galaxy-dev
Threads by month
- ----- 2026 -----
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2009 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2008 -----
- December
- November
- October
- September
- August
- 10009 discussions
details: http://www.bx.psu.edu/hg/galaxy/rev/07dffb2735dd
changeset: 2518:07dffb2735dd
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Fri Jul 31 12:01:02 2009 -0400
description:
merging heads
0 file(s) affected in this change:
diffs (528 lines):
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/datatypes/data.py
--- a/lib/galaxy/datatypes/data.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/datatypes/data.py Fri Jul 31 12:01:02 2009 -0400
@@ -51,6 +51,8 @@
copy_safe_peek = True
is_binary = True #The dataset contains binary data --> do not space_to_tab or convert newlines, etc. Allow binary file uploads of this type when True.
+
+ allow_datatype_change = True #Allow user to change between this datatype and others. If False, this datatype cannot be changed from or into.
#Composite datatypes
composite_type = None
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/datatypes/genetics.py
--- a/lib/galaxy/datatypes/genetics.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/datatypes/genetics.py Fri Jul 31 12:01:02 2009 -0400
@@ -122,6 +122,7 @@
file_ext="html"
composite_type = 'auto_primary_file'
+ allow_datatype_change = False
def missing_meta( self, dataset ):
"""Checks for empty meta values"""
@@ -255,6 +256,8 @@
file_ext = None
is_binary = True
+
+ allow_datatype_change = False
composite_type = 'basic'
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py Fri Jul 31 12:01:02 2009 -0400
@@ -0,0 +1,51 @@
+from sqlalchemy import *
+from sqlalchemy.orm import *
+from sqlalchemy.exceptions import *
+from migrate import *
+from migrate.changeset import *
+
+import datetime
+now = datetime.datetime.utcnow
+
+import sys, logging
+log = logging.getLogger( __name__ )
+log.setLevel(logging.DEBUG)
+handler = logging.StreamHandler( sys.stdout )
+format = "%(name)s %(levelname)s %(asctime)s %(message)s"
+formatter = logging.Formatter( format )
+handler.setFormatter( formatter )
+log.addHandler( handler )
+
+# Need our custom types, but don't import anything else from model
+from galaxy.model.custom_types import *
+
+metadata = MetaData( migrate_engine )
+db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) )
+
+HistoryDatasetAssociationDisplayAtAuthorization_table = Table( "history_dataset_association_display_at_authorization", metadata,
+ Column( "id", Integer, primary_key=True ),
+ Column( "create_time", DateTime, default=now ),
+ Column( "update_time", DateTime, index=True, default=now, onupdate=now ),
+ Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ),
+ Column( "user_id", Integer, ForeignKey( "galaxy_user.id" ), index=True ),
+ Column( "site", TrimmedString( 255 ) ) )
+
+def upgrade():
+ if migrate_engine.name == 'mysql':
+ # Load existing tables
+ metadata.reflect()
+ i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id )
+ try:
+ i.create()
+ except Exception, e:
+ log.debug( "Adding index 'ix_hdadaa_history_dataset_association_id' to table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )
+
+def downgrade():
+ if migrate_engine.name == 'mysql':
+ # Load existing tables
+ metadata.reflect()
+ i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id )
+ try:
+ i.drop()
+ except Exception, e:
+ log.debug( "Removing index 'ix_hdadaa_history_dataset_association_id' from table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py Fri Jul 31 12:01:02 2009 -0400
@@ -1094,7 +1094,7 @@
replace_dataset = None
# Let's not overwrite the imported datatypes module with the variable datatypes?
# The built-in 'id' is overwritten in lots of places as well
- ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
if params.get( 'new_dataset_button', False ):
upload_option = params.get( 'upload_option', 'upload_file' )
@@ -1247,17 +1247,20 @@
elif action == 'edit_info':
if params.get( 'change', False ):
# The user clicked the Save button on the 'Change data type' form
- trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
- trans.app.model.flush()
- msg = "Data type changed for library dataset '%s'" % ldda.name
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- restrict=params.get( 'restrict', True ),
- render_templates=params.get( 'render_templates', False ),
- msg=msg,
- messagetype=messagetype )
+ if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
+ trans.app.model.flush()
+ msg = "Data type changed for library dataset '%s'" % ldda.name
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ restrict=params.get( 'restrict', True ),
+ render_templates=params.get( 'render_templates', False ),
+ msg=msg,
+ messagetype=messagetype )
+ else:
+ return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) )
elif params.get( 'save', False ):
# The user clicked the Save button on the 'Edit Attributes' form
old_name = ldda.name
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/web/controllers/dataset.py
--- a/lib/galaxy/web/controllers/dataset.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/web/controllers/dataset.py Fri Jul 31 12:01:02 2009 -0400
@@ -144,7 +144,7 @@
redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] )
if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ):
return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac
- if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ):
+ if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ):
trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site )
return trans.response.send_redirect( redirect_url )
else:
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/web/controllers/history.py
--- a/lib/galaxy/web/controllers/history.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/web/controllers/history.py Fri Jul 31 12:01:02 2009 -0400
@@ -166,7 +166,7 @@
default_permissions[ default_action ] = [ private_user_role ]
trans.app.security_agent.history_set_default_permissions( history, default_permissions )
n_undeleted += 1
- trans.log_event( "History (%s) %d marked as undeleted" % history.name )
+ trans.log_event( "History (%s) %d marked as undeleted" % ( history.name, history.id ) )
status = SUCCESS
message_parts = []
if n_undeleted:
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/web/controllers/library.py
--- a/lib/galaxy/web/controllers/library.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/web/controllers/library.py Fri Jul 31 12:01:02 2009 -0400
@@ -430,7 +430,7 @@
replace_dataset = None
# Let's not overwrite the imported datatypes module with the variable datatypes?
# The built-in 'id' is overwritten in lots of places as well
- ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
if id:
if params.get( 'permissions', False ):
@@ -505,10 +505,14 @@
if trans.app.security_agent.allow_action( trans.user,
trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
library_item=ldda ):
- trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
- trans.app.model.flush()
- msg = "Data type changed for library dataset '%s'" % ldda.name
- messagetype = 'done'
+ if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
+ trans.app.model.flush()
+ msg = "Data type changed for library dataset '%s'" % ldda.name
+ messagetype = 'done'
+ else:
+ msg = "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype )
+ messagetype = 'error'
else:
msg = "You are not authorized to change the data type of dataset '%s'" % ldda.name
messagetype = 'error'
diff -r 61dd78cafa09 -r 07dffb2735dd lib/galaxy/web/controllers/root.py
--- a/lib/galaxy/web/controllers/root.py Fri Jul 31 11:48:37 2009 -0400
+++ b/lib/galaxy/web/controllers/root.py Fri Jul 31 12:01:02 2009 -0400
@@ -247,8 +247,11 @@
params = util.Params( kwd, safe=False )
if params.change:
# The user clicked the Save button on the 'Change data type' form
- trans.app.datatypes_registry.change_datatype( data, params.datatype )
- trans.app.model.flush()
+ if data.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( data, params.datatype )
+ trans.app.model.flush()
+ else:
+ return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( data.extension, params.datatype ) )
elif params.save:
# The user clicked the Save button on the 'Edit Attributes' form
data.name = params.name
@@ -314,7 +317,7 @@
data.metadata.dbkey = data.dbkey
# let's not overwrite the imported datatypes module with the variable datatypes?
# the built-in 'id' is overwritten in lots of places as well
- ldatatypes = [x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys()]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
trans.log_event( "Opened edit view on dataset %s" % str(id) )
return trans.fill_template( "/dataset/edit_attributes.mako", data=data, datatypes=ldatatypes )
diff -r 61dd78cafa09 -r 07dffb2735dd scripts/cleanup_datasets/cleanup_datasets.py
--- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Jul 31 11:48:37 2009 -0400
+++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Jul 31 12:01:02 2009 -0400
@@ -24,6 +24,7 @@
parser.add_option( "-d", "--days", dest="days", action="store", type="int", help="number of days (60)", default=60 )
parser.add_option( "-r", "--remove_from_disk", action="store_true", dest="remove_from_disk", help="remove datasets from disk when purged", default=False )
parser.add_option( "-i", "--info_only", action="store_true", dest="info_only", help="info about the requested action", default=False )
+ parser.add_option( "-f", "--force_retry", action="store_true", dest="force_retry", help="performs the requested actions, but ignores whether it might have been done before. Useful when -r wasn't used, but should have been", default=False )
parser.add_option( "-1", "--delete_userless_histories", action="store_true", dest="delete_userless_histories", default=False, help="delete userless histories and datasets" )
@@ -73,28 +74,32 @@
print "# Datasets will NOT be removed from disk.\n"
if options.delete_userless_histories:
- delete_userless_histories( app, cutoff_time, info_only = options.info_only )
+ delete_userless_histories( app, cutoff_time, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_histories:
- purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_datasets:
- purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_libraries:
- purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_folders:
- purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
sys.exit(0)
-def delete_userless_histories( app, cutoff_time, info_only = False ):
+def delete_userless_histories( app, cutoff_time, info_only = False, force_retry = False ):
# Deletes userless histories whose update_time value is older than the cutoff_time.
# The purge history script will handle marking DatasetInstances as deleted.
# Nothing is removed from disk yet.
history_count = 0
print '# The following datasets and associated userless histories have been deleted'
start = time.clock()
- histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
- app.model.History.table.c.deleted==False,
- app.model.History.table.c.update_time < cutoff_time ) ).all()# \
+ if force_retry:
+ histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
+ app.model.History.table.c.update_time < cutoff_time ) ).all()
+ else:
+ histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
+ app.model.History.table.c.deleted==False,
+ app.model.History.table.c.update_time < cutoff_time ) ).all()
for history in histories:
if not info_only:
history.deleted = True
@@ -106,7 +111,7 @@
print "Elapsed time: ", stop - start, "\n"
-def purge_histories( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_histories( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted histories whose update_time is older than the cutoff_time.
# The dataset associations of each history are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -115,10 +120,15 @@
history_count = 0
print '# The following datasets and associated deleted histories have been purged'
start = time.clock()
- histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
- app.model.History.table.c.purged==False,
- app.model.History.table.c.update_time < cutoff_time ) ) \
- .options( eagerload( 'datasets' ) ).all()
+ if force_retry:
+ histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
+ app.model.History.table.c.update_time < cutoff_time ) ) \
+ .options( eagerload( 'datasets' ) ).all()
+ else:
+ histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
+ app.model.History.table.c.purged==False,
+ app.model.History.table.c.update_time < cutoff_time ) ) \
+ .options( eagerload( 'datasets' ) ).all()
for history in histories:
for dataset_assoc in history.datasets:
_purge_dataset_instance( dataset_assoc, app, remove_from_disk, info_only = info_only ) #mark a DatasetInstance as deleted, clear associated files, and mark the Dataset as deleted if it is deletable
@@ -136,7 +146,7 @@
print '# Purged %d histories.' % ( history_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted libraries whose update_time is older than the cutoff_time.
# The dataset associations of each library are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -145,9 +155,13 @@
library_count = 0
print '# The following libraries and associated folders have been purged'
start = time.clock()
- libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
- app.model.Library.table.c.purged==False,
- app.model.Library.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
+ app.model.Library.table.c.update_time < cutoff_time ) ).all()
+ else:
+ libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
+ app.model.Library.table.c.purged==False,
+ app.model.Library.table.c.update_time < cutoff_time ) ).all()
for library in libraries:
_purge_folder( library.root_folder, app, remove_from_disk, info_only = info_only )
if not info_only:
@@ -159,7 +173,7 @@
print '# Purged %d libraries .' % ( library_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_folders( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_folders( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted folders whose update_time is older than the cutoff_time.
# The dataset associations of each folder are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -168,9 +182,13 @@
folder_count = 0
print '# The following folders have been purged'
start = time.clock()
- folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
- app.model.LibraryFolder.table.c.purged==False,
- app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
+ app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
+ else:
+ folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
+ app.model.LibraryFolder.table.c.purged==False,
+ app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
for folder in folders:
_purge_folder( folder, app, remove_from_disk, info_only = info_only )
print "%d" % folder.id
@@ -179,17 +197,22 @@
print '# Purged %d folders.' % ( folder_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False, repurge = False, force_retry = False ):
# Purges deleted datasets whose update_time is older than cutoff_time. Files may or may
# not be removed from disk.
dataset_count = 0
disk_space = 0
print '# The following deleted datasets have been purged'
start = time.clock()
- datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
- app.model.Dataset.table.c.purgable==True,
- app.model.Dataset.table.c.purged==False,
- app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
+ app.model.Dataset.table.c.purgable==True,
+ app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
+ else:
+ datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
+ app.model.Dataset.table.c.purgable==True,
+ app.model.Dataset.table.c.purged==False,
+ app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
for dataset in datasets:
file_size = dataset.file_size
_purge_dataset( dataset, remove_from_disk, info_only = info_only )
diff -r 61dd78cafa09 -r 07dffb2735dd templates/admin/library/ldda_edit_info.mako
--- a/templates/admin/library/ldda_edit_info.mako Fri Jul 31 11:48:37 2009 -0400
+++ b/templates/admin/library/ldda_edit_info.mako Fri Jul 31 12:01:02 2009 -0400
@@ -99,24 +99,30 @@
<div class="toolForm">
<div class="toolFormTitle">Change data type of ${ldda.name}</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
- <input type="hidden" name="id" value="${ldda.id}"/>
+ %if ldda.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <input type="hidden" name="id" value="${ldda.id}"/>
+ <div class="form-row">
+ <label>New Type:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( ldda, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ This will change the datatype of the existing dataset
+ but <i>not</i> modify its contents. Use this if Galaxy
+ has incorrectly guessed the type of your dataset.
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="Save"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>New Type:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( ldda, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- This will change the datatype of the existing dataset
- but <i>not</i> modify its contents. Use this if Galaxy
- has incorrectly guessed the type of your dataset.
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="Save"/>
- </div>
- </form>
+ %endif
</div>
</div>
diff -r 61dd78cafa09 -r 07dffb2735dd templates/dataset/edit_attributes.mako
--- a/templates/dataset/edit_attributes.mako Fri Jul 31 11:48:37 2009 -0400
+++ b/templates/dataset/edit_attributes.mako Fri Jul 31 12:01:02 2009 -0400
@@ -102,27 +102,34 @@
</div>
<p />
%endif
+
<div class="toolForm">
<div class="toolFormTitle">${_('Change data type')}</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post">
- <input type="hidden" name="id" value="${data.id}"/>
+ %if data.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post">
+ <input type="hidden" name="id" value="${data.id}"/>
+ <div class="form-row">
+ <label>
+ ${_('New Type')}:
+ </label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( data, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="${_('Save')}"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>
- ${_('New Type')}:
- </label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( data, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')}
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="${_('Save')}"/>
- </div>
- </form>
+ %endif
</div>
</div>
<p />
diff -r 61dd78cafa09 -r 07dffb2735dd templates/library/ldda_edit_info.mako
--- a/templates/library/ldda_edit_info.mako Fri Jul 31 11:48:37 2009 -0400
+++ b/templates/library/ldda_edit_info.mako Fri Jul 31 12:01:02 2009 -0400
@@ -99,24 +99,30 @@
<div class="toolForm">
<div class="toolFormTitle">Change data type</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
- <input type="hidden" name="id" value="${ldda.id}"/>
+ %if ldda.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <input type="hidden" name="id" value="${ldda.id}"/>
+ <div class="form-row">
+ <label>New Type:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( ldda, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ This will change the datatype of the existing dataset
+ but <i>not</i> modify its contents. Use this if Galaxy
+ has incorrectly guessed the type of your dataset.
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="Save"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>New Type:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( ldda, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- This will change the datatype of the existing dataset
- but <i>not</i> modify its contents. Use this if Galaxy
- has incorrectly guessed the type of your dataset.
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="Save"/>
- </div>
- </form>
+ %endif
</div>
</div>
<p/>
1
0
Hello,
I'd like to suggest a new feature - administrative lock which prevents new jobs from starting.
Use case:
1. I need to stop my galaxy server (to upgrade, to add new tool, to add new dbkey, etc).
2. I want to stop it in a friendly way, without killing running jobs, but not allow new jobs to start.
3. Once all the running jobs complete (and new jobs are not started), I can stop the server, fix it, and restart.
4. Restarting the server (and assuming jobs are tracked in the database), all the held jobs are started normally.
Code changes:
1. new administrative method ( job_lock() in ./lib/galaxy/web/controller/admin.py )
2. new template ( ./templates/admin/job_lock.mako )
3. job lock code in lib/galaxy/jobs/schedulingpolicy/roundrobin.py
I'm still testing this patch, but comments are welcomed.
-gordon.
3
2
31 Jul '09
Hi Chris,
Sorry about missing the reply, I was on vacation when you wrote back.
Also, I've moved this over to the dev mailing list since it's regarding
local installation issues.
Could you do the following:
Paste the <iframe> tags from "View Source" on the main page.
Paste the log output from the server (or paster.log if you're running as
a daemon) of your client connecting to Galaxy.
Thanks,
--nate
Chris Cole wrote:
> Just realised I'd not sent this to the list. Whoops!
>
> This is still broken, anyone have any ideas?
> Cheers,
>
> Chris
>
> -------- Original Message --------
> Subject: Re: [galaxy-user] Fresh install has wrong layout
> Date: Tue, 21 Jul 2009 10:47:50 +0100
> From: Chris Cole <chris(a)compbio.dundee.ac.uk>
> Organisation: University of Dundee
> To: Nate Coraor <nate(a)bx.psu.edu>
> References: <4A4E147C.6010107(a)compbio.dundee.ac.uk>
> <4A4E1506.5030609(a)bx.psu.edu> <4A4E1716.2070800(a)compbio.dundee.ac.uk>
> <4A52AFFA.5020102(a)bx.psu.edu>
>
> Hi Nate,
>
> Sorry for not replying earlier, I've been on holiday. Attached should be
> my universe_wsgi.ini for the updated server. (The file has a .txt
> extension to avoid sending blockage).
>
> I've used the same settings (where applicable) for my currently working
> svn version 1686.
>
> Chris
>
> Nate Coraor wrote:
>> Chris,
>>
>> Could you send us your universe_wsgi.ini? We haven't seen this happen
>> without a proxy before.
>>
>> --nate
>>
>> Chris Cole wrote:
>>> Hi Nate,
>>>
>>> Nope. There's no proxy configured. The only things I changed in the HTTP
>>> config part of the universe_wsgi.ini are the host and the port.
>>> Cheers,
>>>
>>> Chris
>>>
>>> Nate Coraor wrote:
>>>> Hi Chris,
>>>>
>>>> It sounds like you maybe be running through a proxy, away from the
>>>> server root, without the proxy-prefix option set in universe_wsgi.ini?
>>>> If so, have a look at the documentation here:
>>>>
>>>> http://g2.trac.bx.psu.edu/wiki/HowToInstall/ApacheProxy#Apacheconfiguration…
>>>>
>>>> --nate
>>>>
>>>> Chris Cole wrote:
>>>>> Hi,
>>>>>
>>>>> I've been using the subversion version of Galaxy for a while, but now I
>>>>> want to update to the latest mercurial release.
>>>>>
>>>>> I installed it in a new location as per the wiki and set-up the SGE
>>>>> settings as per my previous install and all the tests pass. It launches
>>>>> fine, but when viewing the website the frames seem to be off-by-one.
>>>>> i.e., the 'Tools' frame is empty except for "This link may not be
>>>>> followed from within Galaxy.", the tools are in the middle window and
>>>>> the 'History' frame has general information.
>>>>>
>>>>> I can't see any errors in the paster.log file, so where can I look to
>>>>> sort out this error?
>>>>> Thanks,
>>>>>
>>>>> Chris
>>>>> _______________________________________________
>>>>> galaxy-user mailing list
>>>>> galaxy-user(a)bx.psu.edu
>>>>> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user
>
>
>
> ------------------------------------------------------------------------
>
> _______________________________________________
> galaxy-user mailing list
> galaxy-user(a)bx.psu.edu
> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user
2
1
31 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/aabcc797c1da
changeset: 2515:aabcc797c1da
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Thu Jul 30 16:23:47 2009 -0400
description:
Add new flag, allow_datatype_change, to Datatypes. When set to False, datasets of this datatype cannot be changed from or into.
This is needed, i.e. for Rgenetics Datatypes to prevent loss of metadata ('base_name') which occurs when changing to datatypes without this metadata parameter and would render the dataset unusable (composite filenames could be incorrect).
8 file(s) affected in this change:
lib/galaxy/datatypes/data.py
lib/galaxy/datatypes/genetics.py
lib/galaxy/web/controllers/admin.py
lib/galaxy/web/controllers/library.py
lib/galaxy/web/controllers/root.py
templates/admin/library/ldda_edit_info.mako
templates/dataset/edit_attributes.mako
templates/library/ldda_edit_info.mako
diffs (287 lines):
diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/data.py
--- a/lib/galaxy/datatypes/data.py Thu Jul 30 15:03:53 2009 -0400
+++ b/lib/galaxy/datatypes/data.py Thu Jul 30 16:23:47 2009 -0400
@@ -51,6 +51,8 @@
copy_safe_peek = True
is_binary = True #The dataset contains binary data --> do not space_to_tab or convert newlines, etc. Allow binary file uploads of this type when True.
+
+ allow_datatype_change = True #Allow user to change between this datatype and others. If False, this datatype cannot be changed from or into.
#Composite datatypes
composite_type = None
diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/genetics.py
--- a/lib/galaxy/datatypes/genetics.py Thu Jul 30 15:03:53 2009 -0400
+++ b/lib/galaxy/datatypes/genetics.py Thu Jul 30 16:23:47 2009 -0400
@@ -122,6 +122,7 @@
file_ext="html"
composite_type = 'auto_primary_file'
+ allow_datatype_change = False
def missing_meta( self, dataset ):
"""Checks for empty meta values"""
@@ -255,6 +256,8 @@
file_ext = None
is_binary = True
+
+ allow_datatype_change = False
composite_type = 'basic'
diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/admin.py
--- a/lib/galaxy/web/controllers/admin.py Thu Jul 30 15:03:53 2009 -0400
+++ b/lib/galaxy/web/controllers/admin.py Thu Jul 30 16:23:47 2009 -0400
@@ -1094,7 +1094,7 @@
replace_dataset = None
# Let's not overwrite the imported datatypes module with the variable datatypes?
# The built-in 'id' is overwritten in lots of places as well
- ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
if params.get( 'new_dataset_button', False ):
upload_option = params.get( 'upload_option', 'upload_file' )
@@ -1247,17 +1247,20 @@
elif action == 'edit_info':
if params.get( 'change', False ):
# The user clicked the Save button on the 'Change data type' form
- trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
- trans.app.model.flush()
- msg = "Data type changed for library dataset '%s'" % ldda.name
- return trans.fill_template( "/admin/library/ldda_edit_info.mako",
- ldda=ldda,
- library_id=library_id,
- datatypes=ldatatypes,
- restrict=params.get( 'restrict', True ),
- render_templates=params.get( 'render_templates', False ),
- msg=msg,
- messagetype=messagetype )
+ if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
+ trans.app.model.flush()
+ msg = "Data type changed for library dataset '%s'" % ldda.name
+ return trans.fill_template( "/admin/library/ldda_edit_info.mako",
+ ldda=ldda,
+ library_id=library_id,
+ datatypes=ldatatypes,
+ restrict=params.get( 'restrict', True ),
+ render_templates=params.get( 'render_templates', False ),
+ msg=msg,
+ messagetype=messagetype )
+ else:
+ return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) )
elif params.get( 'save', False ):
# The user clicked the Save button on the 'Edit Attributes' form
old_name = ldda.name
diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/library.py
--- a/lib/galaxy/web/controllers/library.py Thu Jul 30 15:03:53 2009 -0400
+++ b/lib/galaxy/web/controllers/library.py Thu Jul 30 16:23:47 2009 -0400
@@ -430,7 +430,7 @@
replace_dataset = None
# Let's not overwrite the imported datatypes module with the variable datatypes?
# The built-in 'id' is overwritten in lots of places as well
- ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
if id:
if params.get( 'permissions', False ):
@@ -505,10 +505,14 @@
if trans.app.security_agent.allow_action( trans.user,
trans.app.security_agent.permitted_actions.LIBRARY_MODIFY,
library_item=ldda ):
- trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
- trans.app.model.flush()
- msg = "Data type changed for library dataset '%s'" % ldda.name
- messagetype = 'done'
+ if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( ldda, params.datatype )
+ trans.app.model.flush()
+ msg = "Data type changed for library dataset '%s'" % ldda.name
+ messagetype = 'done'
+ else:
+ msg = "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype )
+ messagetype = 'error'
else:
msg = "You are not authorized to change the data type of dataset '%s'" % ldda.name
messagetype = 'error'
diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/root.py
--- a/lib/galaxy/web/controllers/root.py Thu Jul 30 15:03:53 2009 -0400
+++ b/lib/galaxy/web/controllers/root.py Thu Jul 30 16:23:47 2009 -0400
@@ -247,8 +247,11 @@
params = util.Params( kwd, safe=False )
if params.change:
# The user clicked the Save button on the 'Change data type' form
- trans.app.datatypes_registry.change_datatype( data, params.datatype )
- trans.app.model.flush()
+ if data.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change:
+ trans.app.datatypes_registry.change_datatype( data, params.datatype )
+ trans.app.model.flush()
+ else:
+ return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( data.extension, params.datatype ) )
elif params.save:
# The user clicked the Save button on the 'Edit Attributes' form
data.name = params.name
@@ -314,7 +317,7 @@
data.metadata.dbkey = data.dbkey
# let's not overwrite the imported datatypes module with the variable datatypes?
# the built-in 'id' is overwritten in lots of places as well
- ldatatypes = [x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys()]
+ ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ]
ldatatypes.sort()
trans.log_event( "Opened edit view on dataset %s" % str(id) )
return trans.fill_template( "/dataset/edit_attributes.mako", data=data, datatypes=ldatatypes )
diff -r 904a72f5cf4c -r aabcc797c1da templates/admin/library/ldda_edit_info.mako
--- a/templates/admin/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400
+++ b/templates/admin/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400
@@ -99,24 +99,30 @@
<div class="toolForm">
<div class="toolFormTitle">Change data type of ${ldda.name}</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
- <input type="hidden" name="id" value="${ldda.id}"/>
+ %if ldda.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <input type="hidden" name="id" value="${ldda.id}"/>
+ <div class="form-row">
+ <label>New Type:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( ldda, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ This will change the datatype of the existing dataset
+ but <i>not</i> modify its contents. Use this if Galaxy
+ has incorrectly guessed the type of your dataset.
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="Save"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>New Type:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( ldda, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- This will change the datatype of the existing dataset
- but <i>not</i> modify its contents. Use this if Galaxy
- has incorrectly guessed the type of your dataset.
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="Save"/>
- </div>
- </form>
+ %endif
</div>
</div>
diff -r 904a72f5cf4c -r aabcc797c1da templates/dataset/edit_attributes.mako
--- a/templates/dataset/edit_attributes.mako Thu Jul 30 15:03:53 2009 -0400
+++ b/templates/dataset/edit_attributes.mako Thu Jul 30 16:23:47 2009 -0400
@@ -102,27 +102,34 @@
</div>
<p />
%endif
+
<div class="toolForm">
<div class="toolFormTitle">${_('Change data type')}</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post">
- <input type="hidden" name="id" value="${data.id}"/>
+ %if data.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post">
+ <input type="hidden" name="id" value="${data.id}"/>
+ <div class="form-row">
+ <label>
+ ${_('New Type')}:
+ </label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( data, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="${_('Save')}"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>
- ${_('New Type')}:
- </label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( data, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')}
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="${_('Save')}"/>
- </div>
- </form>
+ %endif
</div>
</div>
<p />
diff -r 904a72f5cf4c -r aabcc797c1da templates/library/ldda_edit_info.mako
--- a/templates/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400
+++ b/templates/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400
@@ -99,24 +99,30 @@
<div class="toolForm">
<div class="toolFormTitle">Change data type</div>
<div class="toolFormBody">
- <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
- <input type="hidden" name="id" value="${ldda.id}"/>
+ %if ldda.datatype.allow_datatype_change:
+ <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post">
+ <input type="hidden" name="id" value="${ldda.id}"/>
+ <div class="form-row">
+ <label>New Type:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${datatype( ldda, datatypes )}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ This will change the datatype of the existing dataset
+ but <i>not</i> modify its contents. Use this if Galaxy
+ has incorrectly guessed the type of your dataset.
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="change" value="Save"/>
+ </div>
+ </form>
+ %else:
<div class="form-row">
- <label>New Type:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${datatype( ldda, datatypes )}
- </div>
- <div class="toolParamHelp" style="clear: both;">
- This will change the datatype of the existing dataset
- but <i>not</i> modify its contents. Use this if Galaxy
- has incorrectly guessed the type of your dataset.
- </div>
- <div style="clear: both"></div>
+ <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div>
</div>
- <div class="form-row">
- <input type="submit" name="change" value="Save"/>
- </div>
- </form>
+ %endif
</div>
</div>
<p/>
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/904a72f5cf4c
changeset: 2514:904a72f5cf4c
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Thu Jul 30 15:03:53 2009 -0400
description:
Fix for trans.log_event when undeleting a history.
1 file(s) affected in this change:
lib/galaxy/web/controllers/history.py
diffs (12 lines):
diff -r 3574137cf7fb -r 904a72f5cf4c lib/galaxy/web/controllers/history.py
--- a/lib/galaxy/web/controllers/history.py Thu Jul 30 14:13:04 2009 -0400
+++ b/lib/galaxy/web/controllers/history.py Thu Jul 30 15:03:53 2009 -0400
@@ -166,7 +166,7 @@
default_permissions[ default_action ] = [ private_user_role ]
trans.app.security_agent.history_set_default_permissions( history, default_permissions )
n_undeleted += 1
- trans.log_event( "History (%s) %d marked as undeleted" % history.name )
+ trans.log_event( "History (%s) %d marked as undeleted" % ( history.name, history.id ) )
status = SUCCESS
message_parts = []
if n_undeleted:
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/3574137cf7fb
changeset: 2513:3574137cf7fb
user: Nate Coraor <nate(a)bx.psu.edu>
date: Thu Jul 30 14:13:04 2009 -0400
description:
Only require access permission to view private datasets at external sites.
1 file(s) affected in this change:
lib/galaxy/web/controllers/dataset.py
diffs (12 lines):
diff -r 315ac197ff33 -r 3574137cf7fb lib/galaxy/web/controllers/dataset.py
--- a/lib/galaxy/web/controllers/dataset.py Thu Jul 30 12:56:16 2009 -0400
+++ b/lib/galaxy/web/controllers/dataset.py Thu Jul 30 14:13:04 2009 -0400
@@ -144,7 +144,7 @@
redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] )
if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ):
return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac
- if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ):
+ if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ):
trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site )
return trans.response.send_redirect( redirect_url )
else:
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/315ac197ff33
changeset: 2512:315ac197ff33
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Thu Jul 30 12:56:16 2009 -0400
description:
Add a new flag -f/--force_retry to cleanup_datasets.py. This flag will cause the script to attempt to perform the requestion action on objects regardless if it has been performed before.
This is useful, i.e. if purge_datasets was called with out using --remove_from_disk, but it is later decided to remove these files: the purge_datasets script should be called with both -r and -f.
1 file(s) affected in this change:
scripts/cleanup_datasets/cleanup_datasets.py
diffs (162 lines):
diff -r ec59d6bcf827 -r 315ac197ff33 scripts/cleanup_datasets/cleanup_datasets.py
--- a/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:12:26 2009 -0400
+++ b/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:56:16 2009 -0400
@@ -24,6 +24,7 @@
parser.add_option( "-d", "--days", dest="days", action="store", type="int", help="number of days (60)", default=60 )
parser.add_option( "-r", "--remove_from_disk", action="store_true", dest="remove_from_disk", help="remove datasets from disk when purged", default=False )
parser.add_option( "-i", "--info_only", action="store_true", dest="info_only", help="info about the requested action", default=False )
+ parser.add_option( "-f", "--force_retry", action="store_true", dest="force_retry", help="performs the requested actions, but ignores whether it might have been done before. Useful when -r wasn't used, but should have been", default=False )
parser.add_option( "-1", "--delete_userless_histories", action="store_true", dest="delete_userless_histories", default=False, help="delete userless histories and datasets" )
@@ -73,28 +74,32 @@
print "# Datasets will NOT be removed from disk.\n"
if options.delete_userless_histories:
- delete_userless_histories( app, cutoff_time, info_only = options.info_only )
+ delete_userless_histories( app, cutoff_time, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_histories:
- purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_datasets:
- purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_libraries:
- purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
elif options.purge_folders:
- purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only )
+ purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry )
sys.exit(0)
-def delete_userless_histories( app, cutoff_time, info_only = False ):
+def delete_userless_histories( app, cutoff_time, info_only = False, force_retry = False ):
# Deletes userless histories whose update_time value is older than the cutoff_time.
# The purge history script will handle marking DatasetInstances as deleted.
# Nothing is removed from disk yet.
history_count = 0
print '# The following datasets and associated userless histories have been deleted'
start = time.clock()
- histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
- app.model.History.table.c.deleted==False,
- app.model.History.table.c.update_time < cutoff_time ) ).all()# \
+ if force_retry:
+ histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
+ app.model.History.table.c.update_time < cutoff_time ) ).all()
+ else:
+ histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None,
+ app.model.History.table.c.deleted==False,
+ app.model.History.table.c.update_time < cutoff_time ) ).all()
for history in histories:
if not info_only:
history.deleted = True
@@ -106,7 +111,7 @@
print "Elapsed time: ", stop - start, "\n"
-def purge_histories( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_histories( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted histories whose update_time is older than the cutoff_time.
# The dataset associations of each history are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -115,10 +120,15 @@
history_count = 0
print '# The following datasets and associated deleted histories have been purged'
start = time.clock()
- histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
- app.model.History.table.c.purged==False,
- app.model.History.table.c.update_time < cutoff_time ) ) \
- .options( eagerload( 'datasets' ) ).all()
+ if force_retry:
+ histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
+ app.model.History.table.c.update_time < cutoff_time ) ) \
+ .options( eagerload( 'datasets' ) ).all()
+ else:
+ histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True,
+ app.model.History.table.c.purged==False,
+ app.model.History.table.c.update_time < cutoff_time ) ) \
+ .options( eagerload( 'datasets' ) ).all()
for history in histories:
for dataset_assoc in history.datasets:
_purge_dataset_instance( dataset_assoc, app, remove_from_disk, info_only = info_only ) #mark a DatasetInstance as deleted, clear associated files, and mark the Dataset as deleted if it is deletable
@@ -136,7 +146,7 @@
print '# Purged %d histories.' % ( history_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted libraries whose update_time is older than the cutoff_time.
# The dataset associations of each library are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -145,9 +155,13 @@
library_count = 0
print '# The following libraries and associated folders have been purged'
start = time.clock()
- libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
- app.model.Library.table.c.purged==False,
- app.model.Library.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
+ app.model.Library.table.c.update_time < cutoff_time ) ).all()
+ else:
+ libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True,
+ app.model.Library.table.c.purged==False,
+ app.model.Library.table.c.update_time < cutoff_time ) ).all()
for library in libraries:
_purge_folder( library.root_folder, app, remove_from_disk, info_only = info_only )
if not info_only:
@@ -159,7 +173,7 @@
print '# Purged %d libraries .' % ( library_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_folders( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_folders( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ):
# Purges deleted folders whose update_time is older than the cutoff_time.
# The dataset associations of each folder are also marked as deleted.
# The Purge Dataset method will purge each Dataset as necessary
@@ -168,9 +182,13 @@
folder_count = 0
print '# The following folders have been purged'
start = time.clock()
- folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
- app.model.LibraryFolder.table.c.purged==False,
- app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
+ app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
+ else:
+ folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True,
+ app.model.LibraryFolder.table.c.purged==False,
+ app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all()
for folder in folders:
_purge_folder( folder, app, remove_from_disk, info_only = info_only )
print "%d" % folder.id
@@ -179,17 +197,22 @@
print '# Purged %d folders.' % ( folder_count ), '\n'
print "Elapsed time: ", stop - start, "\n"
-def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False ):
+def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False, repurge = False, force_retry = False ):
# Purges deleted datasets whose update_time is older than cutoff_time. Files may or may
# not be removed from disk.
dataset_count = 0
disk_space = 0
print '# The following deleted datasets have been purged'
start = time.clock()
- datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
- app.model.Dataset.table.c.purgable==True,
- app.model.Dataset.table.c.purged==False,
- app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
+ if force_retry:
+ datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
+ app.model.Dataset.table.c.purgable==True,
+ app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
+ else:
+ datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True,
+ app.model.Dataset.table.c.purgable==True,
+ app.model.Dataset.table.c.purged==False,
+ app.model.Dataset.table.c.update_time < cutoff_time ) ).all()
for dataset in datasets:
file_size = dataset.file_size
_purge_dataset( dataset, remove_from_disk, info_only = info_only )
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/ec59d6bcf827
changeset: 2511:ec59d6bcf827
user: Nate Coraor <nate(a)bx.psu.edu>
date: Thu Jul 30 12:12:26 2009 -0400
description:
Fix a problem introduced in db version 10 (MySQL's length limits prevent the creation of an index)
1 file(s) affected in this change:
lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py
diffs (55 lines):
diff -r fab59b1e756d -r ec59d6bcf827 lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py Thu Jul 30 12:12:26 2009 -0400
@@ -0,0 +1,51 @@
+from sqlalchemy import *
+from sqlalchemy.orm import *
+from sqlalchemy.exceptions import *
+from migrate import *
+from migrate.changeset import *
+
+import datetime
+now = datetime.datetime.utcnow
+
+import sys, logging
+log = logging.getLogger( __name__ )
+log.setLevel(logging.DEBUG)
+handler = logging.StreamHandler( sys.stdout )
+format = "%(name)s %(levelname)s %(asctime)s %(message)s"
+formatter = logging.Formatter( format )
+handler.setFormatter( formatter )
+log.addHandler( handler )
+
+# Need our custom types, but don't import anything else from model
+from galaxy.model.custom_types import *
+
+metadata = MetaData( migrate_engine )
+db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) )
+
+HistoryDatasetAssociationDisplayAtAuthorization_table = Table( "history_dataset_association_display_at_authorization", metadata,
+ Column( "id", Integer, primary_key=True ),
+ Column( "create_time", DateTime, default=now ),
+ Column( "update_time", DateTime, index=True, default=now, onupdate=now ),
+ Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ),
+ Column( "user_id", Integer, ForeignKey( "galaxy_user.id" ), index=True ),
+ Column( "site", TrimmedString( 255 ) ) )
+
+def upgrade():
+ if migrate_engine.name == 'mysql':
+ # Load existing tables
+ metadata.reflect()
+ i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id )
+ try:
+ i.create()
+ except Exception, e:
+ log.debug( "Adding index 'ix_hdadaa_history_dataset_association_id' to table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )
+
+def downgrade():
+ if migrate_engine.name == 'mysql':
+ # Load existing tables
+ metadata.reflect()
+ i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id )
+ try:
+ i.drop()
+ except Exception, e:
+ log.debug( "Removing index 'ix_hdadaa_history_dataset_association_id' from table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/fab59b1e756d
changeset: 2510:fab59b1e756d
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Thu Jul 30 12:06:24 2009 -0400
description:
Added fastqsanger data format and required bwa_wrapper to take only that format as input
9 file(s) affected in this change:
datatypes_conf.xml.sample
lib/galaxy/datatypes/registry.py
lib/galaxy/datatypes/sequence.py
lib/galaxy/datatypes/test/1.fastqsanger
lib/galaxy/datatypes/test/2.fastqsanger
test-data/1.fastqsanger
test-data/2.fastqsanger
test/functional/test_sniffing_and_metadata_settings.py
tools/sr_mapping/bwa_wrapper.xml
diffs (298 lines):
diff -r f06777cbd5bb -r fab59b1e756d datatypes_conf.xml.sample
--- a/datatypes_conf.xml.sample Thu Jul 30 11:05:03 2009 -0400
+++ b/datatypes_conf.xml.sample Thu Jul 30 12:06:24 2009 -0400
@@ -20,6 +20,7 @@
<datatype extension="fasta" type="galaxy.datatypes.sequence:Fasta" display_in_upload="true">
<converter file="fasta_to_tabular_converter.xml" target_datatype="tabular"/>
</datatype>
+ <datatype extension="fastqsanger" type="galaxy.datatypes.sequence:FastqSanger" display_in_upload="true"/>
<datatype extension="fastqsolexa" type="galaxy.datatypes.sequence:FastqSolexa" display_in_upload="true">
<converter file="fastqsolexa_to_fasta_converter.xml" target_datatype="fasta"/>
<converter file="fastqsolexa_to_qual_converter.xml" target_datatype="qualsolexa"/>
@@ -195,6 +196,7 @@
<sniffer type="galaxy.datatypes.qualityscore:QualityScore454"/>
<sniffer type="galaxy.datatypes.sequence:Fasta"/>
<sniffer type="galaxy.datatypes.sequence:FastqSolexa"/>
+ <sniffer type="galaxy.datatypes.sequence:FastqSanger"/>
<sniffer type="galaxy.datatypes.interval:Wiggle"/>
<sniffer type="galaxy.datatypes.images:Html"/>
<sniffer type="galaxy.datatypes.sequence:Axt"/>
diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/registry.py
--- a/lib/galaxy/datatypes/registry.py Thu Jul 30 11:05:03 2009 -0400
+++ b/lib/galaxy/datatypes/registry.py Thu Jul 30 12:06:24 2009 -0400
@@ -117,6 +117,7 @@
'customtrack' : interval.CustomTrack(),
'csfasta' : sequence.csFasta(),
'fasta' : sequence.Fasta(),
+ 'fastqsanger' : sequence.FastqSanger(),
'fastqsolexa' : sequence.FastqSolexa(),
'gff' : interval.Gff(),
'gff3' : interval.Gff3(),
@@ -144,6 +145,7 @@
'customtrack' : 'text/plain',
'csfasta' : 'text/plain',
'fasta' : 'text/plain',
+ 'fastqsanger' : 'text/plain',
'fastqsolexa' : 'text/plain',
'gff' : 'text/plain',
'gff3' : 'text/plain',
@@ -173,6 +175,7 @@
qualityscore.QualityScore454(),
sequence.Fasta(),
sequence.FastqSolexa(),
+ sequence.FastqSanger(),
interval.Wiggle(),
images.Html(),
sequence.Axt(),
diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/sequence.py
--- a/lib/galaxy/datatypes/sequence.py Thu Jul 30 11:05:03 2009 -0400
+++ b/lib/galaxy/datatypes/sequence.py Thu Jul 30 12:06:24 2009 -0400
@@ -176,16 +176,139 @@
except:
qscore_int = False
+ # check length and range of quality scores
if qscore_int:
if len( headers[3] ) != len( headers[1][0] ):
return False
+ if not self.check_qual_values_within_range(headers[3], 'int'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[7], 'int'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[11], 'int'):
+ return False
+ except IndexError:
+ pass
+ except IndexError:
+ pass
else:
if len( headers[3][0] ) != len( headers[1][0] ):
- return False
+ return False
+ if not self.check_qual_values_within_range(headers[3][0], 'char'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[7][0], 'char'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[11][0], 'char'):
+ return False
+ except IndexError:
+ pass
+ except IndexError:
+ pass
return True
return False
except:
return False
+ def check_qual_values_within_range( self, qual_seq, score_type ):
+ if score_type == 'char':
+ for val in qual_seq:
+ if ord(val) < 59 or ord(val) > 104:
+ return False
+ elif score_type == 'int':
+ for val in qual_seq:
+ if int(val) < -5 or int(val) > 40:
+ return False
+ return True
+
+
+class FastqSanger( Sequence ):
+ """Class representing a FASTQ sequence ( the Sanger variant )"""
+ file_ext = "fastqsanger"
+
+ def set_peek( self, dataset ):
+ if not dataset.dataset.purged:
+ dataset.peek = data.get_file_peek( dataset.file_name )
+ dataset.blurb = data.nice_size( dataset.get_size() )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+
+ def sniff( self, filename ):
+ """
+ Determines whether the file is in fastqsanger format (Sanger Variant)
+ For details, see http://maq.sourceforge.net/fastq.shtml
+
+ Note: There are two kinds of FASTQ files, known as "Sanger" (sometimes called "Standard") and Solexa
+ These differ in the representation of the quality scores
+
+ >>> fname = get_test_fname( '1.fastqsanger' )
+ >>> FastqSanger().sniff( fname )
+ True
+ >>> fname = get_test_fname( '2.fastqsanger' )
+ >>> FastqSanger().sniff( fname )
+ True
+ """
+ headers = get_headers( filename, None )
+ bases_regexp = re.compile( "^[NGTAC]*$" )
+ try:
+ if len( headers ) >= 4 and headers[0][0] and headers[0][0][0] == "@" and headers[2][0] and headers[2][0][0] == "+" and headers[1][0]:
+ # Check the sequence line, make sure it contains only G/C/A/T/N
+ if not bases_regexp.match( headers[1][0] ):
+ return False
+ # Check quality score: integer or ascii char.
+ try:
+ check = int(headers[3][0])
+ qscore_int = True
+ except:
+ qscore_int = False
+
+ # check length and range of quality scores
+ if qscore_int:
+ if len( headers[3] ) != len( headers[1][0] ):
+ return False
+ if not self.check_qual_values_within_range(headers[3], 'int'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[7], 'int'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[11], 'int'):
+ return False
+ except IndexError:
+ pass
+ except IndexError:
+ pass
+ else:
+ if len( headers[3][0] ) != len( headers[1][0] ):
+ return False
+ if not self.check_qual_values_within_range(headers[3][0], 'char'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[7][0], 'char'):
+ return False
+ try:
+ if not self.check_qual_values_within_range(headers[11][0], 'char'):
+ return False
+ except IndexError:
+ pass
+ except IndexError:
+ pass
+ return True
+ return False
+ except:
+ return False
+ def check_qual_values_within_range( self, qual_seq, score_type ):
+ if score_type == 'char':
+ for val in qual_seq:
+ if ord(val) >= 33 and ord(val) <= 126:
+ return True
+ elif score_type == 'int':
+ for val in qual_seq:
+ if int(val) >= 0 and int(val) <= 93:
+ return True
+ return False
try:
from galaxy import eggs
diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/1.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+><C&&9952+C>5<.?<79,=42<292:<(9/-7
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1,
\ No newline at end of file
diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/2.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/test/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11
\ No newline at end of file
diff -r f06777cbd5bb -r fab59b1e756d test-data/1.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+><C&&9952+C>5<.?<79,=42<292:<(9/-7
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1,
\ No newline at end of file
diff -r f06777cbd5bb -r fab59b1e756d test-data/2.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11
\ No newline at end of file
diff -r f06777cbd5bb -r fab59b1e756d test/functional/test_sniffing_and_metadata_settings.py
--- a/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 11:05:03 2009 -0400
+++ b/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 12:06:24 2009 -0400
@@ -216,6 +216,16 @@
assert latest_hda is not None, "Problem retrieving wig hda from the database"
if not latest_hda.name == '1.wig' and not latest_hda.extension == 'wig':
raise AssertionError, "wig data type was not correctly sniffed."
+ def test_085_fastqsanger_datatype( self ):
+ """Testing correctly sniffing fastqsanger ( the Sanger variant ) data type upon upload"""
+ self.upload_file( '1.fastqsanger' )
+ self.verify_dataset_correctness( '1.fastqsanger' )
+ self.check_history_for_string( '1.fastqsanger format: <span class="fastqsanger">fastqsanger</span>, database: \? Info: uploaded fastqsanger file' )
+ latest_hda = galaxy.model.HistoryDatasetAssociation.query() \
+ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first()
+ assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database"
+ if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger':
+ raise AssertionError, "fastqsanger data type was not correctly sniffed."
def test_9999_clean_up( self ):
self.delete_history( id=self.security.encode_id( history1.id ) )
self.logout()
diff -r f06777cbd5bb -r fab59b1e756d tools/sr_mapping/bwa_wrapper.xml
--- a/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 11:05:03 2009 -0400
+++ b/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 12:06:24 2009 -0400
@@ -71,7 +71,7 @@
<option value="history">Use one from the history</option>
</param>
<when value="history">
- <param name="ownFile" type="data" label="Select a reference genome" />
+ <param name="ownFile" type="data" format="fasta" label="Select a reference genome" />
</when>
<when value="indexed">
<param name="indices" type="select" label="Select a reference genome">
@@ -91,7 +91,7 @@
<option value="history">Use one from the history</option>
</param>
<when value="history">
- <param name="ownFile" type="data" label="Select a reference genome" />
+ <param name="ownFile" type="data" format="fasta" label="Select a reference genome" />
</when>
<when value="indexed">
<param name="indices" type="select" label="Select a reference genome">
@@ -111,11 +111,11 @@
<option value="paired">Paired-end</option>
</param>
<when value="single">
- <param name="input1" type="data" label="FASTQ file" />
+ <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
</when>
<when value="paired">
- <param name="input1" type="data" label="Forward FASTQ file" />
- <param name="input2" type="data" label="Reverse FASTQ file" />
+ <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
+ <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
</when>
</conditional>
<conditional name="params">
1
0
30 Jul '09
details: http://www.bx.psu.edu/hg/galaxy/rev/f06777cbd5bb
changeset: 2509:f06777cbd5bb
user: Dan Blankenberg <dan(a)bx.psu.edu>
date: Thu Jul 30 11:05:03 2009 -0400
description:
Add a new config setting to universe_wsgi.ini: new_user_dataset_access_role_default_private.
When set to True, new users will have default dataset access permissions for histories set to their Private role. Default is False (original behavior); datasets are left as public.
Resolves ticket #111.
4 file(s) affected in this change:
lib/galaxy/config.py
lib/galaxy/security/__init__.py
lib/galaxy/web/controllers/user.py
universe_wsgi.ini.sample
diffs (58 lines):
diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/config.py
--- a/lib/galaxy/config.py Tue Jul 28 14:16:19 2009 -0400
+++ b/lib/galaxy/config.py Thu Jul 30 11:05:03 2009 -0400
@@ -46,6 +46,7 @@
self.require_login = string_as_bool( kwargs.get( "require_login", "False" ) )
self.allow_user_creation = string_as_bool( kwargs.get( "allow_user_creation", "True" ) )
self.allow_user_deletion = string_as_bool( kwargs.get( "allow_user_deletion", "False" ) )
+ self.new_user_dataset_access_role_default_private = string_as_bool( kwargs.get( "new_user_dataset_access_role_default_private", "False" ) )
self.template_path = resolve_path( kwargs.get( "template_path", "templates" ), self.root )
self.template_cache = resolve_path( kwargs.get( "template_cache_path", "database/compiled_templates" ), self.root )
self.local_job_queue_workers = int( kwargs.get( "local_job_queue_workers", "5" ) )
diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/security/__init__.py
--- a/lib/galaxy/security/__init__.py Tue Jul 28 14:16:19 2009 -0400
+++ b/lib/galaxy/security/__init__.py Thu Jul 30 11:05:03 2009 -0400
@@ -206,12 +206,16 @@
else:
return None
return role
- def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False ):
+ def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False, default_access_private = False ):
# bypass_manage_permission is used to change permissions of datasets in a userless history when logging in
if user is None:
return None
if not permissions:
- permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] }
+ #default permissions
+ permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] }
+ #new_user_dataset_access_role_default_private is set as True in config file
+ if default_access_private:
+ permissions[ self.permitted_actions.DATASET_ACCESS ] = permissions.values()[ 0 ]
# Delete all of the current default permissions for the user
for dup in user.default_permissions:
dup.delete()
diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/web/controllers/user.py
--- a/lib/galaxy/web/controllers/user.py Tue Jul 28 14:16:19 2009 -0400
+++ b/lib/galaxy/web/controllers/user.py Thu Jul 30 11:05:03 2009 -0400
@@ -157,7 +157,7 @@
user.flush()
trans.app.security_agent.create_private_user_role( user )
# We set default user permissions, before we log in and set the default history permissions
- trans.app.security_agent.user_set_default_permissions( user )
+ trans.app.security_agent.user_set_default_permissions( user, default_access_private = trans.app.config.new_user_dataset_access_role_default_private )
# The handle_user_login() method has a call to the history_set_default_permissions() method
# (needed when logging in with a history), user needs to have default permissions set before logging in
trans.handle_user_login( user )
diff -r e01bfc281e09 -r f06777cbd5bb universe_wsgi.ini.sample
--- a/universe_wsgi.ini.sample Tue Jul 28 14:16:19 2009 -0400
+++ b/universe_wsgi.ini.sample Thu Jul 30 11:05:03 2009 -0400
@@ -156,6 +156,9 @@
# Can an admin user delete user accounts?
#allow_user_deletion = False
+# Should default dataset access permissions be private for new users; default is False (datasets are public)
+new_user_dataset_access_role_default_private = False
+
# ---- Job Execution --------------------------------------------------------
# Number of concurrent jobs to run (local job runner)
1
0