1161,3 +1161,13 @@ edit_info=True, msg=util.sanitize_text( msg ), messagetype='done' ) ) + + +def get_authorized_libs(trans, user): + all_libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() + authorized_libraries = [] + for library in all_libraries: + if trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) \ + or trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library): + authorized_libraries.append(library) + return authorized_libraries \ No newline at end of file diff -r e66e1e99183c -r 98fa3b9cd980 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Fri Aug 14 15:47:13 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Thu Aug 20 10:46:52 2009 -0400 @@ -9,6 +9,7 @@ from datetime import datetime, timedelta from cgi import escape, FieldStorage from galaxy.web.controllers.forms import get_form_widgets +from galaxy.web.controllers.library import get_authorized_libs log = logging.getLogger( __name__ ) @@ -66,15 +67,7 @@ @web.require_login( "create/submit sequencing requests" ) def index( self, trans ): return trans.fill_template( "requests/index.mako" ) - - def get_authorized_libs(self, trans): - all_libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() - authorized_libraries = [] - for library in all_libraries: - if trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) \ - or trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library): - authorized_libraries.append(library) - return authorized_libraries + @web.expose @web.require_login( "create/submit sequencing requests" ) def list( self, trans, **kwargs ): @@ -140,7 +133,6 @@ Shows the request details ''' request = trans.app.model.Request.get(id) - libraries = self.get_authorized_libs(trans) # list of widgets to be rendered on the request form request_details = [] # main details @@ -424,8 +416,8 @@ if params.get('create_request_button', False) == 'Save': return trans.response.send_redirect( web.url_for( controller='requests', action='list', - msg=msg , - messagetype='done') ) + message=msg , + status='done') ) elif params.get('create_request_samples_button', False) == 'Add samples': new_kwd = {} new_kwd['id'] = trans.security.encode_id(request.id) @@ -468,7 +460,7 @@ helptext='(Optional)')) # libraries selectbox - libraries = self.get_authorized_libs(trans) + libraries = get_authorized_libs(trans, trans.user) libui = self.__library_ui(libraries, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd) @@ -517,8 +509,8 @@ Validates the request entered by the user ''' empty_fields = [] - if not request.library: - empty_fields.append('Library') +# if not request.library: +# empty_fields.append('Library') # check rest of the fields of the form for index, field in enumerate(request.type.request_form.fields): if field['required'] == 'required' and request.values.content[index] in ['', None]: @@ -664,7 +656,7 @@ helptext='(Optional)')) # libraries selectbox - libraries = self.get_authorized_libs(trans) + libraries = get_authorized_libs(trans, trans.user) libui = self.__library_ui(libraries, request, **kwd) widgets = widgets + libui widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd) @@ -700,6 +692,8 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests', action='list', + status='done', + message='The request <b>%s</b> has been deleted.' % request.name, **kwd) ) def __undelete_request(self, trans, id): try: @@ -719,6 +713,8 @@ kwd['id'] = trans.security.encode_id(request.id) return trans.response.send_redirect( web.url_for( controller='requests', action='list', + status='done', + message='The request <b>%s</b> has been undeleted.' % request.name, **kwd) ) def __submit(self, trans, id): try: diff -r e66e1e99183c -r 98fa3b9cd980 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Fri Aug 14 15:47:13 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Aug 20 10:46:52 2009 -0400 @@ -7,19 +7,20 @@ import logging, tempfile, zipfile, tarfile, os, sys from galaxy.web.form_builder import * from datetime import datetime, timedelta +from galaxy.web.controllers.forms import get_form_widgets +from galaxy.web.controllers.library import get_authorized_libs log = logging.getLogger( __name__ ) - -# States for passing messages -SUCCESS, INFO, WARNING, ERROR = "done", "info", "warning", "error" class RequestsListGrid( grids.Grid ): title = "Sequencing Requests" model_class = model.Request default_sort_key = "-create_time" + show_filter = model.Request.states.SUBMITTED columns = [ grids.GridColumn( "Name", key="name", - link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) )), + link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) ), + attach_popup=True ), grids.GridColumn( "Description", key="desc"), grids.GridColumn( "Sample(s)", method='number_of_samples', link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) ), ), @@ -30,15 +31,18 @@ ] operations = [ -# grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Samples", allow_multiple=False, condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), + grids.GridOperation( "Submit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() and item.samples ) ), + grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), + grids.GridOperation( "Delete", allow_multiple=False, condition=( lambda item: not item.deleted and item.unsubmitted() ) ), + grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), ] standard_filters = [ + grids.GridColumnFilter( model.Request.states.UNSUBMITTED, + args=dict( state=model.Request.states.UNSUBMITTED, deleted=False ) ), grids.GridColumnFilter( model.Request.states.SUBMITTED, args=dict( state=model.Request.states.SUBMITTED, deleted=False ) ), grids.GridColumnFilter( model.Request.states.COMPLETE, args=dict( state=model.Request.states.COMPLETE, deleted=False ) ), + grids.GridColumnFilter( "Deleted", args=dict( deleted=True ) ), grids.GridColumnFilter( "All", args=dict( deleted=False ) ) ] def get_user(self, trans, request): @@ -48,9 +52,9 @@ def get_request_type(self, trans, request): request_type = trans.app.model.RequestType.get(request.request_type_id) return request_type.name - def apply_default_filter( self, trans, query ): - return query.filter(or_(self.model_class.state==self.model_class.states.SUBMITTED, - self.model_class.state==self.model_class.states.COMPLETE)) +# def apply_default_filter( self, trans, query ): +# return query.filter(or_(self.model_class.state==self.model_class.states.SUBMITTED, +# self.model_class.state==self.model_class.states.COMPLETE)) def number_of_samples(self, trans, request): return str(len(request.samples)) @@ -75,14 +79,256 @@ if operation == "show_request": id = trans.security.decode_id(kwargs['id']) return self.__show_request(trans, id) - + elif operation == "submit": + id = trans.security.decode_id(kwargs['id']) + return self.__submit(trans, id) + elif operation == "edit": + id = trans.security.decode_id(kwargs['id']) + return self.__edit_request(trans, id) + elif operation == "delete": + id = trans.security.decode_id(kwargs['id']) + return self.__delete_request(trans, id) + elif operation == "undelete": + id = trans.security.decode_id(kwargs['id']) + return self.__undelete_request(trans, id) if 'show_filter' in kwargs.keys(): if kwargs['show_filter'] == 'All': - self.request_grid.default_filter = dict(deleted=False) + self.request_grid.default_filter = {} + elif kwargs['show_filter'] == 'Deleted': + self.request_grid.default_filter = dict(deleted=True) else: - self.request_grid.default_filter = dict(state=kwargs['show_filter'], deleted=False) + self.request_grid.default_filter = dict(state=kwargs['show_filter'], deleted=False) + self.request_grid.show_filter = kwargs.get('show_filter', trans.app.model.Request.states.SUBMITTED) # Render the list view return self.request_grid( trans, template='/admin/requests/grid.mako', **kwargs ) + @web.expose + @web.require_admin + def edit(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + try: + request = trans.app.model.Request.get(int(params.get('request_id', None))) + except: + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message="Invalid request ID", + **kwd) ) + if params.get('show', False) == 'True': + return self.__edit_request(trans, request.id, **kwd) + elif params.get('save_changes_request_button', False) == 'Save changes' \ + or params.get('edit_samples_button', False) == 'Edit samples': + request_type = trans.app.model.RequestType.get(int(params.select_request_type)) + if not util.restore_text(params.get('name', '')): + msg = 'Please enter the <b>Name</b> of the request' + kwd['messagetype'] = 'error' + kwd['msg'] = msg + kwd['show'] = 'True' + return trans.response.send_redirect( web.url_for( controller='requests', + action='edit', + **kwd) ) + request = self.__save_request(trans, request, **kwd) + msg = 'The changes made to the request named %s has been saved' % request.name + if params.get('save_changes_request_button', False) == 'Save changes': + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + message=msg , + status='done') ) + elif params.get('edit_samples_button', False) == 'Edit samples': + new_kwd = {} + new_kwd['request_id'] = request.id + new_kwd['edit_samples_button'] = 'Edit samples' + return trans.response.send_redirect( web.url_for( controller='requests', + action='show_request', + msg=msg , + messagetype='done', + **new_kwd) ) + elif params.get('refresh', False) == 'true': + return self.__edit_request(trans, request.id, **kwd) + def __edit_request(self, trans, id, **kwd): + try: + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg) ) + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + select_request_type = self.__select_request_type(trans, request.type.id) + # list of widgets to be rendered on the request form + widgets = [] + if util.restore_text( params.get( 'name', '' ) ): + name = util.restore_text( params.get( 'name', '' ) ) + else: + name = request.name + widgets.append(dict(label='Name', + widget=TextField('name', 40, name), + helptext='(Required)')) + if util.restore_text( params.get( 'desc', '' ) ): + desc = util.restore_text( params.get( 'desc', '' ) ) + else: + desc = request.desc + widgets.append(dict(label='Description', + widget=TextField('desc', 40, desc), + helptext='(Optional)')) + # libraries selectbox + libraries = get_authorized_libs(trans, trans.user) + libui = self.__library_ui(libraries, request, **kwd) + widgets = widgets + libui + widgets = widgets + get_form_widgets(trans, request.type.request_form, request.values.content, **kwd) + return trans.fill_template( '/admin/requests/edit_request.mako', + select_request_type=select_request_type, + request_type=request.type, + request=request, + widgets=widgets, + msg=msg, + messagetype=messagetype) + return self.__show_request_form(trans) + def __delete_request(self, trans, id): + try: + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) + # change request's submitted field + if not request.unsubmitted(): + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message='This request cannot be deleted as it is already been submitted', + **kwd) ) + request.deleted = True + request.flush() + kwd = {} + kwd['id'] = trans.security.encode_id(request.id) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='done', + message='The request <b>%s</b> has been deleted.' % request.name, + **kwd) ) + def __undelete_request(self, trans, id): + try: + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) + # change request's submitted field + request.deleted = False + request.flush() + kwd = {} + kwd['id'] = trans.security.encode_id(request.id) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='done', + message='The request <b>%s</b> has been undeleted.' % request.name, + **kwd) ) + def __submit(self, trans, id): + try: + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) + msg = self.__validate(trans, request) + if msg: + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='edit', + messagetype = 'error', + msg=msg, + request_id=request.id, + show='True') ) + # get the new state + new_state = request.type.states[0] + for s in request.samples: + event = trans.app.model.SampleEvent(s, new_state, 'Samples submitted to the system') + event.flush() + # change request's submitted field + request.state = request.states.SUBMITTED + request.flush() + kwd = {} + kwd['id'] = trans.security.encode_id(request.id) + kwd['status'] = 'done' + kwd['message'] = 'The request <b>%s</b> has been submitted.' % request.name + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + show_filter=trans.app.model.Request.states.SUBMITTED, + **kwd) ) + @web.expose + @web.require_admin + def submit_request(self, trans, **kwd): + params = util.Params( kwd ) + try: + id = int(params.get('id', False)) + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) + msg = self.__validate(trans, request) + if msg: + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='edit', + messagetype = 'error', + msg=msg, + request_id=request.id, + show='True') ) + # get the new state + new_state = request.type.states[0] + for s in request.samples: + event = trans.app.model.SampleEvent(s, new_state, 'Samples submitted to the system') + event.flush() + # change request's submitted field + request.state = request.states.SUBMITTED + request.flush() + kwd['id'] = trans.security.encode_id(request.id) + kwd['status'] = 'done' + kwd['message'] = 'The request <b>%s</b> has been submitted.' % request.name + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + show_filter=trans.app.model.Request.states.SUBMITTED, + **kwd) ) + def __copy_sample(self): + copy_list = SelectField('copy_sample') + copy_list.add_option('None', -1, selected=True) + for i, s in enumerate(self.current_samples): + copy_list.add_option(s[0], i) + return copy_list + def __update_samples(self, request, **kwd): + params = util.Params( kwd ) + num_samples = len(self.current_samples) + self.current_samples = [] + for s in request.samples: + self.current_samples.append([s.name, s.values.content]) + for index in range(num_samples-len(request.samples)): + sample_index = index + len(request.samples) + sample_name = util.restore_text( params.get( 'sample_%i_name' % sample_index, '' ) ) + sample_values = [] + for field_index in range(len(request.type.sample_form.fields)): + sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) + self.current_samples.append([sample_name, sample_values]) def __show_request(self, trans, id): try: request = trans.app.model.Request.get(id) @@ -93,6 +339,7 @@ message="Invalid request ID", **kwd) ) self.current_samples = [] + self.edit_mode = False for s in request.samples: self.current_samples.append([s.name, s.values.content]) self.details_state = 'Show request details' @@ -100,8 +347,160 @@ request=request, request_details=self.request_details(trans, id), current_samples = self.current_samples, - details_state=self.details_state) + sample_copy=self.__copy_sample(), + details_state=self.details_state, + edit_mode=self.edit_mode) @web.expose + @web.require_admin + def show_request(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + try: + request = trans.app.model.Request.get(int(params.get('request_id', None))) + except: + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message="Invalid request ID", + **kwd) ) + if params.get('import_samples_button', False) == 'Import samples': + try: + file_obj = params.get('file_data', '') + import csv + reader = csv.reader(file_obj.file) + for row in reader: + self.current_samples.append([row[0], row[1:]]) + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples=self.current_samples, + sample_copy=self.__copy_sample(), + details_state=self.details_state, + edit_mode=self.edit_mode) + except: + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message='Error in importing <b>%s</b> samples file' % file_obj.file, + **kwd)) + elif params.get('add_sample_button', False) == 'Add New': + # save the all (saved+unsaved) sample info in 'current_samples' + self.__update_samples(request, **kwd) + # add an empty or filled sample + # if the user has selected a sample no. to copy then copy the contents + # of the src sample to the new sample else an empty sample + src_sample_index = int(params.get( 'copy_sample', -1 )) + if src_sample_index == -1: + # empty sample + self.current_samples.append(['Sample_%i' % (len(self.current_samples)+1),['' for field in request.type.sample_form.fields]]) + else: + self.current_samples.append([self.current_samples[src_sample_index][0]+'_%i' % (len(self.current_samples)+1), + [val for val in self.current_samples[src_sample_index][1]]]) + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples=self.current_samples, + sample_copy=self.__copy_sample(), + details_state=self.details_state, + edit_mode=self.edit_mode) + elif params.get('save_samples_button', False) == 'Save': + # update current_samples + self.__update_samples(request, **kwd) + # check for duplicate sample names + msg = '' + for index in range(len(self.current_samples)-len(request.samples)): + sample_index = index + len(request.samples) + sample_name = self.current_samples[sample_index][0] + if not sample_name.strip(): + msg = 'Please enter the name of sample number %i' % sample_index + break + count = 0 + for i in range(len(self.current_samples)): + if sample_name == self.current_samples[i][0]: + count = count + 1 + if count > 1: + msg = "This request has <b>%i</b> samples with the name <b>%s</b>.\nSamples belonging to a request must have unique names." % (count, sample_name) + break + if msg: + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples = self.current_samples, + sample_copy=self.__copy_sample(), details_state=self.details_state, + messagetype='error', msg=msg) + # save all the new/unsaved samples entered by the user + if not self.edit_mode: + for index in range(len(self.current_samples)-len(request.samples)): + sample_index = index + len(request.samples) + sample_name = util.restore_text( params.get( 'sample_%i_name' % sample_index, '' ) ) + sample_values = [] + for field_index in range(len(request.type.sample_form.fields)): + sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) + form_values = trans.app.model.FormValues(request.type.sample_form, sample_values) + form_values.flush() + s = trans.app.model.Sample(sample_name, '', request, form_values) + s.flush() + else: + for index in range(len(self.current_samples)): + sample_index = index + sample_name = self.current_samples[sample_index][0] + new_sample_name = util.restore_text( params.get( 'sample_%i_name' % sample_index, '' ) ) + sample_values = [] + for field_index in range(len(request.type.sample_form.fields)): + sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) + sample = request.has_sample(sample_name) + if sample: + form_values = trans.app.model.FormValues.get(sample.values.id) + form_values.content = sample_values + form_values.flush() + sample.name = new_sample_name + sample.flush() + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + operation='show_request', + id=trans.security.encode_id(request.id)) ) + elif params.get('edit_samples_button', False) == 'Edit samples': + self.edit_mode = True + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples=self.current_samples, + sample_copy=self.__copy_sample(), + details_state=self.details_state, + edit_mode=self.edit_mode) + elif params.get('cancel_changes_button', False) == 'Cancel': + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + operation='show_request', + id=trans.security.encode_id(request.id)) ) + + + @web.expose + @web.require_admin + def delete_sample(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + request = trans.app.model.Request.get(int(params.get('request_id', 0))) + sample_index = int(params.get('sample_id', 0)) + sample_name = self.current_samples[sample_index][0] + s = request.has_sample(sample_name) + if s: + s.delete() + s.flush() + request.flush() + del self.current_samples[sample_index] + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples = self.current_samples, + sample_copy=self.__copy_sample(), + details_state=self.details_state, + edit_mode=self.edit_mode) + + @web.expose + @web.require_admin def toggle_request_details(self, trans, **kwd): params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) @@ -144,10 +543,16 @@ value=str(request.user.email), helptext='')) # library associated - request_details.append(dict(label='Library', - value=trans.app.model.Library.get(request.library_id).name, - helptext='Associated library where the resultant \ - dataset will be stored')) + if request.library: + request_details.append(dict(label='Library', + value=request.library.name, + helptext='Associated library where the resultant \ + dataset will be stored')) + else: + request_details.append(dict(label='Library', + value=None, + helptext='Associated library where the resultant \ + dataset will be stored')) # form fields for index, field in enumerate(request.type.request_form.fields): if field['required']: @@ -168,6 +573,253 @@ value=request.values.content[index], helptext=field['helptext']+' ('+req+')')) return request_details + + def __select_request_type(self, trans, rtid): + rt_ids = ['none'] + for rt in trans.app.model.RequestType.query().all(): + if not rt.deleted: + rt_ids.append(str(rt.id)) + select_reqtype = SelectField('select_request_type', + refresh_on_change=True, + refresh_on_change_values=rt_ids[1:]) + if rtid == 'none': + select_reqtype.add_option('Select one', 'none', selected=True) + else: + select_reqtype.add_option('Select one', 'none') + for rt in trans.app.model.RequestType.query().all(): + if not rt.deleted: + if rtid == rt.id: + select_reqtype.add_option(rt.name, rt.id, selected=True) + else: + select_reqtype.add_option(rt.name, rt.id) + return select_reqtype + @web.expose + @web.require_admin + def new(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + if params.get('select_request_type', False) == 'True': + return trans.fill_template( '/admin/requests/new_request.mako', + select_request_type=self.__select_request_type(trans, 'none'), + widgets=[], + msg=msg, + messagetype=messagetype) + elif params.get('create', False) == 'True': + if params.get('create_request_button', False) == 'Save' \ + or params.get('create_request_samples_button', False) == 'Add samples': + request_type = trans.app.model.RequestType.get(int(params.select_request_type)) + if not util.restore_text(params.get('name', '')) \ + or util.restore_text(params.get('select_user', '')) == unicode('none'): + msg = 'Please enter the <b>Name</b> of the request and the <b>user</b> on behalf of whom this request will be submitted before saving this request' + kwd['create'] = 'True' + kwd['messagetype'] = 'error' + kwd['msg'] = msg + kwd['create_request_button'] = None + kwd['create_request_samples_button'] = None + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='new', + **kwd) ) + request = self.__save_request(trans, None, **kwd) + msg = 'The new request named %s has been created' % request.name + if params.get('create_request_button', False) == 'Save': + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + show_filter=trans.app.model.Request.states.UNSUBMITTED, + message=msg , + status='done') ) + elif params.get('create_request_samples_button', False) == 'Add samples': + new_kwd = {} + new_kwd['id'] = trans.security.encode_id(request.id) + new_kwd['operation'] = 'show_request' + new_kwd['add_sample'] = True + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + message=msg , + status='done', + **new_kwd) ) + else: + return self.__show_request_form(trans, **kwd) + elif params.get('refresh', False) == 'true': + return self.__show_request_form(trans, **kwd) + def __show_request_form(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + try: + request_type = trans.app.model.RequestType.get(int(params.select_request_type)) + except: + return trans.fill_template( '/admin/requests/new_request.mako', + select_request_type=self.__select_request_type(trans, 'none'), + widgets=[], + msg=msg, + messagetype=messagetype) + form_values = None + select_request_type = self.__select_request_type(trans, request_type.id) + # user + user_id = params.get( 'select_user', 'none' ) + try: + user = trans.app.model.User.get(int(user_id)) + except: + user = None + # list of widgets to be rendered on the request form + widgets = [] + widgets.append(dict(label='Select user', + widget=self.__select_user(trans, user_id), + helptext='The request would be submitted on behalf of this user (Required)')) + widgets.append(dict(label='Name', + widget=TextField('name', 40, + util.restore_text( params.get( 'name', '' ) )), + helptext='(Required)')) + widgets.append(dict(label='Description', + widget=TextField('desc', 40, + util.restore_text( params.get( 'desc', '' ) )), + helptext='(Optional)')) + # libraries selectbox + if not user: + libraries = [] + else: + libraries = get_authorized_libs(trans, user) + libui = self.__library_ui(libraries, **kwd) + widgets = widgets + libui + widgets = widgets + get_form_widgets(trans, request_type.request_form, contents=[], **kwd) + return trans.fill_template( '/admin/requests/new_request.mako', + select_request_type=select_request_type, + request_type=request_type, + widgets=widgets, + msg=msg, + messagetype=messagetype) + def __select_user(self, trans, userid): + user_ids = ['none'] + for user in trans.app.model.User.query().all(): + if not user.deleted: + user_ids.append(str(user.id)) + select_user = SelectField('select_user', + refresh_on_change=True, + refresh_on_change_values=user_ids[1:]) + if userid == 'none': + select_user.add_option('Select one', 'none', selected=True) + else: + select_user.add_option('Select one', 'none') + for user in trans.app.model.User.query().all(): + if not user.deleted: + if userid == str(user.id): + select_user.add_option(user.email, user.id, selected=True) + else: + select_user.add_option(user.email, user.id) + return select_user + + def __library_ui(self, libraries, request=None, **kwd): + params = util.Params( kwd ) + lib_id = params.get( 'library_id', 'none' ) + lib_list = SelectField('library_id', refresh_on_change=True, + refresh_on_change_values=['new']) + if request and lib_id == 'none': + if request.library: + lib_id = str(request.library.id) + if lib_id == 'none': + lib_list.add_option('Select one', 'none', selected=True) + else: + lib_list.add_option('Select one', 'none') + for lib in libraries: + if str(lib.id) == lib_id: + lib_list.add_option(lib.name, lib.id, selected=True) + else: + lib_list.add_option(lib.name, lib.id) + if lib_id == 'new': + lib_list.add_option('Create a new library', 'new', selected=True) + else: + lib_list.add_option('Create a new library', 'new') + widget = dict(label='Library', + widget=lib_list, + helptext='Associated library where the resultant \ + dataset will be stored.') + if lib_id == 'new': + new_lib = dict(label='Create a new Library', + widget=TextField('new_library_name', 40, + util.restore_text( params.get( 'new_library_name', '' ) )), + helptext='Enter a library name here to request a new library') + return [widget, new_lib] + else: + return [widget] + def __validate(self, trans, request): + ''' + Validates the request entered by the user + ''' + empty_fields = [] +# if not request.library: +# empty_fields.append('Library') + # check rest of the fields of the form + for index, field in enumerate(request.type.request_form.fields): + if field['required'] == 'required' and request.values.content[index] in ['', None]: + empty_fields.append(field['label']) + if empty_fields: + msg = 'Fill the following fields of the request <b>%s</b> before submitting<br/>' % request.name + for ef in empty_fields: + msg = msg + '<b>' +ef + '</b><br/>' + return msg + return None + def __save_request(self, trans, request=None, **kwd): + ''' + This method saves a new request if request_id is None. + ''' + params = util.Params( kwd ) + request_type = trans.app.model.RequestType.get(int(params.select_request_type)) + if request: + user = request.user + else: + user = trans.app.model.User.get(int(params.get('select_user', ''))) + name = util.restore_text(params.get('name', '')) + desc = util.restore_text(params.get('desc', '')) + # library + try: + library = trans.app.model.Library.get(int(params.get('library_id', None))) + except: + library = None + # fields + values = [] + for index, field in enumerate(request_type.request_form.fields): + if field['type'] == 'AddressField': + value = util.restore_text(params.get('field_%i' % index, '')) + if value == 'new': + # save this new address in the list of this user's addresses + user_address = trans.app.model.UserAddress( user=trans.user ) + user_address.desc = util.restore_text(params.get('field_%i_short_desc' % index, '')) + user_address.name = util.restore_text(params.get('field_%i_name' % index, '')) + user_address.institution = util.restore_text(params.get('field_%i_institution' % index, '')) + user_address.address = util.restore_text(params.get('field_%i_address1' % index, ''))+' '+util.restore_text(params.get('field_%i_address2' % index, '')) + user_address.city = util.restore_text(params.get('field_%i_city' % index, '')) + user_address.state = util.restore_text(params.get('field_%i_state' % index, '')) + user_address.postal_code = util.restore_text(params.get('field_%i_postal_code' % index, '')) + user_address.country = util.restore_text(params.get('field_%i_country' % index, '')) + user_address.phone = util.restore_text(params.get('field_%i_phone' % index, '')) + user_address.flush() + trans.user.refresh() + values.append(int(user_address.id)) + elif value == unicode('none'): + values.append('') + else: + values.append(int(value)) + else: + values.append(util.restore_text(params.get('field_%i' % index, ''))) + form_values = trans.app.model.FormValues(request_type.request_form, values) + form_values.flush() + if not request: + request = trans.app.model.Request(name, desc, request_type, + user, form_values, + library=library, + state=trans.app.model.Request.states.UNSUBMITTED) + request.flush() + else: + request.name = name + request.desc = desc + request.type = request_type + request.user = user + request.values = form_values + request.library = library + request.state = trans.app.model.Request.states.UNSUBMITTED + request.flush() + return request @web.expose @web.require_admin def bar_codes(self, trans, **kwd): @@ -178,7 +830,7 @@ if request_id: request = trans.app.model.Request.get( int( request_id )) if not request: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", @@ -204,7 +856,7 @@ try: request = trans.app.model.Request.get(int(params.get('request_id', None))) except: - return trans.response.send_redirect( web.url_for( controller='requests', + return trans.response.send_redirect( web.url_for( controller='requests_admin', action='list', status='error', message="Invalid request ID", diff -r e66e1e99183c -r 98fa3b9cd980 templates/admin/requests/edit_request.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/admin/requests/edit_request.mako Thu Aug 20 10:46:52 2009 -0400 @@ -0,0 +1,88 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + +%if msg: + ${render_msg( msg, messagetype )} +%endif + +<script type="text/javascript"> +$( function() { + $( "select[refresh_on_change='true']").change( function() { + var refresh = false; + var refresh_on_change_values = $( this )[0].attributes.getNamedItem( 'refresh_on_change_values' ) + if ( refresh_on_change_values ) { + refresh_on_change_values = refresh_on_change_values.value.split( ',' ); + var last_selected_value = $( this )[0].attributes.getNamedItem( 'last_selected_value' ); + for( i= 0; i < refresh_on_change_values.length; i++ ) { + if ( $( this )[0].value == refresh_on_change_values[i] || ( last_selected_value && last_selected_value.value == refresh_on_change_values[i] ) ){ + refresh = true; + break; + } + } + } + else { + refresh = true; + } + if ( refresh ){ + $( "#edit_request" ).submit(); + } + }); +}); +</script> + +<br/> +<br/> +<ul class="manage-table-actions"> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='list', operation='show_request', id=trans.security.encode_id(request.id) )}"> + <span>Browse this request</span></a> + </li> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='list')}"> + <span>Browse requests</span></a> + </li> +</ul> + +<div class="toolForm"> + <div class="toolFormTitle">Edit request "${request.name}" from ${request.user.email}</div> + %if len(select_request_type.options) == 1: + There are no request types created for a new request. + %else: + <div class="toolFormBody"> + <form name="edit_request" id="edit_request" action="${h.url_for( controller='requests_admin', action='edit', request_id=request.id)}" method="post" > + <div class="form-row"> + <label> + Select Request Type: + </label> + ${select_request_type.get_html()} + </div> + + %if select_request_type.get_selected() != ('Select one', 'none'): + %for i, field in enumerate(widgets): + <div class="form-row"> + <label>${field['label']}</label> + ${field['widget'].get_html()} + %if field['label'] == 'Library' and new_library: + ${new_library.get_html()} + %endif + <div class="toolParamHelp" style="clear: both;"> + ${field['helptext']} + </div> + <div style="clear: both"></div> + </div> + %endfor + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="hidden" name="refresh" value="true" size="40"/> + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="save_changes_request_button" value="Save changes"/> + ##<input type="submit" name="edit_samples_button" value="Edit samples"/> + </div> + %endif + </form> + </div> +</div> +%endif \ No newline at end of file diff -r e66e1e99183c -r 98fa3b9cd980 templates/admin/requests/grid.mako --- a/templates/admin/requests/grid.mako Fri Aug 14 15:47:13 2009 -0400 +++ b/templates/admin/requests/grid.mako Thu Aug 20 10:46:52 2009 -0400 @@ -82,23 +82,22 @@ %if i > 0: <span>|</span> %endif - %if 'state' in grid.default_filter: - %if grid.default_filter['state'] == filter.label: - <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}"><b>${filter.label}</b></a></span> - %else: - <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}">${filter.label}</a></span> - %endif + %if grid.show_filter == filter.label: + <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}"><b>${filter.label}</b></a></span> %else: - %if filter.label == 'All': - <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}"><b>${filter.label}</b></a></span> - %else: - <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}">${filter.label}</a></span> - %endif + <span class="filter"><a href="${h.url_for( controller='requests_admin', action='list', show_filter=filter.label )}">${filter.label}</a></span> %endif %endfor %endif </div> +<ul class="manage-table-actions"> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='new', select_request_type=True )}"> + <img src="${h.url_for('/static/images/silk/add.png')}" /> + <span>Create a new request</span></a> + </li> +</ul> %if not len(query.all()): There are no request(s). diff -r e66e1e99183c -r 98fa3b9cd980 templates/admin/requests/new_request.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/admin/requests/new_request.mako Thu Aug 20 10:46:52 2009 -0400 @@ -0,0 +1,84 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + +%if msg: + ${render_msg( msg, messagetype )} +%endif + +<script type="text/javascript"> +$( function() { + $( "select[refresh_on_change='true']").change( function() { + var refresh = false; + var refresh_on_change_values = $( this )[0].attributes.getNamedItem( 'refresh_on_change_values' ) + if ( refresh_on_change_values ) { + refresh_on_change_values = refresh_on_change_values.value.split( ',' ); + var last_selected_value = $( this )[0].attributes.getNamedItem( 'last_selected_value' ); + for( i= 0; i < refresh_on_change_values.length; i++ ) { + if ( $( this )[0].value == refresh_on_change_values[i] || ( last_selected_value && last_selected_value.value == refresh_on_change_values[i] ) ){ + refresh = true; + break; + } + } + } + else { + refresh = true; + } + if ( refresh ){ + $( "#new_request" ).submit(); + } + }); +}); +</script> + +<br/> +<br/> +<ul class="manage-table-actions"> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='list')}"> + <span>Browse requests</span></a> + </li> +</ul> + +<div class="toolForm"> + <div class="toolFormTitle">Add a new request</div> + %if len(select_request_type.options) == 1: + There are no request types created for a new request. + %else: + <div class="toolFormBody"> + <form name="new_request" id="new_request" action="${h.url_for( controller='requests_admin', action='new', create=True )}" method="post" > + <div class="form-row"> + <label> + Select Request Type + </label> + ${select_request_type.get_html()} + </div> + + %if select_request_type.get_selected() != ('Select one', 'none'): + %for i, field in enumerate(widgets): + <div class="form-row"> + <label>${field['label']}</label> + ${field['widget'].get_html()} + %if field['label'] == 'Library' and new_library: + ${new_library.get_html()} + %endif + <div class="toolParamHelp" style="clear: both;"> + ${field['helptext']} + </div> + <div style="clear: both"></div> + </div> + %endfor + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="hidden" name="refresh" value="true" size="40"/> + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="create_request_button" value="Save"/> + <input type="submit" name="create_request_samples_button" value="Add samples"/> + </div> + %endif + </form> + </div> +</div> +%endif \ No newline at end of file diff -r e66e1e99183c -r 98fa3b9cd980 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Fri Aug 14 15:47:13 2009 -0400 +++ b/templates/admin/requests/show_request.mako Thu Aug 20 10:46:52 2009 -0400 @@ -12,18 +12,49 @@ </div> <ul class="manage-table-actions"> - <li> - <a class="action-button" href="${h.url_for( controller='requests_admin', action='bar_codes', request_id=request.id)}"> - <span>Bar codes</span></a> - </li> + %if request.unsubmitted() and request.samples: + <li> + <a class="action-button" confirm="More samples cannot be added to this request once it is submitted. Click OK to submit." href="${h.url_for( controller='requests_admin', action='submit_request', id=request.id)}"> + <span>Submit request</span></a> + </li> + %endif + %if request.submitted() and request.samples: + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='bar_codes', request_id=request.id)}"> + <span>Bar codes</span></a> + </li> + %endif </ul> + +<%def name="render_sample_form( index, sample_name, sample_values )"> + <td> + <input type="text" name=sample_${index}_name value="${sample_name}" size="10"/> + <div class="toolParamHelp" style="clear: both;"> + <i>${' (required)' }</i> + </div> + </td> + <td> + </td> + %for field_index, field in enumerate(request.type.sample_form.fields): + <td> + <input type="text" name=sample_${index}_field_${field_index} value="${sample_values[field_index]}" size="7"/> + <div class="toolParamHelp" style="clear: both;"> + <i>${'('+field['required']+')' }</i> + </div> + </td> + %endfor +</%def> <%def name="render_sample( index, sample )"> <td> ${sample.name} </td> <td> - <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> + %if sample.request.unsubmitted(): + Unsubmitted + %else: + <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> + %endif </td> %for field_index, field in enumerate(request.type.sample_form.fields): <td> @@ -34,10 +65,10 @@ %endif </td> %endfor + </%def> <div class="toolForm"> - ##<div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> <div class="form-row"> <a href="${h.url_for( controller='requests_admin', action='toggle_request_details', request_id=request.id )}">${details_state}</a> </div> @@ -57,13 +88,21 @@ </div> <div style="clear: both"></div> %endfor + <div class="form-row"> + <ul class="manage-table-actions"> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='edit', show=True, request_id=request.id)}"> + <span>Edit request details</span></a> + </li> + </ul> + </div> %endif </div> </div> <div class="toolForm"> ##<div class="toolFormTitle">Samples (${len(request.samples)})</div> - <form id="edit_form" name="edit_form" action="${h.url_for( controller='requests', action='show_request', request_id=request.id )}" method="post" > + <form id="edit_form" name="edit_form" action="${h.url_for( controller='requests_admin', action='show_request' )}" enctype="multipart/form-data" method="post" > <div class="form-row"> %if current_samples: <table class="grid"> @@ -80,22 +119,88 @@ </div> </th> %endfor + <th></th> </tr> <thead> <tbody> + <% + request.refresh() + %> %for sample_index, sample in enumerate(current_samples): - <tr> - <td>${sample_index+1}</td> - ${render_sample( sample_index, request.samples[sample_index] )} - </tr> + %if edit_mode: + <tr> + <td>${sample_index+1}</td> + ${render_sample_form( sample_index, sample[0], sample[1])} + </tr> + %else: + <tr> + <td>${sample_index+1}</td> + %if sample_index in range(len(request.samples)): + ${render_sample( sample_index, request.samples[sample_index] )} + %else: + ${render_sample_form( sample_index, sample[0], sample[1])} + %endif + <td> + %if request.unsubmitted(): + <a class="action-button" href="${h.url_for( controller='requests_admin', action='delete_sample', request_id=request.id, sample_id=sample_index)}"> + <img src="${h.url_for('/static/images/delete_icon.png')}" /> + <span></span></a> + %endif + </td> + </tr> + %endif %endfor </tbody> </table> %else: <label>There are no samples.</label> %endif - </div> - ##</div> + %if not edit_mode: + <table class="grid"> + <tbody> + <tr> + <div class="form-row"> + <td> + %if current_samples: + <input type="submit" name="edit_samples_button" value="Edit samples"/> + %endif + </td> + %if request.unsubmitted(): + <td> + <label>Import from csv file</label> + <input type="file" name="file_data" /> + <input type="submit" name="import_samples_button" value="Import samples"/> + </td> + <td> + %if current_samples: + <label>Copy from sample</label> + ${sample_copy.get_html()} + %endif + <input type="submit" name="add_sample_button" value="Add New"/> + </td> + %endif + </div> + </tr> + </tbody> + </table> + %endif + %if request.samples or current_samples: + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="hidden" name="refresh" value="true" size="40"/> + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + %if edit_mode: + <input type="submit" name="save_samples_button" value="Save"/> + <input type="submit" name="cancel_changes_button" value="Cancel"/> + %elif request.unsubmitted(): + <input type="submit" name="save_samples_button" value="Save"/> + %endif + </div> + %endif + <input type="hidden" name="request_id" value="${request.id}" /> </form> </div> diff -r e66e1e99183c -r 98fa3b9cd980 templates/requests/grid.mako --- a/templates/requests/grid.mako Fri Aug 14 15:47:13 2009 -0400 +++ b/templates/requests/grid.mako Thu Aug 20 10:46:52 2009 -0400 @@ -95,7 +95,7 @@ <li> <a class="action-button" href="${h.url_for( controller='requests', action='new', select_request_type=True )}"> <img src="${h.url_for('/static/images/silk/add.png')}" /> - <span>New request</span></a> + <span>Create a new request</span></a> </li> </ul> diff -r e66e1e99183c -r 98fa3b9cd980 templates/requests/show_request.mako --- a/templates/requests/show_request.mako Fri Aug 14 15:47:13 2009 -0400 +++ b/templates/requests/show_request.mako Thu Aug 20 10:46:52 2009 -0400 @@ -68,7 +68,6 @@ </%def> <div class="toolForm"> - ##<div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> <div class="form-row"> <a href="${h.url_for( controller='requests', action='toggle_request_details', request_id=request.id )}">${details_state}</a> </div> @@ -217,7 +216,6 @@ %endif </div> %endif - ##</div> - <input type="hidden" name="request_id" value="${request.id}" /> + <input type="hidden" name="request_id" value="${request.id}" /> </form> </div> diff -r e66e1e99183c -r 98fa3b9cd980 test/functional/test_forms_and_requests.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test/functional/test_forms_and_requests.py Thu Aug 20 10:46:52 2009 -0400 @@ -0,0 +1,212 @@ +import galaxy.model +from galaxy.model.orm import * +from base.twilltestcase import * + +not_logged_in_as_admin_security_msg = 'You must be logged in as an administrator to access this feature.' +logged_in_as_admin_security_msg = 'You must be an administrator to access this feature.' +not_logged_in_security_msg = 'You must be logged in to create/submit sequencing requests' +form_one_name = "Request Form" +form_two_name = "Sample Form" +request_type_name = 'Test Requestype' +sample_states = [ ( 'New', 'Sample entered into the system' ), + ( 'Received', 'Sample tube received' ), + ( 'Done', 'Sequence run complete' ) ] +address1 = dict( short_desc="Office", + name="James Bond", + institution="MI6" , + address1="MI6 Headquaters", + address2="", + city="London", + state="London", + postal_code="007", + country="United Kingdom", + phone="007-007-0007" ) + + +def get_latest_form(form_name): + fdc_list = galaxy.model.FormDefinitionCurrent.filter( galaxy.model.FormDefinitionCurrent.table.c.deleted==False )\ + .order_by( galaxy.model.FormDefinitionCurrent.table.c.create_time.desc() ) + for fdc in fdc_list: + if form_name == fdc.latest_form.name: + return fdc.latest_form + return None + + +class TestFormsAndRequests( TwillTestCase ): + def test_000_create_form( self ): + """Testing creating a new form and editing it""" + self.logout() + self.login( email='test(a)bx.psu.edu' ) + # create a form + global form_one_name + name = form_one_name + desc = "This is Form One's description" + self.create_form( name=name, desc=desc ) + self.home() + self.visit_page( 'forms/manage' ) + self.check_page_for_string( name ) + self.check_page_for_string( desc ) + # Get the form_definition object for later tests + form_one = galaxy.model.FormDefinition.filter( and_( galaxy.model.FormDefinition.table.c.name==name, + galaxy.model.FormDefinition.table.c.desc==desc ) ).all()[-1] + assert form_one is not None, 'Problem retrieving form named "%s" from the database' % name + # edit form & add few more fields + new_name = "Request Form (Renamed)" + new_desc = "This is Form One's Re-described" + self.edit_form( form_one.id, form_one.name, new_form_name=new_name, new_form_desc=new_desc ) + self.home() + self.visit_page( 'forms/manage' ) + self.check_page_for_string( new_name ) + self.check_page_for_string( new_desc ) + form_one_name = new_name + def test_005_add_form_fields( self ): + """Testing adding fields to a form definition""" + fields = [dict(name='Test field name one', + desc='Test field description one', + type='TextField', + required='required'), + dict(name='Test field name two', + desc='Test field description two', + type='AddressField', + required='optional')] + form_one = get_latest_form(form_one_name) + self.form_add_field(form_one.id, form_one.name, field_index=len(form_one.fields), fields=fields) + form_one_latest = get_latest_form(form_one_name) + assert len(form_one_latest.fields) == len(form_one.fields)+len(fields) +#This following test has been commented out as it is causing: +#TwillException: multiple matches to "remove_button" +# def test_010_remove_form_fields( self ): +# """Testing removing fields from a form definition""" +# form_one = get_latest_form(form_one_name) +# self.form_remove_field( form_one.id, form_one.name, 'Test field name one' ) +# form_one_latest = get_latest_form(form_one_name) +# assert len(form_one_latest.fields) == len(form_one.fields)-1 + def test_015_create_sample_form( self ): + """Testing creating another form (for samples)""" + global form_two_name + name = form_two_name + desc = "This is Form One's description" + self.create_form( name=name, desc=desc ) + self.home() + self.visit_page( 'forms/manage' ) + self.check_page_for_string( name ) + self.check_page_for_string( desc ) + def test_020_create_request_type( self ): + """Testing creating a new requestype""" + request_form = get_latest_form(form_one_name) + sample_form = get_latest_form(form_two_name) + self.create_request_type(request_type_name, "test request type", + str(request_form.id), str(sample_form.id), sample_states ) + global request_type + request_type = galaxy.model.RequestType.filter( and_( galaxy.model.RequestType.table.c.name==request_type_name ) ).all()[-1] + assert request_type is not None, 'Problem retrieving request type named "%s" from the database' % request_type_name + def test_025_create_address( self ): + """Testing address creation""" + #self.create_address( user_address1 ) + #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) + ## TODO: FIX HACK + ## the user address creation should be done as a test. + global user_address + user_address = galaxy.model.UserAddress() + user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test(a)bx.psu.edu' ).first() + user_address.desc = address1[ 'short_desc' ] + user_address.name = address1[ 'name' ] + user_address.institution = address1[ 'institution' ] + user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] + user_address.city = address1[ 'city' ] + user_address.state = address1[ 'state' ] + user_address.postal_code = address1[ 'postal_code' ] + user_address.country = address1[ 'country' ] + user_address.phone = address1[ 'phone' ] + user_address.flush() + user_address.user.refresh() + def test_030_create_request( self ): + """Testing creating and submitting a request""" + # first create a library for the request so that it can be submitted later + lib_name = 'TestLib001' + self.create_library( lib_name, '' ) + self.visit_page( 'admin/browse_libraries' ) + self.check_page_for_string( lib_name ) + # Get the library object for later tests + global library_one + library_one = galaxy.model.Library.filter( and_( galaxy.model.Library.table.c.name==lib_name, + galaxy.model.Library.table.c.deleted==False ) ).first() + assert library_one is not None, 'Problem retrieving library named "%s" from the database' % lib_name + global admin_user + admin_user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test(a)bx.psu.edu' ).first() + assert admin_user is not None, 'Problem retrieving user with email "test(a)bx.psu.edu" from the database' + # Get the admin user's private role for later use + global admin_user_private_role + admin_user_private_role = None + for role in admin_user.all_roles(): + if role.name == admin_user.email and role.description == 'Private Role for %s' % admin_user.email: + admin_user_private_role = role + break + if not admin_user_private_role: + raise AssertionError( "Private role not found for user '%s'" % admin_user.email ) + # Set permissions on the library, sort for later testing + permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] + permissions_out = [] + # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted to + # LIBRARY_ADD, LIBRARY_MODIFY, LIBRARY_MANAGE for library items. + self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) + # set field values + fields = ['field one value', 'field two value', str(user_address.id)] + # create the request + request_name, request_desc = 'Request One', 'Request One Description' + self.create_request(request_type.id, request_name, request_desc, library_one.id, fields) + self.check_page_for_string( request_name ) + self.check_page_for_string( request_desc ) + global request_one + request_one = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name, + galaxy.model.Request.table.c.deleted==False ) ).first() + # check if the request's state is now set to 'unsubmitted' + assert request_one.state is not request_one.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.UNSUBMITTED ) + + # sample fields + samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), + ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] + # add samples to this request + self.add_samples( request_one.id, request_one.name, samples ) + for sample_name, fields in samples: + self.check_page_for_string( sample_name ) + self.check_page_for_string( 'Unsubmitted' ) + for field_value in fields: + self.check_page_for_string( field_value ) + # submit the request + self.submit_request( request_one.id, request_one.name ) + request_one.refresh() + # check if the request's state is now set to 'submitted' + assert request_one.state is not request_one.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.SUBMITTED ) + def test_035_request_lifecycle( self ): + """Testing request lifecycle as it goes through all the states""" + # goto admin manage requests page + self.home() + self.visit_page( 'requests_admin/list' ) + self.check_page_for_string( request_one.name ) + self.visit_url( "%s/requests_admin/list?sort=-create_time&operation=show_request&id=%s" \ + % ( self.url, self.security.encode_id( request_one.id ) )) + self.check_page_for_string( 'Sequencing Request "%s"' % request_one.name ) + # set bar codes for the samples + bar_codes = [ '1234567890', '0987654321' ] + self.add_bar_codes( request_one.id, request_one.name, bar_codes ) + self.check_page_for_string( 'Bar codes has been saved for this request' ) + # change the states of all the samples of this request + for sample in request_one.samples: + self.change_sample_state( sample.name, sample.id, request_type.states[1].id ) + self.check_page_for_string( request_type.states[1].name ) + self.check_page_for_string( request_type.states[1].desc ) + self.change_sample_state( sample.name, sample.id, request_type.states[2].id ) + self.check_page_for_string( request_type.states[2].name ) + self.check_page_for_string( request_type.states[2].desc ) + self.home() + request_one.refresh() + # check if the request's state is now set to 'complete' + assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.COMPLETE ) + + + + + + + \ No newline at end of file

1 0

[hg] galaxy 2583: Real Job(tm) upload support
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f6e0863862ef changeset: 2583:f6e0863862ef user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Aug 20 10:49:54 2009 -0400 description: Real Job(tm) upload support 12 file(s) affected in this change: lib/galaxy/jobs/__init__.py lib/galaxy/tools/__init__.py lib/galaxy/tools/actions/upload.py lib/galaxy/tools/parameters/basic.py lib/galaxy/tools/parameters/grouping.py lib/galaxy/util/__init__.py lib/galaxy/web/controllers/tool_runner.py lib/galaxy/web/framework/base.py templates/base_panels.mako test/base/twilltestcase.py tools/data_source/upload.py tools/data_source/upload.xml diffs (1505 lines): diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/jobs/__init__.py Thu Aug 20 10:49:54 2009 -0400 @@ -6,6 +6,8 @@ from galaxy.datatypes.tabular import * from galaxy.datatypes.interval import * from galaxy.datatypes import metadata +from galaxy.util.json import from_json_string +from galaxy.util.expressions import ExpressionContext import pkg_resources pkg_resources.require( "PasteDeploy" ) @@ -18,6 +20,12 @@ # States for running a job. These are NOT the same as data states JOB_WAIT, JOB_ERROR, JOB_INPUT_ERROR, JOB_INPUT_DELETED, JOB_OK, JOB_READY, JOB_DELETED, JOB_ADMIN_DELETED = 'wait', 'error', 'input_error', 'input_deleted', 'ok', 'ready', 'deleted', 'admin_deleted' + +# This file, if created in the job's working directory, will be used for +# setting advanced metadata properties on the job and its associated outputs. +# This interface is currently experimental, is only used by the upload tool, +# and should eventually become API'd +TOOL_PROVIDED_JOB_METADATA_FILE = 'galaxy.json' class JobManager( object ): """ @@ -320,6 +328,7 @@ self.working_directory = \ os.path.join( self.app.config.job_working_directory, str( self.job_id ) ) self.output_paths = None + self.tool_provided_job_metadata = None self.external_output_metadata = metadata.JobExternalOutputMetadataWrapper( job ) #wrapper holding the info required to restore and clean up from files used for setting metadata externally def get_param_dict( self ): @@ -422,6 +431,8 @@ dataset.blurb = 'tool error' dataset.info = message dataset.set_size() + if dataset.ext == 'auto': + dataset.extension = 'data' dataset.flush() job.state = model.Job.states.ERROR job.command_line = self.command_line @@ -486,16 +497,28 @@ except ( IOError, OSError ): self.fail( "Job %s's output dataset(s) could not be read" % job.id ) return + job_context = ExpressionContext( dict( stdout = stdout, stderr = stderr ) ) for dataset_assoc in job.output_datasets: + context = self.get_dataset_finish_context( job_context, dataset_assoc.dataset.dataset ) #should this also be checking library associations? - can a library item be added from a history before the job has ended? - lets not allow this to occur for dataset in dataset_assoc.dataset.dataset.history_associations: #need to update all associated output hdas, i.e. history was shared with job running + if context.get( 'path', None ): + # The tool can set an alternate output path for the dataset. + try: + shutil.move( context['path'], dataset.file_name ) + except ( IOError, OSError ): + if not context['stderr']: + context['stderr'] = 'This dataset could not be processed' dataset.blurb = 'done' dataset.peek = 'no peek' - dataset.info = stdout + stderr + dataset.info = context['stdout'] + context['stderr'] dataset.set_size() - if stderr: + if context['stderr']: dataset.blurb = "error" elif dataset.has_data(): + # If the tool was expected to set the extension, attempt to retrieve it + if dataset.ext == 'auto': + dataset.extension = context.get( 'ext', 'data' ) #if a dataset was copied, it won't appear in our dictionary: #either use the metadata from originating output dataset, or call set_meta on the copies #it would be quicker to just copy the metadata from the originating output dataset, @@ -510,18 +533,39 @@ #the metadata that was stored to disk for use via the external process, #and the changes made by the user will be lost, without warning or notice dataset.metadata.from_JSON_dict( self.external_output_metadata.get_output_filenames_by_dataset( dataset ).filename_out ) - if self.tool.is_multi_byte: - dataset.set_multi_byte_peek() - else: - dataset.set_peek() + try: + assert context.get( 'line_count', None ) is not None + if self.tool.is_multi_byte: + dataset.set_multi_byte_peek( line_count=context['line_count'] ) + else: + dataset.set_peek( line_count=context['line_count'] ) + except: + if self.tool.is_multi_byte: + dataset.set_multi_byte_peek() + else: + dataset.set_peek() + try: + # set the name if provided by the tool + dataset.name = context['name'] + except: + pass else: dataset.blurb = "empty" + if dataset.ext == 'auto': + dataset.extension = 'txt' dataset.flush() - if stderr: + if context['stderr']: dataset_assoc.dataset.dataset.state = model.Dataset.states.ERROR else: dataset_assoc.dataset.dataset.state = model.Dataset.states.OK - dataset_assoc.dataset.dataset.flush() + # If any of the rest of the finish method below raises an + # exception, the fail method will run and set the datasets to + # ERROR. The user will never see that the datasets are in error if + # they were flushed as OK here, since upon doing so, the history + # panel stops checking for updates. So allow the + # mapping.context.current.flush() at the bottom of this method set + # the state instead. + #dataset_assoc.dataset.dataset.flush() # Save stdout and stderr if len( stdout ) > 32768: @@ -591,7 +635,8 @@ return self.output_paths class DatasetPath( object ): - def __init__( self, real_path, false_path = None ): + def __init__( self, dataset_id, real_path, false_path = None ): + self.dataset_id = dataset_id self.real_path = real_path self.false_path = false_path def __str__( self ): @@ -605,10 +650,55 @@ self.output_paths = [] for name, data in [ ( da.name, da.dataset.dataset ) for da in job.output_datasets ]: false_path = os.path.abspath( os.path.join( self.working_directory, "galaxy_dataset_%d.dat" % data.id ) ) - self.output_paths.append( DatasetPath( data.file_name, false_path ) ) + self.output_paths.append( DatasetPath( data.id, data.file_name, false_path ) ) else: - self.output_paths = [ DatasetPath( da.dataset.file_name ) for da in job.output_datasets ] + self.output_paths = [ DatasetPath( da.dataset.dataset.id, da.dataset.file_name ) for da in job.output_datasets ] return self.output_paths + + def get_output_file_id( self, file ): + if self.output_paths is None: + self.get_output_fnames() + for dp in self.output_paths: + if self.app.config.outputs_to_working_directory and os.path.basename( dp.false_path ) == file: + return dp.dataset_id + elif os.path.basename( dp.real_path ) == file: + return dp.dataset_id + return None + + def get_tool_provided_job_metadata( self ): + if self.tool_provided_job_metadata is not None: + return self.tool_provided_job_metadata + + # Look for JSONified job metadata + self.tool_provided_job_metadata = [] + meta_file = os.path.join( self.working_directory, TOOL_PROVIDED_JOB_METADATA_FILE ) + if os.path.exists( meta_file ): + for line in open( meta_file, 'r' ): + try: + line = from_json_string( line ) + assert 'type' in line + except: + log.exception( '(%s) Got JSON data from tool, but data is improperly formatted or no "type" key in data' % self.job_id ) + log.debug( 'Offending data was: %s' % line ) + continue + # Set the dataset id if it's a dataset entry and isn't set. + # This isn't insecure. We loop the job's output datasets in + # the finish method, so if a tool writes out metadata for a + # dataset id that it doesn't own, it'll just be ignored. + if line['type'] == 'dataset' and 'dataset_id' not in line: + try: + line['dataset_id'] = self.get_output_file_id( line['dataset'] ) + except KeyError: + log.warning( '(%s) Tool provided job dataset-specific metadata without specifying a dataset' % self.job_id ) + continue + self.tool_provided_job_metadata.append( line ) + return self.tool_provided_job_metadata + + def get_dataset_finish_context( self, job_context, dataset ): + for meta in self.get_tool_provided_job_metadata(): + if meta['type'] == 'dataset' and meta['dataset_id'] == dataset.id: + return ExpressionContext( meta, job_context ) + return job_context def check_output_sizes( self ): sizes = [] diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Aug 20 10:49:54 2009 -0400 @@ -5,7 +5,7 @@ pkg_resources.require( "simplejson" ) -import logging, os, string, sys, tempfile, glob, shutil +import logging, os, string, sys, tempfile, glob, shutil, types import simplejson import binascii from UserDict import DictMixin @@ -415,6 +415,7 @@ output.metadata_source = data_elem.get("metadata_source", "") output.parent = data_elem.get("parent", None) output.label = util.xml_text( data_elem, "label" ) + output.count = int( data_elem.get("count", 1) ) output.filters = data_elem.findall( 'filter' ) self.outputs[ output.name ] = output # Any extra generated config files for the tool @@ -816,7 +817,11 @@ # If we've completed the last page we can execute the tool elif state.page == self.last_page: out_data = self.execute( trans, incoming=params ) - return 'tool_executed.mako', dict( out_data=out_data ) + try: + assert type( out_data ) is types.DictType + return 'tool_executed.mako', dict( out_data=out_data ) + except: + return 'message.mako', dict( message_type='error', message=out_data, refresh_frames=[] ) # Otherwise move on to the next page else: state.page += 1 @@ -824,15 +829,26 @@ self.fill_in_new_state( trans, self.inputs_by_page[ state.page ], state.inputs ) return 'tool_form.mako', dict( errors=errors, tool_state=state ) else: - if filter( lambda x: isinstance( x, FieldStorage ) and x.file, state.inputs.values() ): + try: + self.find_fieldstorage( state.inputs ) + except InterruptedUpload: # If inputs contain a file it won't persist. Most likely this # is an interrupted upload. We should probably find a more # standard method of determining an incomplete POST. return self.handle_interrupted( trans, state.inputs ) - else: - # Just a refresh, render the form with updated state and errors. - return 'tool_form.mako', dict( errors=errors, tool_state=state ) + except: + pass + # Just a refresh, render the form with updated state and errors. + return 'tool_form.mako', dict( errors=errors, tool_state=state ) + def find_fieldstorage( self, x ): + if isinstance( x, FieldStorage ): + raise InterruptedUpload( None ) + elif type( x ) is types.DictType: + [ self.find_fieldstorage( y ) for y in x.values() ] + elif type( x ) is types.ListType: + [ self.find_fieldstorage( y ) for y in x ] + def handle_interrupted( self, trans, inputs ): """ Upon handling inputs, if it appears that we have received an incomplete @@ -1704,3 +1720,6 @@ return value else: return incoming.get( key, default ) + +class InterruptedUpload( Exception ): + pass diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Aug 20 10:49:54 2009 -0400 @@ -1,8 +1,10 @@ import os, shutil, urllib, StringIO, re, gzip, tempfile, shutil, zipfile +from cgi import FieldStorage from __init__ import ToolAction from galaxy import datatypes, jobs from galaxy.datatypes import sniff from galaxy import model, util +from galaxy.util.json import to_json_string import sys, traceback @@ -11,14 +13,28 @@ class UploadToolAction( ToolAction ): # Action for uploading files - def __init__( self ): - self.empty = False - self.line_count = None - def remove_tempfile( self, filename ): - try: - os.unlink( filename ) - except: - log.exception( 'failure removing temporary file: %s' % filename ) + def persist_uploads( self, incoming ): + if 'files' in incoming: + new_files = [] + temp_files = [] + for upload_dataset in incoming['files']: + f = upload_dataset['file_data'] + if isinstance( f, FieldStorage ): + # very small files can be StringIOs + if 'name' in dir( f.file ) and f.file.name != '<fdopen>': + local_filename = util.mkstemp_ln( f.file.name, 'upload_file_data_' ) + f.file.close() + else: + local_filename = datatypes.sniff.stream_to_file( f.file, prefix="strio_upload_file_" )[0] + upload_dataset['file_data'] = dict( filename = f.filename, + local_filename = local_filename ) + if upload_dataset['url_paste'].strip() != '': + upload_dataset['url_paste'] = datatypes.sniff.stream_to_file( StringIO.StringIO( upload_dataset['url_paste'] ), prefix="strio_url_paste_" )[0] + else: + upload_dataset['url_paste'] = None + new_files.append( upload_dataset ) + incoming['files'] = new_files + return incoming def execute( self, tool, trans, incoming={}, set_output_hid = True ): dataset_upload_inputs = [] for input_name, input in tool.inputs.iteritems(): @@ -42,330 +58,100 @@ log.error( 'Got a precreated dataset (%s) but it does not belong to current user (%s)' % ( data.id, trans.user.id ) ) else: self.precreated_datasets.append( data ) + data_list = [] + + incoming = self.persist_uploads( incoming ) + + json_file = tempfile.mkstemp() + json_file_path = json_file[1] + json_file = os.fdopen( json_file[0], 'w' ) for dataset_upload_input in dataset_upload_inputs: uploaded_datasets = dataset_upload_input.get_uploaded_datasets( trans, incoming ) for uploaded_dataset in uploaded_datasets: - precreated_dataset = self.get_precreated_dataset( uploaded_dataset.precreated_name ) - dataset = self.add_file( trans, uploaded_dataset.primary_file, uploaded_dataset.name, uploaded_dataset.file_type, uploaded_dataset.is_multi_byte, uploaded_dataset.dbkey, space_to_tab = uploaded_dataset.space_to_tab, info = uploaded_dataset.info, precreated_dataset = precreated_dataset, metadata = uploaded_dataset.metadata, uploaded_dataset = uploaded_dataset ) - #dataset state is now set, we should not do anything else to this dataset - data_list.append( dataset ) - #clean up extra temp names - uploaded_dataset.clean_up_temp_files() - + data = self.get_precreated_dataset( uploaded_dataset.name ) + if not data: + data = trans.app.model.HistoryDatasetAssociation( history = trans.history, create_dataset = True ) + data.name = uploaded_dataset.name + data.state = data.states.QUEUED + data.extension = uploaded_dataset.file_type + data.dbkey = uploaded_dataset.dbkey + data.flush() + trans.history.add_dataset( data, genome_build = uploaded_dataset.dbkey ) + permissions = trans.app.security_agent.history_get_default_permissions( trans.history ) + trans.app.security_agent.set_all_dataset_permissions( data.dataset, permissions ) + else: + data.extension = uploaded_dataset.file_type + data.dbkey = uploaded_dataset.dbkey + data.flush() + trans.history.genome_build = uploaded_dataset.dbkey + if uploaded_dataset.type == 'composite': + # we need to init metadata before the job is dispatched + data.init_meta() + for meta_name, meta_value in uploaded_dataset.metadata.iteritems(): + setattr( data.metadata, meta_name, meta_value ) + data.flush() + json = dict( file_type = uploaded_dataset.file_type, + dataset_id = data.dataset.id, + dbkey = uploaded_dataset.dbkey, + type = uploaded_dataset.type, + metadata = uploaded_dataset.metadata, + primary_file = uploaded_dataset.primary_file, + extra_files_path = data.extra_files_path, + composite_file_paths = uploaded_dataset.composite_files, + composite_files = dict( [ ( k, v.__dict__ ) for k, v in data.datatype.get_composite_files( data ).items() ] ) ) + else: + try: + is_binary = uploaded_dataset.datatype.is_binary + except: + is_binary = None + json = dict( file_type = uploaded_dataset.file_type, + name = uploaded_dataset.name, + dataset_id = data.dataset.id, + dbkey = uploaded_dataset.dbkey, + type = uploaded_dataset.type, + is_binary = is_binary, + space_to_tab = uploaded_dataset.space_to_tab, + path = uploaded_dataset.path ) + json_file.write( to_json_string( json ) + '\n' ) + data_list.append( data ) + json_file.close() + #cleanup unclaimed precreated datasets: for data in self.precreated_datasets: log.info( 'Cleaned up unclaimed precreated dataset (%s).' % ( data.id ) ) data.state = data.states.ERROR data.info = 'No file contents were available.' - if data_list: - trans.app.model.flush() + if not data_list: + try: + os.remove( json_file_path ) + except: + pass + return 'No data was entered in the upload form, please go back and choose data to upload.' # Create the job object job = trans.app.model.Job() job.session_id = trans.get_galaxy_session().id job.history_id = trans.history.id job.tool_id = tool.id - try: - # For backward compatibility, some tools may not have versions yet. - job.tool_version = tool.version - except: - job.tool_version = "1.0.1" + job.tool_version = tool.version job.state = trans.app.model.Job.states.UPLOAD job.flush() log.info( 'tool %s created job id %d' % ( tool.id, job.id ) ) trans.log_event( 'created job id %d' % job.id, tool_id=tool.id ) + + for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): + job.add_parameter( name, value ) + job.add_parameter( 'paramfile', to_json_string( json_file_path ) ) + for i, dataset in enumerate( data_list ): + job.add_output_dataset( i, dataset ) + trans.app.model.flush() - #if we could make a 'real' job here, then metadata could be set before job.finish() is called - hda = data_list[0] #only our first hda is being added as output for the job, why? - job.state = trans.app.model.Job.states.OK - file_size_str = datatypes.data.nice_size( hda.dataset.file_size ) - job.info = "%s, size: %s" % ( hda.info, file_size_str ) - job.add_output_dataset( hda.name, hda ) - job.flush() - log.info( 'job id %d ended ok, file size: %s' % ( job.id, file_size_str ) ) - trans.log_event( 'job id %d ended ok, file size: %s' % ( job.id, file_size_str ), tool_id=tool.id ) - return dict( output=hda ) - - def upload_empty(self, trans, job, err_code, err_msg, precreated_dataset = None): - if precreated_dataset is not None: - data = precreated_dataset - else: - data = trans.app.model.HistoryDatasetAssociation( create_dataset=True ) - trans.app.security_agent.set_all_dataset_permissions( data.dataset, trans.app.security_agent.history_get_default_permissions( trans.history ) ) - data.name = err_code - data.extension = "txt" - data.dbkey = "?" - data.info = err_msg - data.file_size = 0 - data.state = data.states.EMPTY - data.flush() - if precreated_dataset is None: - trans.history.add_dataset( data ) - trans.app.model.flush() - # Indicate job failure by setting state and info - job.state = trans.app.model.Job.states.ERROR - job.info = err_msg - job.add_output_dataset( data.name, data ) - job.flush() - log.info( 'job id %d ended with errors, err_msg: %s' % ( job.id, err_msg ) ) - trans.log_event( 'job id %d ended with errors, err_msg: %s' % ( job.id, err_msg ), tool_id=job.tool_id ) - return dict( output=data ) - - def add_file( self, trans, temp_name, file_name, file_type, is_multi_byte, dbkey, info=None, space_to_tab=False, precreated_dataset=None, metadata = {}, uploaded_dataset = None ): - def dataset_no_data_error( data, message = 'there was an error uploading your file' ): - data.info = "No data: %s." % message - data.state = data.states.ERROR - if data.extension is None: - data.extension = 'data' - return data - data_type = None - - if precreated_dataset is not None: - data = precreated_dataset - else: - data = trans.app.model.HistoryDatasetAssociation( history = trans.history, create_dataset = True ) - trans.app.security_agent.set_all_dataset_permissions( data.dataset, trans.app.security_agent.history_get_default_permissions( trans.history ) ) - - # See if we have an empty file - if not os.path.getsize( temp_name ) > 0: - return dataset_no_data_error( data, message = 'you attempted to upload an empty file' ) - #raise BadFileException( "you attempted to upload an empty file." ) - if is_multi_byte: - ext = sniff.guess_ext( temp_name, is_multi_byte=True ) - else: - if not data_type: #at this point data_type is always None (just initialized above), so this is always True...lots of cleanup needed here - # See if we have a gzipped file, which, if it passes our restrictions, - # we'll decompress on the fly. - is_gzipped, is_valid = self.check_gzip( temp_name ) - if is_gzipped and not is_valid: - return dataset_no_data_error( data, message = 'you attempted to upload an inappropriate file' ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - elif is_gzipped and is_valid: - # We need to uncompress the temp_name file - CHUNK_SIZE = 2**20 # 1Mb - fd, uncompressed = tempfile.mkstemp() - gzipped_file = gzip.GzipFile( temp_name ) - while 1: - try: - chunk = gzipped_file.read( CHUNK_SIZE ) - except IOError: - os.close( fd ) - os.remove( uncompressed ) - return dataset_no_data_error( data, message = 'problem decompressing gzipped data' ) - #raise BadFileException( 'problem decompressing gzipped data.' ) - if not chunk: - break - os.write( fd, chunk ) - os.close( fd ) - gzipped_file.close() - # Replace the gzipped file with the decompressed file - shutil.move( uncompressed, temp_name ) - file_name = file_name.rstrip( '.gz' ) - data_type = 'gzip' - ext = '' - if not data_type: - # See if we have a zip archive - is_zipped, is_valid, test_ext = self.check_zip( temp_name ) - if is_zipped and not is_valid: - return dataset_no_data_error( data, message = 'you attempted to upload an inappropriate file' ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - elif is_zipped and is_valid: - # Currently, we force specific tools to handle this case. We also require the user - # to manually set the incoming file_type - if ( test_ext == 'ab1' or test_ext == 'scf' ) and file_type != 'binseq.zip': - return dataset_no_data_error( data, message = "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'" ) - #raise BadFileException( "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'." ) - elif test_ext == 'txt' and file_type != 'txtseq.zip': - return dataset_no_data_error( data, message = "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'" ) - #raise BadFileException( "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'." ) - if not ( file_type == 'binseq.zip' or file_type == 'txtseq.zip' ): - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files" ) - #raise BadFileException( "you must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files." ) - data_type = 'zip' - ext = file_type - if not data_type: - if self.check_binary( temp_name ): - if uploaded_dataset and uploaded_dataset.datatype and uploaded_dataset.datatype.is_binary: - #we need a more generalized way of checking if a binary upload is of the right format for a datatype...magic number, etc - data_type = 'binary' - ext = uploaded_dataset.file_type - else: - parts = file_name.split( "." ) - if len( parts ) > 1: - ext = parts[1].strip().lower() - if not( ext == 'ab1' or ext == 'scf' ): - return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - if ext == 'ab1' and file_type != 'ab1': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) - elif ext == 'scf' and file_type != 'scf': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Scf' when uploading scf files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) - data_type = 'binary' - if not data_type: - # We must have a text file - if trans.app.datatypes_registry.get_datatype_by_extension( file_type ).composite_type != 'auto_primary_file' and self.check_html( temp_name ): - return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - #if data_type != 'binary' and data_type != 'zip' and not trans.app.datatypes_registry.get_datatype_by_extension( ext ).is_binary: - if data_type != 'binary' and data_type != 'zip': - if space_to_tab: - self.line_count = sniff.convert_newlines_sep2tabs( temp_name ) - else: - self.line_count = sniff.convert_newlines( temp_name ) - if file_type == 'auto': - ext = sniff.guess_ext( temp_name, sniff_order=trans.app.datatypes_registry.sniff_order ) - else: - ext = file_type - data_type = ext - if info is None: - info = 'uploaded %s file' %data_type - data.extension = ext - data.name = file_name - data.dbkey = dbkey - data.info = info - data.flush() - shutil.move( temp_name, data.file_name ) - dataset_state = data.states.OK #don't set actual state here, only set to OK when finished setting attributes of the dataset - data.set_size() - data.init_meta() - #need to set metadata, has to be done after extention is set - for meta_name, meta_value in metadata.iteritems(): - setattr( data.metadata, meta_name, meta_value ) - if self.line_count is not None: - try: - if is_multi_byte: - data.set_multi_byte_peek( line_count=self.line_count ) - else: - data.set_peek( line_count=self.line_count ) - except: - if is_multi_byte: - data.set_multi_byte_peek() - else: - data.set_peek() - else: - if is_multi_byte: - data.set_multi_byte_peek() - else: - data.set_peek() - - # validate incomming data - # Commented by greg on 3/14/07 - # for error in data.datatype.validate( data ): - # data.add_validation_error( - # model.ValidationError( message=str( error ), err_type=error.__class__.__name__, attributes=util.object_to_string( error.__dict__ ) ) ) - if data.missing_meta(): - data.datatype.set_meta( data ) - dbkey_to_store = dbkey - if type( dbkey_to_store ) == type( [] ): - dbkey_to_store = dbkey[0] - if precreated_dataset is not None: - trans.history.genome_build = dbkey_to_store - else: - trans.history.add_dataset( data, genome_build=dbkey_to_store ) - #set up composite files - if uploaded_dataset is not None: - composite_files = data.datatype.get_composite_files( data ) - if composite_files: - os.mkdir( data.extra_files_path ) #make extra files path - for name, value in composite_files.iteritems(): - if uploaded_dataset.composite_files[ value.name ] is None and not value.optional: - data.info = "A required composite data file was not provided (%s)" % name - dataset_state = data.states.ERROR - break - elif uploaded_dataset.composite_files[ value.name] is not None: - if not value.is_binary: - if uploaded_dataset.composite_files[ value.name ].space_to_tab: - sniff.convert_newlines_sep2tabs( uploaded_dataset.composite_files[ value.name ].filename ) - else: - sniff.convert_newlines( uploaded_dataset.composite_files[ value.name ].filename ) - shutil.move( uploaded_dataset.composite_files[ value.name ].filename, os.path.join( data.extra_files_path, name ) ) - if data.datatype.composite_type == 'auto_primary_file': - #now that metadata was set above, we should create the primary file as required - open( data.file_name, 'wb+' ).write( data.datatype.generate_primary_file( dataset = data ) ) - data.state = dataset_state #Always set dataset state LAST - trans.app.model.flush() - trans.log_event( "Added dataset %d to history %d" %( data.id, trans.history.id ), tool_id="upload" ) - return data - - def check_gzip( self, temp_name ): - temp = open( temp_name, "U" ) - magic_check = temp.read( 2 ) - temp.close() - if magic_check != util.gzip_magic: - return ( False, False ) - CHUNK_SIZE = 2**15 # 32Kb - gzipped_file = gzip.GzipFile( temp_name ) - chunk = gzipped_file.read( CHUNK_SIZE ) - gzipped_file.close() - if self.check_html( temp_name, chunk=chunk ) or self.check_binary( temp_name, chunk=chunk ): - return( True, False ) - return ( True, True ) - - def check_zip( self, temp_name ): - if not zipfile.is_zipfile( temp_name ): - return ( False, False, None ) - zip_file = zipfile.ZipFile( temp_name, "r" ) - # Make sure the archive consists of valid files. The current rules are: - # 1. Archives can only include .ab1, .scf or .txt files - # 2. All file extensions within an archive must be the same - name = zip_file.namelist()[0] - test_ext = name.split( "." )[1].strip().lower() - if not ( test_ext == 'scf' or test_ext == 'ab1' or test_ext == 'txt' ): - return ( True, False, test_ext ) - for name in zip_file.namelist(): - ext = name.split( "." )[1].strip().lower() - if ext != test_ext: - return ( True, False, test_ext ) - return ( True, True, test_ext ) - - def check_html( self, temp_name, chunk=None ): - if chunk is None: - temp = open(temp_name, "U") - else: - temp = chunk - regexp1 = re.compile( "<A\s+[^>]*HREF[^>]+>", re.I ) - regexp2 = re.compile( "<IFRAME[^>]*>", re.I ) - regexp3 = re.compile( "<FRAMESET[^>]*>", re.I ) - regexp4 = re.compile( "<META[^>]*>", re.I ) - lineno = 0 - for line in temp: - lineno += 1 - matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) - if matches: - if chunk is None: - temp.close() - return True - if lineno > 100: - break - if chunk is None: - temp.close() - return False - def check_binary( self, temp_name, chunk=None ): - if chunk is None: - temp = open( temp_name, "U" ) - else: - temp = chunk - lineno = 0 - for line in temp: - lineno += 1 - line = line.strip() - if line: - if util.is_multi_byte( line ): - return False - for char in line: - if ord( char ) > 128: - if chunk is None: - temp.close() - return True - if lineno > 10: - break - if chunk is None: - temp.close() - return False + # Queue the job for execution + trans.app.job_queue.put( job.id, tool ) + trans.log_event( "Added job to the job queue, id: %s" % str(job.id), tool_id=job.tool_id ) + return dict( [ ( i, v ) for i, v in enumerate( data_list ) ] ) def get_precreated_dataset( self, name ): """ @@ -378,7 +164,3 @@ return self.precreated_datasets.pop( names.index( name ) ) else: return None - -class BadFileException( Exception ): - pass - diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/tools/parameters/basic.py --- a/lib/galaxy/tools/parameters/basic.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/tools/parameters/basic.py Thu Aug 20 10:49:54 2009 -0400 @@ -304,21 +304,22 @@ def get_html_field( self, trans=None, value=None, other_values={} ): return form_builder.FileField( self.name, ajax = self.ajax, value = value ) def from_html( self, value, trans=None, other_values={} ): + # TODO: Fix nginx upload module support # Middleware or proxies may encode files in special ways (TODO: this # should be pluggable) - if type( value ) == dict: - upload_location = self.tool.app.config.nginx_upload_location - assert upload_location, \ - "Request appears to have been processed by nginx_upload_module \ - but Galaxy is not configured to recgonize it" - # Check that the file is in the right location - local_filename = os.path.abspath( value['path'] ) - assert local_filename.startswith( upload_location ), \ - "Filename provided by nginx is not in correct directory" - value = Bunch( - filename = value["name"], - local_filename = local_filename - ) + #if type( value ) == dict: + # upload_location = self.tool.app.config.nginx_upload_location + # assert upload_location, \ + # "Request appears to have been processed by nginx_upload_module \ + # but Galaxy is not configured to recgonize it" + # # Check that the file is in the right location + # local_filename = os.path.abspath( value['path'] ) + # assert local_filename.startswith( upload_location ), \ + # "Filename provided by nginx is not in correct directory" + # value = Bunch( + # filename = value["name"], + # local_filename = local_filename + # ) return value def get_required_enctype( self ): """ @@ -330,10 +331,18 @@ return None elif isinstance( value, unicode ) or isinstance( value, str ): return value + elif isinstance( value, dict ): + # or should we jsonify? + try: + return value['local_filename'] + except: + return None raise Exception( "FileToolParameter cannot be persisted" ) def to_python( self, value, app ): if value is None: return None + elif isinstance( value, unicode ) or isinstance( value, str ): + return value else: raise Exception( "FileToolParameter cannot be persisted" ) def get_initial_value( self, trans, context ): diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/tools/parameters/grouping.py --- a/lib/galaxy/tools/parameters/grouping.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/tools/parameters/grouping.py Thu Aug 20 10:49:54 2009 -0400 @@ -12,6 +12,7 @@ from galaxy.datatypes import sniff from galaxy.util.bunch import Bunch from galaxy.util.odict import odict +from galaxy.util import json class Group( object ): def __init__( self ): @@ -167,33 +168,30 @@ rval.append( rval_dict ) return rval def get_uploaded_datasets( self, trans, context, override_name = None, override_info = None ): - def get_data_file_filename( data_file, is_multi_byte = False, override_name = None, override_info = None ): + def get_data_file_filename( data_file, override_name = None, override_info = None ): dataset_name = override_name dataset_info = override_info def get_file_name( file_name ): file_name = file_name.split( '\\' )[-1] file_name = file_name.split( '/' )[-1] return file_name - if 'local_filename' in dir( data_file ): + try: # Use the existing file - return data_file.local_filename, get_file_name( data_file.filename ), is_multi_byte - elif 'filename' in dir( data_file ): - #create a new tempfile - try: - temp_name, is_multi_byte = sniff.stream_to_file( data_file.file, prefix='upload' ) - precreated_name = get_file_name( data_file.filename ) - if not dataset_name: - dataset_name = precreated_name - if not dataset_info: - dataset_info = 'uploaded file' - return temp_name, get_file_name( data_file.filename ), is_multi_byte, dataset_name, dataset_info - except Exception, e: - log.exception( 'exception in sniff.stream_to_file using file %s: %s' % ( data_file.filename, str( e ) ) ) - self.remove_temp_file( temp_name ) - return None, None, is_multi_byte, None, None - def filenames_from_url_paste( url_paste, group_incoming, override_name = None, override_info = None ): + if not dataset_name and 'filename' in data_file: + dataset_name = get_file_name( data_file['filename'] ) + if not dataset_info: + dataset_info = 'uploaded file' + return Bunch( type='file', path=data_file['local_filename'], name=get_file_name( data_file['filename'] ) ) + #return 'file', data_file['local_filename'], get_file_name( data_file.filename ), dataset_name, dataset_info + except: + # The uploaded file should've been persisted by the upload tool action + return Bunch( type=None, path=None, name=None ) + #return None, None, None, None, None + def get_url_paste_urls_or_filename( group_incoming, override_name = None, override_info = None ): filenames = [] - if url_paste not in [ None, "" ]: + url_paste_file = group_incoming.get( 'url_paste', None ) + if url_paste_file is not None: + url_paste = open( url_paste_file, 'r' ).read( 1024 ) if url_paste.lstrip().lower().startswith( 'http://' ) or url_paste.lstrip().lower().startswith( 'ftp://' ): url_paste = url_paste.replace( '\r', '' ).split( '\n' ) for line in url_paste: @@ -208,114 +206,54 @@ dataset_info = override_info if not dataset_info: dataset_info = 'uploaded url' - try: - temp_name, is_multi_byte = sniff.stream_to_file( urllib.urlopen( line ), prefix='url_paste' ) - except Exception, e: - temp_name = None - precreated_name = str( e ) - log.exception( 'exception in sniff.stream_to_file using url_paste %s: %s' % ( url_paste, str( e ) ) ) - try: - self.remove_temp_file( temp_name ) - except: - pass - yield ( temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info ) - #yield ( None, str( e ), False, dataset_name, dataset_info ) + yield Bunch( type='url', path=line, name=precreated_name ) + #yield ( 'url', line, precreated_name, dataset_name, dataset_info ) else: dataset_name = dataset_info = precreated_name = 'Pasted Entry' #we need to differentiate between various url pastes here if override_name: dataset_name = override_name if override_info: dataset_info = override_info - is_valid = False - for line in url_paste: #Trim off empty lines from begining - line = line.rstrip( '\r\n' ) - if line: - is_valid = True - break - if is_valid: - try: - temp_name, is_multi_byte = sniff.stream_to_file( StringIO.StringIO( url_paste ), prefix='strio_url_paste' ) - except Exception, e: - log.exception( 'exception in sniff.stream_to_file using StringIO.StringIO( url_paste ) %s: %s' % ( url_paste, str( e ) ) ) - temp_name = None - precreated_name = str( e ) - try: - self.remove_temp_file( temp_name ) - except: - pass - yield ( temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info ) - #yield ( None, str( e ), False, dataset_name, dataset_info ) - + yield Bunch( type='file', path=url_paste_file, name=precreated_name ) + #yield ( 'file', url_paste_file, precreated_name, dataset_name, dataset_info ) def get_one_filename( context ): data_file = context['file_data'] url_paste = context['url_paste'] name = context.get( 'NAME', None ) info = context.get( 'INFO', None ) warnings = [] - is_multi_byte = False space_to_tab = False if context.get( 'space_to_tab', None ) not in ["None", None]: space_to_tab = True - temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info = get_data_file_filename( data_file, is_multi_byte = is_multi_byte, override_name = name, override_info = info ) - if temp_name: + file_bunch = get_data_file_filename( data_file, override_name = name, override_info = info ) + if file_bunch.path: if url_paste.strip(): warnings.append( "All file contents specified in the paste box were ignored." ) else: #we need to use url_paste - #file_names = filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ) - for temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info in filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ):#file_names: - if temp_name: + for file_bunch in get_url_paste_urls_or_filename( context, override_name = name, override_info = info ): + if file_bunch.path: break - ###this check will cause an additional file to be retrieved and created...so lets not do that - #try: #check to see if additional paste contents were available - # file_names.next() - # warnings.append( "Additional file contents were specified in the paste box, but ignored." ) - #except StopIteration: - # pass - return temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings - + return file_bunch, warnings def get_filenames( context ): rval = [] data_file = context['file_data'] url_paste = context['url_paste'] name = context.get( 'NAME', None ) info = context.get( 'INFO', None ) - warnings = [] - is_multi_byte = False space_to_tab = False if context.get( 'space_to_tab', None ) not in ["None", None]: space_to_tab = True - temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info = get_data_file_filename( data_file, is_multi_byte = is_multi_byte, override_name = name, override_info = info ) - if temp_name: - rval.append( ( temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info ) ) - for temp_name, precreated_name, is_multi_byte, dataset_name, dataset_info in filenames_from_url_paste( url_paste, context, override_name = name, override_info = info ): - if temp_name: - rval.append( ( temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info ) ) + warnings = [] + file_bunch = get_data_file_filename( data_file, override_name = name, override_info = info ) + if file_bunch.path: + file_bunch.space_to_tab = space_to_tab + rval.append( file_bunch ) + #rval.append( ( type, temp_name, precreated_name, space_to_tab, dataset_name, dataset_info ) ) + for file_bunch in get_url_paste_urls_or_filename( context, override_name = name, override_info = info ): + if file_bunch.path: + file_bunch.space_to_tab = space_to_tab + rval.append( file_bunch ) return rval - class UploadedDataset( Bunch ): - def __init__( self, **kwd ): - Bunch.__init__( self, **kwd ) - self.primary_file = None - self.composite_files = odict() - self.dbkey = None - self.warnings = [] - self.metadata = {} - - self._temp_filenames = [] #store all created filenames here, delete on cleanup - def register_temp_file( self, filename ): - if isinstance( filename, list ): - self._temp_filenames.extend( filename ) - else: - self._temp_filenames.append( filename ) - def remove_temp_file( self, filename ): - try: - os.unlink( filename ) - except Exception, e: - pass - #log.warning( str( e ) ) - def clean_up_temp_files( self ): - for filename in self._temp_filenames: - self.remove_temp_file( filename ) - file_type = self.get_file_type( context ) d_type = self.get_datatype( trans, context ) dbkey = context.get( 'dbkey', None ) @@ -325,51 +263,50 @@ for group_incoming in context.get( self.name, [] ): i = int( group_incoming['__index__'] ) groups_incoming[ i ] = group_incoming - if d_type.composite_type is not None: #handle uploading of composite datatypes #Only one Dataset can be created + ''' dataset = UploadedDataset() + dataset.datatype = d_type + ''' + dataset = Bunch() + dataset.type = 'composite' dataset.file_type = file_type + dataset.dbkey = dbkey dataset.datatype = d_type - dataset.dbkey = dbkey + dataset.warnings = [] + dataset.metadata = {} + dataset.composite_files = {} #load metadata files_metadata = context.get( self.metadata_ref, {} ) - for meta_name, meta_spec in d_type.metadata_spec.iteritems(): + for meta_name, meta_spec in d_type.metadata_spec.iteritems(): if meta_spec.set_in_upload: if meta_name in files_metadata: dataset.metadata[ meta_name ] = files_metadata[ meta_name ] - - temp_name = None - precreated_name = None - is_multi_byte = False - space_to_tab = False - warnings = [] dataset_name = None dataset_info = None if dataset.datatype.composite_type == 'auto_primary_file': #replace sniff here with just creating an empty file temp_name, is_multi_byte = sniff.stream_to_file( StringIO.StringIO( d_type.generate_primary_file() ), prefix='upload_auto_primary_file' ) - precreated_name = dataset_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) + dataset.primary_file = temp_name + dataset.space_to_tab = False + dataset.precreated_name = dataset.name = 'Uploaded Composite Dataset (%s)' % ( file_type ) else: - temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings = get_one_filename( groups_incoming[ 0 ] ) + file_bunch, warnings = get_one_filename( groups_incoming[ 0 ] ) if dataset.datatype.composite_type: precreated_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) writable_files_offset = 1 - if temp_name is None:#remove this before finish, this should create an empty dataset + dataset.primary_file = file_bunch.path + dataset.space_to_tab = file_bunch.space_to_tab + dataset.precreated_name = file_bunch.precreated_name + dataset.name = file_bunch.precreated_name + dataset.warnings.extend( file_bunch.warnings ) + if dataset.primary_file is None:#remove this before finish, this should create an empty dataset raise Exception( 'No primary dataset file was available for composite upload' ) - dataset.primary_file = temp_name - dataset.is_multi_byte = is_multi_byte - dataset.space_to_tab = space_to_tab - dataset.precreated_name = precreated_name - dataset.name = dataset_name - dataset.info = dataset_info - dataset.warnings.extend( warnings ) - dataset.register_temp_file( temp_name ) - keys = [ value.name for value in writable_files.values() ] for i, group_incoming in enumerate( groups_incoming[ writable_files_offset : ] ): key = keys[ i + writable_files_offset ] @@ -377,37 +314,22 @@ dataset.warnings.append( "A required composite file (%s) was not specified." % ( key ) ) dataset.composite_files[ key ] = None else: - temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings = get_one_filename( group_incoming ) - if temp_name: - dataset.composite_files[ key ] = Bunch( filename = temp_name, precreated_name = precreated_name, is_multi_byte = is_multi_byte, space_to_tab = space_to_tab, warnings = warnings, info = dataset_info, name = dataset_name ) - dataset.register_temp_file( temp_name ) + file_bunch, warnings = get_one_filename( group_incoming ) + if file_bunch.path: + dataset.composite_files[ key ] = file_bunch.__dict__ else: dataset.composite_files[ key ] = None if not writable_files[ writable_files.keys()[ keys.index( key ) ] ].optional: dataset.warnings.append( "A required composite file (%s) was not specified." % ( key ) ) return [ dataset ] else: + datasets = get_filenames( context[ self.name ][0] ) rval = [] - for temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, in get_filenames( context[ self.name ][0] ): - dataset = UploadedDataset() + for dataset in datasets: dataset.file_type = file_type - dataset.datatype = d_type dataset.dbkey = dbkey - dataset.primary_file = temp_name - dataset.is_multi_byte = is_multi_byte - dataset.space_to_tab = space_to_tab - dataset.name = dataset_name - dataset.info = dataset_info - dataset.precreated_name = precreated_name - dataset.register_temp_file( temp_name ) rval.append( dataset ) - return rval - def remove_temp_file( self, filename ): - try: - os.unlink( filename ) - except Exception, e: - log.warning( str( e ) ) - + return rval class Conditional( Group ): type = "conditional" diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/util/__init__.py --- a/lib/galaxy/util/__init__.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/util/__init__.py Thu Aug 20 10:49:54 2009 -0400 @@ -3,7 +3,7 @@ """ import logging -import threading, random, string, re, binascii, pickle, time, datetime, math, re, os, sys +import threading, random, string, re, binascii, pickle, time, datetime, math, re, os, sys, tempfile # Older py compatibility try: @@ -454,6 +454,26 @@ out_dict[ str( key ) ] = value return out_dict +def mkstemp_ln( src, prefix='mkstemp_ln_' ): + """ + From tempfile._mkstemp_inner, generate a hard link in the same dir with a + random name. Created so we can persist the underlying file of a + NamedTemporaryFile upon its closure. + """ + dir = os.path.dirname(src) + names = tempfile._get_candidate_names() + for seq in xrange(tempfile.TMP_MAX): + name = names.next() + file = os.path.join(dir, prefix + name) + try: + linked_path = os.link( src, file ) + return (os.path.abspath(file)) + except OSError, e: + if e.errno == errno.EEXIST: + continue # try again + raise + raise IOError, (errno.EEXIST, "No usable temporary file name found") + galaxy_root_path = os.path.join(__path__[0], "..","..","..") dbnames = read_dbnames( os.path.join( galaxy_root_path, "tool-data", "shared", "ucsc", "builds.txt" ) ) #this list is used in edit attributes and the upload tool ucsc_build_sites = read_build_sites( os.path.join( galaxy_root_path, "tool-data", "shared", "ucsc", "ucsc_build_sites.txt" ) ) #this list is used in history.tmpl diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/web/controllers/tool_runner.py --- a/lib/galaxy/web/controllers/tool_runner.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/web/controllers/tool_runner.py Thu Aug 20 10:49:54 2009 -0400 @@ -136,6 +136,7 @@ """ Precreate datasets for asynchronous uploading. """ + permissions = trans.app.security_agent.history_get_default_permissions( trans.history ) def create_dataset( name, history ): data = trans.app.model.HistoryDatasetAssociation( create_dataset = True ) data.name = name @@ -143,6 +144,7 @@ data.history = history data.flush() history.add_dataset( data ) + trans.app.security_agent.set_all_dataset_permissions( data.dataset, permissions ) return data tool = self.get_toolbox().tools_by_id.get( tool_id, None ) if not tool: diff -r 5fa8803716fd -r f6e0863862ef lib/galaxy/web/framework/base.py --- a/lib/galaxy/web/framework/base.py Wed Aug 19 18:07:55 2009 -0400 +++ b/lib/galaxy/web/framework/base.py Thu Aug 20 10:49:54 2009 -0400 @@ -212,6 +212,17 @@ else: return None +# For request.params, override cgi.FieldStorage.make_file to create persistent +# tempfiles. Necessary for externalizing the upload tool. It's a little hacky +# but for performance reasons it's way better to use Paste's tempfile than to +# create a new one and copy. +import cgi +class FieldStorage( cgi.FieldStorage ): + def make_file(self, binary=None): + import tempfile + return tempfile.NamedTemporaryFile() +cgi.FieldStorage = FieldStorage + class Request( webob.Request ): """ Encapsulates an HTTP request. diff -r 5fa8803716fd -r f6e0863862ef templates/base_panels.mako --- a/templates/base_panels.mako Wed Aug 19 18:07:55 2009 -0400 +++ b/templates/base_panels.mako Thu Aug 20 10:49:54 2009 -0400 @@ -72,9 +72,6 @@ <script type="text/javascript"> jQuery( function() { $("iframe#galaxy_main").load( function() { - ##$(this.contentDocument).find("input[galaxy-ajax-upload]").each( function() { - ##$("iframe")[0].contentDocument.body.innerHTML = "HELLO" - ##$(this.contentWindow.document).find("input[galaxy-ajax-upload]").each( function() { $(this).contents().find("form").each( function() { if ( $(this).find("input[galaxy-ajax-upload]").length > 0 ){ $(this).submit( function() { diff -r 5fa8803716fd -r f6e0863862ef test/base/twilltestcase.py --- a/test/base/twilltestcase.py Wed Aug 19 18:07:55 2009 -0400 +++ b/test/base/twilltestcase.py Thu Aug 20 10:49:54 2009 -0400 @@ -93,6 +93,8 @@ valid_hid = int( hid ) except: raise AssertionError, "Invalid hid (%s) created when uploading file %s" % ( hid, filename ) + # Wait for upload processing to finish (TODO: this should be done in each test case instead) + self.wait() def upload_url_paste( self, url_paste, ftype='auto', dbkey='unspecified (?)' ): """Pasted data in the upload utility""" self.visit_page( "tool_runner/index?tool_id=upload1" ) @@ -112,6 +114,8 @@ valid_hid = int( hid ) except: raise AssertionError, "Invalid hid (%s) created when pasting %s" % ( hid, url_paste ) + # Wait for upload processing to finish (TODO: this should be done in each test case instead) + self.wait() # Functions associated with histories def check_history_for_errors( self ): diff -r 5fa8803716fd -r f6e0863862ef tools/data_source/upload.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/data_source/upload.py Thu Aug 20 10:49:54 2009 -0400 @@ -0,0 +1,280 @@ +#!/usr/bin/env python +#Processes uploads from the user. + +# WARNING: Changes in this tool (particularly as related to parsing) may need +# to be reflected in galaxy.web.controllers.tool_runner and galaxy.tools + +import urllib, sys, os, gzip, tempfile, shutil, re, gzip, zipfile +from galaxy import eggs +# need to import model before sniff to resolve a circular import dependency +import galaxy.model +from galaxy.datatypes import sniff +from galaxy import util +from galaxy.util.json import * + +assert sys.version_info[:2] >= ( 2, 4 ) + +def stop_err( msg, ret=1 ): + sys.stderr.write( msg ) + sys.exit( ret ) + +def file_err( msg, dataset, json_file ): + json_file.write( to_json_string( dict( type = 'dataset', + ext = 'data', + dataset_id = dataset.dataset_id, + stderr = msg ) ) + "\n" ) + try: + os.remove( dataset.path ) + except: + pass + +def safe_dict(d): + """ + Recursively clone json structure with UTF-8 dictionary keys + http://mellowmachines.com/blog/2009/06/exploding-dictionary-with-unicode-ke… + """ + if isinstance(d, dict): + return dict([(k.encode('utf-8'), safe_dict(v)) for k,v in d.iteritems()]) + elif isinstance(d, list): + return [safe_dict(x) for x in d] + else: + return d + +def check_html( temp_name, chunk=None ): + if chunk is None: + temp = open(temp_name, "U") + else: + temp = chunk + regexp1 = re.compile( "<A\s+[^>]*HREF[^>]+>", re.I ) + regexp2 = re.compile( "<IFRAME[^>]*>", re.I ) + regexp3 = re.compile( "<FRAMESET[^>]*>", re.I ) + regexp4 = re.compile( "<META[^>]*>", re.I ) + lineno = 0 + for line in temp: + lineno += 1 + matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) + if matches: + if chunk is None: + temp.close() + return True + if lineno > 100: + break + if chunk is None: + temp.close() + return False + +def check_binary( temp_name, chunk=None ): + if chunk is None: + temp = open( temp_name, "U" ) + else: + temp = chunk + lineno = 0 + for line in temp: + lineno += 1 + line = line.strip() + if line: + for char in line: + if ord( char ) > 128: + if chunk is None: + temp.close() + return True + if lineno > 10: + break + if chunk is None: + temp.close() + return False + +def check_gzip( temp_name ): + temp = open( temp_name, "U" ) + magic_check = temp.read( 2 ) + temp.close() + if magic_check != util.gzip_magic: + return ( False, False ) + CHUNK_SIZE = 2**15 # 32Kb + gzipped_file = gzip.GzipFile( temp_name ) + chunk = gzipped_file.read( CHUNK_SIZE ) + gzipped_file.close() + if check_html( temp_name, chunk=chunk ) or check_binary( temp_name, chunk=chunk ): + return( True, False ) + return ( True, True ) + +def check_zip( temp_name ): + if not zipfile.is_zipfile( temp_name ): + return ( False, False, None ) + zip_file = zipfile.ZipFile( temp_name, "r" ) + # Make sure the archive consists of valid files. The current rules are: + # 1. Archives can only include .ab1, .scf or .txt files + # 2. All file extensions within an archive must be the same + name = zip_file.namelist()[0] + test_ext = name.split( "." )[1].strip().lower() + if not ( test_ext == 'scf' or test_ext == 'ab1' or test_ext == 'txt' ): + return ( True, False, test_ext ) + for name in zip_file.namelist(): + ext = name.split( "." )[1].strip().lower() + if ext != test_ext: + return ( True, False, test_ext ) + return ( True, True, test_ext ) + +def add_file( dataset, json_file ): + data_type = None + line_count = None + + if dataset.type == 'url': + try: + temp_name, is_multi_byte = sniff.stream_to_file( urllib.urlopen( dataset.path ), prefix='url_paste' ) + except Exception, e: + file_err( 'Unable to fetch %s\n%s' % ( dataset.path, str( e ) ), dataset, json_file ) + return + dataset.path = temp_name + dataset.is_multi_byte = is_multi_byte + + # See if we have an empty file + if not os.path.exists( dataset.path ): + file_err( 'Uploaded temporary file (%s) does not exist. Please' % dataset.path, dataset, json_file ) + return + if not os.path.getsize( dataset.path ) > 0: + file_err( 'The uploaded file is empty', dataset, json_file ) + return + if 'is_multi_byte' not in dir( dataset ): + dataset.is_multi_byte = util.is_multi_byte( open( dataset.path, 'r' ).read( 1024 )[:100] ) + if dataset.is_multi_byte: + ext = sniff.guess_ext( dataset.path, is_multi_byte=True ) + data_type = ext + else: + # See if we have a gzipped file, which, if it passes our restrictions, we'll uncompress + is_gzipped, is_valid = check_gzip( dataset.path ) + if is_gzipped and not is_valid: + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + elif is_gzipped and is_valid: + # We need to uncompress the temp_name file + CHUNK_SIZE = 2**20 # 1Mb + fd, uncompressed = tempfile.mkstemp( prefix='data_id_%s_upload_gunzip_' % dataset.dataset_id, dir=os.path.dirname( dataset.path ) ) + gzipped_file = gzip.GzipFile( dataset.path ) + while 1: + try: + chunk = gzipped_file.read( CHUNK_SIZE ) + except IOError: + os.close( fd ) + os.remove( uncompressed ) + file_err( 'Problem decompressing gzipped data', dataset, json_file ) + return + if not chunk: + break + os.write( fd, chunk ) + os.close( fd ) + gzipped_file.close() + # Replace the gzipped file with the decompressed file + shutil.move( uncompressed, dataset.path ) + dataset.name = dataset.name.rstrip( '.gz' ) + data_type = 'gzip' + if not data_type: + # See if we have a zip archive + is_zipped, is_valid, test_ext = check_zip( dataset.path ) + if is_zipped and not is_valid: + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + elif is_zipped and is_valid: + # Currently, we force specific tools to handle this case. We also require the user + # to manually set the incoming file_type + if ( test_ext == 'ab1' or test_ext == 'scf' ) and dataset.file_type != 'binseq.zip': + file_err( "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'", dataset, json_file ) + return + elif test_ext == 'txt' and dataset.file_type != 'txtseq.zip': + file_err( "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'", dataset, json_file ) + return + if not ( dataset.file_type == 'binseq.zip' or dataset.file_type == 'txtseq.zip' ): + file_err( "You must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files", dataset, json_file ) + return + data_type = 'zip' + ext = dataset.file_type + if not data_type: + if check_binary( dataset.path ): + if dataset.is_binary is not None: + data_type = 'binary' + ext = dataset.file_type + else: + parts = dataset.name.split( "." ) + if len( parts ) > 1: + ext = parts[1].strip().lower() + if not( ext == 'ab1' or ext == 'scf' ): + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + if ext == 'ab1' and dataset.file_type != 'ab1': + file_err( "You must manually set the 'File Format' to 'Ab1' when uploading ab1 files.", dataset, json_file ) + return + elif ext == 'scf' and dataset.file_type != 'scf': + file_err( "You must manually set the 'File Format' to 'Scf' when uploading scf files.", dataset, json_file ) + return + data_type = 'binary' + if not data_type: + # We must have a text file + if check_html( dataset.path ): + file_err( 'The uploaded file contains inappropriate content', dataset, json_file ) + return + if data_type != 'binary' and data_type != 'zip': + if dataset.space_to_tab: + line_count = sniff.convert_newlines_sep2tabs( dataset.path ) + else: + line_count = sniff.convert_newlines( dataset.path ) + if dataset.file_type == 'auto': + ext = sniff.guess_ext( dataset.path ) + else: + ext = dataset.file_type + data_type = ext + # Save job info for the framework + info = dict( type = 'dataset', + dataset_id = dataset.dataset_id, + path = dataset.path, + ext = ext, + stdout = 'uploaded %s file' % data_type, + name = dataset.name, + line_count = line_count ) + json_file.write( to_json_string( info ) + "\n" ) + +def add_composite_file( dataset, json_file ): + if dataset.composite_files: + os.mkdir( dataset.extra_files_path ) + for name, value in dataset.composite_files.iteritems(): + value = util.bunch.Bunch( **value ) + if dataset.composite_file_paths[ value.name ] is None and not value.optional: + file_err( 'A required composite data file was not provided (%s)' % name, dataset, json_file ) + break + elif dataset.composite_file_paths[value.name] is not None: + if not value.is_binary: + if uploaded_dataset.composite_files[ value.name ].space_to_tab: + sniff.convert_newlines_sep2tabs( dataset.composite_file_paths[ value.name ][ 'path' ] ) + else: + sniff.convert_newlines( dataset.composite_file_paths[ value.name ][ 'path' ] ) + shutil.move( dataset.composite_file_paths[ value.name ][ 'path' ], os.path.join( dataset.extra_files_path, name ) ) + info = dict( type = 'dataset', + dataset_id = dataset.dataset_id, + path = dataset.primary_file, + stdout = 'uploaded %s file' % dataset.file_type ) + json_file.write( to_json_string( info ) + "\n" ) + +def __main__(): + + if len( sys.argv ) != 2: + print >>sys.stderr, 'usage: upload.py <json paramfile>' + sys.exit( 1 ) + + json_file = open( 'galaxy.json', 'w' ) + + for line in open( sys.argv[1], 'r' ): + dataset = from_json_string( line ) + dataset = util.bunch.Bunch( **safe_dict( dataset ) ) + + if dataset.type == 'composite': + add_composite_file( dataset, json_file ) + else: + add_file( dataset, json_file ) + + # clean up paramfile + try: + os.remove( sys.argv[1] ) + except: + pass + +if __name__ == '__main__': + __main__() diff -r 5fa8803716fd -r f6e0863862ef tools/data_source/upload.xml --- a/tools/data_source/upload.xml Wed Aug 19 18:07:55 2009 -0400 +++ b/tools/data_source/upload.xml Thu Aug 20 10:49:54 2009 -0400 @@ -1,10 +1,13 @@ <?xml version="1.0"?> -<tool name="Upload File" id="upload1" version="1.0.2"> +<tool name="Upload File" id="upload1" version="1.0.3"> <description> from your computer </description> <action module="galaxy.tools.actions.upload" class="UploadToolAction"/> + <command interpreter="python"> + upload.py $paramfile + </command> <inputs> <param name="file_type" type="select" label="File Format" help="Which format? See help below"> <options from_parameter="tool.app.datatypes_registry.upload_file_formats" transform_lines="[ "%s%s%s" % ( line, self.separator, line ) for line in obj ]">

1 0

[hg] galaxy 2581: Merge.
by Greg Von Kuster 24 Aug '09

24 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3353b15d0fb5 changeset: 2581:3353b15d0fb5 user: James Taylor <james(a)jamestaylor.org> date: Wed Aug 19 17:51:46 2009 -0400 description: Merge. 0 file(s) affected in this change: diffs (2275 lines): diff -r 7d48dc7e60b4 -r 3353b15d0fb5 lib/galaxy/web/form_builder.py --- a/lib/galaxy/web/form_builder.py Wed Aug 19 11:08:58 2009 -0400 +++ b/lib/galaxy/web/form_builder.py Wed Aug 19 17:51:46 2009 -0400 @@ -3,6 +3,7 @@ """ import logging,sys +from cgi import escape log = logging.getLogger(__name__) class BaseField(object): @@ -28,7 +29,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<input type="text" name="%s%s" size="%d" value="%s">' \ - % ( prefix, self.name, self.size, self.value ) + % ( prefix, self.name, self.size, escape(str(self.value), quote=True) ) def set_size(self, size): self.size = int( size ) @@ -49,7 +50,7 @@ self.value = value or "" def get_html( self, prefix="" ): return '<textarea name="%s%s" rows="%d" cols="%d">%s</textarea>' \ - % ( prefix, self.name, self.rows, self.cols, self.value ) + % ( prefix, self.name, self.rows, self.cols, escape(str(self.value), quote=True) ) def set_size(self, rows, cols): self.rows = rows self.cols = cols @@ -113,7 +114,7 @@ self.name = name self.value = value or "" def get_html( self, prefix="" ): - return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, self.value ) + return '<input type="hidden" name="%s%s" value="%s">' % ( prefix, self.name, escape(str(self.value), quote=True) ) class SelectField(BaseField): """ @@ -190,9 +191,9 @@ if len(self.options) > 2 and ctr % 2 == 1: style = " class=\"odd_row\"" if selected: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s" checked>%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) else: - rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, value, text) ) + rval.append( '<div%s><input type="checkbox" name="%s%s" value="%s">%s</div>' % ( style, prefix, self.name, escape(str(value), quote=True), text) ) ctr += 1 return "\n".join( rval ) def get_html_radio( self, prefix="" ): @@ -204,7 +205,7 @@ style = " class=\"odd_row\"" if selected: selected_text = " checked" else: selected_text = "" - rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, value, selected_text, text ) ) + rval.append( '<div%s><input type="radio" name="%s%s"%s value="%s"%s>%s</div>' % ( style, prefix, self.name, self.refresh_on_change_text, escape(str(value), quote=True), selected_text, text ) ) ctr += 1 return "\n".join( rval ) def get_html_default( self, prefix="" ): @@ -217,9 +218,9 @@ selected_text = " selected" last_selected_value = value else: selected_text = "" - rval.append( '<option value="%s"%s>%s</option>' % ( value, selected_text, text ) ) + rval.append( '<option value="%s"%s>%s</option>' % ( escape(str(value), quote=True), selected_text, text ) ) if last_selected_value: - last_selected_value = ' last_selected_value="%s"' % last_selected_value + last_selected_value = ' last_selected_value="%s"' % escape(str(last_selected_value), quote=True) rval.insert( 0, '<select name="%s%s"%s%s%s>' % ( prefix, self.name, multiple, self.refresh_on_change_text, last_selected_value ) ) rval.append( '</select>' ) return "\n".join( rval ) @@ -326,12 +327,12 @@ if option['value'] in expanded_options: default_state = 'expanded' default_icon = '[-]' - html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><span class="toolParameterExpandableCollapsable">%s</span><input type="%s" name="%s%s" value="%s"%s">%s' % ( default_icon, self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '<ul class="toolParameterExpandableCollapsable" default_state="%s">' % default_state ) recurse_options( html, option['options'], expanded_options ) html.append( '</ul>') else: - html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, option['value'], selected, option['name']) ) + html.append( '<li><input type="%s" name="%s%s" value="%s"%s">%s' % ( self.display, prefix, self.name, escape(str(option['value']), quote=True), selected, option['name']) ) html.append( '</li>' ) rval = [] rval.append( '<div><ul class="toolParameterExpandableCollapsable">' ) diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/jStore.Flash.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/jStore.Flash.html Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,19 @@ +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"> + <head> + <title>Flash External Object</title> + <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> + <script type="text/javascript"> + /** + * This function captures the flash_ready event. We need to relay this + * back to the parent so it knows flash is ready. + */ + function flash_ready(){ + parent.flash_ready(); + } + </script> + </head> + <body> + <object classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#versi…" width="1" height="1" id="jStoreFlash"><param name="allowScriptAccess" value="always" /><param name="movie" value="jStore.swf" /><param name="quality" value="high" /><param name="bgcolor" value="#ffcc00" /><embed src="jStore.swf" quality="high" bgcolor="#ffcc00" width="1" height="1" name="jStoreFlash" align="middle" allowScriptAccess="always" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /></object> + </body> +</html> \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/jStore.swf Binary file static/jStore.swf has changed diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/galaxy.workflow_editor.canvas.js --- a/static/scripts/galaxy.workflow_editor.canvas.js Wed Aug 19 11:08:58 2009 -0400 +++ b/static/scripts/galaxy.workflow_editor.canvas.js Wed Aug 19 17:51:46 2009 -0400 @@ -359,6 +359,7 @@ this.nodes = {}; this.name = null; this.has_changes = false; + this.active_form_has_changes = false; } $.extend( Workflow.prototype, { add_node : function( node ) { @@ -438,6 +439,28 @@ }); }); }, + enable_auto_save : function() { + // Implements auto-saving based on whether the inputs change. We consider + // "changed" to be when a field is accessed and not necessarily modified + // because of an issue where "onchange" is not triggered when activating + // another node, or saving the workflow. + outer_this = this; + $(".toolFormBody").find("input,textarea,select").each( function() { + $(this).focus( function() { + outer_this.active_form_has_changes = true; + }); + }); + }, + check_changes_in_active_form : function() { + // If active form has changed, save it + if (this.active_form_has_changes) { + this.has_changes = true; + $(".toolFormBody").find("form").each( function() { + $(this).submit(); + }); + this.active_form_has_changes = false; + } + }, clear_active_node : function() { if ( this.active_node ) { this.active_node.make_inactive(); @@ -447,6 +470,7 @@ }, activate_node : function( node ) { if ( this.active_node != node ) { + this.check_changes_in_active_form(); this.clear_active_node(); parent.show_form_for_tool( node.form_html, node ); node.make_active(); @@ -461,6 +485,7 @@ } }, layout : function () { + this.check_changes_in_active_form(); // Prepare predecessor / successor tracking var n_pred = {}; var successors = {}; @@ -502,7 +527,7 @@ var v = level_parents[k]; delete n_pred[v]; for ( var sk in successors[v] ) { - n_pred[ sucessors[v][sk] ] -= 1; + n_pred[ successors[v][sk] ] -= 1; } } } @@ -805,6 +830,10 @@ self.draw_overview(); }); + /* Disable dragging for child element of the panel so that resizing can + only be done by dragging the borders */ + $("#overview-border div").bind("drag", function(e) { }); + }, update_viewport_overlay: function() { var cc = this.cc, diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/jquery.jstore-all.js Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,748 @@ +/*! + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + *//** + * Javascript Class Framework + * + * Copyright (c) 2008 John Resig (http://ejohn.org/blog/simple-javascript-inheritance/) + * Inspired by base2 and Prototype + */ +(function(){ + var initializing = false, fnTest = /xyz/.test(function(){xyz;}) ? /\b_super\b/ : /.*/; + + // The base Class implementation (does nothing) + this.Class = function(){}; + + // Create a new Class that inherits from this class + Class.extend = function(prop) { + var _super = this.prototype; + + // Instantiate a base class (but only create the instance, + // don't run the init constructor) + initializing = true; + var prototype = new this(); + initializing = false; + + // Copy the properties over onto the new prototype + for (var name in prop) { + // Check if we're overwriting an existing function + prototype[name] = typeof prop[name] == "function" && + typeof _super[name] == "function" && fnTest.test(prop[name]) ? + (function(name, fn){ + return function() { + var tmp = this._super; + + // Add a new ._super() method that is the same method + // but on the super-class + this._super = _super[name]; + + // The method only need to be bound temporarily, so we + // remove it when we're done executing + var ret = fn.apply(this, arguments); + this._super = tmp; + + return ret; + }; + })(name, prop[name]) : + prop[name]; + } + + // The dummy class constructor + function Class() { + // All construction is actually done in the init method + if ( !initializing && this.init ) + this.init.apply(this, arguments); + } + + // Populate our constructed prototype object + Class.prototype = prototype; + + // Enforce the constructor to be what we expect + Class.constructor = Class; + + // And make this class extendable + Class.extend = arguments.callee; + + return Class; + }; +})(); +/*! + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.jStoreDelegate = Class.extend({ + init: function(parent){ + // The Object this delgate operates for + this.parent = parent; + // Container for callbacks to dispatch. + // eventType => [ callback, callback, ... ] + this.callbacks = {}; + }, + bind: function(event, callback){ + if ( !$.isFunction(callback) ) return this; + if ( !this.callbacks[ event ] ) this.callbacks[ event ] = []; + + this.callbacks[ event ].push(callback); + + return this; + }, + trigger: function(){ + var parent = this.parent, + args = [].slice.call(arguments), + event = args.shift(), + handlers = this.callbacks[ event ]; + + if ( !handlers ) return false; + + $.each(handlers, function(){ this.apply(parent, args) }); + return this; + } + }); + +})(jQuery);/** + * jStore-jQuery Interface + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Setup the jStore namespace in jQuery for options storage + $.jStore = {}; + + // Seed the options in + $.extend($.jStore, { + EngineOrder: [], + // Engines should put their availability tests within jStore.Availability + Availability: {}, + // Defined engines should enter themselves into the jStore.Engines + Engines: {}, + // Instanciated engines should exist within jStore.Instances + Instances: {}, + // The current engine to use for storage + CurrentEngine: null, + // Provide global settings for overwriting + defaults: { + project: null, + engine: null, + autoload: true, + flash: 'jStore.Flash.html' + }, + // Boolean for ready state handling + isReady: false, + // Boolean for flash ready state handling + isFlashReady: false, + // An event delegate + delegate: new jStoreDelegate($.jStore) + .bind('jStore-ready', function(engine){ + $.jStore.isReady = true; + if ($.jStore.defaults.autoload) engine.connect(); + }) + .bind('flash-ready', function(){ + $.jStore.isFlashReady = true; + }) + }); + + // Enable ready callback for jStore + $.jStore.ready = function(callback){ + if ($.jStore.isReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('jStore-ready', callback); + } + + // Enable failure callback registration for jStore + $.jStore.fail = function(callback){ + $.jStore.delegate.bind('jStore-failure', callback); + } + + // Enable ready callback for Flash + $.jStore.flashReady = function(callback){ + if ($.jStore.isFlashReady) callback.apply($.jStore, [$.jStore.CurrentEngine]); + else $.jStore.delegate.bind('flash-ready', callback); + } + + // Enable and test an engine + $.jStore.use = function(engine, project, identifier){ + project = project || $.jStore.defaults.project || location.hostname.replace(/\./g, '-') || 'unknown'; + + var e = $.jStore.Engines[engine.toLowerCase()] || null, + name = (identifier ? identifier + '.' : '') + project + '.' + engine; + + if ( !e ) throw 'JSTORE_ENGINE_UNDEFINED'; + + // Instanciate the engine + e = new e(project, name); + + // Prevent against naming conflicts + if ($.jStore.Instances[name]) throw 'JSTORE_JRI_CONFLICT'; + + // Test the engine + if (e.isAvailable()){ + $.jStore.Instances[name] = e; // The Easy Way + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = e; + } + $.jStore.delegate.trigger('jStore-ready', e); + } else { + if (!e.autoload) // Not available + throw 'JSTORE_ENGINE_UNAVILABLE'; + else { // The hard way + e.included(function(){ + if (this.isAvailable()) { // Worked out + $.jStore.Instances[name] = this; + // If there is no current engine, use this one + if (!$.jStore.CurrentEngine){ + $.jStore.CurrentEngine = this; + } + $.jStore.delegate.trigger('jStore-ready', this); + } + else $.jStore.delegate.trigger('jStore-failure', this); + }).include(); + } + } + } + + // Set the current storage engine + $.jStore.setCurrentEngine = function(name){ + if (!$.jStore.Instances.length ) // If no instances exist, attempt to load one + return $.jStore.FindEngine(); + + if (!name && $.jStore.Instances.length >= 1) { // If no name is specified, use the first engine + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[0]); + return $.jStore.CurrentEngine = $.jStore.Instances[0]; + } + + if (name && $.jStore.Instances[name]) { // If a name is specified and exists, use it + $.jStore.delegate.trigger('jStore-ready', $.jStore.Instances[name]); + return $.jStore.CurrentEngine = $.jStore.Instances[name]; + } + + throw 'JSTORE_JRI_NO_MATCH'; + } + + // Test all possible engines for straightforward useability + $.jStore.FindEngine = function(){ + $.each($.jStore.EngineOrder, function(k){ + if ($.jStore.Availability[this]()){ // Find the first, easiest option and use it. + $.jStore.use(this, $.jStore.defaults.project, 'default'); + return false; + } + }) + } + + // Provide a simple interface for storing/getting values + $.jStore.store = function(key, value){ + if (!$.jStore.CurrentEngine) return false; + + if ( !value ) // Executing a get command + return $.jStore.CurrentEngine.get(key); + // Executing a set command + return $.jStore.CurrentEngine.set(key, value); + } + // Provide a simple interface for storing/getting values + $.jStore.remove = function(key){ + if (!$.jStore.CurrentEngine) return false; + + return $.jStore.CurrentEngine.rem(key); + } + + // Provide a chainable interface for storing values/getting a value at the end of a chain + $.fn.store = function(key, value){ + if (!$.jStore.CurrentEngine) return this; + + var result = $.jStore.store(key, value); + + return !value ? result : this; + } + + // Provide a chainable interface for removing values + $.fn.removeStore = function(key){ + $.jStore.remove(key); + + return this; + } + + // Provide a way for users to call for auto-loading + $.jStore.load = function(){ + if ($.jStore.defaults.engine) + return $.jStore.use($.jStore.defaults.engine, $.jStore.defaults.project, 'default'); + + // Attempt to find a valid engine, and catch any exceptions if we can't + try { + $.jStore.FindEngine(); + } catch (e) {} + } + +})(jQuery); +/** + * jStore Engine Core + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + this.StorageEngine = Class.extend({ + init: function(project, name){ + // Configure the project name + this.project = project; + // The JRI name given by the manager + this.jri = name; + // Cache the data so we can work synchronously + this.data = {}; + // The maximum limit of the storage engine + this.limit = -1; + // Third party script includes + this.includes = []; + // Create an event delegate for users to subscribe to event triggers + this.delegate = new jStoreDelegate(this) + .bind('engine-ready', function(){ + this.isReady = true; + }) + .bind('engine-included', function(){ + this.hasIncluded = true; + }); + // If enabled, the manager will check availability, then run include(), then check again + this.autoload = false; // This should be changed by the engines, if they have required includes + // When set, we're ready to transact data + this.isReady = false; + // When the includer is finished, it will set this to true + this.hasIncluded = false; + }, + // Performs all necessary script includes + include: function(){ + var self = this, + total = this.includes.length, + count = 0; + + $.each(this.includes, function(){ + $.ajax({type: 'get', url: this, dataType: 'script', cache: true, + success: function(){ + count++; + if (count == total) self.delegate.trigger('engine-included'); + } + }) + }); + }, + // This should be overloaded with an actual functionality presence check + isAvailable: function(){ + return false; + }, + /** Event Subscription Shortcuts **/ + ready: function(callback){ + if (this.isReady) callback.apply(this); + else this.delegate.bind('engine-ready', callback); + return this; + }, + included: function(callback){ + if (this.hasIncluded) callback.apply(this); + else this.delegate.bind('engine-included', callback); + return this; + }, + /** Cache Data Access **/ + get: function(key){ + return this.data[key] || null; + }, + set: function(key, value){ + this.data[key] = value; + return value; + }, + rem: function(key){ + var beforeDelete = this.data[key]; + this.data[key] = null; + return beforeDelete; + } + }); + +})(jQuery); +/*! + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var sessionAvailability = $.jStore.Availability.session = function(){ + return !!window.sessionStorage; + }, + localAvailability = $.jStore.Availability.local = function(){ + return !!(window.localStorage || window.globalStorage); + }; + + this.jStoreDom = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'DOM'; + + // Set the Database limit + this.limit = 5 * 1024 * 1024; + }, + connect: function(){ + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + get: function(key){ + var out = this.db.getItem(key); + // Gecko's getItem returns {value: 'the value'}, WebKit returns 'the value' + return out && out.value ? out.value : out + }, + set: function(key, value){ + this.db.setItem(key,value); + return value; + }, + rem: function(key){ + var out = this.get(key); + this.db.removeItem(key); + return out + } + }) + + this.jStoreLocal = jStoreDom.extend({ + connect: function(){ + // Gecko uses a non-standard globalStorage[ www.example.com ] DOM access object for persistant storage. + this.db = !window.globalStorage ? window.localStorage : window.globalStorage[location.hostname]; + this._super(); + }, + isAvailable: localAvailability + }) + + this.jStoreSession = jStoreDom.extend({ + connect: function(){ + this.db = sessionStorage; + this._super(); + }, + isAvailable: sessionAvailability + }) + + $.jStore.Engines.local = jStoreLocal; + $.jStore.Engines.session = jStoreSession; + + // Store the ordering preference + $.jStore.EngineOrder[ 1 ] = 'local'; + +})(jQuery); +/*! + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.flash = function(){ + return !!($.jStore.hasFlash('8.0.0')); + } + + this.jStoreFlash = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Flash'; + + // Bind our flashReady function to the jStore Delegate + var self = this; + $.jStore.flashReady(function(){ self.flashReady() }); + }, + connect: function(){ + var name = 'jstore-flash-embed-' + this.project; + + // To make Flash Storage work on IE, we have to load up an iFrame + // which contains an HTML page that embeds the object using an + // object tag wrapping an embed tag. Of course, this is unnecessary for + // all browsers except for IE, which, to my knowledge, is the only browser + // in existance where you need to complicate your code to fix bugs. Goddamnit. :( + $(document.body) + .append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" ' + + 'id="jStoreFlashFrame" src="' +$.jStore.defaults.flash + '"></iframe>'); + }, + flashReady: function(e){ + var iFrame = $('#jStoreFlashFrame')[0]; + + // IE + if (iFrame.Document && $.isFunction(iFrame.Document['jStoreFlash'].f_get_cookie)) this.db = iFrame.Document['jStoreFlash']; + // Safari && Firefox + else if (iFrame.contentWindow && iFrame.contentWindow.document){ + var doc = iFrame.contentWindow.document; + // Safari + if ($.isFunction($('object', $(doc))[0].f_get_cookie)) this.db = $('object', $(doc))[0]; + // Firefox + else if ($.isFunction($('embed', $(doc))[0].f_get_cookie)) this.db = $('embed', $(doc))[0]; + } + + // We're ready to process data + if (this.db) this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + var out = this.db.f_get_cookie(key); + return out == 'null' ? null : out; + }, + set: function(key, value){ + this.db.f_set_cookie(key, value); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.f_delete_cookie(key); + return beforeDelete; + } + }) + + $.jStore.Engines.flash = jStoreFlash; + + // Store the ordering preference + $.jStore.EngineOrder[ 2 ] = 'flash'; + + /** + * Flash Detection functions copied from the jQuery Flash Plugin + * Copyright (c) 2006 Luke Lutman (http://jquery.lukelutman.com/plugins/flash) + * Dual licensed under the MIT and GPL licenses. + * http://www.opensource.org/licenses/mit-license.php + * http://www.opensource.org/licenses/gpl-license.php + */ + $.jStore.hasFlash = function(version){ + var pv = $.jStore.flashVersion().match(/\d+/g), + rv = version.match(/\d+/g); + + for(var i = 0; i < 3; i++) { + pv[i] = parseInt(pv[i] || 0); + rv[i] = parseInt(rv[i] || 0); + // player is less than required + if(pv[i] < rv[i]) return false; + // player is greater than required + if(pv[i] > rv[i]) return true; + } + // major version, minor version and revision match exactly + return true; + } + + $.jStore.flashVersion = function(){ + // ie + try { + try { + // avoid fp6 minor version lookup issues + // see: http://blog.deconcept.com/2006/01/11/getvariable-setvariable-crash-internet… + var axo = new ActiveXObject('ShockwaveFlash.ShockwaveFlash.6'); + try { axo.AllowScriptAccess = 'always'; } + catch(e) { return '6,0,0'; } + } catch(e) {} + return new ActiveXObject('ShockwaveFlash.ShockwaveFlash').GetVariable('$version').replace(/\D+/g, ',').match(/^,?(.+),?$/)[1]; + // other browsers + } catch(e) { + try { + if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){ + return (navigator.plugins["Shockwave Flash 2.0"] || navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g, ",").match(/^,?(.+),?$/)[1]; + } + } catch(e) {} + } + return '0,0,0'; + } + +})(jQuery); + +// Callback fired when ExternalInterface is established +function flash_ready(){ + $.jStore.delegate.trigger('flash-ready'); +} +/*! + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.gears = function(){ + return !!(window.google && window.google.gears) + } + + this.jStoreGears = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'Google Gears'; + + // Add required third-party scripts + this.includes.push('http://code.google.com/apis/gears/gears_init.js'); + + // Allow Autoloading on fail + this.autoload = true; + }, + connect: function(){ + // Create our database connection + var db = this.db = google.gears.factory.create('beta.database'); + db.open( 'jstore-' + this.project ); + db.execute( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + // Read the database into our cache object + var result = this.db.execute( 'SELECT k,v FROM jstore' ); + while (result.isValidRow()){ + this.data[result.field(0)] = result.field(1); + result.next(); + } result.close(); + + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value] ); + db.execute( 'COMMIT' ); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + var db = this.db; + db.execute( 'BEGIN' ); + db.execute( 'DELETE FROM jstore WHERE k = ?', [key] ); + db.execute( 'COMMIT' ); + return this._super(key); + } + }) + + $.jStore.Engines.gears = jStoreGears; + + // Store the ordering preference + $.jStore.EngineOrder[ 3 ] = 'gears'; + +})(jQuery); +/*! + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.html5 = function(){ + return !!window.openDatabase + } + + this.jStoreHtml5 = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'HTML5'; + + // Set the Database limit + this.limit = 1024 * 200; + }, + connect: function(){ + // Create our database connection + var db = this.db = openDatabase('jstore-' + this.project, '1.0', this.project, this.limit); + if (!db) throw 'JSTORE_ENGINE_HTML5_NODB'; + db.transaction(function(db){ + db.executeSql( 'CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)' ); + }); + + // Cache the data from the table + this.updateCache(); + }, + updateCache: function(){ + var self = this; + // Read the database into our cache object + this.db.transaction(function(db){ + db.executeSql( 'SELECT k,v FROM jstore', [], function(db, result){ + var rows = result.rows, i = 0, row; + for (; i < rows.length; ++i){ + row = rows.item(i); + self.data[row.k] = row.v; + } + + // Fire our delegate to indicate we're ready for data transactions + self.delegate.trigger('engine-ready'); + }); + }); + }, + isAvailable: avilability, + set: function(key, value){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)', [key,value]); + }); + return this._super(key, value); + }, + rem: function(key){ + // Update the database + this.db.transaction(function(db){ + db.executeSql( 'DELETE FROM jstore WHERE k = ?', [key] ) + }) + return this._super(key); + } + }) + + $.jStore.Engines.html5 = jStoreHtml5; + + // Store the ordering preference + $.jStore.EngineOrder[ 0 ] = 'html5'; + +})(jQuery); +/*!* + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function($){ + + // Set up a static test function for this instance + var avilability = $.jStore.Availability.ie = function(){ + return !!window.ActiveXObject; + } + + this.jStoreIE = StorageEngine.extend({ + init: function(project, name){ + // Call the parental init object + this._super(project, name); + + // The type of storage engine + this.type = 'IE'; + + // Allow Autoloading on fail + this.limit = 64 * 1024; + }, + connect: function(){ + // Create a hidden div to store attributes in + this.db = $('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-' + this.project + '"></div>') + .appendTo(document.body).get(0); + // Fire our delegate to indicate we're ready for data transactions + this.delegate.trigger('engine-ready'); + }, + isAvailable: avilability, + get: function(key){ + this.db.load(this.project); + return this.db.getAttribute(key); + }, + set: function(key, value){ + this.db.setAttribute(key, value); + this.db.save(this.project); + return value; + }, + rem: function(key){ + var beforeDelete = this.get(key); + this.db.removeAttribute(key); + this.db.save(this.project); + return beforeDelete; + } + }) + + $.jStore.Engines.ie = jStoreIE; + + // Store the ordering preference + $.jStore.EngineOrder[ 4 ] = 'ie'; + +})(jQuery); \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json2.js Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,476 @@ +/* + http://www.JSON.org/json2.js + 2009-06-29 + + Public Domain. + + NO WARRANTY EXPRESSED OR IMPLIED. USE AT YOUR OWN RISK. + + See http://www.JSON.org/js.html + + This file creates a global JSON object containing two methods: stringify + and parse. + + JSON.stringify(value, replacer, space) + value any JavaScript value, usually an object or array. + + replacer an optional parameter that determines how object + values are stringified for objects. It can be a + function or an array of strings. + + space an optional parameter that specifies the indentation + of nested structures. If it is omitted, the text will + be packed without extra whitespace. If it is a number, + it will specify the number of spaces to indent at each + level. If it is a string (such as '\t' or ' '), + it contains the characters used to indent at each level. + + This method produces a JSON text from a JavaScript value. + + When an object value is found, if the object contains a toJSON + method, its toJSON method will be called and the result will be + stringified. A toJSON method does not serialize: it returns the + value represented by the name/value pair that should be serialized, + or undefined if nothing should be serialized. The toJSON method + will be passed the key associated with the value, and this will be + bound to the object holding the key. + + For example, this would serialize Dates as ISO strings. + + Date.prototype.toJSON = function (key) { + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + return this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z'; + }; + + You can provide an optional replacer method. It will be passed the + key and value of each member, with this bound to the containing + object. The value that is returned from your method will be + serialized. If your method returns undefined, then the member will + be excluded from the serialization. + + If the replacer parameter is an array of strings, then it will be + used to select the members to be serialized. It filters the results + such that only members with keys listed in the replacer array are + stringified. + + Values that do not have JSON representations, such as undefined or + functions, will not be serialized. Such values in objects will be + dropped; in arrays they will be replaced with null. You can use + a replacer function to replace those with JSON values. + JSON.stringify(undefined) returns undefined. + + The optional space parameter produces a stringification of the + value that is filled with line breaks and indentation to make it + easier to read. + + If the space parameter is a non-empty string, then that string will + be used for indentation. If the space parameter is a number, then + the indentation will be that many spaces. + + Example: + + text = JSON.stringify(['e', {pluribus: 'unum'}]); + // text is '["e",{"pluribus":"unum"}]' + + + text = JSON.stringify(['e', {pluribus: 'unum'}], null, '\t'); + // text is '[\n\t"e",\n\t{\n\t\t"pluribus": "unum"\n\t}\n]' + + text = JSON.stringify([new Date()], function (key, value) { + return this[key] instanceof Date ? + 'Date(' + this[key] + ')' : value; + }); + // text is '["Date(---current time---)"]' + + + JSON.parse(text, reviver) + This method parses a JSON text to produce an object or array. + It can throw a SyntaxError exception. + + The optional reviver parameter is a function that can filter and + transform the results. It receives each of the keys and values, + and its return value is used instead of the original value. + If it returns what it received, then the structure is not modified. + If it returns undefined then the member is deleted. + + Example: + + // Parse the text. Values that look like ISO date strings will + // be converted to Date objects. + + myData = JSON.parse(text, function (key, value) { + var a; + if (typeof value === 'string') { + a = +/^(\d{4})-(\d{2})-(\d{2})T(\d{2}):(\d{2}):(\d{2}(?:\.\d*)?)Z$/.exec(value); + if (a) { + return new Date(Date.UTC(+a[1], +a[2] - 1, +a[3], +a[4], + +a[5], +a[6])); + } + } + return value; + }); + + myData = JSON.parse('["Date(09/09/2001)"]', function (key, value) { + var d; + if (typeof value === 'string' && + value.slice(0, 5) === 'Date(' && + value.slice(-1) === ')') { + d = new Date(value.slice(5, -1)); + if (d) { + return d; + } + } + return value; + }); + + + This is a reference implementation. You are free to copy, modify, or + redistribute. + + This code should be minified before deployment. + See http://javascript.crockford.com/jsmin.html + + USE YOUR OWN COPY. IT IS EXTREMELY UNWISE TO LOAD CODE FROM SERVERS YOU DO + NOT CONTROL. +*/ + +/*jslint evil: true */ + +/*members "", "\b", "\t", "\n", "\f", "\r", "\"", JSON, "\\", apply, + call, charCodeAt, getUTCDate, getUTCFullYear, getUTCHours, + getUTCMinutes, getUTCMonth, getUTCSeconds, hasOwnProperty, join, + lastIndex, length, parse, prototype, push, replace, slice, stringify, + test, toJSON, toString, valueOf +*/ + +// Create a JSON object only if one does not already exist. We create the +// methods in a closure to avoid creating global variables. + +var JSON = JSON || {}; + +(function () { + + function f(n) { + // Format integers to have at least two digits. + return n < 10 ? '0' + n : n; + } + + if (typeof Date.prototype.toJSON !== 'function') { + + Date.prototype.toJSON = function (key) { + + return isFinite(this.valueOf()) ? + this.getUTCFullYear() + '-' + + f(this.getUTCMonth() + 1) + '-' + + f(this.getUTCDate()) + 'T' + + f(this.getUTCHours()) + ':' + + f(this.getUTCMinutes()) + ':' + + f(this.getUTCSeconds()) + 'Z' : null; + }; + + String.prototype.toJSON = + Number.prototype.toJSON = + Boolean.prototype.toJSON = function (key) { + return this.valueOf(); + }; + } + + var cx = /[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + escapable = /[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g, + gap, + indent, + meta = { // table of character substitutions + '\b': '\\b', + '\t': '\\t', + '\n': '\\n', + '\f': '\\f', + '\r': '\\r', + '"' : '\\"', + '\\': '\\\\' + }, + rep; + + + function quote(string) { + +// If the string contains no control characters, no quote characters, and no +// backslash characters, then we can safely slap some quotes around it. +// Otherwise we must also replace the offending characters with safe escape +// sequences. + + escapable.lastIndex = 0; + return escapable.test(string) ? + '"' + string.replace(escapable, function (a) { + var c = meta[a]; + return typeof c === 'string' ? c : + '\\u' + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }) + '"' : + '"' + string + '"'; + } + + + function str(key, holder) { + +// Produce a string from holder[key]. + + var i, // The loop counter. + k, // The member key. + v, // The member value. + length, + mind = gap, + partial, + value = holder[key]; + +// If the value has a toJSON method, call it to obtain a replacement value. + + if (value && typeof value === 'object' && + typeof value.toJSON === 'function') { + value = value.toJSON(key); + } + +// If we were called with a replacer function, then call the replacer to +// obtain a replacement value. + + if (typeof rep === 'function') { + value = rep.call(holder, key, value); + } + +// What happens next depends on the value's type. + + switch (typeof value) { + case 'string': + return quote(value); + + case 'number': + +// JSON numbers must be finite. Encode non-finite numbers as null. + + return isFinite(value) ? String(value) : 'null'; + + case 'boolean': + case 'null': + +// If the value is a boolean or null, convert it to a string. Note: +// typeof null does not produce 'null'. The case is included here in +// the remote chance that this gets fixed someday. + + return String(value); + +// If the type is 'object', we might be dealing with an object or an array or +// null. + + case 'object': + +// Due to a specification blunder in ECMAScript, typeof null is 'object', +// so watch out for that case. + + if (!value) { + return 'null'; + } + +// Make an array to hold the partial results of stringifying this object value. + + gap += indent; + partial = []; + +// Is the value an array? + + if (Object.prototype.toString.apply(value) === '[object Array]') { + +// The value is an array. Stringify every element. Use null as a placeholder +// for non-JSON values. + + length = value.length; + for (i = 0; i < length; i += 1) { + partial[i] = str(i, value) || 'null'; + } + +// Join all of the elements together, separated with commas, and wrap them in +// brackets. + + v = partial.length === 0 ? '[]' : + gap ? '[\n' + gap + + partial.join(',\n' + gap) + '\n' + + mind + ']' : + '[' + partial.join(',') + ']'; + gap = mind; + return v; + } + +// If the replacer is an array, use it to select the members to be stringified. + + if (rep && typeof rep === 'object') { + length = rep.length; + for (i = 0; i < length; i += 1) { + k = rep[i]; + if (typeof k === 'string') { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } else { + +// Otherwise, iterate through all of the keys in the object. + + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = str(k, value); + if (v) { + partial.push(quote(k) + (gap ? ': ' : ':') + v); + } + } + } + } + +// Join all of the member texts together, separated with commas, +// and wrap them in braces. + + v = partial.length === 0 ? '{}' : + gap ? '{\n' + gap + partial.join(',\n' + gap) + '\n' + + mind + '}' : '{' + partial.join(',') + '}'; + gap = mind; + return v; + } + } + +// If the JSON object does not yet have a stringify method, give it one. + + if (typeof JSON.stringify !== 'function') { + JSON.stringify = function (value, replacer, space) { + +// The stringify method takes a value and an optional replacer, and an optional +// space parameter, and returns a JSON text. The replacer can be a function +// that can replace values, or an array of strings that will select the keys. +// A default replacer method can be provided. Use of the space parameter can +// produce text that is more easily readable. + + var i; + gap = ''; + indent = ''; + +// If the space parameter is a number, make an indent string containing that +// many spaces. + + if (typeof space === 'number') { + for (i = 0; i < space; i += 1) { + indent += ' '; + } + +// If the space parameter is a string, it will be used as the indent string. + + } else if (typeof space === 'string') { + indent = space; + } + +// If there is a replacer, it must be a function or an array. +// Otherwise, throw an error. + + rep = replacer; + if (replacer && typeof replacer !== 'function' && + (typeof replacer !== 'object' || + typeof replacer.length !== 'number')) { + throw new Error('JSON.stringify'); + } + +// Make a fake root object containing our value under the key of ''. +// Return the result of stringifying the value. + + return str('', {'': value}); + }; + } + + +// If the JSON object does not yet have a parse method, give it one. + + if (typeof JSON.parse !== 'function') { + JSON.parse = function (text, reviver) { + +// The parse method takes a text and an optional reviver function, and returns +// a JavaScript value if the text is a valid JSON text. + + var j; + + function walk(holder, key) { + +// The walk method is used to recursively walk the resulting structure so +// that modifications can be made. + + var k, v, value = holder[key]; + if (value && typeof value === 'object') { + for (k in value) { + if (Object.hasOwnProperty.call(value, k)) { + v = walk(value, k); + if (v !== undefined) { + value[k] = v; + } else { + delete value[k]; + } + } + } + } + return reviver.call(holder, key, value); + } + + +// Parsing happens in four stages. In the first stage, we replace certain +// Unicode characters with escape sequences. JavaScript handles many characters +// incorrectly, either silently deleting them, or treating them as line endings. + + cx.lastIndex = 0; + if (cx.test(text)) { + text = text.replace(cx, function (a) { + return '\\u' + + ('0000' + a.charCodeAt(0).toString(16)).slice(-4); + }); + } + +// In the second stage, we run the text against regular expressions that look +// for non-JSON patterns. We are especially concerned with '()' and 'new' +// because they can cause invocation, and '=' because it can cause mutation. +// But just to be safe, we want to reject all unexpected forms. + +// We split the second stage into 4 regexp operations in order to work around +// crippling inefficiencies in IE's and Safari's regexp engines. First we +// replace the JSON backslash pairs with '@' (a non-JSON character). Second, we +// replace all simple value tokens with ']' characters. Third, we delete all +// open brackets that follow a colon or comma or that begin the text. Finally, +// we look to see that the remaining characters are only whitespace or ']' or +// ',' or ':' or '{' or '}'. If that is so, then the text is safe for eval. + + if (/^[\],:{}\s]*$/. +test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g, '@'). +replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g, ']'). +replace(/(?:^|:|,)(?:\s*\[)+/g, ''))) { + +// In the third stage we use the eval function to compile the text into a +// JavaScript structure. The '{' operator is subject to a syntactic ambiguity +// in JavaScript: it can begin a block or an object literal. We wrap the text +// in parens to eliminate the ambiguity. + + j = eval('(' + text + ')'); + +// In the optional fourth stage, we recursively walk the new structure, passing +// each name/value pair to a reviver function for possible transformation. + + return typeof reviver === 'function' ? + walk({'': j}, '') : j; + } + +// If the text is not JSON parseable, then a SyntaxError is thrown. + + throw new SyntaxError('JSON.parse'); + }; + } +}()); diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/json_cookie.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/json_cookie.js Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,61 @@ +/* + JSONCookie: Uses JSON to allow the settings of multiple preferences in one cookie. + Kanwei Li, 2009 + + cookie = new JSONCookie("cookie_name"); // Pass in the name of the cookie + + // Gets the value of a preference, returns optional second argument if pref not found + cookie.get("pref", "val_if_not_found"); + + cookie.set("pref", "val"); // Sets a value for the preference and saves cookie + cookie.unset("pref"); // Unsets the preference and saves cookie + cookie.clear() // Deletes the cookie + +*/ + +function JSONCookie(name) { + this.cookie_name = name; + +} + +JSONCookie.prototype = { + json_data : function() { + cookie = $.cookie(this.cookie_name); + return cookie ? JSON.parse(cookie) : null; + }, + + save : function(data) { + $.cookie(this.cookie_name, JSON.stringify(data)); + }, + + get : function(attr, else_val) { + data = this.json_data(); + if (data && data[attr]) { return data[attr]; + } else if (else_val) { return else_val; + } else { return null; + } + }, + + set : function(attr, val) { + data = this.json_data(); + if (data) { + data[attr] = val; + } else { + data = { attr : val } + } + this.save(data); + }, + + unset : function(attr) { + data = this.json_data(); + if (data) { + delete data[attr]; + } + this.save(data); + }, + + clear : function() { + this.save(null); + } + +}; \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/packed/galaxy.workflow_editor.canvas.js --- a/static/scripts/packed/galaxy.workflow_editor.canvas.js Wed Aug 19 11:08:58 2009 -0400 +++ b/static/scripts/packed/galaxy.workflow_editor.canvas.js Wed Aug 19 17:51:46 2009 -0400 @@ -1,1 +1,1 @@ -function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connectors,function(j,k){f[h.name]={id:k.ha ndle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.clear_active_node();parent.show_ form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){level_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[sucessors[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this.canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$( this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></div>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this).offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prot otype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.css("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this; var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({wi dth:f,height:f});b.draw_overview()})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewp ort_overlay()}}); \ No newline at end of file +function Terminal(a){this.element=a;this.connectors=[]}$.extend(Terminal.prototype,{connect:function(a){this.connectors.push(a);if(this.node){this.node.changed()}},disconnect:function(a){this.connectors.splice($.inArray(a,this.connectors),1);if(this.node){this.node.changed()}},redraw:function(){$.each(this.connectors,function(a,b){b.redraw()})},destroy:function(){$.each(this.connectors.slice(),function(a,b){b.destroy()})}});function OutputTerminal(a,b){Terminal.call(this,a);this.datatype=b}OutputTerminal.prototype=new Terminal();function InputTerminal(a,b){Terminal.call(this,a);this.datatypes=b}InputTerminal.prototype=new Terminal();$.extend(InputTerminal.prototype,{can_accept:function(a){if(this.connectors.length<1){for(var b in this.datatypes){if(a.datatype=="input"){return true}if(issubtype(a.datatype,this.datatypes[b])){return true}}}return false}});function Connector(b,a){this.canvas=null;this.dragging=false;this.inner_color="#FFFFFF";this.outer_color="#D8B365";if(b&&a) {this.connect(b,a)}}$.extend(Connector.prototype,{connect:function(b,a){this.handle1=b;this.handle1.connect(this);this.handle2=a;this.handle2.connect(this)},destroy:function(){if(this.handle1){this.handle1.disconnect(this)}if(this.handle2){this.handle2.disconnect(this)}$(this.canvas).remove()},redraw:function(){var d=$("#canvas-container");if(!this.canvas){this.canvas=document.createElement("canvas");if(window.G_vmlCanvasManager){G_vmlCanvasManager.initElement(this.canvas)}d.append($(this.canvas));if(this.dragging){this.canvas.style.zIndex="300"}}var n=function(c){return $(c).offset().left-d.offset().left};var i=function(c){return $(c).offset().top-d.offset().top};var h=n(this.handle1.element)+5;var g=i(this.handle1.element)+5;var p=n(this.handle2.element)+5;var m=i(this.handle2.element)+5;var f=100;var k=Math.min(h,p);var a=Math.max(h,p);var j=Math.min(g,m);var t=Math.max(g,m);var b=Math.min(Math.max(Math.abs(t-j)/2,100),300);var o=k-f;var s=j-f;var q=a-k+2*f;var l=t-j+2*f; this.canvas.style.left=o+"px";this.canvas.style.top=s+"px";this.canvas.setAttribute("width",q);this.canvas.setAttribute("height",l);h-=o;g-=s;p-=o;m-=s;var r=this.canvas.getContext("2d");r.lineCap="round";r.strokeStyle=this.outer_color;r.lineWidth=7;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke();r.strokeStyle=this.inner_color;r.lineWidth=5;r.beginPath();r.moveTo(h,g);r.bezierCurveTo(h+b,g,p-b,m,p,m);r.stroke()}});function Node(a){this.element=a;this.input_terminals={};this.output_terminals={};this.tool_errors={}}$.extend(Node.prototype,{enable_input_terminal:function(d,a,b){var c=this;$(d).each(function(){var f=this.terminal=new InputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dropstart",function(g){g.dragProxy.terminal.connectors[0].inner_color="#BBFFBB"}).bind("dropend",function(g){g.dragProxy.terminal.connectors[0].inner_color="#FFFFFF"}).bind("drop",function(g){(new Connector(g.dragTarget.terminal,g.dropTarget.terminal)).redraw()}).bind("hov er",function(){if(f.connectors.length>0){var g=$("<div class='callout'></div>").css({display:"none"}).appendTo("body").append($("<div class='buttons'></div>").append($("<img src='../images/delete_icon.png' />").click(function(){$.each(f.connectors,function(i,h){h.destroy()});g.remove()}))).bind("mouseleave",function(){$(this).remove()});g.css({top:$(this).offset().top-2,left:$(this).offset().left-g.width(),"padding-right":$(this).width()}).show()}});c.input_terminals[a]=f})},enable_output_terminal:function(d,a,b){var c=this;$(d).each(function(){var g=this;var f=this.terminal=new OutputTerminal(this,b);f.node=c;f.name=a;$(this).bind("dragstart",function(j){var i=$('<div class="drag-terminal" style="position: absolute;"></div>').appendTo("#canvas-container").get(0);i.terminal=new OutputTerminal(i);var k=new Connector();k.dragging=true;k.connect(this.terminal,i.terminal);$.dropManage({filter:function(h){return this.terminal.can_accept(f)}}).addClass("input-terminal-active");ret urn i}).bind("drag",function(i){var h=function(){var k=$(i.dragProxy).offsetParent().offset(),j=i.offsetX-k.left,l=i.offsetY-k.top;$(i.dragProxy).css({left:j,top:l});i.dragProxy.terminal.redraw();canvas_manager.update_viewport_overlay()};h();$("#canvas-container").get(0).scroll_panel.test(i,h)}).bind("dragend",function(h){h.dragProxy.terminal.connectors[0].destroy();$(h.dragProxy).remove();$.dropManage().removeClass("input-terminal-active");$("#canvas-container").get(0).scroll_panel.stop()});c.output_terminals[a]=f})},redraw:function(){$.each(this.input_terminals,function(a,b){b.redraw()});$.each(this.output_terminals,function(a,b){b.redraw()})},destroy:function(){$.each(this.input_terminals,function(a,b){b.destroy()});$.each(this.output_terminals,function(a,b){b.destroy()});workflow.remove_node(this);$(this.element).remove()},make_active:function(){$(this.element).addClass("toolForm-active")},make_inactive:function(){var a=this.element.get(0);(function(b){b.removeChild(a);b .appendChild(a)})(a.parentNode);$(a).removeClass("toolForm-active")},init_field_data:function(g){var d=this.element;if(g.type){this.type=g.type}this.name=g.name;this.form_html=g.form_html;this.tool_state=g.tool_state;this.tool_errors=g.tool_errors;if(this.tool_errors){d.addClass("tool-node-error")}else{d.removeClass("tool-node-error")}var c=this;var a=d.find(".toolFormBody");a.find("div").remove();var h=$("<div class='inputs'></div>").appendTo(a);$.each(g.data_inputs,function(j,b){var f=$("<div class='terminal input-terminal'></div>");c.enable_input_terminal(f,b.name,b.extensions);h.append($("<div class='form-row dataRow input-data-row' name='"+b.name+"'>"+b.label+"</div>").prepend(f))});if((g.data_inputs.length>0)&&(g.data_outputs.length>0)){a.append($("<div class='rule'></div>"))}$.each(g.data_outputs,function(k,b){var j=$("<div class='terminal output-terminal'></div>");c.enable_output_terminal(j,b.name,b.extension);var f=b.name;if(b.extension!="input"){f=f+" ("+b.extensio n+")"}a.append($("<div class='form-row dataRow'>"+f+"</div>").append(j))});workflow.node_changed(this)},update_field_data:function(f){var c=$(this.element),d=this;this.tool_state=f.tool_state;this.form_html=f.form_html;this.tool_errors=f.tool_errors;if(this.tool_errors){c.addClass("tool-node-error")}else{c.removeClass("tool-node-error")}var g=c.find("div.inputs");var b=$("<div class='inputs'></div>");var a=g.find("div.input-data-row");$.each(f.data_inputs,function(k,h){var j=$("<div class='terminal input-terminal'></div>");d.enable_input_terminal(j,h.name,h.extensions);g.find("div[name="+h.name+"]").each(function(){$(this).find(".input-terminal").each(function(){var i=this.terminal.connectors[0];if(i){j[0].terminal.connectors[0]=i;i.handle2=j[0].terminal}});$(this).remove()});b.append($("<div class='form-row dataRow input-data-row' name='"+h.name+"'>"+h.label+"</div>").prepend(j))});g.replaceWith(b);g.find("div.input-data-row > .terminal").each(function(){this.terminal.destr oy()});this.changed();this.redraw()},error:function(d){var a=$(this.element).find(".toolFormBody");a.find("div").remove();var c="<div style='color: red; text-style: italic;'>"+d+"</div>";this.form_html=c;a.html(c);workflow.node_changed(this)},changed:function(){workflow.node_changed(this)}});function Workflow(a){this.canvas_container=a;this.id_counter=0;this.nodes={};this.name=null;this.has_changes=false;this.active_form_has_changes=false}$.extend(Workflow.prototype,{add_node:function(a){a.id=this.id_counter;a.element.attr("id","wf-node-step-"+a.id);this.id_counter++;this.nodes[a.id]=a;this.has_changes=true;a.workflow=this},remove_node:function(a){if(this.active_node==a){this.clear_active_node()}delete this.nodes[a.id];this.has_changes=true},remove_all:function(){wf=this;$.each(this.nodes,function(b,a){a.destroy();wf.remove_node(a)})},to_simple:function(){var a={};$.each(this.nodes,function(b,d){var f={};$.each(d.input_terminals,function(g,h){f[h.name]=null;$.each(h.connecto rs,function(j,k){f[h.name]={id:k.handle1.node.id,output_name:k.handle1.name}})});var c={id:d.id,type:d.type,tool_id:d.tool_id,tool_state:d.tool_state,tool_errors:d.tool_errors,input_connections:f,position:$(d.element).position()};a[d.id]=c});return{steps:a}},from_simple:function(a){wf=this;var b=0;wf.name=a.name;$.each(a.steps,function(f,d){var c=prebuild_node("tool",d.name,d.tool_id);c.init_field_data(d);if(d.position){c.element.css({top:d.position.top,left:d.position.left})}c.id=d.id;wf.nodes[c.id]=c;b=Math.max(b,parseInt(f))});wf.id_counter=b+1;$.each(a.steps,function(f,d){var c=wf.nodes[f];$.each(d.input_connections,function(h,g){if(g){var i=wf.nodes[g.id];var j=new Connector();j.connect(i.output_terminals[g.output_name],c.input_terminals[h]);j.redraw()}})})},enable_auto_save:function(){outer_this=this;$(".toolFormBody").find("input,textarea,select").each(function(){$(this).focus(function(){outer_this.active_form_has_changes=true})})},check_changes_in_active_form:functio n(){if(this.active_form_has_changes){this.has_changes=true;$(".toolFormBody").find("form").each(function(){$(this).submit()});this.active_form_has_changes=false}},clear_active_node:function(){if(this.active_node){this.active_node.make_inactive();this.active_node=null}parent.show_form_for_tool("<div>No node selected</div>")},activate_node:function(a){if(this.active_node!=a){this.check_changes_in_active_form();this.clear_active_node();parent.show_form_for_tool(a.form_html,a);a.make_active();this.active_node=a}},node_changed:function(a){this.has_changes=true;if(this.active_node==a){parent.show_form_for_tool(a.form_html,a)}},layout:function(){this.check_changes_in_active_form();var i={};var b={};$.each(this.nodes,function(l,k){if(i[l]===undefined){i[l]=0}if(b[l]===undefined){b[l]=[]}});$.each(this.nodes,function(l,k){$.each(k.input_terminals,function(m,n){$.each(n.connectors,function(p,q){var o=q.handle1.node;i[k.id]+=1;b[o.id].push(k.id)})})});node_ids_by_level=[];while(true){l evel_parents=[];for(var a in i){if(i[a]==0){level_parents.push(a)}}if(level_parents.length==0){break}node_ids_by_level.push(level_parents);for(var f in level_parents){var j=level_parents[f];delete i[j];for(var g in b[j]){i[b[j][g]]-=1}}}if(i.length){return}var d=this.nodes;var h=80;v_pad=30;var c=h;$.each(node_ids_by_level,function(k,l){l.sort(function(p,o){return $(d[p].element).position().top-$(d[o].element).position().top});var m=0;var n=v_pad;$.each(l,function(o,r){var q=d[r];var p=$(q.element);$(p).css({top:n,left:c});m=Math.max(m,$(p).width());n+=$(p).height()+v_pad});c+=m+h});$.each(d,function(k,l){l.redraw()})},bounds_for_all_nodes:function(){var d=Infinity,b=-Infinity,c=Infinity,a=-Infinity,f;$.each(this.nodes,function(h,g){e=$(g.element);f=e.position();d=Math.min(d,f.left);b=Math.max(b,f.left+e.width());c=Math.min(c,f.top);a=Math.max(a,f.top+e.width())});return{xmin:d,xmax:b,ymin:c,ymax:a}},fit_canvas_to_nodes:function(){var a=this.bounds_for_all_nodes();var f=this .canvas_container.position();var i=this.canvas_container.parent();var d=fix_delta(a.xmin,100);var h=fix_delta(a.ymin,100);d=Math.max(d,f.left);h=Math.max(h,f.top);var c=f.left-d;var g=f.top-h;var b=round_up(a.xmax+100,100)+d;var j=round_up(a.ymax+100,100)+h;b=Math.max(b,-c+i.width());j=Math.max(j,-g+i.height());this.canvas_container.css({left:c,top:g,width:b,height:j});this.canvas_container.children().each(function(){var k=$(this).position();$(this).css("left",k.left+d);$(this).css("top",k.top+h)})}});function fix_delta(a,b){if(a<b||a>3*b){new_pos=(Math.ceil(((a%b))/b)+1)*b;return(-(a-new_pos))}return 0}function round_up(a,b){return Math.ceil(a/b)*b}function prebuild_node(l,j,r){var i=$("<div class='toolForm toolFormInCanvas'></div>");var g=new Node(i);g.type=l;if(l=="tool"){g.tool_id=r}var n=$("<div class='toolFormTitle unselectable'>"+j+"</div>");i.append(n);i.css("left",$(window).scrollLeft()+20);i.css("top",$(window).scrollTop()+20);var m=$("<div class='toolFormBody'></d iv>");var h="<div><img height='16' align='middle' src='../images/loading_small_white_bg.gif'/> loading tool info...</div>";m.append(h);g.form_html=h;i.append(m);var k=$("<div class='buttons' style='float: right;'></div>");k.append($("<img src='../images/delete_icon.png' />").click(function(b){g.destroy()}).hover(function(){$(this).attr("src","../images/delete_icon_dark.png")},function(){$(this).attr("src","../images/delete_icon.png")}));i.appendTo("#canvas-container");var d=$("#canvas-container").position();var c=$("#canvas-container").parent();var a=i.width();var q=i.height();i.css({left:(-d.left)+(c.width()/2)-(a/2),top:(-d.top)+(c.height()/2)-(q/2)});k.prependTo(n);a+=(k.width()+10);i.css("width",a);$(i).bind("dragstart",function(){workflow.activate_node(g)}).bind("dragend",function(){workflow.node_changed(this);workflow.fit_canvas_to_nodes();canvas_manager.draw_overview()}).bind("dragclickonly",function(){workflow.activate_node(g)}).bind("drag",function(o){var f=$(this). offsetParent().offset(),b=o.offsetX-f.left,p=o.offsetY-f.top;$(this).css({left:b,top:p});$(this).find(".terminal").each(function(){this.terminal.redraw()})});return g}var ext_to_type=null;var type_to_type=null;function issubtype(b,a){b=ext_to_type[b];a=ext_to_type[a];return(type_to_type[b])&&(a in type_to_type[b])}function populate_datatype_info(a){ext_to_type=a.ext_to_class_name;type_to_type=a.class_to_classes}function ScrollPanel(a){this.panel=a}$.extend(ScrollPanel.prototype,{test:function(v,d){clearTimeout(this.timeout);var k=v.pageX,j=v.pageY,l=$(this.panel),c=l.position(),b=l.width(),i=l.height(),w=l.parent(),s=w.width(),a=w.height(),r=w.offset(),p=r.left,m=r.top,A=p+w.width(),u=m+w.height(),B=-(b-(s/2)),z=-(i-(a/2)),g=(s/2),f=(a/2),h=false,q=5,o=23;if(k-q<p){if(c.left<g){var n=Math.min(o,g-c.left);l.css("left",c.left+n);h=true}}else{if(k+q>A){if(c.left>B){var n=Math.min(o,c.left-B);l.css("left",c.left-n);h=true}}else{if(j-q<m){if(c.top<f){var n=Math.min(o,f-c.top);l.c ss("top",c.top+n);h=true}}else{if(j+q>u){if(c.top>z){var n=Math.min(o,c.top-B);l.css("top",(c.top-n)+"px");h=true}}}}}if(h){d();var l=this;this.timeout=setTimeout(function(){l.test(v,d)},50)}},stop:function(b,a){clearTimeout(this.timeout)}});function CanvasManager(b,a){this.cv=b;this.cc=this.cv.find("#canvas-container");this.oc=a.find("#overview-canvas");this.ov=a.find("#overview-viewport");this.init_drag()}$.extend(CanvasManager.prototype,{init_drag:function(){var b=this;var a=function(f,g){f=Math.min(f,b.cv.width()/2);f=Math.max(f,-b.cc.width()+b.cv.width()/2);g=Math.min(g,b.cv.height()/2);g=Math.max(g,-b.cc.height()+b.cv.height()/2);b.cc.css({left:f,top:g});b.update_viewport_overlay()};this.cc.each(function(){this.scroll_panel=new ScrollPanel(this)});var d,c;this.cv.bind("dragstart",function(g){var h=$(this).offset();var f=b.cc.position();c=f.top-h.top;d=f.left-h.left}).bind("drag",function(f){a(f.offsetX+d,f.offsetY+c)}).bind("dragend",function(){workflow.fit_canvas_to_n odes();b.draw_overview()});this.ov.bind("drag",function(k){var j=b.cc.width(),g=b.cc.height(),f=b.oc.width(),h=b.oc.height(),i=$(this).offsetParent().offset(),m=k.offsetX-i.left,l=k.offsetY-i.top;a(-(m/f*j),-(l/h*g))}).bind("dragend",function(){workflow.fit_canvas_to_nodes();b.draw_overview()});$("#overview-border").bind("drag",function(g){var i=$(this).offsetParent();var h=i.offset();var f=Math.max(i.width()-(g.offsetX-h.left),i.height()-(g.offsetY-h.top));$(this).css({width:f,height:f});b.draw_overview()});$("#overview-border div").bind("drag",function(f){})},update_viewport_overlay:function(){var b=this.cc,f=this.cv,a=this.oc,c=this.ov,d=b.width(),j=b.height(),i=a.width(),g=a.height(),h=b.position();c.css({left:-(h.left/d*i),top:-(h.top/j*g),width:(f.width()/d*i)-2,height:(f.height()/j*g)-2})},draw_overview:function(){var j=$("#overview-canvas"),m=j.parent().parent().width(),i=j.get(0).getContext("2d"),d=$("#canvas-container").width(),l=$("#canvas-container").height();var g,a,k,f;var h=this.cv.width();var b=this.cv.height();if(d<h&&l<b){k=d/h*m;f=(m-k)/2;g=l/b*m;a=(m-g)/2}else{if(d<l){a=0;g=m;k=Math.ceil(g*d/l);f=(m-k)/2}else{k=m;f=0;g=Math.ceil(k*l/d);a=(m-g)/2}}j.parent().css({left:f,top:a,width:k,height:g});j.attr("width",k);j.attr("height",g);i.fillStyle="#D2C099";i.strokeStyle="#D8B365";i.lineWidth=1;$.each(workflow.nodes,function(t,q){var s=$(q.element),n=s.position(),c=n.left/d*k,r=n.top/l*g,o=s.width()/d*k,p=s.height()/l*g;i.fillRect(c,r,o,p);i.strokeRect(c,r,o,p)});this.update_viewport_overlay()}}); \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/packed/jquery.jstore-all.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/jquery.jstore-all.js Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,41 @@ +/* + * jStore - Persistent Client-Side Storage + * + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * + * Dual licensed under: + * MIT: http://www.opensource.org/licenses/mit-license.php + * GPLv3: http://www.opensource.org/licenses/gpl-3.0.html + */ +(function(){var a=false,b=/xyz/.test(function(){xyz})?/\b_super\b/:/.*/;this.Class=function(){};Class.extend=function(g){var f=this.prototype;a=true;var e=new this();a=false;for(var d in g){e[d]=typeof g[d]=="function"&&typeof f[d]=="function"&&b.test(g[d])?(function(h,i){return function(){var k=this._super;this._super=f[h];var j=i.apply(this,arguments);this._super=k;return j}})(d,g[d]):g[d]}function c(){if(!a&&this.init){this.init.apply(this,arguments)}}c.prototype=e;c.constructor=c;c.extend=arguments.callee;return c}})(); +/* + * jStore Delegate Framework + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(a){this.jStoreDelegate=Class.extend({init:function(b){this.parent=b;this.callbacks={}},bind:function(b,c){if(!a.isFunction(c)){return this}if(!this.callbacks[b]){this.callbacks[b]=[]}this.callbacks[b].push(c);return this},trigger:function(){var d=this.parent,c=[].slice.call(arguments),e=c.shift(),b=this.callbacks[e];if(!b){return false}a.each(b,function(){this.apply(d,c)});return this}})})(jQuery);(function(a){a.jStore={};a.extend(a.jStore,{EngineOrder:[],Availability:{},Engines:{},Instances:{},CurrentEngine:null,defaults:{project:null,engine:null,autoload:true,flash:"jStore.Flash.html"},isReady:false,isFlashReady:false,delegate:new jStoreDelegate(a.jStore).bind("jStore-ready",function(b){a.jStore.isReady=true;if(a.jStore.defaults.autoload){b.connect()}}).bind("flash-ready",function(){a.jStore.isFlashReady=true})});a.jStore.ready=function(b){if(a.jStore.isReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("jStore-ready",b)}};a.jStore.fail =function(b){a.jStore.delegate.bind("jStore-failure",b)};a.jStore.flashReady=function(b){if(a.jStore.isFlashReady){b.apply(a.jStore,[a.jStore.CurrentEngine])}else{a.jStore.delegate.bind("flash-ready",b)}};a.jStore.use=function(d,g,c){g=g||a.jStore.defaults.project||location.hostname.replace(/\./g,"-")||"unknown";var f=a.jStore.Engines[d.toLowerCase()]||null,b=(c?c+".":"")+g+"."+d;if(!f){throw"JSTORE_ENGINE_UNDEFINED"}f=new f(g,b);if(a.jStore.Instances[b]){throw"JSTORE_JRI_CONFLICT"}if(f.isAvailable()){a.jStore.Instances[b]=f;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=f}a.jStore.delegate.trigger("jStore-ready",f)}else{if(!f.autoload){throw"JSTORE_ENGINE_UNAVILABLE"}else{f.included(function(){if(this.isAvailable()){a.jStore.Instances[b]=this;if(!a.jStore.CurrentEngine){a.jStore.CurrentEngine=this}a.jStore.delegate.trigger("jStore-ready",this)}else{a.jStore.delegate.trigger("jStore-failure",this)}}).include()}}};a.jStore.setCurrentEngine=function(b){if(!a.jStore.Instanc es.length){return a.jStore.FindEngine()}if(!b&&a.jStore.Instances.length>=1){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[0]);return a.jStore.CurrentEngine=a.jStore.Instances[0]}if(b&&a.jStore.Instances[b]){a.jStore.delegate.trigger("jStore-ready",a.jStore.Instances[b]);return a.jStore.CurrentEngine=a.jStore.Instances[b]}throw"JSTORE_JRI_NO_MATCH"};a.jStore.FindEngine=function(){a.each(a.jStore.EngineOrder,function(b){if(a.jStore.Availability[this]()){a.jStore.use(this,a.jStore.defaults.project,"default");return false}})};a.jStore.store=function(b,c){if(!a.jStore.CurrentEngine){return false}if(!c){return a.jStore.CurrentEngine.get(b)}return a.jStore.CurrentEngine.set(b,c)};a.jStore.remove=function(b){if(!a.jStore.CurrentEngine){return false}return a.jStore.CurrentEngine.rem(b)};a.fn.store=function(c,d){if(!a.jStore.CurrentEngine){return this}var b=a.jStore.store(c,d);return !d?b:this};a.fn.removeStore=function(b){a.jStore.remove(b);return this};a.jStore.load=f unction(){if(a.jStore.defaults.engine){return a.jStore.use(a.jStore.defaults.engine,a.jStore.defaults.project,"default")}try{a.jStore.FindEngine()}catch(b){}}})(jQuery);(function(a){this.StorageEngine=Class.extend({init:function(c,b){this.project=c;this.jri=b;this.data={};this.limit=-1;this.includes=[];this.delegate=new jStoreDelegate(this).bind("engine-ready",function(){this.isReady=true}).bind("engine-included",function(){this.hasIncluded=true});this.autoload=false;this.isReady=false;this.hasIncluded=false},include:function(){var b=this,d=this.includes.length,c=0;a.each(this.includes,function(){a.ajax({type:"get",url:this,dataType:"script",cache:true,success:function(){c++;if(c==d){b.delegate.trigger("engine-included")}}})})},isAvailable:function(){return false},ready:function(b){if(this.isReady){b.apply(this)}else{this.delegate.bind("engine-ready",b)}return this},included:function(b){if(this.hasIncluded){b.apply(this)}else{this.delegate.bind("engine-included",b)}return th is},get:function(b){return this.data[b]||null},set:function(b,c){this.data[b]=c;return c},rem:function(b){var c=this.data[b];this.data[b]=null;return c}})})(jQuery); +/* + * jStore DOM Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(c){var b=c.jStore.Availability.session=function(){return !!window.sessionStorage},a=c.jStore.Availability.local=function(){return !!(window.localStorage||window.globalStorage)};this.jStoreDom=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="DOM";this.limit=5*1024*1024},connect:function(){this.delegate.trigger("engine-ready")},get:function(e){var d=this.db.getItem(e);return d&&d.value?d.value:d},set:function(d,e){this.db.setItem(d,e);return e},rem:function(e){var d=this.get(e);this.db.removeItem(e);return d}});this.jStoreLocal=jStoreDom.extend({connect:function(){this.db=!window.globalStorage?window.localStorage:window.globalStorage[location.hostname];this._super()},isAvailable:a});this.jStoreSession=jStoreDom.extend({connect:function(){this.db=sessionStorage;this._super()},isAvailable:b});c.jStore.Engines.local=jStoreLocal;c.jStore.Engines.session=jStoreSession;c.jStore.EngineOrder[1]="local"})(jQuery); +/* + * jStore Flash Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + * jStore.swf Copyright (c) 2008 Daniel Bulli (http://www.nuff-respec.com) + */ +(function(b){var a=b.jStore.Availability.flash=function(){return !!(b.jStore.hasFlash("8.0.0"))};this.jStoreFlash=StorageEngine.extend({init:function(e,d){this._super(e,d);this.type="Flash";var c=this;b.jStore.flashReady(function(){c.flashReady()})},connect:function(){var c="jstore-flash-embed-"+this.project;b(document.body).append('<iframe style="height:1px;width:1px;position:absolute;left:0;top:0;margin-left:-100px;" id="jStoreFlashFrame" src="'+b.jStore.defaults.flash+'"></iframe>')},flashReady:function(f){var c=b("#jStoreFlashFrame")[0];if(c.Document&&b.isFunction(c.Document.jStoreFlash.f_get_cookie)){this.db=c.Document.jStoreFlash}else{if(c.contentWindow&&c.contentWindow.document){var d=c.contentWindow.document;if(b.isFunction(b("object",b(d))[0].f_get_cookie)){this.db=b("object",b(d))[0]}else{if(b.isFunction(b("embed",b(d))[0].f_get_cookie)){this.db=b("embed",b(d))[0]}}}}if(this.db){this.delegate.trigger("engine-ready")}},isAvailable:a,get:function(d){var c=this.db.f_g et_cookie(d);return c=="null"?null:c},set:function(c,d){this.db.f_set_cookie(c,d);return d},rem:function(c){var d=this.get(c);this.db.f_delete_cookie(c);return d}});b.jStore.Engines.flash=jStoreFlash;b.jStore.EngineOrder[2]="flash";b.jStore.hasFlash=function(c){var e=b.jStore.flashVersion().match(/\d+/g),f=c.match(/\d+/g);for(var d=0;d<3;d++){e[d]=parseInt(e[d]||0);f[d]=parseInt(f[d]||0);if(e[d]<f[d]){return false}if(e[d]>f[d]){return true}}return true};b.jStore.flashVersion=function(){try{try{var c=new ActiveXObject("ShockwaveFlash.ShockwaveFlash.6");try{c.AllowScriptAccess="always"}catch(d){return"6,0,0"}}catch(d){}return new ActiveXObject("ShockwaveFlash.ShockwaveFlash").GetVariable("$version").replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}catch(d){try{if(navigator.mimeTypes["application/x-shockwave-flash"].enabledPlugin){return(navigator.plugins["Shockwave Flash 2.0"]||navigator.plugins["Shockwave Flash"]).description.replace(/\D+/g,",").match(/^,?(.+),?$/)[1]}}catch(d){}}r eturn"0,0,0"}})(jQuery);function flash_ready(){$.jStore.delegate.trigger("flash-ready")} +/* + * jStore Google Gears Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.gears=function(){return !!(window.google&&window.google.gears)};this.jStoreGears=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="Google Gears";this.includes.push("http://code.google.com/apis/gears/gears_init.js");this.autoload=true},connect:function(){var c=this.db=google.gears.factory.create("beta.database");c.open("jstore-"+this.project);c.execute("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)");this.updateCache()},updateCache:function(){var c=this.db.execute("SELECT k,v FROM jstore");while(c.isValidRow()){this.data[c.field(0)]=c.field(1);c.next()}c.close();this.delegate.trigger("engine-ready")},isAvailable:a,set:function(d,e){var c=this.db;c.execute("BEGIN");c.execute("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[d,e]);c.execute("COMMIT");return this._super(d,e)},rem:function(d){var c=this.db;c.execute("BEGIN");c.execute("DELETE FROM jstore WHERE k = ?",[d]);c.ex ecute("COMMIT");return this._super(d)}});b.jStore.Engines.gears=jStoreGears;b.jStore.EngineOrder[3]="gears"})(jQuery); +/* + * jStore HTML5 Specification Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.html5=function(){return !!window.openDatabase};this.jStoreHtml5=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="HTML5";this.limit=1024*200},connect:function(){var c=this.db=openDatabase("jstore-"+this.project,"1.0",this.project,this.limit);if(!c){throw"JSTORE_ENGINE_HTML5_NODB"}c.transaction(function(d){d.executeSql("CREATE TABLE IF NOT EXISTS jstore (k TEXT UNIQUE NOT NULL PRIMARY KEY, v TEXT NOT NULL)")});this.updateCache()},updateCache:function(){var c=this;this.db.transaction(function(d){d.executeSql("SELECT k,v FROM jstore",[],function(f,e){var h=e.rows,g=0,j;for(;g<h.length;++g){j=h.item(g);c.data[j.k]=j.v}c.delegate.trigger("engine-ready")})})},isAvailable:a,set:function(c,d){this.db.transaction(function(e){e.executeSql("INSERT OR REPLACE INTO jstore(k, v) VALUES (?, ?)",[c,d])});return this._super(c,d)},rem:function(c){this.db.transaction(function(d){d.executeSql("DELETE FROM jstore WHERE k = ?",[c])});ret urn this._super(c)}});b.jStore.Engines.html5=jStoreHtml5;b.jStore.EngineOrder[0]="html5"})(jQuery); +/** + * jStore IE Storage Engine + * Copyright (c) 2009 Eric Garside (http://eric.garside.name) + */ +(function(b){var a=b.jStore.Availability.ie=function(){return !!window.ActiveXObject};this.jStoreIE=StorageEngine.extend({init:function(d,c){this._super(d,c);this.type="IE";this.limit=64*1024},connect:function(){this.db=b('<div style="display:none;behavior:url(\'#default#userData\')" id="jstore-'+this.project+'"></div>').appendTo(document.body).get(0);this.delegate.trigger("engine-ready")},isAvailable:a,get:function(c){this.db.load(this.project);return this.db.getAttribute(c)},set:function(c,d){this.db.setAttribute(c,d);this.db.save(this.project);return d},rem:function(c){var d=this.get(c);this.db.removeAttribute(c);this.db.save(this.project);return d}});b.jStore.Engines.ie=jStoreIE;b.jStore.EngineOrder[4]="ie"})(jQuery); \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 static/scripts/packed/json2.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/packed/json2.js Wed Aug 19 17:51:46 2009 -0400 @@ -0,0 +1,1 @@ +var JSON=JSON||{};(function(){function f(n){return n<10?"0"+n:n}if(typeof Date.prototype.toJSON!=="function"){Date.prototype.toJSON=function(key){return isFinite(this.valueOf())?this.getUTCFullYear()+"-"+f(this.getUTCMonth()+1)+"-"+f(this.getUTCDate())+"T"+f(this.getUTCHours())+":"+f(this.getUTCMinutes())+":"+f(this.getUTCSeconds())+"Z":null};String.prototype.toJSON=Number.prototype.toJSON=Boolean.prototype.toJSON=function(key){return this.valueOf()}}var cx=/[\u0000\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,escapable=/[\\\"\x00-\x1f\x7f-\x9f\u00ad\u0600-\u0604\u070f\u17b4\u17b5\u200c-\u200f\u2028-\u202f\u2060-\u206f\ufeff\ufff0-\uffff]/g,gap,indent,meta={"\b":"\\b","\t":"\\t","\n":"\\n","\f":"\\f","\r":"\\r",'"':'\\"',"\\":"\\\\"},rep;function quote(string){escapable.lastIndex=0;return escapable.test(string)?'"'+string.replace(escapable,function(a){var c=meta[a];return typeof c==="string"?c:"\\u"+("0000"+a.charCodeAt(0) .toString(16)).slice(-4)})+'"':'"'+string+'"'}function str(key,holder){var i,k,v,length,mind=gap,partial,value=holder[key];if(value&&typeof value==="object"&&typeof value.toJSON==="function"){value=value.toJSON(key)}if(typeof rep==="function"){value=rep.call(holder,key,value)}switch(typeof value){case"string":return quote(value);case"number":return isFinite(value)?String(value):"null";case"boolean":case"null":return String(value);case"object":if(!value){return"null"}gap+=indent;partial=[];if(Object.prototype.toString.apply(value)==="[object Array]"){length=value.length;for(i=0;i<length;i+=1){partial[i]=str(i,value)||"null"}v=partial.length===0?"[]":gap?"[\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"]":"["+partial.join(",")+"]";gap=mind;return v}if(rep&&typeof rep==="object"){length=rep.length;for(i=0;i<length;i+=1){k=rep[i];if(typeof k==="string"){v=str(k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}else{for(k in value){if(Object.hasOwnProperty.call(value,k)){v=str( k,value);if(v){partial.push(quote(k)+(gap?": ":":")+v)}}}}v=partial.length===0?"{}":gap?"{\n"+gap+partial.join(",\n"+gap)+"\n"+mind+"}":"{"+partial.join(",")+"}";gap=mind;return v}}if(typeof JSON.stringify!=="function"){JSON.stringify=function(value,replacer,space){var i;gap="";indent="";if(typeof space==="number"){for(i=0;i<space;i+=1){indent+=" "}}else{if(typeof space==="string"){indent=space}}rep=replacer;if(replacer&&typeof replacer!=="function"&&(typeof replacer!=="object"||typeof replacer.length!=="number")){throw new Error("JSON.stringify")}return str("",{"":value})}}if(typeof JSON.parse!=="function"){JSON.parse=function(text,reviver){var j;function walk(holder,key){var k,v,value=holder[key];if(value&&typeof value==="object"){for(k in value){if(Object.hasOwnProperty.call(value,k)){v=walk(value,k);if(v!==undefined){value[k]=v}else{delete value[k]}}}}return reviver.call(holder,key,value)}cx.lastIndex=0;if(cx.test(text)){text=text.replace(cx,function(a){return"\\u"+("000 0"+a.charCodeAt(0).toString(16)).slice(-4)})}if(/^[\],:{}\s]*$/.test(text.replace(/\\(?:["\\\/bfnrt]|u[0-9a-fA-F]{4})/g,"@").replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(?:[eE][+\-]?\d+)?/g,"]").replace(/(?:^|:|,)(?:\s*\[)+/g,""))){j=eval("("+text+")");return typeof reviver==="function"?walk({"":j},""):j}throw new SyntaxError("JSON.parse")}}}()); \ No newline at end of file diff -r 7d48dc7e60b4 -r 3353b15d0fb5 templates/root/history.mako --- a/templates/root/history.mako Wed Aug 19 11:08:58 2009 -0400 +++ b/templates/root/history.mako Wed Aug 19 17:51:46 2009 -0400 @@ -15,219 +15,242 @@ <meta http-equiv="Pragma" content="no-cache"> ${h.css( "base", "history" )} -${h.js( "jquery", "jquery.cookie", "cookie_set" )} - +${h.js( "jquery", "json2", "jquery.jstore-all" )} + <script type="text/javascript"> - $( document ).ready( function() { - initShowHide(); - setupHistoryItem( $("div.historyItemWrapper") ); - // Collapse all - $("#top-links").append( "| " ).append( $("<a href='#'>${_('collapse all')}</a>").click( function() { - $( "div.historyItemBody:visible" ).each( function() { - if ( $.browser.mozilla ) - { - $(this).find( "pre.peek" ).css( "overflow", "hidden" ); +$(function() { + // Load jStore for local storage + $.extend(jQuery.jStore.defaults, { project: 'galaxy', flash: '/static/jStore.Flash.html' }) + $.jStore.load(); // Auto-select best storage + + $.jStore.ready(function(engine) { + engine.ready(function() { + // Init stuff that requires the local storage to be running + initShowHide(); + setupHistoryItem( $("div.historyItemWrapper") ); + }); + }); + + // Generate 'collapse all' link + $("#top-links").append( "| " ).append( $("<a href='#'>${_('collapse all')}</a>").click( function() { + $( "div.historyItemBody:visible" ).each( function() { + if ( $.browser.mozilla ) { + $(this).find( "pre.peek" ).css( "overflow", "hidden" ); + } + $(this).slideUp( "fast" ); + }); + $.jStore.remove("history_expand_state"); + })); + + $("#history-rename").click( function() { + var old_name = $("#history-name").text() + var t = $("<input type='text' value='" + old_name + "'></input>" ); + t.blur( function() { + $(this).remove(); + $("#history-name").show(); + }); + t.keyup( function( e ) { + if ( e.keyCode == 27 ) { + // Escape key + $(this).trigger( "blur" ); + } else if ( e.keyCode == 13 ) { + // Enter key + new_value = this.value; + $(this).trigger( "blur" ); + $.ajax({ + url: "${h.url_for( controller='history', action='rename_async', id=history.id )}", + data: { "_": true, new_name: new_value }, + error: function() { alert( "Rename failed" ) }, + success: function() { + $("#history-name").text( new_value ); + } + }); + } + }); + $("#history-name").hide(); + $("#history-name-area").append( t ); + t.focus(); + return false; + }); + // Updater + updater({ + %for i, data in enumerate( reversed( datasets ) ): + %if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]: + %if i > 0: + , + %endif + "${data.id}": "${data.state}" + %endif + %endfor + }); +}); +// Functionized so AJAX'd datasets can call them +// Get shown/hidden state from cookie +function initShowHide() { + + // Load saved state and show as neccesary + try { + var stored = $.jStore.store("history_expand_state"); + if (stored) { + var st = JSON.parse(stored); + for (var id in st) { + $("#" + id + " div.historyItemBody" ).show(); + } + } + } catch(err) { + // Something was wrong with values in storage, so clear storage + $.jStore.remove("history_expand_state"); + } + + // If Mozilla, hide scrollbars in hidden items since they cause animation bugs + if ( $.browser.mozilla ) { + $( "div.historyItemBody" ).each( function() { + if ( ! $(this).is( ":visible" ) ) $(this).find( "pre.peek" ).css( "overflow", "hidden" ); + }) + } +} +// Add show/hide link and delete link to a history item +function setupHistoryItem( query ) { + query.each( function() { + var id = this.id; + var body = $(this).children( "div.historyItemBody" ); + var peek = body.find( "pre.peek" ) + $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() { + if ( body.is(":visible") ) { + // Hiding stuff here + if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) } + body.slideUp( "fast" ); + + // Save setting + var stored = $.jStore.store("history_expand_state") + var prefs = stored ? JSON.parse(stored) : null + if (prefs) { + delete prefs[id]; + $.jStore.store("history_expand_state", JSON.stringify(prefs)); } - $(this).slideUp( "fast" ); - }) - var state = new CookieSet( "galaxy.history.expand_state" ); - state.removeAll().save(); - return false; - })); - $("#history-rename").click( function() { - var old_name = $("#history-name").text() - var t = $("<input type='text' value='" + old_name + "'></input>" ); - t.blur( function() { - $(this).remove(); - $("#history-name").show(); - }); - t.keyup( function( e ) { - if ( e.keyCode == 27 ) { - // Escape key - $(this).trigger( "blur" ); - } else if ( e.keyCode == 13 ) { - // Enter key - new_value = this.value; - $(this).trigger( "blur" ); - $.ajax({ - url: "${h.url_for( controller='history', action='rename_async', id=history.id )}", - data: { "_": true, new_name: new_value }, - error: function() { alert( "Rename failed" ) }, - success: function() { - $("#history-name").text( new_value ); - } - }); - } - }); - $("#history-name").hide(); - $("#history-name-area").append( t ); - t.focus(); - return false; - }); - // Updater - updater({ - %for i, data in enumerate( reversed( datasets ) ): - %if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]: - %if i > 0: - , - %endif - "${data.id}": "${data.state}" - %endif - %endfor + } + else { + // Showing stuff here + body.slideDown( "fast", function() { + if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); } + }); + + // Save setting + var stored = $.jStore.store("history_expand_state") + var prefs = stored ? JSON.parse(stored) : new Object; + prefs[id] = true; + $.jStore.store("history_expand_state", JSON.stringify(prefs)); + } + return false; }); - }) - //' Functionized so AJAX'd datasets can call them - // Get shown/hidden state from cookie - function initShowHide() { - // $( "div.historyItemBody" ).hide(); - // Load saved state and show as neccesary - var state = new CookieSet( "galaxy.history.expand_state" ); - for ( id in state.store ) { - if ( id ) { - $( "#" + id + " div.historyItemBody" ).show(); - } - } - // If Mozilla, hide scrollbars in hidden items since they cause animation bugs - if ( $.browser.mozilla ) { - $( "div.historyItemBody" ).each( function() { - if ( ! $(this).is( ":visible" ) ) $(this).find( "pre.peek" ).css( "overflow", "hidden" ); - }) - } - delete state; - } - // Add show/hide link and delete link to a history item - function setupHistoryItem( query ) { - query.each( function() { - var id = this.id; - var body = $(this).children( "div.historyItemBody" ); - var peek = body.find( "pre.peek" ) - $(this).children( ".historyItemTitleBar" ).find( ".historyItemTitle" ).wrap( "<a href='#'></a>" ).click( function() { - if ( body.is(":visible") ) { - if ( $.browser.mozilla ) { peek.css( "overflow", "hidden" ) } - body.slideUp( "fast" ); - ## other instances of this could be editing the cookie, refetch - var state = new CookieSet( "galaxy.history.expand_state" ); - state.remove( id ); state.save(); - delete state; - } - else { - body.slideDown( "fast", function() { - if ( $.browser.mozilla ) { peek.css( "overflow", "auto" ); } - }); - var state = new CookieSet( "galaxy.history.expand_state" ); - state.add( id ); state.save(); - delete state; - } + // Delete link + $(this).find( "div.historyItemButtons > .delete" ).each( function() { + var data_id = this.id.split( "-" )[1]; + $(this).click( function() { + $( '#historyItem-' + data_id + "> div.historyItemTitleBar" ).addClass( "spinner" ); + $.ajax({ + url: "${h.url_for( action='delete_async', id='XXX' )}".replace( 'XXX', data_id ), + error: function() { alert( "Delete failed" ) }, + success: function() { + %if show_deleted: + var to_update = {}; + to_update[data_id] = "none"; + updater( to_update ); + %else: + $( "#historyItem-" + data_id ).fadeOut( "fast", function() { + $( "#historyItemContainer-" + data_id ).remove(); + if ( $( "div.historyItemContainer" ).length < 1 ) { + $( "#emptyHistoryMessage" ).show(); + } + }); + %endif + } + }); return false; }); - // Delete link - $(this).find( "div.historyItemButtons > .delete" ).each( function() { - var data_id = this.id.split( "-" )[1]; - $(this).click( function() { - $( '#historyItem-' + data_id + "> div.historyItemTitleBar" ).addClass( "spinner" ); - $.ajax({ - url: "${h.url_for( action='delete_async', id='XXX' )}".replace( 'XXX', data_id ), - error: function() { alert( "Delete failed" ) }, - success: function() { - %if show_deleted: - var to_update = {}; - to_update[data_id] = "none"; - updater( to_update ); - %else: - $( "#historyItem-" + data_id ).fadeOut( "fast", function() { - $( "#historyItemContainer-" + data_id ).remove(); - if ( $( "div.historyItemContainer" ).length < 1 ) { - $( "#emptyHistoryMessage" ).show(); - } - }); - %endif - } - }); - return false; + }); + // Undelete link + $(this).find( "a.historyItemUndelete" ).each( function() { + var data_id = this.id.split( "-" )[1]; + $(this).click( function() { + $( '#historyItem-' + data_id + " > div.historyItemTitleBar" ).addClass( "spinner" ); + $.ajax({ + url: "${h.url_for( controller='dataset', action='undelete_async', id='XXX' )}".replace( 'XXX', data_id ), + error: function() { alert( "Undelete failed" ) }, + success: function() { + var to_update = {}; + to_update[data_id] = "none"; + updater( to_update ); + } }); - }); - // Undelete link - $(this).find( "a.historyItemUndelete" ).each( function() { - var data_id = this.id.split( "-" )[1]; - $(this).click( function() { - $( '#historyItem-' + data_id + " > div.historyItemTitleBar" ).addClass( "spinner" ); - $.ajax({ - url: "${h.url_for( controller='dataset', action='undelete_async', id='XXX' )}".replace( 'XXX', data_id ), - error: function() { alert( "Undelete failed" ) }, - success: function() { - var to_update = {}; - to_update[data_id] = "none"; - updater( to_update ); - } - }); - return false; - }); + return false; }); }); - }; - // Looks for changes in dataset state using an async request. Keeps - // calling itself (via setTimeout) until all datasets are in a terminal - // state. - var updater = function ( tracked_datasets ) { - // Check if there are any items left to track - var empty = true; - for ( i in tracked_datasets ) { - empty = false; - break; + }); +}; +// Looks for changes in dataset state using an async request. Keeps +// calling itself (via setTimeout) until all datasets are in a terminal +// state. +var updater = function ( tracked_datasets ) { + // Check if there are any items left to track + var empty = true; + for ( i in tracked_datasets ) { + empty = false; + break; + } + if ( ! empty ) { + // console.log( "Updater running in 3 seconds" ); + setTimeout( function() { updater_callback( tracked_datasets ) }, 3000 ); + } else { + // console.log( "Updater finished" ); + } +}; +var updater_callback = function ( tracked_datasets ) { + // Build request data + var ids = [] + var states = [] + var force_history_refresh = false + $.each( tracked_datasets, function ( id, state ) { + ids.push( id ); + states.push( state ); + }); + // Make ajax call + $.ajax( { + type: "POST", + url: "${h.url_for( controller='root', action='history_item_updates' )}", + dataType: "json", + data: { ids: ids.join( "," ), states: states.join( "," ) }, + success : function ( data ) { + $.each( data, function( id, val ) { + // Replace HTML + var container = $("#historyItemContainer-" + id); + container.html( val.html ); + setupHistoryItem( container.children( ".historyItemWrapper" ) ); + initShowHide(); + // If new state was terminal, stop tracking + if (( val.state == "ok") || ( val.state == "error") || ( val.state == "empty") || ( val.state == "deleted" ) || ( val.state == "discarded" )) { + if ( val.force_history_refresh ){ + force_history_refresh = true; + } + delete tracked_datasets[ parseInt(id) ]; + } else { + tracked_datasets[ parseInt(id) ] = val.state; + } + }); + if ( force_history_refresh ) { + parent.frames.galaxy_history.location.reload(); + } + else { + // Keep going (if there are still any items to track) + updater( tracked_datasets ); + } + }, + error: function() { + // Just retry, like the old method, should try to be smarter + updater( tracked_datasets ); } - if ( ! empty ) { - // console.log( "Updater running in 3 seconds" ); - setTimeout( function() { updater_callback( tracked_datasets ) }, 3000 ); - } else { - // console.log( "Updater finished" ); - } - }; - var updater_callback = function ( tracked_datasets ) { - // Build request data - var ids = [] - var states = [] - var force_history_refresh = false - $.each( tracked_datasets, function ( id, state ) { - ids.push( id ); - states.push( state ); - }); - // Make ajax call - $.ajax( { - type: "POST", - url: "${h.url_for( controller='root', action='history_item_updates' )}", - dataType: "json", - data: { ids: ids.join( "," ), states: states.join( "," ) }, - success : function ( data ) { - $.each( data, function( id, val ) { - // Replace HTML - var container = $("#historyItemContainer-" + id); - container.html( val.html ); - setupHistoryItem( container.children( ".historyItemWrapper" ) ); - initShowHide(); - // If new state was terminal, stop tracking - if (( val.state == "ok") || ( val.state == "error") || ( val.state == "empty") || ( val.state == "deleted" ) || ( val.state == "discarded" )) { - if ( val.force_history_refresh ){ - force_history_refresh = true; - } - delete tracked_datasets[ parseInt(id) ]; - } else { - tracked_datasets[ parseInt(id) ] = val.state; - } - }); - if ( force_history_refresh ) { - parent.frames.galaxy_history.location.reload(); - } - else { - // Keep going (if there are still any items to track) - updater( tracked_datasets ); - } - }, - error: function() { - // Just retry, like the old method, should try to be smarter - updater( tracked_datasets ); - } - }); - }; + }); +}; </script> <style> diff -r 7d48dc7e60b4 -r 3353b15d0fb5 templates/workflow/editor.mako --- a/templates/workflow/editor.mako Wed Aug 19 11:08:58 2009 -0400 +++ b/templates/workflow/editor.mako Wed Aug 19 17:51:46 2009 -0400 @@ -31,6 +31,7 @@ <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.event.hover.js')}"> </script> <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.form.js')}"> </script> <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.json.js')}"> </script> + <script type='text/javascript' src="${h.url_for('/static/scripts/jquery.jstore-all.js')}"> </script> <script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.base.js')}"> </script> <script type='text/javascript' src="${h.url_for('/static/scripts/galaxy.workflow_editor.canvas.js')}"> </script> @@ -47,6 +48,7 @@ canvas_manager = null; // jQuery onReady $( function() { + if ( window.lt_ie_7 ) { show_modal( "Browser not supported", @@ -54,8 +56,14 @@ ); return; } + + // Load jStore for local storage + $.extend(jQuery.jStore.defaults, { project: 'galaxy', flash: '/static/jStore.Flash.html' }) + $.jStore.load(); // Auto-select best storage + // Canvas overview management canvas_manager = new CanvasManager( $("#canvas-viewport"), $("#overview") ); + // Initialize workflow state reset(); // Load the datatype info @@ -121,17 +129,46 @@ canvas_manager.draw_overview(); }); - /* Lets the viewport be toggled visible and invisible, adjusting the arrows accordingly */ + $.jStore.ready(function(engine) { + engine.ready(function() { + // On load, set the size to the pref stored in local storage if it exists + overview_size = $.jStore.store("overview-size"); + if (overview_size) { + $("#overview-border").css( { + width: overview_size, + height: overview_size + }); + } + + // Show viewport on load unless pref says it's off + $.jStore.store("overview-off") ? hide_overview() : show_overview() + }); + }); + + // Stores the size of the overview into local storage when it's resized + $("#overview-border").bind( "dragend", function( e ) { + var op = $(this).offsetParent(); + var opo = op.offset(); + var new_size = Math.max( op.width() - ( e.offsetX - opo.left ), + op.height() - ( e.offsetY - opo.top ) ); + $.jStore.store("overview-size", new_size + "px"); + }); + + function show_overview() { + $.jStore.remove("overview-off"); + $("#overview-border").css("right", "0px"); + $("#close-viewport").css("background-position", "0px 0px"); + } + + function hide_overview() { + $.jStore.store("overview-off", true); + $("#overview-border").css("right", "20000px"); + $("#close-viewport").css("background-position", "12px 0px"); + } + + // Lets the overview be toggled visible and invisible, adjusting the arrows accordingly $("#close-viewport").click( function() { - if ( $("#overview-border").css("right") == "0px" ) { - $("#overview-border").css("right", "20000px"); - $("#close-viewport").css("background-position", "12px 0px"); - - } else { - $("#overview-border").css("right", "0px"); - $("#close-viewport").css("background-position", "0px 0px"); - } - + $("#overview-border").css("right") == "0px" ? hide_overview() : show_overview(); }); // Unload handler @@ -245,10 +282,6 @@ beforeSubmit: function( data ) { data.push( { name: 'tool_state', value: node.tool_state } ); data.push( { name: '_', value: "true" } ); - $("#tool-form-save-button").each( function() { - this.value = "Saving..."; - this.disabled = true; - }); } }).each( function() { form = this; @@ -275,6 +308,7 @@ var close_editor = function() { <% next_url = h.url_for( controller='workflow', action='index' ) %> + workflow.check_changes_in_active_form(); if ( workflow && workflow.has_changes ) { do_close = function() { window.onbeforeunload = undefined; @@ -297,39 +331,46 @@ var save_current_workflow = function ( success_callback ) { show_modal( "Saving workflow", "progress" ); - $.ajax( { - url: "${h.url_for( action='save_workflow' )}", - type: "POST", - data: { - id: "${trans.security.encode_id( workflow_id )}", - workflow_data: $.toJSON( workflow.to_simple() ), - "_": "true" - }, - dataType: 'json', - success: function( data ) { - var body = $("<div></div>").text( data.message ); - if ( data.errors ) { - body.addClass( "warningmark" ) - var errlist = $( "<ul/>" ); - $.each( data.errors, function( i, v ) { - $("<li></li>").text( v ).appendTo( errlist ); - }); - body.append( errlist ); - } else { - body.addClass( "donemark" ); + workflow.check_changes_in_active_form(); + // We bind to ajaxStop because of auto-saving, since the form submission ajax + // call needs to be completed so that the new data is saved + $(document).bind('ajaxStop.save_workflow', function() { + $(document).unbind('ajaxStop.save_workflow'); + $.ajax( { + url: "${h.url_for( action='save_workflow' )}", + type: "POST", + data: { + id: "${trans.security.encode_id( workflow_id )}", + workflow_data: function() { return $.toJSON( workflow.to_simple() ) }, + "_": "true" + }, + dataType: 'json', + success: function( data ) { + var body = $("<div></div>").text( data.message ); + if ( data.errors ) { + body.addClass( "warningmark" ) + var errlist = $( "<ul/>" ); + $.each( data.errors, function( i, v ) { + $("<li></li>").text( v ).appendTo( errlist ); + }); + body.append( errlist ); + } else { + body.addClass( "donemark" ); + } + workflow.name = data.name; + workflow.has_changes = false; + workflow.stored = true; + if ( success_callback ) { + success_callback(); + } + if ( data.errors ) { + show_modal( "Saving workflow", body, { "Ok" : hide_modal } ); + } else { + hide_modal(); + } } - workflow.name = data.name; - workflow.has_changes = false; - workflow.stored = true; - if ( success_callback ) { - success_callback(); - } - if ( data.errors ) { - show_modal( "Saving workflow", body, { "Ok" : hide_modal } ); - } else { - hide_modal(); - } - } + }); + $(document).unbind('ajaxStop.save_workflow'); // IE7 needs it here }); } @@ -642,7 +683,7 @@ <div id="canvas-viewport" style="width: 100%; height: 100%; position: absolute; overflow: hidden; background: #EEEEEE; background: white url(${h.url_for('/static/images/light_gray_grid.gif')}) repeat;"> <div id="canvas-container" style="position: absolute; width: 100%; height: 100%;"></div> </div> - <div id="overview-border" style="position: absolute; width: 150px; height: 150px; right: 0px; bottom: 0px; border-top: solid gray 1px; border-left: solid grey 1px; padding: 7px 0 0 7px; background: #EEEEEE no-repeat url(${h.url_for('/static/images/resizable.png')}); z-index: 20000; overflow: hidden; max-width: 300px; max-height: 300px; min-width: 50px; min-height: 50px"> + <div id="overview-border" style="position: absolute; width: 150px; height: 150px; right: 20000px; bottom: 0px; border-top: solid gray 1px; border-left: solid grey 1px; padding: 7px 0 0 7px; background: #EEEEEE no-repeat url(${h.url_for('/static/images/resizable.png')}); z-index: 20000; overflow: hidden; max-width: 300px; max-height: 300px; min-width: 50px; min-height: 50px"> <div style="position: relative; overflow: hidden; width: 100%; height: 100%; border-top: solid gray 1px; border-left: solid grey 1px;"> <div id="overview" style="position: absolute;"> <canvas width="0" height="0" style="background: white; width: 100%; height: 100%;" id="overview-canvas"></canvas> @@ -650,7 +691,7 @@ </div> </div> </div> - <div id="close-viewport" style="border-left: 1px solid #999; border-top: 1px solid #999; background: #ddd url(${h.url_for('/static/images/overview_arrows.png')}); position: absolute; right: 0px; bottom: 0px; width: 12px; height: 12px; z-index: 25000;"></div> + <div id="close-viewport" style="border-left: 1px solid #999; border-top: 1px solid #999; background: #ddd url(${h.url_for('/static/images/overview_arrows.png')}) 12px 0px; position: absolute; right: 0px; bottom: 0px; width: 12px; height: 12px; z-index: 25000;"></div> </div> </%def> diff -r 7d48dc7e60b4 -r 3353b15d0fb5 templates/workflow/editor_generic_form.mako --- a/templates/workflow/editor_generic_form.mako Wed Aug 19 11:08:58 2009 -0400 +++ b/templates/workflow/editor_generic_form.mako Wed Aug 19 17:51:46 2009 -0400 @@ -15,7 +15,7 @@ ${input.label}: </label> <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="${input.type}" name="${input.name}" value="${input.value}" size="40"> + <input type="${input.type}" name="${input.name | h}" value="${input.value | h}" size="30"> </div> %if input.error: <div style="float: left; color: red; font-weight: bold; padding-top: 1px; padding-bottom: 3px;"> @@ -33,11 +33,14 @@ </div> %endfor - <div class="form-row"><input type="submit" value="${form.submit_text}"></div> %else: <div class="form-row"><i>No options</i></div> %endif </table> </form> </div> -</div> \ No newline at end of file +</div> + +<script type="text/javascript"> + workflow.enable_auto_save(); +</script> diff -r 7d48dc7e60b4 -r 3353b15d0fb5 templates/workflow/editor_tool_form.mako --- a/templates/workflow/editor_tool_form.mako Wed Aug 19 11:08:58 2009 -0400 +++ b/templates/workflow/editor_tool_form.mako Wed Aug 19 17:51:46 2009 -0400 @@ -93,7 +93,7 @@ <div style="clear: both"></div> </div> </%def> - + <div class="toolForm"> <div class="toolFormTitle">Tool: ${tool.name}</div> <div class="toolFormBody"> @@ -105,9 +105,11 @@ %endif ${do_inputs( inputs, values, errors, "" )} %endfor - <div class="form-row"> - <input type="submit" id="tool-form-save-button" value="Save"></input> - </div> </form> </div> -</div> \ No newline at end of file +</div> + +<script type="text/javascript"> + workflow.enable_auto_save(); +</script> + diff -r 7d48dc7e60b4 -r 3353b15d0fb5 tools/new_operations/cluster.xml --- a/tools/new_operations/cluster.xml Wed Aug 19 11:08:58 2009 -0400 +++ b/tools/new_operations/cluster.xml Wed Aug 19 17:51:46 2009 -0400 @@ -74,7 +74,7 @@ **Syntax** - **Maximum distance** is greatest distance in base pairs allowed between intervals that will be considered "clustered". **Negative** values for distance are allowed, and are useful for clustering intervals that overlap. -- **Minimum intervals per cluster** allow a threshold to be set on the minimum number of intervals to be considered a cluster. Any area with less than this minimum will not be included in the ouput. +- **Minimum intervals per cluster** allow a threshold to be set on the minimum number of intervals to be considered a cluster. Any area with less than this minimum will not be included in the output. - **Merge clusters into single intervals** outputs intervals that span the entire cluster. - **Find cluster intervals; preserve comments and order** filters out non-cluster intervals while maintaining the original ordering and comments in the file. - **Find cluster intervals; output grouped by clusters** filters out non-cluster intervals, but outputs the cluster intervals so that they are grouped together. Comments and original ordering in the file are lost.

1 0