- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2497: Remove restriction for displaying a dataset at...
by Nate Coraor 29 Jul '09

29 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/4e0671e6eeaa changeset: 2497:4e0671e6eeaa user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Jul 24 11:22:31 2009 -0400 description: Remove restriction for displaying a dataset at UCSC if the dataset is not public - as long as you can access the dataset, you can send it outside of the Galaxy environment. Fix for sharing restricted histories - default the options for sharing, and some style fixes on a few library forms. 9 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/web/controllers/history.py templates/admin/library/ldda_edit_info.mako templates/admin/library/new_dataset.mako templates/admin/library/new_folder.mako templates/history/share.mako templates/library/ldda_edit_info.mako templates/library/new_dataset.mako templates/library/new_folder.mako diffs (215 lines): diff -r 26b69d176146 -r 4e0671e6eeaa lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Jul 23 17:08:21 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Fri Jul 24 11:22:31 2009 -0400 @@ -205,16 +205,17 @@ return "This display type (%s) is not implemented for this datatype (%s)." % ( type, dataset.ext) def get_display_links(self, dataset, type, app, base_url, **kwd): """ - Returns a list of tuples of (name, link) for a particular display type - as long as the dataset is not associated with a role restricting its access. - We determine this by sending None as the user to the allow_action method. + Returns a list of tuples of (name, link) for a particular display type. No check on + 'access' permissions is done here - if you can view the dataset, you can also save it + or send it to a destination outside of Galaxy, so Galaxy security restrictions do not + apply anyway. """ - if app.security_agent.allow_action( None, dataset.permitted_actions.DATASET_ACCESS, dataset=dataset ): - try: - if type in self.get_display_types(): - return getattr (self, self.supported_display_apps[type]['links_function']) (dataset, type, app, base_url, **kwd) - except: - log.exception('Function %s is referred to in datatype %s for generating links for type %s, but is not accessible' % (self.supported_display_apps[type]['links_function'], self.__class__.__name__, type) ) + try: + if type in self.get_display_types(): + return getattr (self, self.supported_display_apps[type]['links_function']) (dataset, type, app, base_url, **kwd) + except: + log.exception( 'Function %s is referred to in datatype %s for generating links for type %s, but is not accessible' \ + % ( self.supported_display_apps[type]['links_function'], self.__class__.__name__, type ) ) return [] def get_converter_types(self, original_dataset, datatypes_registry): """Returns available converters by type for this dataset""" diff -r 26b69d176146 -r 4e0671e6eeaa lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Jul 23 17:08:21 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Jul 24 11:22:31 2009 -0400 @@ -288,12 +288,16 @@ # in the cloned history params = util.Params( kwd ) user = trans.get_user() + # TODO: we have too many error messages floating around in here - we need + # to incorporate the messaging system used by the libraries that will display + # a message on any page. + err_msg = util.restore_text( params.get( 'err_msg', '' ) ) if not email: if not id: # Default to the current history id = trans.security.encode_id( trans.history.id ) id = util.listify( id ) - send_to_err = "" + send_to_err = err_msg histories = [] for history_id in id: histories.append( get_history( trans, history_id ) ) @@ -304,7 +308,7 @@ histories, send_to_users, send_to_err = self._get_histories_and_users( trans, user, id, email ) if not send_to_users: if not send_to_err: - send_to_err += "%s is not a valid Galaxy user. " % email + send_to_err += "%s is not a valid Galaxy user. %s" % ( email, err_msg ) return trans.fill_template( "/history/share.mako", histories=histories, email=email, @@ -313,6 +317,7 @@ # The user has not yet made a choice about how to share, so dictionaries will be built for display can_change, cannot_change, no_change_needed, unique_no_change_needed, send_to_err = \ self._populate_restricted( trans, user, histories, send_to_users, None, send_to_err, unique=True ) + send_to_err += err_msg if can_change or cannot_change: return trans.fill_template( "/history/share.mako", histories=histories, @@ -330,7 +335,16 @@ @web.expose @web.require_login( "share restricted histories with other users" ) def share_restricted( self, trans, id=None, email="", **kwd ): - action = kwd[ 'action' ] + if 'action' in kwd: + action = kwd[ 'action' ] + else: + err_msg = "Select an action. " + return trans.response.send_redirect( url_for( controller='history', + action='share', + id=id, + email=email, + err_msg=err_msg, + share_button=True ) ) if action == "no_share": trans.response.send_redirect( url_for( controller='root', action='history_options' ) ) user = trans.get_user() diff -r 26b69d176146 -r 4e0671e6eeaa templates/admin/library/ldda_edit_info.mako --- a/templates/admin/library/ldda_edit_info.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/admin/library/ldda_edit_info.mako Fri Jul 24 11:22:31 2009 -0400 @@ -83,12 +83,14 @@ </div> </form> <form name="auto_detect" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="submit" name="detect" value="Auto-detect"/> - </div> - <div class="toolParamHelp" style="clear: both;"> - This will inspect the dataset and attempt to correct the above column values if they are not accurate. + <div class="form-row"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="submit" name="detect" value="Auto-detect"/> + </div> + <div class="toolParamHelp" style="clear: both;"> + This will inspect the dataset and attempt to correct the above column values if they are not accurate. + </div> </div> </form> </div> diff -r 26b69d176146 -r 4e0671e6eeaa templates/admin/library/new_dataset.mako --- a/templates/admin/library/new_dataset.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/admin/library/new_dataset.mako Fri Jul 24 11:22:31 2009 -0400 @@ -192,7 +192,9 @@ <input name="hda_ids" value="${hda.id}" type="checkbox"/>${hda.hid}: ${hda.name} </div> %endfor - <input type="submit" name="add_history_datasets_to_library_button" value="Import to library"/> + <div class="form-row"> + <input type="submit" name="add_history_datasets_to_library_button" value="Import to library"/> + </div> </form> %else: <p/> diff -r 26b69d176146 -r 4e0671e6eeaa templates/admin/library/new_folder.mako --- a/templates/admin/library/new_folder.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/admin/library/new_folder.mako Fri Jul 24 11:22:31 2009 -0400 @@ -36,7 +36,9 @@ </div> <div style="clear: both"></div> </div> - <input type="submit" name="new_folder_button" value="Create"/> + <div class="form-row"> + <input type="submit" name="new_folder_button" value="Create"/> + </div> </form> </div> </div> diff -r 26b69d176146 -r 4e0671e6eeaa templates/history/share.mako --- a/templates/history/share.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/history/share.mako Fri Jul 24 11:22:31 2009 -0400 @@ -58,6 +58,12 @@ %else: ## We are sharing restricted histories <form name='share_restricted' id=share_restricted' action="${h.url_for( controller='history', action='share_restricted' )}" method="post"> + %if send_to_err: + <div style="clear: both"></div> + <div class="form-row"> + <div class="errormessage">${send_to_err}</div> + </div> + %endif ## Needed for rebuilding dicts <input type="hidden" name="email" value="${email}" size="40"> %for history in histories: @@ -173,7 +179,7 @@ %endif </div> <div class="form-row"> - <input type="radio" name="action" value="no_share"> Don't share + <input type="radio" name="action" value="no_share" checked> Don't share </div> <div class="form-row"> <input type="submit" name="share_restricted_button" value="Go"><br/> diff -r 26b69d176146 -r 4e0671e6eeaa templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Fri Jul 24 11:22:31 2009 -0400 @@ -83,12 +83,14 @@ </div> </form> <form name="auto_detect" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="submit" name="detect" value="Auto-detect"/> - </div> - <div class="toolParamHelp" style="clear: both;"> - This will inspect the dataset and attempt to correct the above column values if they are not accurate. + <div class="form-row"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="submit" name="detect" value="Auto-detect"/> + </div> + <div class="toolParamHelp" style="clear: both;"> + This will inspect the dataset and attempt to correct the above column values if they are not accurate. + </div> </div> </form> </div> diff -r 26b69d176146 -r 4e0671e6eeaa templates/library/new_dataset.mako --- a/templates/library/new_dataset.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/library/new_dataset.mako Fri Jul 24 11:22:31 2009 -0400 @@ -201,7 +201,9 @@ <input name="hda_ids" value="${hda.id}" type="checkbox"/>${hda.hid}: ${hda.name} </div> %endfor - <input type="submit" name="add_history_datasets_to_library_button" value="Import to library"/> + <div class="form-row"> + <input type="submit" name="add_history_datasets_to_library_button" value="Import to library"/> + </div> </form> %else: <p/> diff -r 26b69d176146 -r 4e0671e6eeaa templates/library/new_folder.mako --- a/templates/library/new_folder.mako Thu Jul 23 17:08:21 2009 -0400 +++ b/templates/library/new_folder.mako Fri Jul 24 11:22:31 2009 -0400 @@ -36,7 +36,9 @@ </div> <div style="clear: both"></div> </div> - <input type="submit" name="new_folder_button" value="Create"/> + <div class="form-row"> + <input type="submit" name="new_folder_button" value="Create"/> + </div> </form> </div> </div>

1 0

[hg] galaxy 2496: More LIMS changes
by Nate Coraor 29 Jul '09

29 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/26b69d176146 changeset: 2496:26b69d176146 user: rc date: Thu Jul 23 17:08:21 2009 -0400 description: More LIMS changes - Request page now includes all its samples (both Admin & User perspective) - Sample page removed and samples UI overhaul - DB changes - new 'submitted' column in request table - new 'bar_code' column in sample table - CSV importer to create forms 34 file(s) affected in this change: lib/galaxy/model/__init__.py lib/galaxy/model/mapping.py lib/galaxy/model/migrate/versions/0009_request_table.py lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/forms.py lib/galaxy/web/controllers/requests.py lib/galaxy/web/controllers/requests_admin.py templates/admin/forms/create_form.mako templates/admin/forms/edit_form.mako templates/admin/requests/add_states.mako templates/admin/requests/create_request_type.mako templates/admin/requests/edit_request_type.mako templates/admin/requests/grid.mako templates/admin/requests/show_request.mako templates/admin/requests/view_request.mako templates/admin/requests/view_request_type.mako templates/admin/samples/bar_codes.mako templates/admin/samples/change_state.mako templates/admin/samples/edit_sample.mako templates/admin/samples/events.mako templates/admin/samples/grid.mako templates/admin/samples/view_sample.mako templates/base.mako templates/base_panels.mako templates/requests/grid.mako templates/requests/new_request.mako templates/requests/show_request.mako templates/requests/view_request.mako templates/sample/browse_samples.mako templates/sample/edit_sample.mako templates/sample/grid.mako templates/sample/new_sample.mako templates/sample/sample_events.mako templates/sample/view_sample.mako diffs (2706 lines): diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/model/__init__.py Thu Jul 23 17:08:21 2009 -0400 @@ -1116,16 +1116,40 @@ class Request( object ): def __init__(self, name=None, desc=None, request_type=None, user=None, - form_values=None, library=None): + form_values=None, library=None, submitted=False): self.name = name self.desc = desc self.type = request_type self.values = form_values self.user = user self.library = library + self.submitted = submitted + self.samples_list = [] + def add_sample(self, sample_name=None, sample_desc=None, sample_values=None): + # create a form_values row + values = trans.app.model.FormValues(self.type.sample_form, sample_values) + values.flush() + sample = Sample(sample_name, sample_desc, self, values) + sample.flush() + # set the initial state + state = self.type.states[0] + event = SampleEvent(sample, state) + event.flush() + # add this sample to the member array + self.samples_list.append(sample) + return sample + def delete_sample(self, sample_name): + pass + def has_sample(self, sample_name): + for s in self.samples: + if s.name == sample_name: + return s + return False class RequestType( object ): - def __init__(self, request_form=None, sample_form=None): + def __init__(self, name=None, desc=None, request_form=None, sample_form=None): + self.name = name + self.desc = desc self.request_form = request_form self.sample_form = sample_form @@ -1135,9 +1159,10 @@ self.desc = desc self.request = request self.values = form_values + + def current_state(self): + return self.events[0].state - - class SampleState( object ): def __init__(self, name=None, desc=None, request_type=None): self.name = name diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/model/mapping.py Thu Jul 23 17:08:21 2009 -0400 @@ -569,6 +569,7 @@ Column( "request_type_id", Integer, ForeignKey( "request_type.id" ), index=True ), Column( "user_id", Integer, ForeignKey( "galaxy_user.id" ), index=True ), Column( "library_id", Integer, ForeignKey( "library.id" ), index=True ), + Column( "submitted", Boolean, index=True, default=False ), Column( "deleted", Boolean, index=True, default=False ) ) Sample.table = Table('sample', metadata, @@ -579,6 +580,7 @@ Column( "desc", TEXT ), Column( "form_values_id", Integer, ForeignKey( "form_values.id" ), index=True ), Column( "request_id", Integer, ForeignKey( "request.id" ), index=True ), + Column( "bar_code", TrimmedString( 255 ), index=True ), Column( "deleted", Boolean, index=True, default=False ) ) # new table to store all the possible sample states and the sample type it @@ -626,13 +628,17 @@ user=relation( User, primaryjoin=( Request.table.c.user_id == User.table.c.id ), backref="requests" ), + samples=relation( Sample, + primaryjoin=( Request.table.c.id == Sample.table.c.request_id ) ), library=relation( Library, primaryjoin=( Request.table.c.library_id == Library.table.c.id ) ), ) ) assign_mapper( context, RequestType, RequestType.table, - properties=dict( states=relation( SampleState, backref="request_type", - order_by=desc(SampleState.table.c.update_time) ), + properties=dict( states=relation( SampleState, + backref="request_type", + primaryjoin=( RequestType.table.c.id == SampleState.table.c.request_type_id ), + order_by=asc(SampleState.table.c.update_time) ), request_form=relation( FormDefinition, primaryjoin=( RequestType.table.c.request_form_id == FormDefinition.table.c.id ) ), sample_form=relation( FormDefinition, diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/model/migrate/versions/0009_request_table.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0009_request_table.py Thu Jul 23 17:08:21 2009 -0400 @@ -0,0 +1,52 @@ +from sqlalchemy import * +from sqlalchemy.orm import * +from migrate import * +from migrate.changeset import * +import sys, logging +from galaxy.model.custom_types import * + +log = logging.getLogger( __name__ ) +log.setLevel(logging.DEBUG) +handler = logging.StreamHandler( sys.stdout ) +format = "%(name)s %(levelname)s %(asctime)s %(message)s" +formatter = logging.Formatter( format ) +handler.setFormatter( formatter ) +log.addHandler( handler ) + +metadata = MetaData( migrate_engine ) + + +def upgrade(): + # Load existing tables + metadata.reflect() + + # Add 1 column to the request table + try: + Request_table = Table( "request", metadata, autoload=True ) + except NoSuchTableError: + Request_table = None + log.debug( "Failed loading table request" ) + if Request_table: + try: + col = Column( "submitted", Boolean, index=True, default=False ) + col.create( Request_table ) + assert col is Request_table.c.submitted + except Exception, e: + log.debug( "Adding column 'submitted' to submitted table failed: %s" % ( str( e ) ) ) + + # Add 1 column to the sample table + try: + Sample_table = Table( "sample", metadata, autoload=True ) + except NoSuchTableError: + Sample_table = None + log.debug( "Failed loading table sample" ) + if Sample_table: + try: + col = Column( "bar_code", TrimmedString( 255 ), index=True ) + col.create( Sample_table ) + assert col is Sample_table.c.bar_code + except Exception, e: + log.debug( "Adding column 'bar_code' to submitted table failed: %s" % ( str( e ) ) ) + +def downgrade(): + pass \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Thu Jul 23 17:08:21 2009 -0400 @@ -2162,7 +2162,7 @@ elif params.get('edit', False) == 'True': rt = trans.app.model.RequestType.get(int(util.restore_text( params.id ))) ss_list = trans.app.model.SampleState.filter(trans.app.model.SampleState.table.c.request_type_id == rt.id).all() - return trans.fill_template( '/admin/requests/edit_request_type.mako', + return trans.fill_template( '/admin/requests/view_request_type.mako', request_type=rt, forms=self._get_all_forms(trans, all_versions=False), states_list=ss_list, @@ -2193,10 +2193,13 @@ for ss in ss_list: ss.delete() ss.flush() + # unsubmitted state + ss = trans.app.model.SampleState('Unsubmitted', 'Sample not yet submitted', rt) + ss.flush() for i in range( num_states ): name = util.restore_text( params.get( 'new_element_name_%i' % i, None )) desc = util.restore_text( params.get( 'new_element_description_%i' % i, None )) ss = trans.app.model.SampleState(name, desc, rt) ss.flush() - msg = "The new sample type named '%s' with %s state(s) has been created" % (rt.name, num_states) + msg = "The new request type named '%s' with %s state(s) has been created" % (rt.name, num_states) return rt, msg diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/web/controllers/forms.py --- a/lib/galaxy/web/controllers/forms.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/web/controllers/forms.py Thu Jul 23 17:08:21 2009 -0400 @@ -62,7 +62,8 @@ self.current_form['desc'] = '' self.current_form['fields'] = [] inputs = [ ( 'Name', TextField('name', 40,self.current_form['name'] ) ), - ( 'Description', TextField('description', 40, self.current_form['desc']) ) ] + ( 'Description', TextField('description', 40, self.current_form['desc']) ), + ( 'Import from csv file (Optional)', TextField('csv_file', 40, '') ) ] return trans.fill_template( '/admin/forms/create_form.mako', inputs=inputs, msg=msg, @@ -215,11 +216,16 @@ params = util.Params( kwd ) name = util.restore_text( params.name ) desc = util.restore_text( params.description ) or "" - # set form fields - fields = [] - for i in range( len(self.current_form['fields']) ): - fields.append(self.__get_field(i, **kwd)) - fields = fields + if params.get( 'csv_file', None ): + csv_file = util.restore_text( params.get( 'csv_file', '' ) ) + if csv_file: + fields = self.__import_fields(csv_file) + else: + # set form fields + fields = [] + for i in range( len(self.current_form['fields']) ): + fields.append(self.__get_field(i, **kwd)) + fields = fields return name, desc, fields def __update_current_form(self, **kwd): name, desc, fields = self.__get_form(**kwd) @@ -228,6 +234,24 @@ self.current_form['desc'] = desc self.current_form['fields'] = fields + def __import_fields(self, csv_file): + ''' + "company","name of the company", "True", "required", "TextField",, + "due date","turnaround time", "True", "optional", "SelectField","24 hours, 1 week, 1 month" + ''' + import csv + fields = [] + reader = csv.reader(open(csv_file)) + for row in reader: + options = row[5].split(',') + fields.append({'label': row[0], + 'helptext': row[1], + 'visible': row[2], + 'required': row[3], + 'type': row[4], + 'selectlist': options}) + return fields + def __save_form(self, trans, fdc_id=None, **kwd): ''' This method saves the current form @@ -271,8 +295,8 @@ for ft in BaseField.form_field_types(): self.fieldtype.add_option(ft, ft) self.required = SelectField('field_required_'+str(index), display='radio') - self.required.add_option('Required', 'true') - self.required.add_option('Optional', 'true', selected=True) + self.required.add_option('Required', 'required') + self.required.add_option('Optional', 'optional', selected=True) if field: self.fill(field, field_type) def fill(self, field, field_type=None): @@ -296,10 +320,10 @@ else: self.fieldtype.add_option(ft, ft) # required/optional - if field['required']: - self.required = SelectField('required_'+str(self.index), display='radio') - self.required.add_option('Required', 'true', selected=True) - self.required.add_option('Optional', 'true') + if field['required'] == 'required': + self.required = SelectField('field_required_'+str(self.index), display='radio') + self.required.add_option('Required', 'required', selected=True) + self.required.add_option('Optional', 'optional') def selectbox_ui(self, field): self.selectbox_options = [] if field['selectlist']: diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/web/controllers/requests.py Thu Jul 23 17:08:21 2009 -0400 @@ -11,7 +11,7 @@ log = logging.getLogger( __name__ ) class RequestsListGrid( grids.Grid ): - title = "Requests" + title = "Sequencing Requests" model_class = model.Request default_sort_key = "-create_time" columns = [ @@ -20,13 +20,14 @@ attach_popup=True ), grids.GridColumn( "Description", key='desc'), grids.GridColumn( "Sample(s)", method='number_of_samples', - link=( lambda item: iff( item.deleted, None, dict( operation="samples", id=item.id ) ) ), ), + link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) ), ), grids.GridColumn( "Type", key="request_type_id", method='get_request_type'), - grids.GridColumn( "Last update", key="update_time", format=time_ago ) + grids.GridColumn( "Last update", key="update_time", format=time_ago ), + grids.GridColumn( "Submitted", method='submitted'), ] operations = [ # grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), - grids.GridOperation( "Samples", allow_multiple=False, condition=( lambda item: not item.deleted ) ), + grids.GridOperation( "Submit", allow_multiple=False, condition=( lambda item: not item.submitted ) ) # grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), # grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), ] @@ -43,45 +44,13 @@ def apply_default_filter( self, trans, query ): return query.filter_by( user=trans.user ) def number_of_samples(self, trans, request): - return str(len(trans.app.model.Sample.filter(trans.app.model.Sample.table.c.request_id==request.id).all())) + return str(len(request.samples)) + def submitted(self, trans, request): + if request.submitted: + return 'Yes' + return 'No' -class SamplesListGrid( grids.Grid ): - model_class = model.Sample - default_sort_key = "-create_time" - columns = [ - grids.GridColumn( "Name", key="name", - link=( lambda item: iff( item.deleted, None, dict( operation="show_sample", id=item.id ) ) ), - attach_popup=True ), - grids.GridColumn( "Description", key='desc' ), - grids.GridColumn( "Status", method="get_status", - link=( lambda item: iff( item.deleted, None, dict( operation="events", id=item.id ) ) )), - grids.GridColumn( "Last update", key="update_time", format=time_ago ) - - # Valid for filtering but invisible - #grids.GridColumn( "Deleted", key="deleted", visible=False ) - ] - operations = [ -# grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), - - ] - standard_filters = [ - grids.GridColumnFilter( "Active", args=dict( deleted=False ) ), - grids.GridColumnFilter( "Deleted", args=dict( deleted=True ) ), - grids.GridColumnFilter( "All", args=dict( deleted='All' ) ) - ] - def __init__(self, request): - self.request = request - def get_current_item( self, trans ): - return None - def apply_default_filter( self, trans, query ): - return query.filter_by( request_id=self.request.id ) - def get_status(self, trans, sample): - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample.id).all() - curr_state = all_states[len(all_states)-1].state - return curr_state.name class Requests( BaseController ): request_grid = RequestsListGrid() @@ -94,7 +63,8 @@ all_libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() authorized_libraries = [] for library in all_libraries: - if trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) or trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library) or trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library) or trans.app.security_agent.check_folder_contents(trans.user, library) or trans.app.security_agent.show_library_item(trans.user, library): + if trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) \ + or trans.app.security_agent.allow_action(trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library): authorized_libraries.append(library) return authorized_libraries @web.expose @@ -107,27 +77,38 @@ operation = kwargs['operation'].lower() if operation == "show_request": id = trans.security.decode_id(kwargs['id']) - return self.show_read_only(trans, id) - elif operation == "samples": + return self.__show_request(trans, id, kwargs.get('add_sample', False)) + elif operation == "submit": id = trans.security.decode_id(kwargs['id']) - return self.show_samples(trans, id, kwargs) - elif operation == "show_sample": - id = trans.security.decode_id(kwargs['id']) - return self.show_sample_read_only(trans, id) - elif operation == "events": - id = trans.security.decode_id(kwargs['id']) - return self.show_events(trans, id) + return self.__submit(trans, id) # Render the list view - return self.request_grid( trans, status=status, message=message, template='/requests/grid.mako', **kwargs ) - def show_samples(self, trans, id, kwargs): - ''' - Shows all the samples associated with this request - ''' - status = message = None - request = trans.app.model.Request.get(id) - self.samples_grid = SamplesListGrid(request) - return self.samples_grid( trans, status=status, message=message, template='/sample/grid.mako', **kwargs ) - def show_read_only(self, trans, id): + return self.request_grid( trans, template='/requests/grid.mako', **kwargs ) + + def __show_request(self, trans, id, add_sample=False): + try: + request = trans.app.model.Request.get(id) + except: + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message="Invalid request ID", + **kwd) ) + self.current_samples = [] + for s in request.samples: + self.current_samples.append([s.name, s.values.content]) + if add_sample: + self.current_samples.append(['New Sample',['' for field in request.type.sample_form.fields]]) + # selectfield of all samples + copy_list = SelectField('copy_sample') + copy_list.add_option('None', -1, selected=True) + for i, s in enumerate(self.current_samples): + copy_list.add_option(i+1, i) + return trans.fill_template( '/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, id), + current_samples = self.current_samples, + sample_copy=copy_list) + def request_details(self, trans, id): ''' Shows the request details ''' @@ -136,9 +117,6 @@ # list of widgets to be rendered on the request form request_details = [] # main details - request_details.append(dict(label='Name', - value=request.name, - helptext='')) request_details.append(dict(label='Description', value=request.desc, helptext='')) @@ -147,12 +125,6 @@ helptext='')) request_details.append(dict(label='Date created', value=request.create_time, - helptext='')) - request_details.append(dict(label='Date updated', - value=request.create_time, - helptext='')) - request_details.append(dict(label='User', - value=str(request.user.email), helptext='')) # library associated request_details.append(dict(label='Library', @@ -168,10 +140,97 @@ request_details.append(dict(label=field['label'], value=request.values.content[index], helptext=field['helptext']+' ('+req+')')) - return trans.fill_template( '/requests/view_request.mako', - request_form_id=request.type.request_form.id, - request_details=request_details, - request_type=request.type) + return request_details + + @web.expose + def show_request(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + try: + request = trans.app.model.Request.get(int(params.get('request_id', None))) + except: + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message="Invalid request ID", + **kwd) ) + if params.get('add_sample_button', False) == 'Add New': + # save the all (saved+unsaved) sample info in 'current_samples' + num_samples = len(self.current_samples) + self.current_samples = [] + for s in request.samples: + self.current_samples.append([s.name, s.values.content]) + for index in range(num_samples-len(request.samples)): + sample_index = index + len(request.samples) + sample_name = util.restore_text( params.get( 'sample_%i_name' % sample_index, '' ) ) + sample_values = [] + for field_index in range(len(request.type.sample_form.fields)): + sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) + self.current_samples.append([sample_name, sample_values]) + # add an empty or filled sample + # if the user has selected a sample no. to copy then copy the contents + # of the src sample to the new sample else an empty sample + src_sample_index = int(params.get( 'copy_sample', -1 )) + if src_sample_index == -1: + # empty sample + self.current_samples.append(['New Sample',['' for field in request.type.sample_form.fields]]) + else: + self.current_samples.append([self.current_samples[src_sample_index][0]+'_copy',[val for val in self.current_samples[src_sample_index][1]]]) + # selectfield of all samples + copy_list = SelectField('copy_sample') + copy_list.add_option('None', -1, selected=True) + for i, s in enumerate(self.current_samples): + copy_list.add_option(i+1, i) + return trans.fill_template( '/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples = self.current_samples, + sample_copy=copy_list) + if params.get('save_samples_button', False) == 'Save': + num_samples = len(self.current_samples) + # save all the new/unsaved samples entered by the user + for index in range(num_samples-len(request.samples)): + sample_index = index + len(request.samples) + sample_name = util.restore_text( params.get( 'sample_%i_name' % sample_index, '' ) ) + sample_values = [] + for field_index in range(len(request.type.sample_form.fields)): + sample_values.append(util.restore_text( params.get( 'sample_%i_field_%i' % (sample_index, field_index), '' ) )) + form_values = trans.app.model.FormValues(request.type.sample_form, sample_values) + form_values.flush() + s = trans.app.model.Sample(sample_name, '', request, form_values) + s.flush() + # set the initial state + state = s.request.type.states[0] + event = trans.app.model.SampleEvent(s, state) + event.flush() + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + operation='show_request', + id=trans.security.encode_id(request.id)) ) + + @web.expose + def delete_sample(self, trans, **kwd): + params = util.Params( kwd ) + msg = util.restore_text( params.get( 'msg', '' ) ) + messagetype = params.get( 'messagetype', 'done' ) + request = trans.app.model.Request.get(int(params.get('request_id', 0))) + sample_index = int(params.get('sample_id', 0)) + sample_name = self.current_samples[sample_index][0] + s = request.has_sample(sample_name) + if s: + s.delete() + s.flush() + del self.current_samples[sample_index] + copy_list = SelectField('copy_sample') + copy_list.add_option('None', -1, selected=True) + for i, s in enumerate(self.current_samples): + copy_list.add_option(i+1, i) + return trans.fill_template( '/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, request.id), + current_samples = self.current_samples, + sample_copy=copy_list) @web.expose def new(self, trans, **kwd): params = util.Params( kwd ) @@ -202,10 +261,22 @@ request = self.__save_request(trans, None, **kwd) msg = 'The new request named %s has been created' % request.name request_type_id = int(util.restore_text( params.request_type_id )) - return trans.response.send_redirect( web.url_for( controller='requests', - action='list', - msg=msg , - messagetype='done') ) + if params.get('create_request_button', False) == 'Save': + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + msg=msg , + messagetype='done') ) + elif params.get('create_request_samples_button', False) == 'Add samples': + new_kwd = {} + new_kwd['id'] = trans.security.encode_id(request.id) + new_kwd['operation'] = 'show_request' + new_kwd['add_sample'] = True + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + msg=msg , + messagetype='done', + **new_kwd) ) + def __validate(self, trans, main_fields=[], form_fields=[], **kwd): ''' Validates the request entered by the user @@ -216,7 +287,8 @@ return 'Please enter the <b>%s</b> of the request' % field_name # check rest of the fields of the form for index, field in enumerate(form_fields): - if not util.restore_text(params.get('field_%i' % index, None)) and field['required']: + if not util.restore_text(params.get('field_%i' % index, None)) \ + and field['required'] == 'required': return 'Please enter the <b>%s</b> field of the request' % field['label'] return None def __save_request(self, trans, request_id=None, **kwd): @@ -240,7 +312,8 @@ form_values.flush() request = trans.app.model.Request(name, desc, request_type, trans.user, form_values, - trans.app.model.Library.get(library_id)) + trans.app.model.Library.get(library_id), + submitted=False) request.flush() else: # TODO editing @@ -266,29 +339,103 @@ util.restore_text( params.get( 'desc', '' ) )), helptext='(Optional)')) # libraries selectbox - value = int(params.get( 'library_id', 0 )) libraries = self.get_authorized_libs(trans) - lib_list = SelectField('library_id') - for lib in libraries: - if lib.id == value: - lib_list.add_option(lib.name, lib.id, selected=True) - else: - lib_list.add_option(lib.name, lib.id) - widgets.append(dict(label='Library', - widget=lib_list, - helptext='Associated library where the resultant \ - dataset will be stored')) + if libraries: + libui = self.__library_ui(libraries, **kwd) + widgets.append(libui) widgets = self.__create_form(trans, request_type.request_form_id, widgets, form_values, **kwd) title = 'Add a new request of type: %s' % request_type.name return trans.fill_template( '/requests/new_request.mako', request_form_id=request_type.request_form_id, - request_type=request_type, + request_type=request_type, widgets=widgets, title=title, msg=msg, messagetype=messagetype) + def __library_ui(self, libraries, **kwd): + params = util.Params( kwd ) + create_lib_str = 'Create a new library' + value = int(params.get( 'library_id', 0 )) + if not value: # if no library previously selected + # show the selectbox with 'create a new library' option selected + lib_list = SelectField('library_id', refresh_on_change=True, + refresh_on_change_values=[create_lib_str]) + #lib_list.add_option(create_lib_str, 0, selected=True) + for lib in libraries: + lib_list.add_option(lib.name, lib.id) + widget = dict(label='Library', + widget=lib_list, + helptext='Associated library where the resultant \ + dataset will be stored.') + else: # if some library previously selected + # show the selectbox with some library selected + lib_list = SelectField('library_id', refresh_on_change=True, + refresh_on_change_values=[create_lib_str]) + #lib_list.add_option(create_lib_str, 0) + for lib in libraries: + if value == lib.id: + lib_list.add_option(lib.name, lib.id, selected=True) + else: + lib_list.add_option(lib.name, lib.id) + widget = dict(label='Library', + widget=lib_list, + helptext='Associated library where the resultant \ + dataset will be stored.') + return widget + + def __submit(self, trans, id): + try: + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message=msg, + **kwd) ) + # get the new state + new_state = request.type.states[1] + for s in request.samples: + event = trans.app.model.SampleEvent(s, new_state, 'Samples submitted to the system') + event.flush() + # change request's submitted field + request.submitted = True + request.flush() + kwd = {} + kwd['id'] = trans.security.encode_id(request.id) + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + **kwd) ) + @web.expose + def submit_request(self, trans, **kwd): + params = util.Params( kwd ) + try: + id = int(params.get('id', False)) + request = trans.app.model.Request.get(id) + except: + msg = "Invalid request ID" + log.warn( msg ) + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message=msg, + **kwd) ) + # get the new state + new_state = request.type.states[1] + for s in request.samples: + event = trans.app.model.SampleEvent(s, new_state, 'Samples submitted to the system') + event.flush() + # change request's submitted field + request.submitted = True + request.flush() + ## TODO + kwd['id'] = trans.security.encode_id(request.id) + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + **kwd) ) def __create_form(self, trans, form_id, widgets=[], form_values=None, **kwd): params = util.Params( kwd ) form = trans.app.model.FormDefinition.get(form_id) @@ -316,7 +463,7 @@ elif field['type'] == 'CheckboxField': fw.checked = value # require/optional - if field['required']: + if field['required'] == 'required': req = 'Required' else: req = 'Optional' @@ -325,140 +472,20 @@ helptext=field['helptext']+' ('+req+')')) return widgets @web.expose - def add_sample(self, trans, **kwd): + def show_events(self, trans, **kwd): params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - return self.__show_sample_form(trans, sample=None, **kwd) - - def __show_sample_form(self, trans, sample=None, **kwd): - params = util.Params( kwd ) - msg = util.restore_text( params.get( 'msg', '' ) ) - messagetype = params.get( 'messagetype', 'done' ) - request = trans.app.model.Request.get(int( params.request_id )) - if sample: - form_values = sample.values - else: - form_values = None - # list of widgets to be rendered on the request form - widgets = [] - widgets.append(dict(label='Name', - widget=TextField('name', 40, - util.restore_text( params.get( 'name', '' ) )), - helptext='(Required)')) - widgets.append(dict(label='Description', - widget=TextField('desc', 40, - util.restore_text( params.get( 'desc', '' ) )), - helptext='(Optional)')) - widgets = self.__create_form(trans, request.type.sample_form_id, widgets, - form_values, **kwd) - title = 'Add a new sample to request: %s of type: %s' % (request.name, request.type.name) - return trans.fill_template( '/sample/new_sample.mako', - sample_form_id=request.type.sample_form_id, - request_id=request.id, - widgets=widgets, - title=title, - msg=msg, - messagetype=messagetype) - @web.expose - def samples(self, trans, **kwd): - params = util.Params( kwd ) - if params.get('save', False) == 'True': - request = trans.app.model.Request.get(int(params.request_id )) - msg = self.__validate(trans, - [('name','Name')], - request.type.sample_form.fields, - **kwd) - if msg: - return trans.response.send_redirect( web.url_for( controller='requests', - action='add_sample', - msg=msg, - messagetype='error', - **kwd) ) - sample = self.__save_sample(trans, sample_id=None, **kwd) - msg = 'The new sample named %s has been created' % sample.name + try: + sample_id = int(params.get('sample_id', False)) + sample = trans.app.model.Sample.get(sample_id) + except: + msg = "Invalid sample ID" return trans.response.send_redirect( web.url_for( controller='requests', action='list', - operation='samples', - id=trans.security.encode_id(sample.request_id), + status='error', + message=msg, **kwd) ) - def __save_sample(self, trans, sample_id=None, **kwd): - params = util.Params( kwd ) - if not sample_id: - request = trans.app.model.Request.get(int(params.request_id)) - else: - #TODO editing - pass - name = util.restore_text(params.get('name', '')) - desc = util.restore_text(params.get('desc', '')) - values = [] - for index, field in enumerate(request.type.sample_form.fields): - values.append(util.restore_text(params.get('field_%i' % index, ''))) - if not sample_id: - form_values = trans.app.model.FormValues(request.type.sample_form, values) - form_values.flush() - sample = trans.app.model.Sample(name, desc, request, form_values) - sample.flush() - # set the initial state - state = trans.app.model.SampleState.filter(trans.app.model.SampleState.table.c.request_type_id == request.type.id).first() - event = trans.app.model.SampleEvent(sample, state) - event.flush() - else: - form_data.content = values - form_data.flush() - return sample - def show_sample_read_only(self, trans, sample_id): - ''' - Shows the sample details - ''' - sample = trans.app.model.Sample.get(sample_id) - request = sample.request - request_type = sample.request.type - sample_form = sample.request.type.sample_form - sample_values = sample.values - # list of widgets to be rendered on the request form - sample_details = [] - # main details - sample_details.append(dict(label='Name', - value=sample.name, - helptext='')) - sample_details.append(dict(label='Description', - value=sample.desc, - helptext='')) - sample_details.append(dict(label='Date created', - value=sample.create_time, - helptext='')) - sample_details.append(dict(label='Date updated', - value=sample.create_time, - helptext='')) - sample_details.append(dict(label='User', - value=str(trans.user.email), - helptext='')) - sample_details.append(dict(label='Request', - value=request.name, - helptext='Name/ID of the request this sample belongs to.')) - # get the current state of the sample - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample_id).all() - curr_state = all_states[len(all_states)-1].state - sample_details.append(dict(label='State', - value=curr_state.name, - helptext=curr_state.desc)) - # form fields - for index, field in enumerate(sample_form.fields): - if field['required']: - req = 'Required' - else: - req = 'Optional' - sample_details.append(dict(label=field['label'], - value=sample_values.content[index], - helptext=field['helptext']+' ('+req+')')) - return trans.fill_template( '/sample/view_sample.mako', - sample_details=sample_details) - def show_events(self, trans, sample_id): - sample = trans.app.model.Sample.get(sample_id) events_list = [] - all_events = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample_id).all() - all_events.reverse() + all_events = sample.events for event in all_events: delta = datetime.utcnow() - event.update_time if delta > timedelta( minutes=60 ): @@ -469,7 +496,7 @@ return trans.fill_template( '/sample/sample_events.mako', events_list=events_list, sample_name=sample.name, - request=sample.request.name) + request=sample.request) diff -r f75758b35e51 -r 26b69d176146 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Jul 23 14:31:11 2009 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Thu Jul 23 17:08:21 2009 -0400 @@ -15,16 +15,15 @@ SUCCESS, INFO, WARNING, ERROR = "done", "info", "warning", "error" class RequestsListGrid( grids.Grid ): - title = "Requests" + title = "Sequencing Requests" model_class = model.Request default_sort_key = "-create_time" columns = [ grids.GridColumn( "Name", key="name", - link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) ), - attach_popup=True ), + link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) )), grids.GridColumn( "Description", key="desc"), grids.GridColumn( "Sample(s)", method='number_of_samples', - link=( lambda item: iff( item.deleted, None, dict( operation="samples", id=item.id ) ) ), ), + link=( lambda item: iff( item.deleted, None, dict( operation="show_request", id=item.id ) ) ), ), grids.GridColumn( "Type", key="request_type_id", method='get_request_type'), grids.GridColumn( "Last update", key="update_time", format=time_ago ), grids.GridColumn( "User", key="user_id", method='get_user') @@ -32,7 +31,7 @@ ] operations = [ # grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), - grids.GridOperation( "Samples", allow_multiple=False, condition=( lambda item: not item.deleted ) ), +# grids.GridOperation( "Samples", allow_multiple=False, condition=( lambda item: not item.deleted ) ), # grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), # grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), ] @@ -49,50 +48,10 @@ request_type = trans.app.model.RequestType.get(request.request_type_id) return request_type.name def apply_default_filter( self, trans, query ): - return query + return query.filter_by(submitted=True) def number_of_samples(self, trans, request): - return str(len(trans.app.model.Sample.filter(trans.app.model.Sample.table.c.request_id==request.id).all())) + return str(len(request.samples)) -class SamplesListGrid( grids.Grid ): - model_class = model.Sample - default_sort_key = "-create_time" - columns = [ - grids.GridColumn( "Name", key="name", - link=( lambda item: iff( item.deleted, None, dict( operation="show_sample", id=item.id ) ) ), - attach_popup=True ), - grids.GridColumn( "Description", key='desc' ), - grids.GridColumn( "Status", method="get_status", - link=( lambda item: iff( item.deleted, None, dict( operation="events", id=item.id ) ) )), - - grids.GridColumn( "Last update", key="update_time", format=time_ago ) - - # Valid for filtering but invisible - #grids.GridColumn( "Deleted", key="deleted", visible=False ) - ] - operations = [ -# grids.GridOperation( "Edit", allow_multiple=False, condition=( lambda item: not item.deleted ) ), - grids.GridOperation( "Change state", condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), -# grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), - - ] - standard_filters = [ - grids.GridColumnFilter( "Active", args=dict( deleted=False ) ), - grids.GridColumnFilter( "Deleted", args=dict( deleted=True ) ), - grids.GridColumnFilter( "All", args=dict( deleted='All' ) ) - ] - def __init__(self, request, user): - self.request = request - self.user = user - def get_current_item( self, trans ): - return None - def apply_default_filter( self, trans, query ): - return query.filter_by( request_id=self.request.id ) - def get_status(self, trans, sample): - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample.id).all() - curr_state = trans.app.model.SampleState.get(all_states[len(all_states)-1].sample_state_id) - return curr_state.name - class Requests( BaseController ): request_grid = RequestsListGrid() @@ -118,30 +77,26 @@ operation = kwargs['operation'].lower() if operation == "show_request": id = trans.security.decode_id(kwargs['id']) - return self.show_read_only(trans, id) - elif operation == "samples": - id = trans.security.decode_id(kwargs['id']) - return self.show_samples(trans, id, kwargs) - elif operation == "show_sample": - id = trans.security.decode_id(kwargs['id']) - return self.show_sample_read_only(trans, id) - elif operation == "change state": - id_list = [trans.security.decode_id(id) for id in util.listify(kwargs['id'])] - return self.change_state(trans, id_list) - elif operation == "events": - id = trans.security.decode_id(kwargs['id']) - return self.show_events(trans, id) + return self.__show_request(trans, id) # Render the list view - return self.request_grid( trans, status=status, message=message, template='/admin/requests/grid.mako', **kwargs ) - def show_samples(self, trans, id, kwargs): - ''' - Shows all the samples associated with this request - ''' - status = message = None - request = trans.app.model.Request.get(id) - self.samples_grid = SamplesListGrid(request, trans.app.model.User.get(request.user_id)) - return self.samples_grid( trans, status=status, message=message, template='/admin/samples/grid.mako', **kwargs ) - def show_read_only(self, trans, id): + return self.request_grid( trans, template='/admin/requests/grid.mako', **kwargs ) + def __show_request(self, trans, id): + try: + request = trans.app.model.Request.get(id) + except: + return trans.response.send_redirect( web.url_for( controller='requests', + action='list', + status='error', + message="Invalid request ID", + **kwd) ) + self.current_samples = [] + for s in request.samples: + self.current_samples.append([s.name, s.values.content]) + return trans.fill_template( '/admin/requests/show_request.mako', + request=request, + request_details=self.request_details(trans, id), + current_samples = self.current_samples) + def request_details(self, trans, id): ''' Shows the request details ''' @@ -150,9 +105,6 @@ # list of widgets to be rendered on the request form request_details = [] # main details - request_details.append(dict(label='Name', - value=request.name, - helptext='')) request_details.append(dict(label='Description', value=request.desc, helptext='')) @@ -182,120 +134,106 @@ request_details.append(dict(label=field['label'], value=request.values.content[index], helptext=field['helptext']+' ('+req+')')) - return trans.fill_template( '/admin/requests/view_request.mako', - request_form_id=request.type.request_form.id, - request_details=request_details, - request_type=request.type) + return request_details + @web.expose + @web.require_admin + def bar_codes(self, trans, **kwd): + params = util.Params( kwd ) + request_id = params.get('request_id', None) + if request_id: + request_id = int(request_id) + request = trans.app.model.Request.get(request_id) + return trans.fill_template( '/admin/samples/bar_codes.mako', + samples_list=[s for s in request.samples], + user=request.user, + request=request) @web.expose @web.require_admin - def samples(self, trans, **kwd): + def save_bar_codes(self, trans, **kwd): params = util.Params( kwd ) - if params.get('save', False) == 'True': - sample = self.__save_sample(trans, params) - return self.show_samples(trans, sample.request_id, {}) - def show_sample_read_only(self, trans, sample_id): - ''' - Shows the sample details - ''' - sample = trans.app.model.Sample.get(sample_id) - request = sample.request - request_type = sample.request.type - sample_form = sample.request.type.sample_form - sample_values = sample.values - # list of widgets to be rendered on the request form - sample_details = [] - # main details - sample_details.append(dict(label='Name', - value=request.name, - helptext='')) - sample_details.append(dict(label='Description', - value=request.desc, - helptext='')) - sample_details.append(dict(label='Date created', - value=sample.create_time, - helptext='')) - sample_details.append(dict(label='Date updated', - value=sample.create_time, - helptext='')) - sample_details.append(dict(label='User', - value=str(trans.user.email), - helptext='')) - sample_details.append(dict(label='Request', - value=request.name, - helptext='Name/ID of the request this sample belongs to.')) - # get the current state of the sample - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample_id).all() - curr_state = all_states[len(all_states)-1].state - sample_details.append(dict(label='State', - value=curr_state.name, - helptext=curr_state.desc)) - # form fields - for index, field in enumerate(sample_form.fields): - if field['required']: - req = 'Required' + request_id = params.get('request_id', None) + if request_id: + request_id = int(request_id) + request = trans.app.model.Request.get(request_id) + # validate + # bar codes need to be globally unique + unique = True + for index in range(len(request.samples)): + bar_code = util.restore_text(params.get('sample_%i_bar_code' % index, '')) + all_samples = trans.app.model.Sample.query.all() + for sample in all_samples: + if bar_code == sample.bar_code: + unique = False + if not unique: + return trans.fill_template( '/admin/samples/bar_codes.mako', + samples_list=[s for s in request.samples], + user=request.user, + request=request, + messagetype='error', + msg='Samples cannot have same bar code.') + for index, sample in enumerate(request.samples): + bar_code = util.restore_text(params.get('sample_%i_bar_code' % index, '')) + sample.bar_code = bar_code + sample.flush() + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + operation='show_request', + id=trans.security.encode_id(request.id)) ) + def change_state(self, trans, sample): + possible_states = sample.request.type.states + curr_state = sample.current_state() + states_input = SelectField('select_state') + for state in possible_states: + if curr_state.name == state.name: + states_input.add_option(state.name+' (Current)', state.id, selected=True) else: - req = 'Optional' - sample_details.append(dict(label=field['label'], - value=sample_values.content[index], - helptext=field['helptext']+' ('+req+')')) - return trans.fill_template( '/admin/samples/view_sample.mako', - sample_details=sample_details) - def __get_all_states(self, trans, sample): - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample.id).all() - curr_state = all_states[len(all_states)-1].state - states_list = trans.app.model.SampleState.filter(trans.app.model.SampleState.table.c.request_type_id == sample.request.type.id) - return states_list - def __get_curr_state(self, trans, sample): - all_states = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample.id).all() - curr_state = all_states[len(all_states)-1].state - return curr_state - def change_state(self, trans, sample_id_list): - sample = trans.app.model.Sample.get(sample_id_list[0]) - states_list = self.__get_all_states(trans, sample) - curr_state = self.__get_curr_state(trans, sample) - states_input = SelectField('select_state') - for state in states_list: - if len(sample_id_list) == 1: - if curr_state.name == state.name: - states_input.add_option(state.name+' (Current)', state.name, selected=True) - else: - states_input.add_option(state.name, state.name) - else: - states_input.add_option(state.name, state.name) + states_input.add_option(state.name, state.id) widgets = [] - widgets.append(('Select the new state of the sample(s) from the list of possible state(s)', + widgets.append(('Select the new state of the sample from the list of possible state(s)', states_input)) widgets.append(('Comments', TextArea('comment'))) - title = 'Change current state of sample: ' + sample.name - return trans.fill_template( '/admin/samples/change_state.mako', - widgets=widgets, title=title, - sample_id_list=util.object_to_string(sample_id_list)) + title = 'Change current state' + return widgets, title @web.expose @web.require_admin def save_state(self, trans, **kwd): params = util.Params( kwd ) - sample_id_list = util.string_to_object(util.restore_text( params.sample_id_list )) + try: + sample_id = int(params.get('sample_id', False)) + sample = trans.app.model.Sample.get(sample_id) + except: + msg = "Invalid sample ID" + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) comments = util.restore_text( params.comment ) - sample = trans.app.model.Sample.get(sample_id_list[0]) - selected_state = util.restore_text( params.select_state ) + selected_state = int( params.select_state ) new_state = trans.app.model.SampleState.filter(trans.app.model.SampleState.table.c.request_type_id == sample.request.type.id - and trans.app.model.SampleState.table.c.name == selected_state)[0] - for id in sample_id_list: - s = trans.app.model.Sample.get(id) - event = trans.app.model.SampleEvent(s, new_state, comments) - event.flush() + and trans.app.model.SampleState.table.c.id == selected_state)[0] + event = trans.app.model.SampleEvent(sample, new_state, comments) + event.flush() return trans.response.send_redirect( web.url_for( controller='requests_admin', - action='list', - operation='samples', - id=trans.security.encode_id(sample.request.id)) ) + action='show_events', + sample_id=sample.id)) @web.expose @web.require_admin - def show_events(self, trans, sample_id): - sample = trans.app.model.Sample.get(sample_id) + def show_events(self, trans, **kwd): + params = util.Params( kwd ) + try: + sample_id = int(params.get('sample_id', False)) + sample = trans.app.model.Sample.get(sample_id) + except: + msg = "Invalid sample ID" + return trans.response.send_redirect( web.url_for( controller='requests_admin', + action='list', + status='error', + message=msg, + **kwd) ) events_list = [] - all_events = trans.app.model.SampleEvent.filter(trans.app.model.SampleEvent.table.c.sample_id == sample_id).all() - all_events.reverse() + all_events = sample.events for event in all_events: delta = datetime.utcnow() - event.update_time if delta > timedelta( minutes=60 ): @@ -303,8 +241,8 @@ else: last_update = '%s minutes' % int( delta.seconds / 60 ) events_list.append((event.state.name, event.state.desc, last_update, event.comment)) + widgets, title = self.change_state(trans, sample) return trans.fill_template( '/admin/samples/events.mako', events_list=events_list, - sample_name=sample.name, user=sample.request.user, - request=sample.request.name) + sample=sample, widgets=widgets, title=title) \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/forms/create_form.mako --- a/templates/admin/forms/create_form.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/forms/create_form.mako Thu Jul 23 17:08:21 2009 -0400 @@ -25,7 +25,9 @@ </div> <div style="clear: both"></div> </div> - <input type="submit" name="save_form" value="Save"/> + <div class="form-row"> + <input type="submit" name="save_form" value="Save"/> + </div> </form> </div> </div> diff -r f75758b35e51 -r 26b69d176146 templates/admin/forms/edit_form.mako --- a/templates/admin/forms/edit_form.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/forms/edit_form.mako Thu Jul 23 17:08:21 2009 -0400 @@ -37,20 +37,18 @@ %if field_attr[1].get_selected()[0] == 'SelectField': <% options = field_attr[2] %> <div class="repeat-group-item"> + <div class="form-row"> <label> Options</label> %for i, option in enumerate(options): <b> ${i+1}</b> - ${option[1].get_html()} - ##<input type="submit" name="remove_option_${index}" value="Remove option ${i+1}"/><br> + ${option[1].get_html()} <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form.id, select_box_options='remove', field_index=index, option_index=i )}">Remove</a><br> %endfor - </div> + </div> + </div> <div class="form-row"> <a class="action-button" href="${h.url_for( controller='forms', action='edit', form_id=form.id, select_box_options='add', field_index=index )}">Add</a> </div> - ##<div class="form-row"> - ## <input type="submit" name="add_option_field_${index}" value="Add option"/> - ##</div> %endif %endif </%def> @@ -99,7 +97,9 @@ </div> <div style="clear: both"></div> </div> - <input type="submit" name="save_changes_button" value="Save"/> + <div class="form-row"> + <input type="submit" name="save_changes_button" value="Save"/> + </div> </form> </div> </div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/add_states.mako --- a/templates/admin/requests/add_states.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/requests/add_states.mako Thu Jul 23 17:08:21 2009 -0400 @@ -6,7 +6,7 @@ %endif <div class="toolForm"> - <div class="toolFormTitle">Create ${num_states} states for the '${sample_type_name}' sample type</div> + <div class="toolFormTitle">Create ${num_states} states for the '${sample_type_name}' request type</div> <form name="new_form_fields" action="${h.url_for( controller='admin', action='request_type', save_new=True, create=False, edit=False, name=sample_type_name, description=desc, num_states=num_states, request_form_id=request_form_id, sample_form_id=sample_form_id)}" method="post" > <div class="toolFormBody"> %for element_count in range( num_states ): @@ -19,7 +19,7 @@ <div style="clear: both"></div> %endfor </div> - <div class="toolFormBody"> + <div class="form-row"> <input type="submit" name="save_new_sample_type" value="Save"/> </div> </form> diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/create_request_type.mako --- a/templates/admin/requests/create_request_type.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/requests/create_request_type.mako Thu Jul 23 17:08:21 2009 -0400 @@ -59,7 +59,9 @@ </div> <div style="clear: both"></div> </div> + <div class="form-row"> <input type="submit" name="create_library_button" value="Define states"/> + </div> </form> </div> %endif diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/edit_request_type.mako --- a/templates/admin/requests/edit_request_type.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/requests/edit_request_type.mako Thu Jul 23 17:08:21 2009 -0400 @@ -71,8 +71,9 @@ </div> <div style="clear: both"></div> </div> - - <input type="submit" name="edit_request_type_button" value="Save"/> + <div class="form-row"> + <input type="submit" name="edit_request_type_button" value="Save"/> + </div> </form> </div> </div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/grid.mako --- a/templates/admin/requests/grid.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/requests/grid.mako Thu Jul 23 17:08:21 2009 -0400 @@ -179,7 +179,11 @@ <div popupmenu="grid-${i}-popup"> %for operation in grid.operations: %if operation.allowed( item ): - <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %if operation.label == 'Submit': + <a class="action-button" confirm="More samples cannot be added to this request once it is submitted. Click OK to submit." href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %else: + <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %endif %endif %endfor </div> diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/show_request.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/admin/requests/show_request.mako Thu Jul 23 17:08:21 2009 -0400 @@ -0,0 +1,96 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + + +%if msg: + ${render_msg( msg, messagetype )} +%endif + + +<div class="grid-header"> + <h2>Request: ${request.name}</h2> +</div> + +<ul class="manage-table-actions"> + <li> + <a class="action-button" href="${h.url_for( controller='requests_admin', action='bar_codes', request_id=request.id)}"> + <span>Bar codes</span></a> + </li> +</ul> + +<%def name="render_sample( index, sample )"> + <td> + ${sample.name} + </td> + <td> + <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> + </td> + %for field_index, field in enumerate(request.type.sample_form.fields): + <td> + %if sample.values.content[field_index]: + ${sample.values.content[field_index]} + %else: + <i>None</i> + %endif + </td> + %endfor +</%def> + +<div class="toolForm"> + ##<div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> + %for index, rd in enumerate(request_details): + <div class="form-row"> + <label>${rd['label']}</label> + %if not rd['value']: + <i>None</i> + %else: + %if rd['label'] == 'Library': + <a href="${h.url_for( controller='admin', action='browse_library', id=request.library.id )}">${rd['value']}</a> + %else: + ${rd['value']} + %endif + %endif + </div> + <div style="clear: both"></div> + %endfor + </div> +</div> + +<div class="toolForm"> + ##<div class="toolFormTitle">Samples (${len(request.samples)})</div> + <form id="edit_form" name="edit_form" action="${h.url_for( controller='requests', action='show_request', request_id=request.id )}" method="post" > + <div class="form-row"> + %if current_samples: + <table class="grid"> + <thead> + <tr> + <th>No.</th> + <th>Sample Name</th> + <th>State</th> + %for field_index, field in enumerate(request.type.sample_form.fields): + <th> + ${field['label']} + <div class="toolParamHelp" style="clear: both;"> + <i>${field['helptext']}</i> + </div> + </th> + %endfor + </tr> + <thead> + <tbody> + %for sample_index, sample in enumerate(current_samples): + <tr> + <td>${sample_index+1}</td> + ${render_sample( sample_index, request.samples[sample_index] )} + </tr> + %endfor + </tbody> + </table> + %else: + <label>There are no samples.</label> + %endif + + </div> + ##</div> + </form> +</div> diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/view_request.mako --- a/templates/admin/requests/view_request.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,20 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> - %for index, rd in enumerate(request_details): - <div class="form-row"> - <label>${rd['label']}</label> - ##<i>${rd['helptext']}</i> - ${rd['value']} - </div> - <div style="clear: both"></div> - %endfor - </div> -</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/requests/view_request_type.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/admin/requests/view_request_type.mako Thu Jul 23 17:08:21 2009 -0400 @@ -0,0 +1,51 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + + +%if msg: + ${render_msg( msg, messagetype )} +%endif + +<% num_states=len(states_list) %> + +<div class="toolForm"> + <div class="toolFormTitle">View request type details</div> + <div class="toolFormBody"> + <form name="library" action="${h.url_for( controller='admin', action='request_type', save_changes=True, create=False, id=request_type.id, num_states=num_states )}" method="post" > + <div class="form-row"> + <label>Name</label> + ${request_type.name} + <div style="clear: both"></div> + </div> + <div class="form-row"> + <label>Description</label> + ${request_type.desc} + <div style="clear: both"></div> + </div> + <div class="form-row"> + <label> + Request Form definition + </label> + ${request_type.request_form.name} + </div> + <div class="form-row"> + <label> + Sample Form definition + </label> + ${request_type.sample_form.name} + </div> + <div class="form-row"> + <label> + Possible states + </label> + %for element_count, state in enumerate(states_list): + <div class="form-row"> + <label>${1+element_count}. ${state.name}</label> + ${state.desc} + </div> + <div style="clear: both"></div> + %endfor + </div> + </form> + </div> +</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/bar_codes.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/admin/samples/bar_codes.mako Thu Jul 23 17:08:21 2009 -0400 @@ -0,0 +1,37 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + +<h2>Bar codes for Samples of Request: ${request.name}</h2> +<h3>User: ${user.email}</h3> + +%if msg: + ${render_msg( msg, messagetype )} +%endif + +<div class="toolForm"> + <form name="bar_codes" action="${h.url_for( controller='requests_admin', action='save_bar_codes', request_id=request.id)}" method="post" > + <table class="grid"> + <thead> + <tr> + <th>Name</th> + <th>Description</th> + <th>Bar code</th> + </tr> + </thead> + <tbody> + %for index, sample in enumerate(samples_list): + <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> + <td><b><a>${sample.name}</a></b></td> + <td><a>${sample.desc}</a></td> + <td> + <input type="text" name="sample_${index}_bar_code" value=${sample.bar_code} size="40"/> + </td> + </tr> + %endfor + </tbody> + </table> + <div class="form-row"> + <input type="submit" name="save_new_sample_type" value="Save"/> + </div> + </form> +</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/change_state.mako --- a/templates/admin/samples/change_state.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,30 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif -<div class="toolForm"> - <div class="toolFormTitle">${title}</div> - <div class="toolFormBody"> - <form name="event" action="${h.url_for( controller='requests_admin', action='save_state', new=True, sample_id_list=sample_id_list)}" method="post" > - %for w in widgets: - <div class="form-row"> - <label> - ${w[0]} - </label> - ${w[1].get_html()} - %if w[0] == 'Comments': - <div class="toolParamHelp" style="clear: both;"> - Optional - </div> - %endif - </div> - %endfor - <div class="form-row"> - <input type="submit" name="add_event" value="Save"/> - </div> - </form> - </div> -</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/edit_sample.mako --- a/templates/admin/samples/edit_sample.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,83 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Edit sample named: ${values.content['Name']}</div> - <div class="toolFormBody"> - <form name="sample" action="${h.url_for( controller='sample', action='do', save_changes=True, sample_id=sample.id )}" method="post" > - <div class="form-row"> - <label> - Library: - </label> - <select name="library_id"> - %for library in libraries: - <option value="${library.id}">${library.name}</option> - %endfor - </select> - </div> - %for i, field in enumerate(form.fields): - <div class="form-row"> - <label>${field['label']}</label> - %if field['type'] == 'TextField': - <input type="text" name="${field['label']}" value="${values.content[field['label']]}" size="40"/> - %elif field['type'] == 'TextArea': - <textarea name="${field['label']}" rows="3" cols="35">${values.content[field['label']]}</textarea> - %elif field['type'] == 'CheckBox': - %if values.content[field['label']] == "true": - <input type="checkbox" name="${field['label']}" value="true" checked> - %else: - <input type="checkbox" name="${field['label']}" value="true"> - %endif - %elif field['type'] == 'SelectBox': - <select name="${field['label']}"> - %for ft in field['selectlist']: - %if ft == values.content[field['label']]: - <option value="${ft}" selected>${ft}</option> - %else: - <option value="${ft}">${ft}</option> - %endif - %endfor - </select> - %endif - <div class="toolParamHelp" style="clear: both;"> - ${field['helptext']} - </div> - <div style="clear: both"></div> - </div> - %endfor - <div class="form-row"> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="hidden" name="new" value="submitted" size="40"/> - </div> - <div style="clear: both"></div> - </div> - <div class="form-row"> - <input type="submit" name="create_library_button" value="Save"/> - </div> - </form> - </div> -</div> -<div class="toolForm"> - <div class="toolFormBody"> - <form name="event" action="${h.url_for( controller='admin', action='event', new=True, sample_id=sample.id)}" method="post" > - <div class="form-row"> - <label> - Change sample state to: - </label> - <select name="state_id"> - %for state in states: - <option value="${state.id}">${state.name}</option> - %endfor - </select> - </div> - <div class="form-row"> - <input type="submit" name="add_event" value="Save"/> - </div> - </form> - </div> -</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/events.mako --- a/templates/admin/samples/events.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/admin/samples/events.mako Thu Jul 23 17:08:21 2009 -0400 @@ -1,33 +1,57 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<%def name="title()">Events for Sample ${sample_name}</%def> +<%def name="title()">Events for Sample ${sample.name}</%def> -<h2>Events for Sample "${sample_name}" of Request: ${request}</h2> -<h3>User: ${user.email}</h3> +<h2>Events for Sample "${sample.name}" of Request: <a href="${h.url_for( controller='requests_admin', action='list', operation='show_request', id=trans.security.encode_id(sample.request.id))}">${sample.request.name}</a></h2> +<h3>User: ${sample.request.user.email}</h3> %if msg: ${render_msg( msg, messagetype )} %endif - -<table class="grid"> - <thead> - <tr> - <th>State</th> - <th>Description</th> - <th>Last Update</th> - <th>Comments</th> - </tr> - </thead> - <tbody> - %for state, desc, updated, comments in events_list: - <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - <td><b><a>${state}</a></b></td> - <td><a>${desc}</a></td> - <td><a>${updated}</a></td> - <td><a>${comments}</a></td> - </tr> - %endfor - </tbody> -</table> \ No newline at end of file +<div class="toolForm"> + <table class="grid"> + <thead> + <tr> + <th>State</th> + <th>Description</th> + <th>Last Update</th> + <th>Comments</th> + </tr> + </thead> + <tbody> + %for state, desc, updated, comments in events_list: + <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> + <td><b><a>${state}</a></b></td> + <td><a>${desc}</a></td> + <td><a>${updated}</a></td> + <td><a>${comments}</a></td> + </tr> + %endfor + </tbody> + </table> +</div> +<div class="toolForm"> + <div class="toolFormTitle">Change current state</div> + <div class="toolFormBody"> + <form name="event" action="${h.url_for( controller='requests_admin', action='save_state', new=True, sample_id=sample.id)}" method="post" > + %for w in widgets: + <div class="form-row"> + <label> + ${w[0]} + </label> + ${w[1].get_html()} + %if w[0] == 'Comments': + <div class="toolParamHelp" style="clear: both;"> + Optional + </div> + %endif + </div> + %endfor + <div class="form-row"> + <input type="submit" name="add_event" value="Save"/> + </div> + </form> + </div> +</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/grid.mako --- a/templates/admin/samples/grid.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,203 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - -<%def name="title()">Browse Samples</%def> - -%if message: - <p> - <div class="${message_type}message transient-message">${message}</div> - <div style="clear: both"></div> - </p> -%endif - -<%def name="javascripts()"> - ${parent.javascripts()} - <script type="text/javascript"> - ## TODO: generalize and move into galaxy.base.js - $(document).ready(function() { - $(".grid").each( function() { - var grid = this; - var checkboxes = $(this).find("input.grid-row-select-checkbox"); - var update = $(this).find( "span.grid-selected-count" ); - $(checkboxes).each( function() { - $(this).change( function() { - var n = $(checkboxes).filter("[checked]").size(); - update.text( n ); - }); - }) - }); - }); - ## Can this be moved into base.mako? - %if refresh_frames: - %if 'masthead' in refresh_frames: - ## Refresh masthead == user changes (backward compatibility) - if ( parent.user_changed ) { - %if trans.user: - parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} ); - %else: - parent.user_changed( null, false ); - %endif - } - %endif - %if 'history' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_history ) { - parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}"; - if ( parent.force_right_panel ) { - parent.force_right_panel( 'show' ); - } - } - %endif - %if 'tools' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_tools ) { - parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}"; - if ( parent.force_left_panel ) { - parent.force_left_panel( 'show' ); - } - } - %endif - %endif - </script> -</%def> - -<%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> - <style> - ## Not generic to all grids -- move to base? - .count-box { - min-width: 1.1em; - padding: 5px; - border-width: 1px; - border-style: solid; - text-align: center; - display: inline-block; - } - </style> -</%def> - -<div class="grid-header"> - <h2>Samples associated with request: ${grid.request.name}</h2> - <h3>User: ${grid.user.email}</h3> -## %if len(query.all()): -## <span class="title">Filter:</span> -## %for i, filter in enumerate( grid.standard_filters ): -## %if i > 0: -## <span>|</span> -## %endif -## <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span> -## %endfor -## %endif -</div> - -%if not len(query.all()): - There are no sample(s). -%else: -<form name="history_actions" action="${url()}" method="post" > - <table class="grid"> - <thead> - <tr> - <th></th> - %for column in grid.columns: - %if column.visible: - <% - href = "" - extra = "" - if column.sortable: - if sort_key == column.key: - if sort_order == "asc": - href = url( sort=( "-" + column.key ) ) - extra = "↓" - else: - href = url( sort=( column.key ) ) - extra = "↑" - else: - href = url( sort=column.key ) - %> - <th\ - %if column.ncells > 1: - colspan="${column.ncells}" - %endif - > - %if href: - <a href="${href}">${column.label}</a> - %else: - ${column.label} - %endif - <span>${extra}</span> - </th> - %endif - %endfor - <th></th> - </tr> - </thead> - <tbody> - %for i, item in enumerate( query ): - <tr \ - %if current_item == item: - class="current" \ - %endif - > - ## Item selection column - <td style="width: 1.5em;"> - <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" /> - </td> - ## Data columns - %for column in grid.columns: - %if column.visible: - <% - # Link - if column.link and column.link( item ): - href = url( **column.link( item ) ) - else: - href = None - # Value (coerced to list so we can loop) - value = column.get_value( trans, grid, item ) - if column.ncells == 1: - value = [ value ] - %> - %for cellnum, v in enumerate( value ): - <% - # Attach popup menu? - if column.attach_popup and cellnum == 0: - extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i - else: - extra = "" - %> - %if href: - <td><a href="${href}">${v}</a> ${extra}</td> - %else: - <td >${v}${extra}</td> - %endif - </td> - %endfor - %endif - %endfor - ## Actions column - <td> - <div popupmenu="grid-${i}-popup"> - %for operation in grid.operations: - %if operation.allowed( item ): - <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> - %endif - %endfor - </div> - </td> - </tr> - %endfor - </tbody> - <tfoot> - <tr> - <td></td> - <td colspan="100"> - For <span class="grid-selected-count"></span> selected requests: - %for operation in grid.operations: - %if operation.allow_multiple: - <input type="submit" name="operation" value="${operation.label}" class="action-button"> - %endif - %endfor - </td> - </tr> - </tfoot> - </table> -</form> - -%endif diff -r f75758b35e51 -r 26b69d176146 templates/admin/samples/view_sample.mako --- a/templates/admin/samples/view_sample.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,19 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Sample Details: '${sample_details[0]['value']}'</div> - %for index, rd in enumerate(sample_details): - <div class="form-row"> - <label>${rd['label']}</label> - ${rd['value']} - </div> - <div style="clear: both"></div> - %endfor - </div> -</div> diff -r f75758b35e51 -r 26b69d176146 templates/base.mako --- a/templates/base.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/base.mako Thu Jul 23 17:08:21 2009 -0400 @@ -33,30 +33,3 @@ </%def> -<script type="text/javascript"> -$( function() { - $( "select[refresh_on_change='true']").change( function() { - var refresh = false; - var refresh_on_change_values = $( this )[0].attributes.getNamedItem( 'refresh_on_change_values' ) - if ( refresh_on_change_values ) { - refresh_on_change_values = refresh_on_change_values.value.split( ',' ); - var last_selected_value = $( this )[0].attributes.getNamedItem( 'last_selected_value' ); - for( i= 0; i < refresh_on_change_values.length; i++ ) { - if ( $( this )[0].value == refresh_on_change_values[i] || ( last_selected_value && last_selected_value.value == refresh_on_change_values[i] ) ){ - refresh = true; - break; - } - } - } - else { - refresh = true; - } - if ( refresh ){ - $( ':file' ).each( function() { - var file_value = $( this )[0].value; - } ); - $( "#edit_form" ).submit(); - } - }); -}); -</script> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/base_panels.mako --- a/templates/base_panels.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/base_panels.mako Thu Jul 23 17:08:21 2009 -0400 @@ -156,7 +156,14 @@ ${tab( "libraries", "Libraries", h.url_for( controller='library', action='index' ))} - ${tab( "requests", "Requests", h.url_for( controller='requests', action='index' ), visible = (trans.user and trans.request_types)) } + <td class="tab"> + <a>Lab</a> + <div class="submenu"> + <ul> + <li><a target="requests" href="${h.url_for( controller='requests', action='index' )}">Sequencing Requests</a></li> + </ul> + </div> + </td> %if app.config.get_bool( 'enable_tracks', False ): <td class="tab"> diff -r f75758b35e51 -r 26b69d176146 templates/requests/grid.mako --- a/templates/requests/grid.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/requests/grid.mako Thu Jul 23 17:08:21 2009 -0400 @@ -184,7 +184,11 @@ <div popupmenu="grid-${i}-popup"> %for operation in grid.operations: %if operation.allowed( item ): - <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %if operation.label == 'Submit': + <a class="action-button" confirm="More samples cannot be added to this request once it is submitted. Click OK to submit." href="${url( operation=operation.label, id=item.id)}">${operation.label}</a> + %else: + <a class="action-button" href="${url( operation=operation.label, id=item.id )}">${operation.label}</a> + %endif %endif %endfor </div> diff -r f75758b35e51 -r 26b69d176146 templates/requests/new_request.mako --- a/templates/requests/new_request.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/requests/new_request.mako Thu Jul 23 17:08:21 2009 -0400 @@ -9,11 +9,14 @@ <div class="toolForm"> <div class="toolFormTitle">${title}</div> <div class="toolFormBody"> - <form name="sample" action="${h.url_for( controller='requests', action='new', save=True, request_form_id=request_form_id, request_type_id=request_type.id )}" method="post" > + <form id="new_request" name="new_request" action="${h.url_for( controller='requests', action='new', save=True, request_form_id=request_form_id, request_type_id=request_type.id )}" method="post" > %for i, field in enumerate(widgets): <div class="form-row"> <label>${field['label']}</label> ${field['widget'].get_html()} + %if field['label'] == 'Library' and new_library: + ${new_library.get_html()} + %endif <div class="toolParamHelp" style="clear: both;"> ${field['helptext']} </div> @@ -26,7 +29,10 @@ </div> <div style="clear: both"></div> </div> - <input type="submit" name="create_library_button" value="Save"/> + <div class="form-row"> + <input type="submit" name="create_request_button" value="Save"/> + <input type="submit" name="create_request_samples_button" value="Add samples"/> + </div> </form> </div> </div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/requests/show_request.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/requests/show_request.mako Thu Jul 23 17:08:21 2009 -0400 @@ -0,0 +1,157 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + + +%if msg: + ${render_msg( msg, messagetype )} +%endif + + +<div class="grid-header"> + <h2>Request: ${request.name}</h2> +</div> + +%if not request.submitted and request.samples: +<ul class="manage-table-actions"> + <li> + <a class="action-button" confirm="More samples cannot be added to this request once it is submitted. Click OK to submit." href="${h.url_for( controller='requests', action='submit_request', id=request.id)}"> + <span>Submit request</span></a> + </li> +</ul> +%endif + + +<%def name="render_sample_form( index, sample_name, sample_values )"> + <td> + <input type="text" name=sample_${index}_name value="${sample_name}" size="15"/> + <div class="toolParamHelp" style="clear: both;"> + <i>${' (required)' }</i> + </div> + </td> + <td> + </td> + %for field_index, field in enumerate(request.type.sample_form.fields): + <td> + <input type="text" name=sample_${index}_field_${field_index} value="${sample_values[field_index]}" size="15"/> + <div class="toolParamHelp" style="clear: both;"> + <i>${'('+field['required']+')' }</i> + </div> + </td> + %endfor +</%def> + +<%def name="render_sample( index, sample )"> + <td> + ${sample.name} + </td> + <td> + <a href="${h.url_for( controller='requests', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> + </td> + %for field_index, field in enumerate(request.type.sample_form.fields): + <td> + %if sample.values.content[field_index]: + ${sample.values.content[field_index]} + %else: + <i>None</i> + %endif + </td> + %endfor +</%def> + +<div class="toolForm"> + ##<div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> + %for index, rd in enumerate(request_details): + <div class="form-row"> + <label>${rd['label']}</label> + %if not rd['value']: + <i>None</i> + %else: + %if rd['label'] == 'Library': + <a href="${h.url_for( controller='library', action='browse_library', id=request.library.id )}">${rd['value']}</a> + %else: + ${rd['value']} + %endif + %endif + </div> + <div style="clear: both"></div> + %endfor + </div> +</div> + +<div class="toolForm"> + ##<div class="toolFormTitle">Samples (${len(request.samples)})</div> + <form id="edit_form" name="edit_form" action="${h.url_for( controller='requests', action='show_request', request_id=request.id )}" method="post" > + <div class="form-row"> + %if current_samples: + <table class="grid"> + <thead> + <tr> + <th>No.</th> + <th>Sample Name</th> + <th>State</th> + %for field_index, field in enumerate(request.type.sample_form.fields): + <th> + ${field['label']} + <div class="toolParamHelp" style="clear: both;"> + <i>${field['helptext']}</i> + </div> + </th> + %endfor + <th></th> + </tr> + <thead> + <tbody> + %for sample_index, sample in enumerate(current_samples): + <tr> + <td>${sample_index+1}</td> + %if sample[0] in [s.name for s in request.samples]: + ${render_sample( sample_index, request.samples[sample_index] )} + %else: + ${render_sample_form( sample_index, sample[0], sample[1])} + %endif + <td> + %if not request.submitted: + <a class="action-button" href="${h.url_for( controller='requests', action='delete_sample', request_id=request.id, sample_id=sample_index)}"> + <img src="${h.url_for('/static/images/delete_icon.png')}" /> + <span></span></a> + %endif + </td> + </tr> + %endfor + </tbody> + </table> + %else: + <label>There are no samples.</label> + %endif + + </div> + %if not request.submitted: + <br/> + <br/> + <div class="form-row"> + <ul class="manage-table-actions"> + <li> + %if current_samples: + <a>Copy from sample no. </a> + ${sample_copy.get_html()} + %endif + <input type="submit" name="add_sample_button" value="Add New"/> + + </li> + </ul> + </div> + %endif + %if not request.submitted and (request.samples or current_samples): + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="hidden" name="refresh" value="true" size="40"/> + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="save_samples_button" value="Save"/> + </div> + %endif + ##</div> + </form> +</div> diff -r f75758b35e51 -r 26b69d176146 templates/requests/view_request.mako --- a/templates/requests/view_request.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,20 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Request Details: '${request_details[0]['value']}'</div> - %for index, rd in enumerate(request_details): - <div class="form-row"> - <label>${rd['label']}</label> - ##<i>${rd['helptext']}</i> - ${rd['value']} - </div> - <div style="clear: both"></div> - %endfor - </div> -</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/sample/browse_samples.mako --- a/templates/sample/browse_samples.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,43 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - -<%def name="title()">Browse Samples</%def> - -<h2>Samples</h2> - -<ul class="manage-table-actions"> - %if not deleted: - <li> - <a class="action-button" href="${h.url_for( controller='sample', action='do', new=True )}"><span>Add Sample</span></a> - </li> - %endif -</ul> - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -%if not samples_list: - You have no samples. -%else: - <table class="grid"> - <thead> - <tr> - <th>Name</th> - <th>Description</th> - <th>Type</th> - <th>State</th> - </tr> - </thead> - <tbody> - %for id, name, desc, st, state in samples_list: - <tr class="libraryRow libraryOrFolderRow" id="libraryRow"> - <td><b><a href="${h.url_for( controller='sample', action='do', sample_id=id, edit=True)}">${name}</a></b></td> - <td><a>${desc}</a></td> - <td><a>${st}</a></td> - <td><a href="${h.url_for( controller='sample', action='events', sample_id=id)}">${state}</a></td> - </tr> - %endfor - </tbody> - </table> -%endif \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/sample/edit_sample.mako --- a/templates/sample/edit_sample.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,64 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Edit sample named: ${values.content['Name']}</div> - <div class="toolFormBody"> - <form name="sample" action="${h.url_for( controller='sample', action='do', save_changes=True, sample_id=sample.id )}" method="post" > - <div class="form-row"> - <label> - Library: - </label> - <select name="library_id"> - %for library in libraries: - <option value="${library.id}">${library.name}</option> - %endfor - </select> - </div> - %for i, field in enumerate(form.fields): - <div class="form-row"> - <label>${field['label']}</label> - %if field['type'] == 'TextField': - <input type="text" name="${field['label']}" value="${values.content[field['label']]}" size="40"/> - %elif field['type'] == 'TextArea': - <textarea name="${field['label']}" rows="3" cols="35">${values.content[field['label']]}</textarea> - %elif field['type'] == 'CheckBox': - %if values.content[field['label']] == "true": - <input type="checkbox" name="${field['label']}" value="true" checked> - %else: - <input type="checkbox" name="${field['label']}" value="true"> - %endif - %elif field['type'] == 'SelectBox': - <select name="${field['label']}"> - %for ft in field['selectlist']: - %if ft == values.content[field['label']]: - <option value="${ft}" selected>${ft}</option> - %else: - <option value="${ft}">${ft}</option> - %endif - %endfor - </select> - %endif - <div class="toolParamHelp" style="clear: both;"> - ${field['helptext']} - </div> - <div style="clear: both"></div> - </div> - %endfor - <div class="form-row"> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="hidden" name="new" value="submitted" size="40"/> - </div> - <div style="clear: both"></div> - </div> - <div class="form-row"> - <input type="submit" name="create_library_button" value="Save"/> - </div> - </form> - </div> -</div> diff -r f75758b35e51 -r 26b69d176146 templates/sample/grid.mako --- a/templates/sample/grid.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,210 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - -<%def name="title()">Browse Samples</%def> - -%if message: - <p> - <div class="${message_type}message transient-message">${message}</div> - <div style="clear: both"></div> - </p> -%endif - -<%def name="javascripts()"> - ${parent.javascripts()} - <script type="text/javascript"> - ## TODO: generalize and move into galaxy.base.js - $(document).ready(function() { - $(".grid").each( function() { - var grid = this; - var checkboxes = $(this).find("input.grid-row-select-checkbox"); - var update = $(this).find( "span.grid-selected-count" ); - $(checkboxes).each( function() { - $(this).change( function() { - var n = $(checkboxes).filter("[checked]").size(); - update.text( n ); - }); - }) - }); - }); - ## Can this be moved into base.mako? - %if refresh_frames: - %if 'masthead' in refresh_frames: - ## Refresh masthead == user changes (backward compatibility) - if ( parent.user_changed ) { - %if trans.user: - parent.user_changed( "${trans.user.email}", ${int( app.config.is_admin_user( trans.user ) )} ); - %else: - parent.user_changed( null, false ); - %endif - } - %endif - %if 'history' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_history ) { - parent.frames.galaxy_history.location.href="${h.url_for( controller='root', action='history')}"; - if ( parent.force_right_panel ) { - parent.force_right_panel( 'show' ); - } - } - %endif - %if 'tools' in refresh_frames: - if ( parent.frames && parent.frames.galaxy_tools ) { - parent.frames.galaxy_tools.location.href="${h.url_for( controller='root', action='tool_menu')}"; - if ( parent.force_left_panel ) { - parent.force_left_panel( 'show' ); - } - } - %endif - %endif - </script> -</%def> - -<%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> - <style> - ## Not generic to all grids -- move to base? - .count-box { - min-width: 1.1em; - padding: 5px; - border-width: 1px; - border-style: solid; - text-align: center; - display: inline-block; - } - </style> -</%def> - -<div class="grid-header"> - <h2>Samples associated with request: ${grid.request.name}</h2> -## %if len(query.all()): -## <span class="title">Filter:</span> -## %for i, filter in enumerate( grid.standard_filters ): -## %if i > 0: -## <span>|</span> -## %endif -## <span class="filter"><a href="${url( filter.get_url_args() )}">${filter.label}</a></span> -## %endfor -## %endif -</div> - -<ul class="manage-table-actions"> - <li> - <a class="action-button" href="${h.url_for( controller='requests', action='add_sample', request_id=grid.request.id)}"> - <img src="${h.url_for('/static/images/silk/add.png')}" /> - <span>Add sample</span></a> - </li> -</ul> - -%if not len(query.all()): - There are no sample(s). -%else: -<form name="history_actions" action="${url()}" method="post" > - <table class="grid"> - <thead> - <tr> - <th></th> - %for column in grid.columns: - %if column.visible: - <% - href = "" - extra = "" - if column.sortable: - if sort_key == column.key: - if sort_order == "asc": - href = url( sort=( "-" + column.key ) ) - extra = "↓" - else: - href = url( sort=( column.key ) ) - extra = "↑" - else: - href = url( sort=column.key ) - %> - <th\ - %if column.ncells > 1: - colspan="${column.ncells}" - %endif - > - %if href: - <a href="${href}">${column.label}</a> - %else: - ${column.label} - %endif - <span>${extra}</span> - </th> - %endif - %endfor - <th></th> - </tr> - </thead> - <tbody> - %for i, item in enumerate( query ): - <tr \ - %if current_item == item: - class="current" \ - %endif - > - ## Item selection column - <td style="width: 1.5em;"> - <input type="checkbox" name="id" value=${trans.security.encode_id( item.id )} class="grid-row-select-checkbox" /> - </td> - ## Data columns - %for column in grid.columns: - %if column.visible: - <% - # Link - if column.link and column.link( item ): - href = url( **column.link( item ) ) - else: - href = None - # Value (coerced to list so we can loop) - value = column.get_value( trans, grid, item ) - if column.ncells == 1: - value = [ value ] - %> - %for cellnum, v in enumerate( value ): - <% - # Attach popup menu? - if column.attach_popup and cellnum == 0: - extra = '<a id="grid-%d-popup" class="popup-arrow" style="display: none;">▼</a>' % i - else: - extra = "" - %> - %if href: - <td><a href="${href}">${v}</a> ${extra}</td> - %else: - <td >${v}${extra}</td> - %endif - </td> - %endfor - %endif - %endfor - ## Actions column -## <td> -## <div popupmenu="grid-${i}-popup"> -## %for operation in grid.operations: -## %if operation.allowed( item ): -## <a class="action-button" href="${url( operation=operation.label, id=trans.security.encode_id( item.id ) )}">${operation.label}</a> -## %endif -## %endfor -## </div> -## </td> - </tr> - %endfor - </tbody> -## <tfoot> -## <tr> -## <td></td> -## <td colspan="100"> -## For <span class="grid-selected-count"></span> selected requests: -## %for operation in grid.operations: -## %if operation.allow_multiple: -## <input type="submit" name="operation" value="${operation.label}" class="action-button"> -## %endif -## %endfor -## </td> -## </tr> -## </tfoot> - </table> -</form> - -%endif diff -r f75758b35e51 -r 26b69d176146 templates/sample/new_sample.mako --- a/templates/sample/new_sample.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,32 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">${title}</div> - <div class="toolFormBody"> - <form name="sample" action="${h.url_for( controller='requests', action='samples', save=True, sample_form_id=sample_form_id, request_id=request_id )}" method="post" > - %for i, field in enumerate(widgets): - <div class="form-row"> - <label>${field['label']}</label> - ${field['widget'].get_html()} - <div class="toolParamHelp" style="clear: both;"> - ${field['helptext']} - </div> - <div style="clear: both"></div> - </div> - %endfor - <div class="form-row"> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="hidden" name="new" value="submitted" size="40"/> - </div> - <div style="clear: both"></div> - </div> - <input type="submit" name="create_sample_button" value="Save"/> - </form> - </div> -</div> \ No newline at end of file diff -r f75758b35e51 -r 26b69d176146 templates/sample/sample_events.mako --- a/templates/sample/sample_events.mako Thu Jul 23 14:31:11 2009 -0400 +++ b/templates/sample/sample_events.mako Thu Jul 23 17:08:21 2009 -0400 @@ -3,7 +3,7 @@ <%def name="title()">Events for Sample ${sample_name}</%def> -<h2>Events for Sample "${sample_name}" of Request: ${request}</h2> +<h2>Events for Sample "${sample_name}" of Request: <a href="${h.url_for( controller='requests', action='list', operation='show_request', id=trans.security.encode_id(request.id))}">${request.name}</a></h2> %if msg: ${render_msg( msg, messagetype )} diff -r f75758b35e51 -r 26b69d176146 templates/sample/view_sample.mako --- a/templates/sample/view_sample.mako Thu Jul 23 14:31:11 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,19 +0,0 @@ -<%inherit file="/base.mako"/> -<%namespace file="/message.mako" import="render_msg" /> - - -%if msg: - ${render_msg( msg, messagetype )} -%endif - -<div class="toolForm"> - <div class="toolFormTitle">Sample Details: '${sample_details[0]['value']}'</div> - %for index, rd in enumerate(sample_details): - <div class="form-row"> - <label>${rd['label']}</label> - ${rd['value']} - </div> - <div style="clear: both"></div> - %endfor - </div> -</div>

1 0

Post-installation: AttributeError: 'builtin_function_or_method' object has no attribute 'body'
by Pedro Silva 28 Jul '09

28 Jul '09

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Hi all, I'm trying out Galaxy. Installation went fine, but most links other than those under Tools (Workflow, Libraries, Help, User, etc.) return a python traceback (included below) relating to AttributeError. I'm pretty new to Python and the egg system, so I am having a hard time figuring out the problem. I've tested this with the generic release tarball, mercurial checkout, and latest 3851029eda94 revision. I'm running this on Ubuntu 9.04 x86_64 with Python 2.6.2 (but already tested with 2.4 and 2.5 as well -- both fail to start the server). I've a server running at http://dzlab.pmb.berkeley.edu:8081/, in case it helps. Thanks for your help. The software looks pretty sweet in any case. Pedro Traceback: - --- URL: http://dzlab.pmb.berkeley.edu:8081/workflow/list File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/WebError-0.8a-py2.6.egg/weberror/evalexception/middleware.py', line 364 in respond File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Paste-1.5.1-py2.6.egg/paste/debug/prints.py', line 98 in __call__ File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Paste-1.5.1-py2.6.egg/paste/wsgilib.py', line 539 in intercept_output File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Beaker-0.5-py2.6.egg/beaker/session.py', line 103 in __call__ File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Paste-1.5.1-py2.6.egg/paste/recursive.py', line 80 in __call__ File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Paste-1.5.1-py2.6.egg/paste/httpexceptions.py', line 632 in __call__ File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/base.py', line 126 in __call__ body = method( trans, **kwargs ) File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/__init__.py', line 74 in decorator % ( url_for( controller='user', action='login' ), verb ) ) File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/__init__.py', line 542 in show_error_message return self.show_message( message, 'error', refresh_frames ) File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/__init__.py', line 537 in show_message return self.fill_template( "message.mako", message_type=type, message=message, refresh_frames=refresh_frames, cont=cont ) File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/__init__.py', line 567 in fill_template return self.fill_template_mako( filename, **kwargs ) File '/home/psilva/src/galaxy_dist/lib/galaxy/web/framework/__init__.py', line 578 in fill_template_mako return template.render( **data ) File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Mako-0.1.10-py2.6.egg/mako/template.py', line 114 in render File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Mako-0.1.10-py2.6.egg/mako/runtime.py', line 287 in _render File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Mako-0.1.10-py2.6.egg/mako/runtime.py', line 304 in _render_context File '/home/psilva/src/galaxy_dist/eggs/py2.6-noplatform/Mako-0.1.10-py2.6.egg/mako/runtime.py', line 337 in _exec_template File '/home/psilva/src/galaxy_dist/database/compiled_templates/base.mako.py', line 33 in render_body context.write(unicode(next.body())) AttributeError: 'builtin_function_or_method' object has no attribute 'body' -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.9 (GNU/Linux) Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org iEYEAREIAAYFAkpn7yAACgkQvUI03qKHSRpiYwCggTcEcAeL29Qo/9old9OndGlk Dh8AnA007bHeudf1YKBFpF3yfKRIfbhv =tcaT -----END PGP SIGNATURE-----

3 5

Re: [galaxy-dev] Problem with Galaxy Installation
by Greg Von Kuster 27 Jul '09

27 Jul '09

Pankaj, Thanks for pointing this out. We'll let you know as soon as the problem is corrected - it will be a few days. Greg Von Kuster Galaxy Development Team Pankaj Narang wrote: > Hello Greg, > > Thank you for your reply. > Yes,Galaxy should work on 64 bit RHEL 5.0 system which I came to know > while I was going through the documentation available for galaxy on > website but it doesn't .It seems that it is not able to download the > required eggs for 64 bit Linux.I am sending you the error which I get > while running setup.sh.I get the same error when I run fetch_eggs.py > in scripts/ > May be this will help you in fixing this problem while installation on > my system. > > *Traceback (most recent call last): > File "./scripts/fetch_eggs.py", line 34, in ? > c.fetch( ignore=ignore ) > File > "/home/pnarang/Desktop/galaxy-46bd94b12a0c/lib/galaxy/eggs/__init__.py", > line 317, in fetch > f = urllib2.urlopen( "%s/%s" % ( self.repo, > self.platform['galaxy'] ) ) > File "/usr/local/lib/python2.4/urllib2.py", line 130, in urlopen > return _opener.open(url, data) > File "/usr/local/lib/python2.4/urllib2.py", line 358, in open > response = self._open(req, data) > File "/usr/local/lib/python2.4/urllib2.py", line 376, in _open > '_open', req) > File "/usr/local/lib/python2.4/urllib2.py", line 337, in _call_chain > result = func(*args) > File "/usr/local/lib/python2.4/urllib2.py", line 1021, in http_open > return self.do_open(httplib.HTTPConnection, req) > File "/usr/local/lib/python2.4/urllib2.py", line 996, in do_open > raise URLError(err) > urllib2.URLError: <urlopen error (-3, 'Temporary failure in name > resolution')> > * > Pankaj Narang > IGIB > New Delhi,India > > On Tue, Jul 21, 2009 at 6:00 PM, Greg Von Kuster <ghv2(a)psu.edu > <mailto:ghv2@psu.edu>> wrote: > > Hello Pankaj, > > Galaxy should run on 64 bit linux, could you send us the stack > trace containing the error when you try starting the server? > > Greg Von Kuster > Galaxy Development Team > > > Pankaj Narang wrote: > > > Dear Sir, > > I am installing Galaxy using setup.sh script on my 64 bit RED > HAT Enterprises Linux system but it gives an error . > I have Python 2.4.It <http://2.4.It> <http://2.4.It> works > well on my other† 32 bit RHEL system in the same network.Could > you please tell me whether current version of Galaxy is > compatible with 64 bit linux system or not? > > > Thanx in advance, > -- > Regards, > Pankaj Narang > > > ------------------------------------------------------------------------ > > _______________________________________________ > galaxy-dev mailing list > galaxy-dev(a)bx.psu.edu <mailto:galaxy-dev@bx.psu.edu> > http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-dev > > > >

2 1

Feature suggestion: "Re-Run" button
by Assaf Gordon 24 Jul '09

24 Jul '09

Hello, this is a feature that some of my users requested: the ability to easily re-run a job (or at least see the parameters that were used to create a specific dataset). This patch adds a 're-run' link (next to the 'save' link). The link is encoded in a way to trick the 'tool_runner' controller into displaying the tool-form with the parameters already initialized. The encoded URL looks like: http://localhost:8080/tool_runner?tool_id=addValue&dbkey=%3F&exp=143&input=… This is just a proof of concept, and there are many problems with it (one is that conditionals/grouping don't work) and many possible improvements. The code itself is a hodge-podge of lines copied from different classes... (not be best example of python code). I'm sure there's a better why to do it, because constructing a workflow from a history is basically the same thing, but I don't understand the galaxy code good enough for that. Comments are welcomed, -gordon.

2 4

[hg] galaxy 2495: Fixed for functional tests for new version of ...
by Greg Von Kuster 23 Jul '09

23 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f75758b35e51 changeset: 2495:f75758b35e51 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Jul 23 14:31:11 2009 -0400 description: Fixed for functional tests for new version of fasta_filter_by_length tool contributed by James Casbon. 2 file(s) affected in this change: test-data/fasta_tool_filter_length_1.out tools/fasta_tools/fasta_filter_by_length.xml diffs (108 lines): diff -r 3dae3393e275 -r f75758b35e51 test-data/fasta_tool_filter_length_1.out --- a/test-data/fasta_tool_filter_length_1.out Thu Jul 23 12:38:11 2009 -0400 +++ b/test-data/fasta_tool_filter_length_1.out Thu Jul 23 14:31:11 2009 -0400 @@ -1,61 +1,52 @@ >EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_ -CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGC -CGAA +CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA >EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_ -CTTACCGGTCACCACCGTGCCTTCAGGATTGATCGCCAGATCGGTCGGTG -CGTCAGGCGGGGTGACATCGCCCACCACGGTACTCACTGGCTGGCTCTGG -TTCCCGGCGGCATCGGAGGCCACCACGTTGAGGGTATTCCCCTCGGTTTG -TGGCTCGGTGAGAACCACGTTGTAGTCGCCATTGGTC +CTTACCGGTCACCACCGTGCCTTCAGGATTGATCGCCAGATCGGTCGGTGCGTCAGGCGG +GGTGACATCGCCCACCACGGTACTCACTGGCTGGCTCTGGTTCCCGGCGGCATCGGAGGC +CACCACGTTGAGGGTATTCCCCTCGGTTTGTGGCTCGGTGAGAACCACGTTGTAGTCGCC +ATTGGTC >EYKX4VC01CD9FT length=115 xy=0865_1719 region=1 run=R_2007_11_07_16_15_57_ -GGGGGCTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCG -GCTGGCGATCATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCA -CCCGCACCCAACGCG +GGGGGCTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGATC +ATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG >EYKX4VC01B8FW0 length=95 xy=0799_0514 region=1 run=R_2007_11_07_16_15_57_ -TAAATTTCAAGGAATGCAAATCAGGGTCGTGTGTTTAGACTTCGGCTTTA -GAGACCTGAATACGTCAAAAACATAACTTCATGATATCTTGCAGT +TAAATTTCAAGGAATGCAAATCAGGGTCGTGTGTTTAGACTTCGGCTTTAGAGACCTGAA +TACGTCAAAAACATAACTTCATGATATCTTGCAGT >EYKX4VC01BCGYW length=115 xy=0434_3926 region=1 run=R_2007_11_07_16_15_57_ -GGCCAGCCGGGACAGCGTTGTTGGGCTGCATGGCGACGAGCTAAAAGTCG -CCATCACCGCCCCGCCGGTTGATGGGCAGGCTAATGCCCATCTGGTAAAA -ACTTTCTCGCCAAAC +GGCCAGCCGGGACAGCGTTGTTGGGCTGCATGGCGACGAGCTAAAAGTCGCCATCACCGC +CCCGCCGGTTGATGGGCAGGCTAATGCCCATCTGGTAAAAACTTTCTCGCCAAAC >EYKX4VC01AZXC6 length=116 xy=0292_0280 region=1 run=R_2007_11_07_16_15_57_ -GGGGGCGTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGC -GGCTGGCGATCATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACC -ACCCGCACCCAACGCG +GGGGGCGTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGAT +CATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG >EYKX4VC01CATH5 length=82 xy=0826_0843 region=1 run=R_2007_11_07_16_15_57_ -CGAAATTGCACATTCTCGGCCATATCTCTGGACCTACATGACCGATTTGA -TCATCTTCGAACTTAGCCTTCCTTTNTTAACG +CGAAATTGCACATTCTCGGCCATATCTCTGGACCTACATGACCGATTTGATCATCTTCGA +ACTTAGCCTTCCTTTNTTAACG >EYKX4VC01BCEIV length=47 xy=0434_0757 region=1 run=R_2007_11_07_16_15_57_ TGACGTCGTGCCGAGCTACGACAATGCCGACATGGTGATCGTTAACA >EYKX4VC01BWERM length=83 xy=0662_0304 region=1 run=R_2007_11_07_16_15_57_ -CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGG -ATCTCGGCCAGGGCGTGCTGATGAAGTTCAAAT +CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA +GGGCGTGCTGATGAAGTTCAAAT >EYKX4VC01BT2O7 length=69 xy=0635_1945 region=1 run=R_2007_11_07_16_15_57_ -AGCGTTTCTCCAGCCGGTCGGCTACGCCGTTTGCCCCTGAAAGACGCTGT -TCAGACCGAACGCGGTAAA +AGCGTTTCTCCAGCCGGTCGGCTACGCCGTTTGCCCCTGAAAGACGCTGTTCAGACCGAA +CGCGGTAAA >EYKX4VC01BO0UO length=222 xy=0577_3838 region=1 run=R_2007_11_07_16_15_57_ -AGACCTGGGACAGCGGCGGGCTGCTGAAGCCGCAGGCGATAGAGGACAAA -CTGCAGTACCGCTTCTGGCTGCACTATGCCGAAGGCTCGCTGATGCCGCT -GCTGTTAATGAAGCTGGTGTTCGCCAGCCTGGGTAAACCCCCTGTGCCCT -TTGGCGTCCGCTCGCTGGGCGCCCTGCTGGGCAAGGGCATTCAGAAAGCG -TGGCTGGATCCCCAGCTGGCCA +AGACCTGGGACAGCGGCGGGCTGCTGAAGCCGCAGGCGATAGAGGACAAACTGCAGTACC +GCTTCTGGCTGCACTATGCCGAAGGCTCGCTGATGCCGCTGCTGTTAATGAAGCTGGTGT +TCGCCAGCCTGGGTAAACCCCCTGTGCCCTTTGGCGTCCGCTCGCTGGGCGCCCTGCTGG +GCAAGGGCATTCAGAAAGCGTGGCTGGATCCCCAGCTGGCCA >EYKX4VC01CBCPK length=83 xy=0832_1158 region=1 run=R_2007_11_07_16_15_57_ -CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGG -ATCTCGGCCAGGGCGTGCTGATGAAGTTCAAAT +CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA +GGGCGTGCTGATGAAGTTCAAAT >EYKX4VC01B474S length=54 xy=0762_2010 region=1 run=R_2007_11_07_16_15_57_ -AGCAGTTTTCCAGCGCTTTCGAAGAGCGCTGGCGCGCGCGGGCTTCCAGC -ATAT +AGCAGTTTTCCAGCGCTTTCGAAGAGCGCTGGCGCGCGCGGGCTTCCAGCATAT >EYKX4VC01BB4QL length=57 xy=0431_0363 region=1 run=R_2007_11_07_16_15_57_ -GGGGAGGAGCTAATAATATGCTCTTGGGGAGGAGCTAATTATATGCTCTT -GGGGAGG +GGGGAGGAGCTAATAATATGCTCTTGGGGAGGAGCTAATTATATGCTCTTGGGGAGG >EYKX4VC01BJ37M length=64 xy=0522_0192 region=1 run=R_2007_11_07_16_15_57_ -TCGAGTATGTATCAAGGACTACATACAAATTTGCCAAAAGAGATTATGCA -CTATCCCGACTTCC +TCGAGTATGTATCAAGGACTACATACAAATTTGCCAAAAGAGATTATGCACTATCCCGAC +TTCC >EYKX4VC01BV9R8 length=54 xy=0660_2038 region=1 run=R_2007_11_07_16_15_57_ -AAAACTCGGAGAAACTATTCAGCAGCACTGCGTTTCGCTGAATTTTAGAC -CGTT +AAAACTCGGAGAAACTATTCAGCAGCACTGCGTTTCGCTGAATTTTAGACCGTT >EYKX4VC01CEPP8 length=60 xy=0870_2350 region=1 run=R_2007_11_07_16_15_57_ -CTGGGTGGGTGCACTACAGGAACGTCATTTGTTCAATCCTCACGTTGTTG -TTAGTGTCAG +CTGGGTGGGTGCACTACAGGAACGTCATTTGTTCAATCCTCACGTTGTTGTTAGTGTCAG >EYKX4VC01BTLME length=78 xy=0630_0292 region=1 run=R_2007_11_07_16_15_57_ -TTATCCACACGCTGTCCGGATCCAGCGCCAGGCGCCGACGCTGGACTTCC -GCCGCCTGCGCCCAGTTGCCCTGACTTC +TTATCCACACGCTGTCCGGATCCAGCGCCAGGCGCCGACGCTGGACTTCCGCCGCCTGCG +CCCAGTTGCCCTGACTTC \ No newline at end of file diff -r 3dae3393e275 -r f75758b35e51 tools/fasta_tools/fasta_filter_by_length.xml --- a/tools/fasta_tools/fasta_filter_by_length.xml Thu Jul 23 12:38:11 2009 -0400 +++ b/tools/fasta_tools/fasta_filter_by_length.xml Thu Jul 23 14:31:11 2009 -0400 @@ -1,4 +1,4 @@ -<tool id="fasta_filter_by_length" name="Filter sequences by length"> +<tool id="fasta_filter_by_length" name="Filter sequences by length" version="1.1"> <description></description> <command interpreter="python">fasta_filter_by_length.py $input $min_length $max_length $output </command> <inputs>

1 0

[hg] galaxy 2494: Allow composite files to be defined as binary ...
by Greg Von Kuster 23 Jul '09

23 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3dae3393e275 changeset: 2494:3dae3393e275 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 23 12:38:11 2009 -0400 description: Allow composite files to be defined as binary to allow proper uploading. This is done on a per component basis. To set a particular composite file to be binary, set is_binary = True. If the primary file is to be binary, set the datatype attribute is_binary = True. 4 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/datatypes/genetics.py lib/galaxy/tools/actions/upload.py lib/galaxy/tools/parameters/grouping.py diffs (221 lines): diff -r d51e2ea0daf9 -r 3dae3393e275 lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Jul 23 12:24:12 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Jul 23 12:38:11 2009 -0400 @@ -252,12 +252,14 @@ def after_edit( self, dataset ): """This function is called on the dataset after metadata is edited.""" dataset.clear_associated_files( metadata_safe = True ) - def __new_composite_file( self, name, optional = False, mimetype = None, description = None, substitute_name_with_metadata = None, **kwds ): + def __new_composite_file( self, name, optional = False, mimetype = None, description = None, substitute_name_with_metadata = None, is_binary = False, space_to_tab = True, **kwds ): kwds[ 'name' ] = name kwds[ 'optional' ] = optional kwds[ 'mimetype' ] = mimetype kwds[ 'description' ] = description kwds[ 'substitute_name_with_metadata' ] = substitute_name_with_metadata + kwds[ 'is_binary' ] = is_binary + kwds[ 'space_to_tab' ] = space_to_tab return Bunch( **kwds ) def add_composite_file( self, name, **kwds ): #self.composite_files = self.composite_files.copy() diff -r d51e2ea0daf9 -r 3dae3393e275 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Thu Jul 23 12:24:12 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Thu Jul 23 12:38:11 2009 -0400 @@ -160,8 +160,8 @@ def __init__( self, **kwd ): Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.ped', description = 'Pedigree File', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.map', description = 'Map File', substitute_name_with_metadata = 'base_name' ) + self.add_composite_file( '%s.ped', description = 'Pedigree File', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.map', description = 'Map File', substitute_name_with_metadata = 'base_name', is_binary = True ) class Pphe(Rgenetics): @@ -198,10 +198,10 @@ def __init__( self, **kwd ): Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.bim', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.bed', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.fam', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name' ) + self.add_composite_file( '%s.bim', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.bed', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.fam', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name', is_binary = True ) class Eigenstratgeno(Rgenetics): @@ -211,15 +211,15 @@ def __init__( self, **kwd ): Rgenetics.__init__( self, **kwd ) - self.add_composite_file( '%s.eigenstratgeno', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.ind', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name' ) - self.add_composite_file( '%s_fo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True' ) - self.add_composite_file( '%s_fo.ind', substitute_name_with_metadata = 'base_name', optional = 'True' ) - self.add_composite_file( '%s_fo.map', substitute_name_with_metadata = 'base_name', optional = 'True' ) - self.add_composite_file( '%s_oo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True' ) - self.add_composite_file( '%s_oo.ind', substitute_name_with_metadata = 'base_name', optional = 'True' ) - self.add_composite_file( '%s_oo.map', substitute_name_with_metadata = 'base_name', optional = 'True' ) + self.add_composite_file( '%s.eigenstratgeno', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.ind', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s.map', substitute_name_with_metadata = 'base_name', is_binary = True ) + self.add_composite_file( '%s_fo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) + self.add_composite_file( '%s_fo.ind', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) + self.add_composite_file( '%s_fo.map', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) + self.add_composite_file( '%s_oo.eigenstratgeno', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) + self.add_composite_file( '%s_oo.ind', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) + self.add_composite_file( '%s_oo.map', substitute_name_with_metadata = 'base_name', optional = 'True', is_binary = True ) @@ -259,7 +259,7 @@ def __init__( self, **kwd ): Html.__init__( self, **kwd ) - self.add_composite_file( '%s.phenodata', substitute_name_with_metadata = 'base_name' ) + self.add_composite_file( '%s.phenodata', substitute_name_with_metadata = 'base_name', is_binary = True ) def set_peek( self, dataset ): """expects a .pheno file in the extra_files_dir - ugh diff -r d51e2ea0daf9 -r 3dae3393e275 lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Jul 23 12:24:12 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Jul 23 12:38:11 2009 -0400 @@ -46,26 +46,8 @@ uploaded_datasets = dataset_upload_input.get_uploaded_datasets( trans, incoming ) for uploaded_dataset in uploaded_datasets: precreated_dataset = self.get_precreated_dataset( uploaded_dataset.precreated_name ) - dataset = self.add_file( trans, uploaded_dataset.primary_file, uploaded_dataset.name, uploaded_dataset.file_type, uploaded_dataset.is_multi_byte, uploaded_dataset.dbkey, space_to_tab = uploaded_dataset.space_to_tab, info = uploaded_dataset.info, precreated_dataset = precreated_dataset, metadata = uploaded_dataset.metadata ) - composite_files = dataset.datatype.get_composite_files( dataset ) - if composite_files: - os.mkdir( dataset.extra_files_path ) #make extra files path - for name, value in composite_files.iteritems(): - #what about binary files here, need to skip converting newlines - if uploaded_dataset.composite_files[ value.name ] is None and not value.optional: - dataset.info = "A required composite data file was not provided (%s)" % name - dataset.state = dataset.states.ERROR - break - elif uploaded_dataset.composite_files[ value.name] is not None: - if uploaded_dataset.composite_files[ value.name ].space_to_tab: - sniff.convert_newlines_sep2tabs( uploaded_dataset.composite_files[ value.name ].filename ) - else: - sniff.convert_newlines( uploaded_dataset.composite_files[ value.name ].filename ) - shutil.move( uploaded_dataset.composite_files[ value.name ].filename, os.path.join( dataset.extra_files_path, name ) ) - if dataset.datatype.composite_type == 'auto_primary_file': - #now that metadata is set, we should create the primary file as required - open( dataset.file_name, 'wb+' ).write( dataset.datatype.generate_primary_file( dataset = dataset ) ) - + dataset = self.add_file( trans, uploaded_dataset.primary_file, uploaded_dataset.name, uploaded_dataset.file_type, uploaded_dataset.is_multi_byte, uploaded_dataset.dbkey, space_to_tab = uploaded_dataset.space_to_tab, info = uploaded_dataset.info, precreated_dataset = precreated_dataset, metadata = uploaded_dataset.metadata, uploaded_dataset = uploaded_dataset ) + #dataset state is now set, we should not do anything else to this dataset data_list.append( dataset ) #clean up extra temp names uploaded_dataset.clean_up_temp_files() @@ -130,7 +112,7 @@ trans.log_event( 'job id %d ended with errors, err_msg: %s' % ( job.id, err_msg ), tool_id=job.tool_id ) return dict( output=data ) - def add_file( self, trans, temp_name, file_name, file_type, is_multi_byte, dbkey, info=None, space_to_tab=False, precreated_dataset=None, metadata = {} ): + def add_file( self, trans, temp_name, file_name, file_type, is_multi_byte, dbkey, info=None, space_to_tab=False, precreated_dataset=None, metadata = {}, uploaded_dataset = None ): def dataset_no_data_error( data, message = 'there was an error uploading your file' ): data.info = "No data: %s." % message data.state = data.states.ERROR @@ -152,7 +134,7 @@ if is_multi_byte: ext = sniff.guess_ext( temp_name, is_multi_byte=True ) else: - if not data_type: + if not data_type: #at this point data_type is always None (just initialized above), so this is always True...lots of cleanup needed here # See if we have a gzipped file, which, if it passes our restrictions, # we'll decompress on the fly. is_gzipped, is_valid = self.check_gzip( temp_name ) @@ -204,19 +186,24 @@ ext = file_type if not data_type: if self.check_binary( temp_name ): - parts = file_name.split( "." ) - if len( parts ) > 1: - ext = parts[1].strip().lower() - if not( ext == 'ab1' or ext == 'scf' ): - return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) - #raise BadFileException( "you attempted to upload an inappropriate file." ) - if ext == 'ab1' and file_type != 'ab1': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) - elif ext == 'scf' and file_type != 'scf': - return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Scf' when uploading scf files" ) - #raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) - data_type = 'binary' + if uploaded_dataset and uploaded_dataset.datatype and uploaded_dataset.datatype.is_binary: + #we need a more generalized way of checking if a binary upload is of the right format for a datatype...magic number, etc + data_type = 'binary' + ext = uploaded_dataset.file_type + else: + parts = file_name.split( "." ) + if len( parts ) > 1: + ext = parts[1].strip().lower() + if not( ext == 'ab1' or ext == 'scf' ): + return dataset_no_data_error( data, message = "you attempted to upload an inappropriate file" ) + #raise BadFileException( "you attempted to upload an inappropriate file." ) + if ext == 'ab1' and file_type != 'ab1': + return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files" ) + #raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) + elif ext == 'scf' and file_type != 'scf': + return dataset_no_data_error( data, message = "you must manually set the 'File Format' to 'Scf' when uploading scf files" ) + #raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) + data_type = 'binary' if not data_type: # We must have a text file if trans.app.datatypes_registry.get_datatype_by_extension( file_type ).composite_type != 'auto_primary_file' and self.check_html( temp_name ): @@ -241,9 +228,7 @@ data.info = info data.flush() shutil.move( temp_name, data.file_name ) - ## FIXME - data.state = data.states.OK ##THIS SHOULD BE THE LAST THING DONE - #### its bad to set other things after this point, i.e. metadata and composite files...this creates a race condition where a dataset could be pushed into a job before its metadata, etc is set + dataset_state = data.states.OK #don't set actual state here, only set to OK when finished setting attributes of the dataset data.set_size() data.init_meta() #need to set metadata, has to be done after extention is set @@ -280,6 +265,27 @@ trans.history.genome_build = dbkey_to_store else: trans.history.add_dataset( data, genome_build=dbkey_to_store ) + #set up composite files + if uploaded_dataset is not None: + composite_files = data.datatype.get_composite_files( data ) + if composite_files: + os.mkdir( data.extra_files_path ) #make extra files path + for name, value in composite_files.iteritems(): + if uploaded_dataset.composite_files[ value.name ] is None and not value.optional: + data.info = "A required composite data file was not provided (%s)" % name + dataset_state = data.states.ERROR + break + elif uploaded_dataset.composite_files[ value.name] is not None: + if not value.is_binary: + if uploaded_dataset.composite_files[ value.name ].space_to_tab: + sniff.convert_newlines_sep2tabs( uploaded_dataset.composite_files[ value.name ].filename ) + else: + sniff.convert_newlines( uploaded_dataset.composite_files[ value.name ].filename ) + shutil.move( uploaded_dataset.composite_files[ value.name ].filename, os.path.join( data.extra_files_path, name ) ) + if data.datatype.composite_type == 'auto_primary_file': + #now that metadata was set above, we should create the primary file as required + open( data.file_name, 'wb+' ).write( data.datatype.generate_primary_file( dataset = data ) ) + data.state = dataset_state #Always set dataset state LAST trans.app.model.flush() trans.log_event( "Added dataset %d to history %d" %( data.id, trans.history.id ), tool_id="upload" ) return data diff -r d51e2ea0daf9 -r 3dae3393e275 lib/galaxy/tools/parameters/grouping.py --- a/lib/galaxy/tools/parameters/grouping.py Thu Jul 23 12:24:12 2009 -0400 +++ b/lib/galaxy/tools/parameters/grouping.py Thu Jul 23 12:38:11 2009 -0400 @@ -356,6 +356,8 @@ precreated_name = dataset_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) else: temp_name, precreated_name, is_multi_byte, space_to_tab, dataset_name, dataset_info, warnings = get_one_filename( groups_incoming[ 0 ] ) + if dataset.datatype.composite_type: + precreated_name = 'Uploaded Composite Dataset (%s)' % ( file_type ) writable_files_offset = 1 if temp_name is None:#remove this before finish, this should create an empty dataset raise Exception( 'No primary dataset file was available for composite upload' )

1 0

[hg] galaxy 2493: Only search up to the first 100 lines in an in...
by Greg Von Kuster 23 Jul '09

23 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/d51e2ea0daf9 changeset: 2493:d51e2ea0daf9 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 23 12:24:12 2009 -0400 description: Only search up to the first 100 lines in an interval file when setting metadata. 1 file(s) affected in this change: lib/galaxy/datatypes/interval.py diffs (25 lines): diff -r 2177d6f7bf80 -r d51e2ea0daf9 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Thu Jul 23 12:16:44 2009 -0400 +++ b/lib/galaxy/datatypes/interval.py Thu Jul 23 12:24:12 2009 -0400 @@ -75,6 +75,8 @@ """Tries to guess from the line the location number of the column for the chromosome, region start-end and strand""" if dataset.has_data(): + empty_line_count = 0 + num_check_lines = 100 # only check up to this many non empty lines for i, line in enumerate( file( dataset.file_name ) ): line = line.rstrip( '\r\n' ) if line: @@ -131,8 +133,10 @@ dataset.metadata.strandCol = 6 metadata_is_set = True break - if metadata_is_set: - break # Our metadata is set, so break out of the outer loop + if metadata_is_set or ( i - empty_line_count ) > num_check_lines: + break # Our metadata is set or we examined 100 non-empty lines, so break out of the outer loop + else: + empty_line_count += 1 def get_estimated_display_viewport( self, dataset ): """Return a chrom, start, stop tuple for viewing a file."""

1 0

[hg] galaxy 2491: No longer guess the name column in interval se...
by Greg Von Kuster 23 Jul '09

23 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/cd366f615220 changeset: 2491:cd366f615220 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 23 11:11:41 2009 -0400 description: No longer guess the name column in interval set_meta(). Name column must now always be set manually. 1 file(s) affected in this change: lib/galaxy/datatypes/interval.py diffs (24 lines): diff -r 3851029eda94 -r cd366f615220 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Wed Jul 22 21:28:26 2009 -0400 +++ b/lib/galaxy/datatypes/interval.py Thu Jul 23 11:11:41 2009 -0400 @@ -115,12 +115,14 @@ dataset.metadata.endCol = 3 except: pass # Metadata default will be used - if len( elems ) > 3: - try: - int( elems[3] ) - except: - if overwrite or not dataset.metadata.element_is_set( 'nameCol' ): - dataset.metadata.nameCol = 4 + #we no longer want to guess that this column is the 'name', name must now be set manually for interval files + #we will still guess at the strand, as we can make a more educated guess + #if len( elems ) > 3: + # try: + # int( elems[3] ) + # except: + # if overwrite or not dataset.metadata.element_is_set( 'nameCol' ): + # dataset.metadata.nameCol = 4 if len( elems ) < 6 or elems[5] not in data.valid_strand: if overwrite or not dataset.metadata.element_is_set( 'strandCol' ): dataset.metadata.strandCol = 0

1 0

[hg] galaxy 2492: Performance improvements for fasta_filter_by_l...
by Greg Von Kuster 23 Jul '09

23 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/2177d6f7bf80 changeset: 2492:2177d6f7bf80 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Jul 23 12:16:44 2009 -0400 description: Performance improvements for fasta_filter_by_length and fasta_to_tabular 2 file(s) affected in this change: tools/fasta_tools/fasta_filter_by_length.py tools/fasta_tools/fasta_to_tabular.py diffs (143 lines): diff -r cd366f615220 -r 2177d6f7bf80 tools/fasta_tools/fasta_filter_by_length.py --- a/tools/fasta_tools/fasta_filter_by_length.py Thu Jul 23 11:11:41 2009 -0400 +++ b/tools/fasta_tools/fasta_filter_by_length.py Thu Jul 23 12:16:44 2009 -0400 @@ -14,8 +14,7 @@ sys.exit() def __main__(): - - infile = sys.argv[1] + input_filename = sys.argv[1] try: min_length = int( sys.argv[2] ) except: @@ -24,65 +23,30 @@ max_length = int( sys.argv[3] ) except: stop_err( "Maximum length of the return sequence requires a numerical value." ) - outfile = sys.argv[4] - fasta_title = fasta_seq = '' + output_filename = sys.argv[4] + output_handle = open( output_filename, 'w' ) + tmp_size = 0 #-1 + tmp_buf = '' at_least_one = 0 - - out = open( outfile, 'w' ) - - for i, line in enumerate( file( infile ) ): - line = line.rstrip( '\r\n' ) - if not line or line.startswith( '#' ): + for line in file(input_filename): + if not line or line.startswith('#'): continue - if line[0] == '>': - if len( fasta_seq ) > 0: - - if max_length <= 0: - compare_max_length = len( fasta_seq ) + 1 - else: - compare_max_length = max_length - - l = len( fasta_seq ) - - if l >= min_length and l <= compare_max_length: - at_least_one += 1 - out.write( "%s\n" % fasta_title ) - c = 0 - s = fasta_seq - while c < l: - b = min( c + 50, l ) - out.write( "%s\n" % s[ c:b ] ) - c = b - - fasta_title = line - fasta_seq = '' + if min_length <= tmp_size <= max_length or (min_length <= tmp_size and max_length == 0): + output_handle.write(tmp_buf) + at_least_one = 1 + tmp_buf = line + tmp_size = 0 else: - fasta_seq = "%s%s" % ( fasta_seq, line ) - - if len( fasta_seq ) > 0: - - if max_length <= 0: - compare_max_length = len( fasta_seq ) + 1 - else: - compare_max_length = max_length - - l = len( fasta_seq ) - - if l >= min_length and l <= compare_max_length: - at_least_one += 1 - out.write( "%s\n" % fasta_title ) - c = 0 - s = fasta_seq - while c < l: - b = min( c + 50, l ) - out.write( "%s\n" % s[ c:b ] ) - c = b - - out.close() - + if max_length == 0 or tmp_size < max_length: + tmp_size += len(line.rstrip('\r\n')) + tmp_buf += line + # final flush of buffer + if min_length <= tmp_size <= max_length or (min_length <= tmp_size and max_length == 0): + output_handle.write(tmp_buf.rstrip('\r\n')) + at_least_one = 1 + output_handle.close() if at_least_one == 0: print "There is no sequence that falls within your range." - -if __name__ == "__main__" : __main__() \ No newline at end of file +if __name__ == "__main__" : __main__() diff -r cd366f615220 -r 2177d6f7bf80 tools/fasta_tools/fasta_to_tabular.py --- a/tools/fasta_tools/fasta_to_tabular.py Thu Jul 23 11:11:41 2009 -0400 +++ b/tools/fasta_tools/fasta_to_tabular.py Thu Jul 23 12:16:44 2009 -0400 @@ -15,30 +15,23 @@ outfile = sys.argv[2] keep_first = int( sys.argv[3] ) fasta_title = fasta_seq = '' - if keep_first == 0: keep_first = None else: keep_first += 1 - out = open( outfile, 'w' ) - for i, line in enumerate( open( infile ) ): line = line.rstrip( '\r\n' ) if not line or line.startswith( '#' ): continue if line.startswith( '>' ): - if fasta_seq: - out.write( "%s\t%s\n" %( fasta_title[ 1:keep_first ], fasta_seq ) ) - fasta_title = line - fasta_seq = '' + if i: + out.write('\n') + out.write(line[1:keep_first]) + out.write('\t') else: - if line: - fasta_seq = "%s%s" % ( fasta_seq, line ) - - if fasta_seq: - out.write( "%s\t%s\n" %( fasta_title[ 1:keep_first ], fasta_seq ) ) - + out.write(line) out.close() -if __name__ == "__main__" : __main__() \ No newline at end of file +if __name__ == "__main__" : __main__() + \ No newline at end of file

1 0