- galaxy-dev - lists.galaxyproject.org

Re: [galaxy-dev] Fresh install has wrong layout (From galaxy-user)
by Nate Coraor 31 Jul '09

31 Jul '09

Hi Chris, Sorry about missing the reply, I was on vacation when you wrote back. Also, I've moved this over to the dev mailing list since it's regarding local installation issues. Could you do the following: Paste the <iframe> tags from "View Source" on the main page. Paste the log output from the server (or paster.log if you're running as a daemon) of your client connecting to Galaxy. Thanks, --nate Chris Cole wrote: > Just realised I'd not sent this to the list. Whoops! > > This is still broken, anyone have any ideas? > Cheers, > > Chris > > -------- Original Message -------- > Subject: Re: [galaxy-user] Fresh install has wrong layout > Date: Tue, 21 Jul 2009 10:47:50 +0100 > From: Chris Cole <chris(a)compbio.dundee.ac.uk> > Organisation: University of Dundee > To: Nate Coraor <nate(a)bx.psu.edu> > References: <4A4E147C.6010107(a)compbio.dundee.ac.uk> > <4A4E1506.5030609(a)bx.psu.edu> <4A4E1716.2070800(a)compbio.dundee.ac.uk> > <4A52AFFA.5020102(a)bx.psu.edu> > > Hi Nate, > > Sorry for not replying earlier, I've been on holiday. Attached should be > my universe_wsgi.ini for the updated server. (The file has a .txt > extension to avoid sending blockage). > > I've used the same settings (where applicable) for my currently working > svn version 1686. > > Chris > > Nate Coraor wrote: >> Chris, >> >> Could you send us your universe_wsgi.ini? We haven't seen this happen >> without a proxy before. >> >> --nate >> >> Chris Cole wrote: >>> Hi Nate, >>> >>> Nope. There's no proxy configured. The only things I changed in the HTTP >>> config part of the universe_wsgi.ini are the host and the port. >>> Cheers, >>> >>> Chris >>> >>> Nate Coraor wrote: >>>> Hi Chris, >>>> >>>> It sounds like you maybe be running through a proxy, away from the >>>> server root, without the proxy-prefix option set in universe_wsgi.ini? >>>> If so, have a look at the documentation here: >>>> >>>> http://g2.trac.bx.psu.edu/wiki/HowToInstall/ApacheProxy#Apacheconfiguration… >>>> >>>> --nate >>>> >>>> Chris Cole wrote: >>>>> Hi, >>>>> >>>>> I've been using the subversion version of Galaxy for a while, but now I >>>>> want to update to the latest mercurial release. >>>>> >>>>> I installed it in a new location as per the wiki and set-up the SGE >>>>> settings as per my previous install and all the tests pass. It launches >>>>> fine, but when viewing the website the frames seem to be off-by-one. >>>>> i.e., the 'Tools' frame is empty except for "This link may not be >>>>> followed from within Galaxy.", the tools are in the middle window and >>>>> the 'History' frame has general information. >>>>> >>>>> I can't see any errors in the paster.log file, so where can I look to >>>>> sort out this error? >>>>> Thanks, >>>>> >>>>> Chris >>>>> _______________________________________________ >>>>> galaxy-user mailing list >>>>> galaxy-user(a)bx.psu.edu >>>>> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user > > > > ------------------------------------------------------------------------ > > _______________________________________________ > galaxy-user mailing list > galaxy-user(a)bx.psu.edu > http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user

2 1

[hg] galaxy 2515: Add new flag, allow_datatype_change, to Dataty...
by Greg Von Kuster 31 Jul '09

31 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/aabcc797c1da changeset: 2515:aabcc797c1da user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 16:23:47 2009 -0400 description: Add new flag, allow_datatype_change, to Datatypes. When set to False, datasets of this datatype cannot be changed from or into. This is needed, i.e. for Rgenetics Datatypes to prevent loss of metadata ('base_name') which occurs when changing to datatypes without this metadata parameter and would render the dataset unusable (composite filenames could be incorrect). 8 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/datatypes/genetics.py lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/root.py templates/admin/library/ldda_edit_info.mako templates/dataset/edit_attributes.mako templates/library/ldda_edit_info.mako diffs (287 lines): diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Jul 30 16:23:47 2009 -0400 @@ -51,6 +51,8 @@ copy_safe_peek = True is_binary = True #The dataset contains binary data --> do not space_to_tab or convert newlines, etc. Allow binary file uploads of this type when True. + + allow_datatype_change = True #Allow user to change between this datatype and others. If False, this datatype cannot be changed from or into. #Composite datatypes composite_type = None diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Thu Jul 30 16:23:47 2009 -0400 @@ -122,6 +122,7 @@ file_ext="html" composite_type = 'auto_primary_file' + allow_datatype_change = False def missing_meta( self, dataset ): """Checks for empty meta values""" @@ -255,6 +256,8 @@ file_ext = None is_binary = True + + allow_datatype_change = False composite_type = 'basic' diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Thu Jul 30 16:23:47 2009 -0400 @@ -1094,7 +1094,7 @@ replace_dataset = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well - ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() if params.get( 'new_dataset_button', False ): upload_option = params.get( 'upload_option', 'upload_file' ) @@ -1247,17 +1247,20 @@ elif action == 'edit_info': if params.get( 'change', False ): # The user clicked the Save button on the 'Change data type' form - trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) - trans.app.model.flush() - msg = "Data type changed for library dataset '%s'" % ldda.name - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - restrict=params.get( 'restrict', True ), - render_templates=params.get( 'render_templates', False ), - msg=msg, - messagetype=messagetype ) + if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) + trans.app.model.flush() + msg = "Data type changed for library dataset '%s'" % ldda.name + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + restrict=params.get( 'restrict', True ), + render_templates=params.get( 'render_templates', False ), + msg=msg, + messagetype=messagetype ) + else: + return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) ) elif params.get( 'save', False ): # The user clicked the Save button on the 'Edit Attributes' form old_name = ldda.name diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Thu Jul 30 16:23:47 2009 -0400 @@ -430,7 +430,7 @@ replace_dataset = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well - ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() if id: if params.get( 'permissions', False ): @@ -505,10 +505,14 @@ if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): - trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) - trans.app.model.flush() - msg = "Data type changed for library dataset '%s'" % ldda.name - messagetype = 'done' + if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) + trans.app.model.flush() + msg = "Data type changed for library dataset '%s'" % ldda.name + messagetype = 'done' + else: + msg = "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) + messagetype = 'error' else: msg = "You are not authorized to change the data type of dataset '%s'" % ldda.name messagetype = 'error' diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Thu Jul 30 16:23:47 2009 -0400 @@ -247,8 +247,11 @@ params = util.Params( kwd, safe=False ) if params.change: # The user clicked the Save button on the 'Change data type' form - trans.app.datatypes_registry.change_datatype( data, params.datatype ) - trans.app.model.flush() + if data.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( data, params.datatype ) + trans.app.model.flush() + else: + return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( data.extension, params.datatype ) ) elif params.save: # The user clicked the Save button on the 'Edit Attributes' form data.name = params.name @@ -314,7 +317,7 @@ data.metadata.dbkey = data.dbkey # let's not overwrite the imported datatypes module with the variable datatypes? # the built-in 'id' is overwritten in lots of places as well - ldatatypes = [x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys()] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() trans.log_event( "Opened edit view on dataset %s" % str(id) ) return trans.fill_template( "/dataset/edit_attributes.mako", data=data, datatypes=ldatatypes ) diff -r 904a72f5cf4c -r aabcc797c1da templates/admin/library/ldda_edit_info.mako --- a/templates/admin/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/admin/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400 @@ -99,24 +99,30 @@ <div class="toolForm"> <div class="toolFormTitle">Change data type of ${ldda.name}</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> + %if ldda.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div class="form-row"> + <label>New Type:</label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( ldda, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + This will change the datatype of the existing dataset + but <i>not</i> modify its contents. Use this if Galaxy + has incorrectly guessed the type of your dataset. + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="Save"/> + </div> + </form> + %else: <div class="form-row"> - <label>New Type:</label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( ldda, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - This will change the datatype of the existing dataset - but <i>not</i> modify its contents. Use this if Galaxy - has incorrectly guessed the type of your dataset. - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="Save"/> - </div> - </form> + %endif </div> </div> diff -r 904a72f5cf4c -r aabcc797c1da templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Thu Jul 30 16:23:47 2009 -0400 @@ -102,27 +102,34 @@ </div> <p /> %endif + <div class="toolForm"> <div class="toolFormTitle">${_('Change data type')}</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post"> - <input type="hidden" name="id" value="${data.id}"/> + %if data.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post"> + <input type="hidden" name="id" value="${data.id}"/> + <div class="form-row"> + <label> + ${_('New Type')}: + </label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( data, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')} + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="${_('Save')}"/> + </div> + </form> + %else: <div class="form-row"> - <label> - ${_('New Type')}: - </label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( data, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')} - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="${_('Save')}"/> - </div> - </form> + %endif </div> </div> <p /> diff -r 904a72f5cf4c -r aabcc797c1da templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400 @@ -99,24 +99,30 @@ <div class="toolForm"> <div class="toolFormTitle">Change data type</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> + %if ldda.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div class="form-row"> + <label>New Type:</label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( ldda, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + This will change the datatype of the existing dataset + but <i>not</i> modify its contents. Use this if Galaxy + has incorrectly guessed the type of your dataset. + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="Save"/> + </div> + </form> + %else: <div class="form-row"> - <label>New Type:</label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( ldda, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - This will change the datatype of the existing dataset - but <i>not</i> modify its contents. Use this if Galaxy - has incorrectly guessed the type of your dataset. - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="Save"/> - </div> - </form> + %endif </div> </div> <p/>

1 0

[hg] galaxy 2514: Fix for trans.log_event when undeleting a hist...
by Dan Blankenberg 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/904a72f5cf4c changeset: 2514:904a72f5cf4c user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 15:03:53 2009 -0400 description: Fix for trans.log_event when undeleting a history. 1 file(s) affected in this change: lib/galaxy/web/controllers/history.py diffs (12 lines): diff -r 3574137cf7fb -r 904a72f5cf4c lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Jul 30 14:13:04 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Jul 30 15:03:53 2009 -0400 @@ -166,7 +166,7 @@ default_permissions[ default_action ] = [ private_user_role ] trans.app.security_agent.history_set_default_permissions( history, default_permissions ) n_undeleted += 1 - trans.log_event( "History (%s) %d marked as undeleted" % history.name ) + trans.log_event( "History (%s) %d marked as undeleted" % ( history.name, history.id ) ) status = SUCCESS message_parts = [] if n_undeleted:

1 0

[hg] galaxy 2513: Only require access permission to view private...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3574137cf7fb changeset: 2513:3574137cf7fb user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Jul 30 14:13:04 2009 -0400 description: Only require access permission to view private datasets at external sites. 1 file(s) affected in this change: lib/galaxy/web/controllers/dataset.py diffs (12 lines): diff -r 315ac197ff33 -r 3574137cf7fb lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Thu Jul 30 12:56:16 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Thu Jul 30 14:13:04 2009 -0400 @@ -144,7 +144,7 @@ redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] ) if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ): return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ): + if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site ) return trans.response.send_redirect( redirect_url ) else:

1 0

[hg] galaxy 2512: Add a new flag -f/--force_retry to cleanup_dat...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/315ac197ff33 changeset: 2512:315ac197ff33 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 12:56:16 2009 -0400 description: Add a new flag -f/--force_retry to cleanup_datasets.py. This flag will cause the script to attempt to perform the requestion action on objects regardless if it has been performed before. This is useful, i.e. if purge_datasets was called with out using --remove_from_disk, but it is later decided to remove these files: the purge_datasets script should be called with both -r and -f. 1 file(s) affected in this change: scripts/cleanup_datasets/cleanup_datasets.py diffs (162 lines): diff -r ec59d6bcf827 -r 315ac197ff33 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:12:26 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:56:16 2009 -0400 @@ -24,6 +24,7 @@ parser.add_option( "-d", "--days", dest="days", action="store", type="int", help="number of days (60)", default=60 ) parser.add_option( "-r", "--remove_from_disk", action="store_true", dest="remove_from_disk", help="remove datasets from disk when purged", default=False ) parser.add_option( "-i", "--info_only", action="store_true", dest="info_only", help="info about the requested action", default=False ) + parser.add_option( "-f", "--force_retry", action="store_true", dest="force_retry", help="performs the requested actions, but ignores whether it might have been done before. Useful when -r wasn't used, but should have been", default=False ) parser.add_option( "-1", "--delete_userless_histories", action="store_true", dest="delete_userless_histories", default=False, help="delete userless histories and datasets" ) @@ -73,28 +74,32 @@ print "# Datasets will NOT be removed from disk.\n" if options.delete_userless_histories: - delete_userless_histories( app, cutoff_time, info_only = options.info_only ) + delete_userless_histories( app, cutoff_time, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_histories: - purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_datasets: - purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_libraries: - purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_folders: - purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) sys.exit(0) -def delete_userless_histories( app, cutoff_time, info_only = False ): +def delete_userless_histories( app, cutoff_time, info_only = False, force_retry = False ): # Deletes userless histories whose update_time value is older than the cutoff_time. # The purge history script will handle marking DatasetInstances as deleted. # Nothing is removed from disk yet. history_count = 0 print '# The following datasets and associated userless histories have been deleted' start = time.clock() - histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, - app.model.History.table.c.deleted==False, - app.model.History.table.c.update_time < cutoff_time ) ).all()# \ + if force_retry: + histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, + app.model.History.table.c.update_time < cutoff_time ) ).all() + else: + histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, + app.model.History.table.c.deleted==False, + app.model.History.table.c.update_time < cutoff_time ) ).all() for history in histories: if not info_only: history.deleted = True @@ -106,7 +111,7 @@ print "Elapsed time: ", stop - start, "\n" -def purge_histories( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_histories( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted histories whose update_time is older than the cutoff_time. # The dataset associations of each history are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -115,10 +120,15 @@ history_count = 0 print '# The following datasets and associated deleted histories have been purged' start = time.clock() - histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, - app.model.History.table.c.purged==False, - app.model.History.table.c.update_time < cutoff_time ) ) \ - .options( eagerload( 'datasets' ) ).all() + if force_retry: + histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, + app.model.History.table.c.update_time < cutoff_time ) ) \ + .options( eagerload( 'datasets' ) ).all() + else: + histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, + app.model.History.table.c.purged==False, + app.model.History.table.c.update_time < cutoff_time ) ) \ + .options( eagerload( 'datasets' ) ).all() for history in histories: for dataset_assoc in history.datasets: _purge_dataset_instance( dataset_assoc, app, remove_from_disk, info_only = info_only ) #mark a DatasetInstance as deleted, clear associated files, and mark the Dataset as deleted if it is deletable @@ -136,7 +146,7 @@ print '# Purged %d histories.' % ( history_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted libraries whose update_time is older than the cutoff_time. # The dataset associations of each library are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -145,9 +155,13 @@ library_count = 0 print '# The following libraries and associated folders have been purged' start = time.clock() - libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, - app.model.Library.table.c.purged==False, - app.model.Library.table.c.update_time < cutoff_time ) ).all() + if force_retry: + libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, + app.model.Library.table.c.update_time < cutoff_time ) ).all() + else: + libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, + app.model.Library.table.c.purged==False, + app.model.Library.table.c.update_time < cutoff_time ) ).all() for library in libraries: _purge_folder( library.root_folder, app, remove_from_disk, info_only = info_only ) if not info_only: @@ -159,7 +173,7 @@ print '# Purged %d libraries .' % ( library_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_folders( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_folders( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted folders whose update_time is older than the cutoff_time. # The dataset associations of each folder are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -168,9 +182,13 @@ folder_count = 0 print '# The following folders have been purged' start = time.clock() - folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, - app.model.LibraryFolder.table.c.purged==False, - app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() + if force_retry: + folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, + app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() + else: + folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, + app.model.LibraryFolder.table.c.purged==False, + app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() for folder in folders: _purge_folder( folder, app, remove_from_disk, info_only = info_only ) print "%d" % folder.id @@ -179,17 +197,22 @@ print '# Purged %d folders.' % ( folder_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False, repurge = False, force_retry = False ): # Purges deleted datasets whose update_time is older than cutoff_time. Files may or may # not be removed from disk. dataset_count = 0 disk_space = 0 print '# The following deleted datasets have been purged' start = time.clock() - datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, - app.model.Dataset.table.c.purgable==True, - app.model.Dataset.table.c.purged==False, - app.model.Dataset.table.c.update_time < cutoff_time ) ).all() + if force_retry: + datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, + app.model.Dataset.table.c.purgable==True, + app.model.Dataset.table.c.update_time < cutoff_time ) ).all() + else: + datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, + app.model.Dataset.table.c.purgable==True, + app.model.Dataset.table.c.purged==False, + app.model.Dataset.table.c.update_time < cutoff_time ) ).all() for dataset in datasets: file_size = dataset.file_size _purge_dataset( dataset, remove_from_disk, info_only = info_only )

1 0

[hg] galaxy 2510: Added fastqsanger data format and required bwa...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/fab59b1e756d changeset: 2510:fab59b1e756d user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Jul 30 12:06:24 2009 -0400 description: Added fastqsanger data format and required bwa_wrapper to take only that format as input 9 file(s) affected in this change: datatypes_conf.xml.sample lib/galaxy/datatypes/registry.py lib/galaxy/datatypes/sequence.py lib/galaxy/datatypes/test/1.fastqsanger lib/galaxy/datatypes/test/2.fastqsanger test-data/1.fastqsanger test-data/2.fastqsanger test/functional/test_sniffing_and_metadata_settings.py tools/sr_mapping/bwa_wrapper.xml diffs (298 lines): diff -r f06777cbd5bb -r fab59b1e756d datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Thu Jul 30 11:05:03 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Jul 30 12:06:24 2009 -0400 @@ -20,6 +20,7 @@ <datatype extension="fasta" type="galaxy.datatypes.sequence:Fasta" display_in_upload="true"> <converter file="fasta_to_tabular_converter.xml" target_datatype="tabular"/> </datatype> + <datatype extension="fastqsanger" type="galaxy.datatypes.sequence:FastqSanger" display_in_upload="true"/> <datatype extension="fastqsolexa" type="galaxy.datatypes.sequence:FastqSolexa" display_in_upload="true"> <converter file="fastqsolexa_to_fasta_converter.xml" target_datatype="fasta"/> <converter file="fastqsolexa_to_qual_converter.xml" target_datatype="qualsolexa"/> @@ -195,6 +196,7 @@ <sniffer type="galaxy.datatypes.qualityscore:QualityScore454"/> <sniffer type="galaxy.datatypes.sequence:Fasta"/> <sniffer type="galaxy.datatypes.sequence:FastqSolexa"/> + <sniffer type="galaxy.datatypes.sequence:FastqSanger"/> <sniffer type="galaxy.datatypes.interval:Wiggle"/> <sniffer type="galaxy.datatypes.images:Html"/> <sniffer type="galaxy.datatypes.sequence:Axt"/> diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Thu Jul 30 11:05:03 2009 -0400 +++ b/lib/galaxy/datatypes/registry.py Thu Jul 30 12:06:24 2009 -0400 @@ -117,6 +117,7 @@ 'customtrack' : interval.CustomTrack(), 'csfasta' : sequence.csFasta(), 'fasta' : sequence.Fasta(), + 'fastqsanger' : sequence.FastqSanger(), 'fastqsolexa' : sequence.FastqSolexa(), 'gff' : interval.Gff(), 'gff3' : interval.Gff3(), @@ -144,6 +145,7 @@ 'customtrack' : 'text/plain', 'csfasta' : 'text/plain', 'fasta' : 'text/plain', + 'fastqsanger' : 'text/plain', 'fastqsolexa' : 'text/plain', 'gff' : 'text/plain', 'gff3' : 'text/plain', @@ -173,6 +175,7 @@ qualityscore.QualityScore454(), sequence.Fasta(), sequence.FastqSolexa(), + sequence.FastqSanger(), interval.Wiggle(), images.Html(), sequence.Axt(), diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/sequence.py --- a/lib/galaxy/datatypes/sequence.py Thu Jul 30 11:05:03 2009 -0400 +++ b/lib/galaxy/datatypes/sequence.py Thu Jul 30 12:06:24 2009 -0400 @@ -176,16 +176,139 @@ except: qscore_int = False + # check length and range of quality scores if qscore_int: if len( headers[3] ) != len( headers[1][0] ): return False + if not self.check_qual_values_within_range(headers[3], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[7], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[11], 'int'): + return False + except IndexError: + pass + except IndexError: + pass else: if len( headers[3][0] ) != len( headers[1][0] ): - return False + return False + if not self.check_qual_values_within_range(headers[3][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[7][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[11][0], 'char'): + return False + except IndexError: + pass + except IndexError: + pass return True return False except: return False + def check_qual_values_within_range( self, qual_seq, score_type ): + if score_type == 'char': + for val in qual_seq: + if ord(val) < 59 or ord(val) > 104: + return False + elif score_type == 'int': + for val in qual_seq: + if int(val) < -5 or int(val) > 40: + return False + return True + + +class FastqSanger( Sequence ): + """Class representing a FASTQ sequence ( the Sanger variant )""" + file_ext = "fastqsanger" + + def set_peek( self, dataset ): + if not dataset.dataset.purged: + dataset.peek = data.get_file_peek( dataset.file_name ) + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def sniff( self, filename ): + """ + Determines whether the file is in fastqsanger format (Sanger Variant) + For details, see http://maq.sourceforge.net/fastq.shtml + + Note: There are two kinds of FASTQ files, known as "Sanger" (sometimes called "Standard") and Solexa + These differ in the representation of the quality scores + + >>> fname = get_test_fname( '1.fastqsanger' ) + >>> FastqSanger().sniff( fname ) + True + >>> fname = get_test_fname( '2.fastqsanger' ) + >>> FastqSanger().sniff( fname ) + True + """ + headers = get_headers( filename, None ) + bases_regexp = re.compile( "^[NGTAC]*$" ) + try: + if len( headers ) >= 4 and headers[0][0] and headers[0][0][0] == "@" and headers[2][0] and headers[2][0][0] == "+" and headers[1][0]: + # Check the sequence line, make sure it contains only G/C/A/T/N + if not bases_regexp.match( headers[1][0] ): + return False + # Check quality score: integer or ascii char. + try: + check = int(headers[3][0]) + qscore_int = True + except: + qscore_int = False + + # check length and range of quality scores + if qscore_int: + if len( headers[3] ) != len( headers[1][0] ): + return False + if not self.check_qual_values_within_range(headers[3], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[7], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[11], 'int'): + return False + except IndexError: + pass + except IndexError: + pass + else: + if len( headers[3][0] ) != len( headers[1][0] ): + return False + if not self.check_qual_values_within_range(headers[3][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[7][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[11][0], 'char'): + return False + except IndexError: + pass + except IndexError: + pass + return True + return False + except: + return False + def check_qual_values_within_range( self, qual_seq, score_type ): + if score_type == 'char': + for val in qual_seq: + if ord(val) >= 33 and ord(val) <= 126: + return True + elif score_type == 'int': + for val in qual_seq: + if int(val) >= 0 and int(val) <= 93: + return True + return False try: from galaxy import eggs diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11 \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test-data/1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test-data/2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11 \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test/functional/test_sniffing_and_metadata_settings.py --- a/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 11:05:03 2009 -0400 +++ b/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 12:06:24 2009 -0400 @@ -216,6 +216,16 @@ assert latest_hda is not None, "Problem retrieving wig hda from the database" if not latest_hda.name == '1.wig' and not latest_hda.extension == 'wig': raise AssertionError, "wig data type was not correctly sniffed." + def test_085_fastqsanger_datatype( self ): + """Testing correctly sniffing fastqsanger ( the Sanger variant ) data type upon upload""" + self.upload_file( '1.fastqsanger' ) + self.verify_dataset_correctness( '1.fastqsanger' ) + self.check_history_for_string( '1.fastqsanger format: <span class="fastqsanger">fastqsanger</span>, database: \? Info: uploaded fastqsanger file' ) + latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ + .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() + assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database" + if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger': + raise AssertionError, "fastqsanger data type was not correctly sniffed." def test_9999_clean_up( self ): self.delete_history( id=self.security.encode_id( history1.id ) ) self.logout() diff -r f06777cbd5bb -r fab59b1e756d tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 11:05:03 2009 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 12:06:24 2009 -0400 @@ -71,7 +71,7 @@ <option value="history">Use one from the history</option> </param> <when value="history"> - <param name="ownFile" type="data" label="Select a reference genome" /> + <param name="ownFile" type="data" format="fasta" label="Select a reference genome" /> </when> <when value="indexed"> <param name="indices" type="select" label="Select a reference genome"> @@ -91,7 +91,7 @@ <option value="history">Use one from the history</option> </param> <when value="history"> - <param name="ownFile" type="data" label="Select a reference genome" /> + <param name="ownFile" type="data" format="fasta" label="Select a reference genome" /> </when> <when value="indexed"> <param name="indices" type="select" label="Select a reference genome"> @@ -111,11 +111,11 @@ <option value="paired">Paired-end</option> </param> <when value="single"> - <param name="input1" type="data" label="FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> </when> <when value="paired"> - <param name="input1" type="data" label="Forward FASTQ file" /> - <param name="input2" type="data" label="Reverse FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> </when> </conditional> <conditional name="params">

1 0

[hg] galaxy 2511: Fix a problem introduced in db version 10 (MyS...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ec59d6bcf827 changeset: 2511:ec59d6bcf827 user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Jul 30 12:12:26 2009 -0400 description: Fix a problem introduced in db version 10 (MySQL's length limits prevent the creation of an index) 1 file(s) affected in this change: lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py diffs (55 lines): diff -r fab59b1e756d -r ec59d6bcf827 lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py Thu Jul 30 12:12:26 2009 -0400 @@ -0,0 +1,51 @@ +from sqlalchemy import * +from sqlalchemy.orm import * +from sqlalchemy.exceptions import * +from migrate import * +from migrate.changeset import * + +import datetime +now = datetime.datetime.utcnow + +import sys, logging +log = logging.getLogger( __name__ ) +log.setLevel(logging.DEBUG) +handler = logging.StreamHandler( sys.stdout ) +format = "%(name)s %(levelname)s %(asctime)s %(message)s" +formatter = logging.Formatter( format ) +handler.setFormatter( formatter ) +log.addHandler( handler ) + +# Need our custom types, but don't import anything else from model +from galaxy.model.custom_types import * + +metadata = MetaData( migrate_engine ) +db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) ) + +HistoryDatasetAssociationDisplayAtAuthorization_table = Table( "history_dataset_association_display_at_authorization", metadata, + Column( "id", Integer, primary_key=True ), + Column( "create_time", DateTime, default=now ), + Column( "update_time", DateTime, index=True, default=now, onupdate=now ), + Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "user_id", Integer, ForeignKey( "galaxy_user.id" ), index=True ), + Column( "site", TrimmedString( 255 ) ) ) + +def upgrade(): + if migrate_engine.name == 'mysql': + # Load existing tables + metadata.reflect() + i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id ) + try: + i.create() + except Exception, e: + log.debug( "Adding index 'ix_hdadaa_history_dataset_association_id' to table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) ) + +def downgrade(): + if migrate_engine.name == 'mysql': + # Load existing tables + metadata.reflect() + i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id ) + try: + i.drop() + except Exception, e: + log.debug( "Removing index 'ix_hdadaa_history_dataset_association_id' from table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )

1 0

[hg] galaxy 2509: Add a new config setting to universe_wsgi.ini:...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f06777cbd5bb changeset: 2509:f06777cbd5bb user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 11:05:03 2009 -0400 description: Add a new config setting to universe_wsgi.ini: new_user_dataset_access_role_default_private. When set to True, new users will have default dataset access permissions for histories set to their Private role. Default is False (original behavior); datasets are left as public. Resolves ticket #111. 4 file(s) affected in this change: lib/galaxy/config.py lib/galaxy/security/__init__.py lib/galaxy/web/controllers/user.py universe_wsgi.ini.sample diffs (58 lines): diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/config.py --- a/lib/galaxy/config.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/config.py Thu Jul 30 11:05:03 2009 -0400 @@ -46,6 +46,7 @@ self.require_login = string_as_bool( kwargs.get( "require_login", "False" ) ) self.allow_user_creation = string_as_bool( kwargs.get( "allow_user_creation", "True" ) ) self.allow_user_deletion = string_as_bool( kwargs.get( "allow_user_deletion", "False" ) ) + self.new_user_dataset_access_role_default_private = string_as_bool( kwargs.get( "new_user_dataset_access_role_default_private", "False" ) ) self.template_path = resolve_path( kwargs.get( "template_path", "templates" ), self.root ) self.template_cache = resolve_path( kwargs.get( "template_cache_path", "database/compiled_templates" ), self.root ) self.local_job_queue_workers = int( kwargs.get( "local_job_queue_workers", "5" ) ) diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/security/__init__.py --- a/lib/galaxy/security/__init__.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/security/__init__.py Thu Jul 30 11:05:03 2009 -0400 @@ -206,12 +206,16 @@ else: return None return role - def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False ): + def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False, default_access_private = False ): # bypass_manage_permission is used to change permissions of datasets in a userless history when logging in if user is None: return None if not permissions: - permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] } + #default permissions + permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] } + #new_user_dataset_access_role_default_private is set as True in config file + if default_access_private: + permissions[ self.permitted_actions.DATASET_ACCESS ] = permissions.values()[ 0 ] # Delete all of the current default permissions for the user for dup in user.default_permissions: dup.delete() diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/web/controllers/user.py --- a/lib/galaxy/web/controllers/user.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/web/controllers/user.py Thu Jul 30 11:05:03 2009 -0400 @@ -157,7 +157,7 @@ user.flush() trans.app.security_agent.create_private_user_role( user ) # We set default user permissions, before we log in and set the default history permissions - trans.app.security_agent.user_set_default_permissions( user ) + trans.app.security_agent.user_set_default_permissions( user, default_access_private = trans.app.config.new_user_dataset_access_role_default_private ) # The handle_user_login() method has a call to the history_set_default_permissions() method # (needed when logging in with a history), user needs to have default permissions set before logging in trans.handle_user_login( user ) diff -r e01bfc281e09 -r f06777cbd5bb universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample Tue Jul 28 14:16:19 2009 -0400 +++ b/universe_wsgi.ini.sample Thu Jul 30 11:05:03 2009 -0400 @@ -156,6 +156,9 @@ # Can an admin user delete user accounts? #allow_user_deletion = False +# Should default dataset access permissions be private for new users; default is False (datasets are public) +new_user_dataset_access_role_default_private = False + # ---- Job Execution -------------------------------------------------------- # Number of concurrent jobs to run (local job runner)

1 0

Links in help
by Pieter Neerincx 29 Jul '09

29 Jul '09

Hi, After Googling and browsing the tool config files for some time I found the syntax for adding a link to the help section... To make a future lookup a bit faster: could this please be added to http://g2.trac.bx.psu.edu/wiki/ToolConfigSyntax on the Wiki? Thanks, Pi ------------------------------------------------------------- Biomolecular Mass Spectrometry and Proteomics Utrecht University Visiting address: H.R. Kruyt building room O607 Padualaan 8 3584 CH Utrecht The Netherlands Mail address: P.O. box 80.082 3508 TB Utrecht The Netherlands phone: +31 (0)6-143 66 783 email: pieter.neerincx(a)gmail.com skype: pieter.online ------------------------------------------------------------

2 1

[hg] galaxy 2506: Allow the upload of PDF files to libraries via...
by Nate Coraor 29 Jul '09

29 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ae750790079a changeset: 2506:ae750790079a user: Dan Blankenberg <dan(a)bx.psu.edu> date: Mon Jul 27 11:33:12 2009 -0400 description: Allow the upload of PDF files to libraries via the admin interface. A more generic method of determining binary files' type and whether they are allowed to be uploaded via the various upload methods should be created. 1 file(s) affected in this change: lib/galaxy/web/controllers/library_dataset.py diffs (29 lines): diff -r 5a92b5877cf7 -r ae750790079a lib/galaxy/web/controllers/library_dataset.py --- a/lib/galaxy/web/controllers/library_dataset.py Mon Jul 27 10:46:25 2009 -0400 +++ b/lib/galaxy/web/controllers/library_dataset.py Mon Jul 27 11:33:12 2009 -0400 @@ -73,12 +73,19 @@ ext = name.split( "." )[1].strip().lower() except: ext = '' - if not( ext == 'ab1' or ext == 'scf' ): - raise BadFileException( "you attempted to upload an inappropriate file." ) - if ext == 'ab1' and file_format != 'ab1': - raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) - elif ext == 'scf' and file_format != 'scf': - raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) + try: + is_pdf = open( temp_name ).read( len( '%PDF' ) ) == '%PDF' + except: + is_pdf = False #file failed to open or contents are smaller than pdf header + if is_pdf: + file_format = 'pdf' #allow the upload of PDFs to library via the admin interface. + else: + if not( ext == 'ab1' or ext == 'scf' ): + raise BadFileException( "you attempted to upload an inappropriate file." ) + if ext == 'ab1' and file_format != 'ab1': + raise BadFileException( "you must manually set the 'File Format' to 'Ab1' when uploading ab1 files." ) + elif ext == 'scf' and file_format != 'scf': + raise BadFileException( "you must manually set the 'File Format' to 'Scf' when uploading scf files." ) data_type = 'binary' if not data_type: # We must have a text file

1 0