galaxy-commits
Threads by month
- ----- 2026 -----
- July
- June
- May
- April
- March
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
November 2010
- 1 participants
- 286 discussions
galaxy-dist commit 081ce300b688: porocessTaxonomynow removes parenthesis fixing various tree drawing issues in metagenomic tools. Major rework of MG tools needed to ensure reproducibility
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Anton Nekrutenko <anton(a)bx.psu.edu>
# Date 1289402232 18000
# Node ID 081ce300b688968521edd30f25a020d96999cd64
# Parent 0e3fe3e7b21bfd78461869817c6b43db827d77f0
porocessTaxonomynow removes parenthesis fixing various tree drawing issues in metagenomic tools. Major rework of MG tools needed to ensure reproducibility
--- a/test/functional/test_sample_tracking.py
+++ b/test/functional/test_sample_tracking.py
@@ -388,6 +388,7 @@ class TestFormsAndRequests( TwillTestCas
% ( request_two.name, request_two.states.REJECTED )
def test_055_reset_data_for_later_test_runs( self ):
"""Reseting data to enable later test runs to pass"""
+ '''
# Logged in as admin_user
##################
# Delete request_type permissions
@@ -432,3 +433,4 @@ class TestFormsAndRequests( TwillTestCas
# Manually delete the group from the database
refresh( group )
delete( group )
+ '''
--- a/static/welcome.html
+++ b/static/welcome.html
@@ -2,20 +2,211 @@
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"><head>
- <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
- <link rel="stylesheet" href="style/base.css" type="text/css" />
+<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
+<meta name="generator" content="Docutils 0.3.9: http://docutils.sourceforge.net/" />
+<link rel="stylesheet" href="style/base.css" type="text/css" />
+<style type="text/css">
+
+ .quickie {
+ text-align: center;
+ background: black;
+ margin: 10px;
+ }
+
+ .current-quickie {
+ width: 300px;
+ background: white;
+ margin: auto;
+ }
+
+ .current-quickie img {
+ padding: 15px;
+ border: 1px solid #ccc;
+ margin: auto;
+ background-color: white;
+ -moz-border-radius:4px;
+ -webkit-border-radius:4px;
+
+ }
+
+ .previous {
+ width: 100%;
+ overflow: auto;
+ border: solid #ccc 1px;
+ -moz-border-radius:4px;
+ -webkit-border-radius:4px;
+
+ }
+ .previous .quickie {
+ padding-top: 10px;
+ min-height: 90px;
+ min-width: 150px;
+ }
+ #screencasts {
+ max-width: 50em;
+ margin-left: auto;
+ margin-right: auto;
+ }
+
+</style>
+<script type="text/javascript" src="http://galaxy.psu.edu/welcome_img/jquery.min.js"></script>
+<script type="text/javascript" src="http://galaxy.psu.edu/welcome_img/jquery.cycle.all.2.72.js"></script>
+<script type="text/javascript">
+
+$(document).ready(function() {
+ $('.current-quickie').cycle({
+ fx: 'fade',
+ pause: 1,
+ timeout: 1000,
+ speed: 1000
+ });
+});
+</script></head><body>
- <div class="document">
- <div class="donemessagelarge">
- <strong>Hello world! It's running...</strong>
- <hr>
- To customize this page edit <code>static/welcome.html</code>
- </div>
- <br/>
- <img src="images/noodles.png" alt="WWFSMD?" style="display: block; margin-left: auto; margin-right: auto;" />
- <hr/>
- This project is supported in part by <a target="_blank" class="reference" href="http://www.nsf.gov">NSF</a>, <a target="_blank" class="reference" href="http://www.genome.gov">NHGRI</a>, and <a target="_blank" class="reference" href="http://www.huck.psu.edu">the Huck Institutes of the Life Sciences</a>.
- </div>
+<div class="document">
+<h3 align="center">Here is what's happening...</h3>
+<div align="center" class="current-quickie">
+ <a target="_blank" href="http://usegalaxy.org/cloud"><img src="http://galaxy.psu.edu/welcome_img/welcome_images.001.png" width="300" height="200"></a>
+ <a target="_blank" href="http://bitbucket.org/galaxy/galaxy-central/wiki/ISMB2010_GalaxyTutorial_3_R…"><img src="http://galaxy.psu.edu/welcome_img/welcome_images.002.png" width="300" height="200"></a>
+ <a target="_blank" href="http://main.g2.bx.psu.edu/u/aun1/p/ismb2010-demo"><img src="http://galaxy.psu.edu/welcome_img/welcome_images.003.png" width="300" height="200" /></a>
+ <a target="_blank" href="http://bitbucket.org/galaxy/galaxy-central/wiki/DataLibraries/Tutorial/Data…"><img src="http://galaxy.psu.edu/welcome_img/welcome_images.004.png" width="300" height="200" /></a>
+ <a target="_blank" href="http://main.g2.bx.psu.edu/u/aun1/p/windshield-splatter"><img src="http://galaxy.psu.edu/welcome_img/welcome_images.005.png" width="300" height="200" /></a>
+</div>
+
+<h3 align="center">Live Quickies</h3>
+
+<div class="previous" id="previous">
+ <table border="0" cellpadding="0" cellspacing="0" width="100%">
+ <tr>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie1_TabSeq/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie1_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie2_Grouping/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie2_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie3_Intervals/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie3_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie4_whatsNew/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie4_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie5_join/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie5_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie6_share/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie6_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie7_sr_beta/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie7_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie8_solid_single_end/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie8_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie9_solid_mate_pair/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie9_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie10_custom_genome/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie10_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie_11_illumina_se/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie11_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie12_illumina_pe/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie12_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie_13_fastq_basic/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie13_small.png" border="0">
+ </div>
+ </a>
+ </td>
+
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie_14_fastq_adv/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie14_small.png" border="0">
+ </div>
+ </a>
+ </td>
+ <td>
+ <a href="javascript:parent.show_in_overlay({url:'http://screencast.g2.bx.psu.edu/galaxy/quickie_15_lastz_frag/flow.html',width:640,height:480,scroll:'no'})">
+ <div class="quickie">
+ <img src="images/qk/quickie15_small.png" border="0">
+ </div>
+ </a>
+ </td>
+
+
+
+ </tr>
+ </table>
+</div>
+
+<script type="text/javascript">
+ // Scroll to last quickie in box
+ document.getElementById("previous").scrollLeft = 100000000;
+</script>
+
+<br/>
+<br/>
+<br/>
+<hr/>
+
+<p><a target="_blank" class="reference" href="http://g2.trac.bx.psu.edu/wiki/GalaxyTeam">The Galaxy team</a> is a part of <a target="_blank" class="reference" href="http://www.bx.psu.edu">BX</a> at <a target="_blank" class="reference" href="http://www.psu.edu">Penn State</a>.</p>
+
+This project is supported in part by <a target="_blank" class="reference" href="http://www.nsf.gov">NSF</a>, <a target="_blank" class="reference" href="http://www.genome.gov">NHGRI</a>, <a target="_blank" class="reference" href="http://www.huck.psu.edu">The Huck Institutes of the Life Sciences</a>, and <a target="_blank" class="reference" href="http://www.ics.psu.edu">The Institute for CyberScience at Penn State</a>.
+<p><small>Galaxy build: <b>$Rev 3885:1ab9d6b0ddfc$</b></small></p>
+</div>
+</div></body></html>
--- a/scripts/taxonomy/processTaxonomy.sh
+++ b/scripts/taxonomy/processTaxonomy.sh
@@ -10,5 +10,9 @@ cat gi_taxid_nucl.dmp gi_taxid_prot.dmp
echo "Sorting gi2tax files..."
sort -n -k 1 gi_taxid_all.dmp > gi_taxid_sorted.txt
rm gi_taxid_nucl.dmp gi_taxid_prot.dmp gi_taxid_all.dmp
+echo "Removing parenthesis from names.dmp"
+cat names.dmp | sed s/\(/_/g | sed s/\)/_/g > names.temporary
+mv names.dmp names.dmp.orig
+mv names.temporary names.dmp
1
0
galaxy-dist commit a77b2888759e: Streamline the sample tracking UI in selecting and transferring sample datasets.
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Greg Von Kuster <greg(a)bx.psu.edu>
# Date 1289275808 18000
# Node ID a77b2888759e94861252ca65437e11ec298b3058
# Parent 2875445df9906828bc804e9b0923160f902b3fac
Streamline the sample tracking UI in selecting and transferring sample datasets.
--- a/templates/requests/common/sample_datasets.mako
+++ b/templates/requests/common/sample_datasets.mako
@@ -1,5 +1,5 @@
<%def name="render_sample_datasets( sample )">
- ${len( sample.transferred_dataset_files )} / ${len( sample.datasets )}
+ ${len( sample.datasets )} / ${len( sample.transferred_dataset_files )}
</%def>
${render_sample_datasets( sample )}
--- /dev/null
+++ b/templates/admin/requests/view_sample_dataset.mako
@@ -0,0 +1,72 @@
+<%inherit file="/base.mako"/>
+<%namespace file="/message.mako" import="render_msg" />
+
+%if message:
+ ${render_msg( message, status )}
+%endif
+
+<br/><br/>
+
+<%
+ sample = sample_dataset.sample
+ is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
+ can_manage_datasets = is_admin and sample.untransferred_dataset_files
+%>
+
+<ul class="manage-table-actions">
+ %if can_manage_datasets:
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='manage_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">Manage sample datasets</a></li>
+ %endif
+ <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller=cntrller, id=trans.security.encode_id( sample.request.id ) )}">Browse this request</a></li>
+</ul>
+
+<div class="toolForm">
+ <div class="toolFormTitle">"${sample.name}" Dataset</div>
+ <div class="toolFormBody">
+ <div class="form-row">
+ <label>Name:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${sample_dataset.name}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <label>File path:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${sample_dataset.file_path}
+ </div>
+ <div class="toolParamHelp" style="clear: both;">
+ This file is contained in a sub-directory of the data directory configured for the sequencer.
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <label>Size:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${sample_dataset.size}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <label>Date this dataset was selected for this sample:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${sample_dataset.create_time}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ <div class="form-row">
+ <label>Transfer status:</label>
+ <div style="float: left; width: 250px; margin-right: 10px;">
+ ${sample_dataset.status}
+ </div>
+ <div style="clear: both"></div>
+ </div>
+ %if sample_dataset.status == trans.app.model.SampleDataset.transfer_status.ERROR:
+ <div class="form-row">
+ <label>Transfer error:</label>
+ ${sample_dataset.error_msg}
+ </div>
+ <div style="clear: both"></div>
+ %endif
+ </div>
+</div>
--- a/templates/admin/requests/get_data.mako
+++ /dev/null
@@ -1,114 +0,0 @@
-<%inherit file="/base.mako"/>
-<%namespace file="/message.mako" import="render_msg" />
-${h.js( "ui.core", "jquery.cookie" )}
-<link href='/static/june_2007_style/blue/dynatree_skin/ui.dynatree.css' rel='stylesheet' type='text/css'>
-${h.js( "jquery.dynatree" )}
-
-<script type="text/javascript">
- $(function(){
- $("#tree").ajaxComplete(function(event, XMLHttpRequest, ajaxOptions) {
- _log("debug", "ajaxComplete: %o", this); // dom element listening
- });
- // --- Initialize sample trees
- $("#tree").dynatree({
- title: "${request.type.datatx_info['data_dir']}",
- rootVisible: true,
- minExpandLevel: 0, // 1: root node is not collapsible
- persist: false,
- checkbox: true,
- selectMode: 3,
- onPostInit: function(isReloading, isError) {
-// alert("reloading: "+isReloading+", error:"+isError);
- logMsg("onPostInit(%o, %o) - %o", isReloading, isError, this);
- // Re-fire onActivate, so the text is updated
- this.reactivate();
- },
- fx: { height: "toggle", duration: 200 },
- // initAjax is hard to fake, so we pass the children as object array:
- initAjax: {url: "${h.url_for( controller='requests_admin', action='open_folder' )}",
- dataType: "json",
- data: { id: "${request.id}", key: "${request.type.datatx_info['data_dir']}" },
- },
- onLazyRead: function(dtnode){
- dtnode.appendAjax({
- url: "${h.url_for( controller='requests_admin', action='open_folder' )}",
- dataType: "json",
- data: { id: "${request.id}", key: dtnode.data.key },
- });
- },
- onSelect: function(select, dtnode) {
- // Display list of selected nodes
- var selNodes = dtnode.tree.getSelectedNodes();
- // convert to title/key array
- var selKeys = $.map(selNodes, function(node){
- return node.data.key;
- });
- document.get_data.selected_files.value = selKeys.join(",")
- },
- onActivate: function(dtnode) {
- var cell = $("#file_details");
- var selected_value = dtnode.data.key
- if(selected_value.charAt(selected_value.length-1) != '/') {
- // Make ajax call
- $.ajax( {
- type: "POST",
- url: "${h.url_for( controller='requests_admin', action='get_file_details' )}",
- dataType: "json",
- data: { id: "${request.id}", folder_path: dtnode.data.key },
- success : function ( data ) {
- cell.html( '<label>'+data+'</label>' )
- }
- });
- } else {
- cell.html( '' )
- }
- },
- });
- });
-
-</script>
-
-<br/>
-<br/>
-<ul class="manage-table-actions">
- <li>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='view_request_type', id=trans.security.encode_id( request.type.id ) )}">Sequencer configuration "${request.type.name}"</a>
- </li>
- <li>
- <a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Browse this request</a>
- </li>
-</ul>
-
-%if message:
- ${render_msg( message, status )}
-%endif
-
-<div class="toolForm">
- <div class="toolFormTitle">Select files for transfer</div>
- <form name="get_data" id="get_data" action="${h.url_for( controller='requests_admin', action='get_data', cntrller=cntrller, request_id=trans.security.encode_id( request.id ))}" method="post" >
- <div class="form-row">
- <label>Sample:</label>
- ${sample_id_select_field.get_html()}
- <div class="toolParamHelp" style="clear: both;">
- Select the sample with which you want to associate the datasets
- </div>
- </div>
- <div class="form-row" >
- <label>Select dataset files in the sequencer:</label>
- <div id="tree" >
- Loading...
- </div>
- <input id="selected_files" name="selected_files" type="hidden" size=40"/>
- <div class="toolParamHelp" style="clear: both;">
- To select a folder, select all the individual files in that folder.
- </div>
- </div>
- <div class="form-row">
- <div id="file_details" class="toolParamHelp" style="clear: both;background-color:#FAFAFA;"></div>
- </div>
- <div class="form-row">
- <input type="submit" name="select_show_datasets_button" value="Select & show datasets"/>
- <input type="submit" name="select_more_button" value="Select more"/>
- </div>
- </form>
-</div>
--- a/lib/galaxy/web/controllers/requests_common.py
+++ b/lib/galaxy/web/controllers/requests_common.py
@@ -58,7 +58,7 @@ class RequestsGrid( grids.Grid ):
columns = [
NameColumn( "Name",
key="name",
- link=( lambda item: iff( item.deleted, None, dict( operation="view_request", id=item.id ) ) ),
+ link=( lambda item: dict( operation="view_request", id=item.id ) ),
attach_popup=True,
filterable="advanced" ),
DescriptionColumn( "Description",
@@ -318,11 +318,10 @@ class RequestsCommon( BaseController, Us
trans.sa_session.flush()
trans.sa_session.refresh( request )
# Create an event with state 'New' for this new request
+ comment = "Request created by %s" % trans.user.email
if request.user != trans.user:
- sample_event_comment = "Request created by user %s for user %s." % ( trans.user.email, request.user.email )
- else:
- sample_event_comment = "Request created."
- event = trans.model.RequestEvent( request, request.states.NEW, sample_event_comment )
+ comment += " on behalf of %s." % request.user.email
+ event = trans.model.RequestEvent( request, request.states.NEW, comment )
trans.sa_session.add( event )
trans.sa_session.flush()
else:
@@ -361,11 +360,10 @@ class RequestsCommon( BaseController, Us
status='error',
message=message ) )
# Change the request state to 'Submitted'
- if request.user.email is not trans.user:
- sample_event_comment = "Request submitted by %s on behalf of %s." % ( trans.user.email, request.user.email )
- else:
- sample_event_comment = ""
- event = trans.model.RequestEvent( request, request.states.SUBMITTED, sample_event_comment )
+ comment = "Request submitted by %s" % trans.user.email
+ if request.user != trans.user:
+ comment += " on behalf of %s." % request.user.email
+ event = trans.model.RequestEvent( request, request.states.SUBMITTED, comment )
trans.sa_session.add( event )
# Change the state of each of the samples of this request
# request.type.states is the list of SampleState objects configured
@@ -511,23 +509,39 @@ class RequestsCommon( BaseController, Us
id_list = util.listify( kwd.get( 'id', '' ) )
message = util.restore_text( params.get( 'message', '' ) )
status = util.restore_text( params.get( 'status', 'done' ) )
+ is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
num_deleted = 0
+ not_deleted = []
for id in id_list:
ok_for_now = True
try:
+ # This block will handle bots that do not send valid request ids.
request = trans.sa_session.query( trans.model.Request ).get( trans.security.decode_id( id ) )
except:
ok_for_now = False
if ok_for_now:
- request.deleted = True
- trans.sa_session.add( request )
- # Delete all the samples belonging to this request
- for s in request.samples:
- s.deleted = True
- trans.sa_session.add( s )
- trans.sa_session.flush()
- num_deleted += 1
+ # We will only allow the request to be deleted by a non-admin user if not request.submitted
+ if is_admin or not request.is_submitted:
+ request.deleted = True
+ trans.sa_session.add( request )
+ # Delete all the samples belonging to this request
+ for s in request.samples:
+ s.deleted = True
+ trans.sa_session.add( s )
+ comment = "Request marked deleted by %s." % trans.user.email
+ # There is no DELETED state for a request, so keep the current request state
+ event = trans.model.RequestEvent( request, request.state, comment )
+ trans.sa_session.add( event )
+ trans.sa_session.flush()
+ num_deleted += 1
+ else:
+ not_deleted.append( request )
message += '%i requests have been deleted.' % num_deleted
+ if not_deleted:
+ message += ' Contact the administrator to delete the following submitted requests: '
+ for request in not_deleted:
+ message += '%s, ' % request.name
+ message = message.rstrip( ', ' )
return trans.response.send_redirect( web.url_for( controller=cntrller,
action='browse_requests',
status=status,
@@ -543,6 +557,7 @@ class RequestsCommon( BaseController, Us
for id in id_list:
ok_for_now = True
try:
+ # This block will handle bots that do not send valid request ids.
request = trans.sa_session.query( trans.model.Request ).get( trans.security.decode_id( id ) )
except:
ok_for_now = False
@@ -553,6 +568,9 @@ class RequestsCommon( BaseController, Us
for s in request.samples:
s.deleted = False
trans.sa_session.add( s )
+ comment = "Request marked undeleted by %s." % trans.user.email
+ event = trans.model.RequestEvent( request, request.state, comment )
+ trans.sa_session.add( event )
trans.sa_session.flush()
num_undeleted += 1
message += '%i requests have been undeleted.' % num_undeleted
@@ -651,7 +669,7 @@ class RequestsCommon( BaseController, Us
# If the current request state is complete and one of its samples moved from
# the final sample state, then move the request state to In-progress
if request.is_complete:
- message = "At least 1 sample state moved from the final sample state, so now the request is in the '%s' state" % request.states.SUBMITTED
+ message = "At least 1 sample state moved from the final sample state, so now the request's state is (%s)" % request.states.SUBMITTED
event = trans.model.RequestEvent( request, request.states.SUBMITTED, message )
trans.sa_session.add( event )
trans.sa_session.flush()
@@ -668,13 +686,13 @@ class RequestsCommon( BaseController, Us
request_type_state = request.type.final_sample_state
if common_state.id == request_type_state.id:
# since all the samples are in the final state, change the request state to 'Complete'
- comments = "All samples of this request are in the last sample state (%s). " % request_type_state.name
+ comment = "All samples of this request are in the final sample state (%s). " % request_type_state.name
state = request.states.COMPLETE
final_state = True
else:
- comments = "All samples are in %s state. " % common_state.name
+ comment = "All samples of this request are in the (%s) sample state. " % common_state.name
state = request.states.SUBMITTED
- event = trans.model.RequestEvent( request, state, comments )
+ event = trans.model.RequestEvent( request, state, comment )
trans.sa_session.add( event )
trans.sa_session.flush()
# See if an email notification is configured to be sent when the samples
@@ -879,7 +897,10 @@ class RequestsCommon( BaseController, Us
message=message ) )
@web.expose
@web.require_login( "view data transfer page" )
- def view_dataset_transfer( self, trans, cntrller, **kwd ):
+ def view_selected_datasets( self, trans, cntrller, **kwd ):
+ # The link on the number of selected datasets will only appear if there is at least 1 selected dataset.
+ # If there are 0 selected datasets, there is no link, so this method will only be reached from the requests
+ # controller if there are selected datasets.
params = util.Params( kwd )
message = util.restore_text( params.get( 'message', '' ) )
status = params.get( 'status', 'done' )
@@ -890,9 +911,9 @@ class RequestsCommon( BaseController, Us
except:
return invalid_id_redirect( trans, cntrller, sample_id )
# See if a library and folder have been set for this sample.
- if not sample.library or not sample.folder:
+ if is_admin and not sample.library or not sample.folder:
status = 'error'
- message = "Set a data library and folder for sequencing request (%s) to transfer datasets." % sample.name
+ message = "Select a target data library and folder for the sample before selecting the datasets."
return trans.response.send_redirect( web.url_for( controller='requests_common',
action='edit_samples',
cntrller=cntrller,
@@ -900,11 +921,6 @@ class RequestsCommon( BaseController, Us
editing_samples=True,
status=status,
message=message ) )
- if is_admin:
- return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='manage_datasets',
- sample_id=sample_id ) )
-
folder_path = util.restore_text( params.get( 'folder_path', '' ) )
if not folder_path:
if len( sample.datasets ):
@@ -917,11 +933,10 @@ class RequestsCommon( BaseController, Us
or not sample.request.type.datatx_info['username'] \
or not sample.request.type.datatx_info['password']:
status = 'error'
- message = 'The sequencer login information is incomplete. Click on sequencer information to add login details.'
- return trans.fill_template( '/requests/common/dataset_transfer.mako',
+ message = 'The sequencer login information is incomplete. Click sequencer information to add login details.'
+ return trans.fill_template( '/requests/common/view_selected_datasets.mako',
cntrller=cntrller,
- sample=sample,
- dataset_files=sample.datasets,
+ sample=sample,
message=message,
status=status,
files=[],
@@ -1063,9 +1078,8 @@ class RequestsCommon( BaseController, Us
# See if all the samples' barcodes are in the same state, and if so send email if configured to.
common_state = request.samples_have_common_state
if common_state and common_state.id == request.type.states[1].id:
- event = trans.model.RequestEvent( request,
- request.states.SUBMITTED,
- "All samples are in %s state." % common_state.name )
+ comment = "All samples of this request are in the (%s) sample state. " % common_state.name
+ event = trans.model.RequestEvent( request, request.states.SUBMITTED, comment )
trans.sa_session.add( event )
trans.sa_session.flush()
request.send_email_notification( trans, request.type.states[1] )
--- a/lib/galaxy/model/__init__.py
+++ b/lib/galaxy/model/__init__.py
@@ -1595,7 +1595,7 @@ class Request( object ):
states = Bunch( NEW = 'New',
SUBMITTED = 'In Progress',
REJECTED = 'Rejected',
- COMPLETE = 'Complete' )
+ COMPLETE = 'Complete' )
api_collection_visible_keys = ( 'id', 'name', 'state' )
def __init__( self, name=None, desc=None, request_type=None, user=None, form_values=None, notification=None ):
self.name = name
@@ -1813,17 +1813,21 @@ class Sample( object ):
if dataset.status == SampleDataset.transfer_status.COMPLETE:
transferred_datasets.append( dataset )
return transferred_datasets
- def dataset_size( self, filepath ):
- def print_ticks(d):
+ def get_untransferred_dataset_size( self, filepath ):
+ # TODO: RC: If rsh keys are not set, this method will return something like the following:
+ # greg(a)scofield.bx.psu.edu's password: 46M /afs/bx.psu.edu/home/greg/chr22/chr21.fa
+ # This method should return the number of bytes in the file. I believe du
+ # displays the file system block usage which may not be the number of bytes in the file.
+ # Would ls -l be better?
+ def print_ticks( d ):
pass
datatx_info = self.request.type.datatx_info
- cmd = 'ssh %s@%s "du -sh \'%s\'"' % ( datatx_info['username'],
- datatx_info['host'],
- filepath)
- output = pexpect.run(cmd, events={'.ssword:*': datatx_info['password']+'\r\n',
- pexpect.TIMEOUT:print_ticks},
- timeout=10)
- return output.replace(filepath, '').strip()
+ cmd = 'ssh %s@%s "du -sh \'%s\'"' % ( datatx_info['username'], datatx_info['host'], filepath )
+ output = pexpect.run( cmd,
+ events={ '.ssword:*': datatx_info['password']+'\r\n',
+ pexpect.TIMEOUT:print_ticks},
+ timeout=10 )
+ return output.replace( filepath, '' ).strip()
def get_api_value( self, view='collection' ):
rval = {}
try:
@@ -1856,8 +1860,7 @@ class SampleDataset( object ):
ADD_TO_LIBRARY = 'Adding to data library',
COMPLETE = 'Complete',
ERROR = 'Error' )
- def __init__(self, sample=None, name=None, file_path=None,
- status=None, error_msg=None, size=None):
+ def __init__( self, sample=None, name=None, file_path=None, status=None, error_msg=None, size=None):
self.sample = sample
self.name = name
self.file_path = file_path
@@ -1866,9 +1869,9 @@ class SampleDataset( object ):
self.size = size
class UserAddress( object ):
- def __init__(self, user=None, desc=None, name=None, institution=None,
- address=None, city=None, state=None, postal_code=None,
- country=None, phone=None):
+ def __init__( self, user=None, desc=None, name=None, institution=None,
+ address=None, city=None, state=None, postal_code=None,
+ country=None, phone=None ):
self.user = user
self.desc = desc
self.name = name
--- a/templates/admin/requests/rename_datasets.mako
+++ b/templates/admin/requests/rename_datasets.mako
@@ -6,19 +6,14 @@
<h3>Rename datasets for Sample "${sample.name}"</h3><ul class="manage-table-actions">
- <li>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='manage_datasets', sample_id=trans.security.encode_id( sample.id ) )}">Browse datasets</a>
- </li>
- <li>
- <a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller='requests_admin', id=trans.security.encode_id( sample.request.id ) )}">Browse this request</a>
- </li>
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='manage_datasets', sample_id=trans.security.encode_id( sample.id ) )}">Browse datasets</a></li>
+ <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller='requests_admin', id=trans.security.encode_id( sample.request.id ) )}">Browse this request</a></li></ul>
%if message:
${render_msg( message, status )}
%endif
-${render_msg( 'A dataset can be renamed only if it is in <b>Not Started</b> state.', 'warning' )}
<div class="toolForm"><form name="rename_datasets" id="rename_datasets" action="${h.url_for( controller='requests_admin', action='rename_datasets', id_list=id_list, sample_id=trans.security.encode_id( sample.id ) )}" method="post" ><table class="grid">
--- a/templates/requests/common/find_samples.mako
+++ b/templates/requests/common/find_samples.mako
@@ -71,7 +71,7 @@
%else:
State: ${sample.state.name}<br/>
%endif
- Datasets: <a href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.transferred_dataset_files )}/${len( sample.datasets )}</a><br/>
+ Datasets: <a href="${h.url_for( controller='requests_common', action='view_selected_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.transferred_dataset_files )}/${len( sample.datasets )}</a><br/>
%if is_admin:
<i>User: ${sample.request.user.email}</i>
%endif
--- /dev/null
+++ b/templates/requests/common/view_selected_datasets.mako
@@ -0,0 +1,37 @@
+<%inherit file="/base.mako"/>
+<%namespace file="/message.mako" import="render_msg" />
+<%namespace file="/requests/common/common.mako" import="render_sample_datasets" />
+
+<%
+ is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
+ is_complete = sample.request.is_complete
+ is_submitted = sample.request.is_submitted
+ can_select_datasets = is_admin and ( is_complete or is_submitted )
+ can_transfer_datasets = is_admin and sample.untransferred_dataset_files
+%>
+
+<br/><br/>
+
+<ul class="manage-table-actions">
+ %if can_transfer_datasets:
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='manage_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">Transfer datasets</a></li>
+ %endif
+ <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_selected_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">Refresh page</a></li>
+ <li><a class="action-button" id="sample-${sample.id}-popup" class="menubutton">Dataset Actions</a></li>
+ <div popupmenu="sample-${sample.id}-popup">
+ %if can_select_datasets:
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', cntrller=cntrller, request_id=trans.security.encode_id( sample.request.id ), sample_id=trans.security.encode_id( sample.id ) )}">Select more datasets</a></li>
+ %endif
+ <li><a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( sample.library.id ) )}">View target Data Library</a></li>
+ <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller=cntrller, id=trans.security.encode_id( sample.request.id ) )}">Browse this request</a></li>
+ </div>
+</ul>
+
+%if message:
+ ${render_msg( message, status )}
+%endif
+
+%if sample and sample.datasets:
+ <% title = 'Datasets currently selected for "sample.name"' %>
+ ${render_sample_datasets( cntrller, sample, sample.datasets, title )}
+%endif
--- a/templates/requests/common/dataset_transfer.mako
+++ /dev/null
@@ -1,46 +0,0 @@
-<%inherit file="/base.mako"/>
-<%namespace file="/message.mako" import="render_msg" />
-
-<br/><br/>
-
-<ul class="manage-table-actions">
- <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">Refresh</a></li>
- <li><a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( sample.library.id ) )}">Target Data Library</a></li>
- <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller=cntrller, id=trans.security.encode_id( sample.request.id ) )}">Browse this request</a></li>
-</ul>
-
-%if message:
- ${render_msg( message, status )}
-%endif
-
-<div class="toolForm">
- <div class="toolFormTitle">Sample "${sample.name}"</div>
- <div class="toolFormBody">
- %if dataset_files:
- <div class="form-row">
- <table class="grid">
- <thead>
- <tr>
- <th>Name</th>
- <th>Size</th>
- <th>Status</th>
- </tr>
- <thead>
- <tbody>
- %for dataset_file in dataset_files:
- <tr>
- <td>${dataset_file.name}</td>
- <td>${dataset_file.size}</td>
- <td>${dataset_file.status}</td>
- </tr>
- %endfor
- </tbody>
- </table>
- </div>
- %else:
- <div class="form-row">
- There are no datasets associated with this sample.
- </div>
- %endif
- </div>
-</div>
--- /dev/null
+++ b/templates/admin/requests/select_datasets_to_transfer.mako
@@ -0,0 +1,133 @@
+<%inherit file="/base.mako"/>
+<%namespace file="/message.mako" import="render_msg" />
+<%namespace file="/requests/common/common.mako" import="render_sample_datasets" />
+
+${h.js( "ui.core", "jquery.cookie", "jquery.dynatree" )}
+<link href='/static/june_2007_style/blue/dynatree_skin/ui.dynatree.css' rel='stylesheet' type='text/css'>
+##${h.js( "jquery.dynatree" )}
+
+<script type="text/javascript">
+ $(function(){
+ $("#tree").ajaxComplete(function(event, XMLHttpRequest, ajaxOptions) {
+ _log("debug", "ajaxComplete: %o", this); // dom element listening
+ });
+ // --- Initialize sample trees
+ $("#tree").dynatree({
+ title: "${request.type.datatx_info['data_dir']}",
+ rootVisible: true,
+ minExpandLevel: 0, // 1: root node is not collapsible
+ persist: false,
+ checkbox: true,
+ selectMode: 3,
+ onPostInit: function(isReloading, isError) {
+// alert("reloading: "+isReloading+", error:"+isError);
+ logMsg("onPostInit(%o, %o) - %o", isReloading, isError, this);
+ // Re-fire onActivate, so the text is updated
+ this.reactivate();
+ },
+ fx: { height: "toggle", duration: 200 },
+ // initAjax is hard to fake, so we pass the children as object array:
+ initAjax: {url: "${h.url_for( controller='requests_admin', action='open_folder' )}",
+ dataType: "json",
+ data: { id: "${request.id}", key: "${request.type.datatx_info['data_dir']}" },
+ },
+ onLazyRead: function(dtnode){
+ dtnode.appendAjax({
+ url: "${h.url_for( controller='requests_admin', action='open_folder' )}",
+ dataType: "json",
+ data: { id: "${request.id}", key: dtnode.data.key },
+ });
+ },
+ onSelect: function(select, dtnode) {
+ // Display list of selected nodes
+ var selNodes = dtnode.tree.getSelectedNodes();
+ // convert to title/key array
+ var selKeys = $.map(selNodes, function(node){
+ return node.data.key;
+ });
+ document.select_datasets_to_transfer.selected_datasets_to_transfer.value = selKeys.join(",")
+ },
+ onActivate: function(dtnode) {
+ var cell = $("#file_details");
+ var selected_value = dtnode.data.key
+ if(selected_value.charAt(selected_value.length-1) != '/') {
+ // Make ajax call
+ $.ajax( {
+ type: "POST",
+ url: "${h.url_for( controller='requests_admin', action='get_file_details' )}",
+ dataType: "json",
+ data: { id: "${request.id}", folder_path: dtnode.data.key },
+ success : function ( data ) {
+ cell.html( '<label>'+data+'</label>' )
+ }
+ });
+ } else {
+ cell.html( '' )
+ }
+ },
+ });
+ });
+
+</script>
+
+<%
+ is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
+ can_transfer_datasets = is_admin and sample.untransferred_dataset_files
+%>
+
+<br/><br/>
+<ul class="manage-table-actions">
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='view_request_type', id=trans.security.encode_id( request.type.id ) )}">Sequencer configuration</a></li>
+ %if can_transfer_datasets:
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='manage_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">Transfer datasets</a></li>
+ %endif
+ <li><a class="action-button" href="${h.url_for( controller='requests_common', action='view_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Browse this request</a></li>
+</ul>
+
+%if not sample:
+ <font color="red"><b><i>Select a sample before selecting datasets to transfer</i></b></font>
+ <br/><br/>
+%endif
+
+%if message:
+ ${render_msg( message, status )}
+%endif
+
+<div class="toolForm">
+ <div class="toolFormTitle">Select datasets to transfer from data directory configured for the sequencer</div>
+ <form name="select_datasets_to_transfer" id="select_datasets_to_transfer" action="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', cntrller=cntrller, request_id=trans.security.encode_id( request.id ))}" method="post" >
+ <div class="form-row">
+ <label>Sample:</label>
+ ${sample_id_select_field.get_html()}
+ <div class="toolParamHelp" style="clear: both;">
+ Select the sample that was sequenced to produce the datasets you want to transfer.
+ </div>
+ </div>
+ <div class="form-row" >
+ <label>Select datasets from source data location defined in the sequencer configuration:</label>
+ <div id="tree" >
+ Loading...
+ </div>
+ <input id="selected_datasets_to_transfer" name="selected_datasets_to_transfer" type="hidden" size=40"/>
+ <div class="toolParamHelp" style="clear: both;">
+ <ul>
+ <li>Click the <b>Sequencer configuration</b> button and change the <b>Data directory</b> setting to redefine the source data location.</li>
+ <li>Select a folder to select all of the individual files within that folder.</li>
+ <li>Click the <b>Select datasets</b> button when desired dataset check boxes are checked.</li>
+ </ul>
+ </div>
+ </div>
+ <div class="form-row">
+ <div id="file_details" class="toolParamHelp" style="clear: both;background-color:#FAFAFA;"></div>
+ </div>
+ <div class="form-row">
+ <input type="submit" name="select_datasets_to_transfer_button" value="Select datasets"/>
+ </div>
+ </form>
+</div>
+
+%if sample and sample.datasets:
+ <% title = 'Datasets currently selected for "sample.name"' %>
+ <p/>
+ ${render_sample_datasets( 'requests_admin', sample, sample.datasets, title )}
+%endif
--- a/lib/galaxy/web/controllers/requests_admin.py
+++ b/lib/galaxy/web/controllers/requests_admin.py
@@ -23,10 +23,6 @@ class AdminRequestsGrid( RequestsGrid ):
operations.append( grids.GridOperation( "Reject", allow_multiple=False, condition=( lambda item: not item.deleted and item.is_submitted ) ) )
operations.append( grids.GridOperation( "Delete", allow_multiple=True, condition=( lambda item: not item.deleted ) ) )
operations.append( grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ) )
- operations.append( grids.GridOperation( "Purge",
- allow_multiple=False,
- confirm="This will permanently delete this sequencing request. Click OK to proceed.",
- condition=( lambda item: item.deleted ) ) )
global_actions = [
grids.GridAction( "Create new request", dict( controller='requests_common',
action='create_request',
@@ -227,7 +223,8 @@ class RequestsAdmin( BaseController, Use
status=status,
message=message )
# Create an event with state 'Rejected' for this request
- event = trans.model.RequestEvent( request, request.states.REJECTED, comment )
+ event_comment = "Request marked rejected by %s. Reason: %s " % ( trans.user.email, comment )
+ event = trans.model.RequestEvent( request, request.states.REJECTED, event_comment )
trans.sa_session.add( event )
trans.sa_session.flush()
message='Request (%s) has been rejected.' % request.name
@@ -240,6 +237,11 @@ class RequestsAdmin( BaseController, Use
@web.expose
@web.require_admin
def manage_datasets( self, trans, **kwd ):
+ def handle_error( **kwd ):
+ kwd[ 'status' ] = 'error'
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
+ action='manage_datasets',
+ **kwd ) )
params = util.Params( kwd )
message = util.restore_text( params.get( 'message', '' ) )
status = params.get( 'status', 'done' )
@@ -247,23 +249,28 @@ class RequestsAdmin( BaseController, Use
operation = kwd[ 'operation' ].lower()
sample_dataset_id = params.get( 'id', None )
if not sample_dataset_id:
- return invalid_id_redirect( trans, 'requests_admin', sample_dataset_id )
+ message = 'Select at least 1 dataset to %s.' % operation
+ kwd[ 'message' ] = message
+ del kwd[ 'operation' ]
+ handle_error( **kwd )
id_list = util.listify( sample_dataset_id )
selected_sample_datasets = []
for sample_dataset_id in id_list:
- try:
- selected_sample_datasets.append( trans.sa_session.query( trans.model.SampleDataset ).get( trans.security.decode_id( sample_dataset_id ) ) )
+ try:
+ sample_dataset = trans.sa_session.query( trans.model.SampleDataset ).get( trans.security.decode_id( sample_dataset_id ) )
except:
return invalid_id_redirect( trans, 'requests_admin', sample_dataset_id )
+ selected_sample_datasets.append( sample_dataset )
if operation == "view":
- return trans.fill_template( '/admin/requests/dataset.mako',
+ return trans.fill_template( '/admin/requests/view_sample_dataset.mako',
+ cntrller='requests_admin',
sample_dataset=selected_sample_datasets[0] )
elif operation == "delete":
not_deleted = []
for sample_dataset in selected_sample_datasets:
# Make sure the dataset has been transferred before deleting it.
if sample_dataset in sample_dataset.sample.untransferred_dataset_files:
- # save the sample to which these datasets belong to
+ # Save the sample dataset
sample = sample_dataset.sample
trans.sa_session.delete( sample_dataset )
trans.sa_session.flush()
@@ -299,7 +306,9 @@ class RequestsAdmin( BaseController, Use
sample=selected_sample_datasets[0].sample,
id_list=id_list )
elif operation == "transfer":
- self.initiate_data_transfer( trans, selected_sample_datasets[0].sample, selected_sample_datasets )
+ self.initiate_data_transfer( trans,
+ trans.security.encode_id( selected_sample_datasets[0].sample.id ),
+ sample_datasets=selected_sample_datasets )
# Render the grid view
sample_id = params.get( 'sample_id', None )
try:
@@ -308,13 +317,10 @@ class RequestsAdmin( BaseController, Use
return invalid_id_redirect( trans, 'requests_admin', sample_id )
request_id = trans.security.encode_id( sample.request.id )
library_id = trans.security.encode_id( sample.library.id )
- self.datatx_grid.global_actions = [ grids.GridAction( "Refresh page",
+ self.datatx_grid.title = 'Manage "%s" datasets' % sample.name
+ self.datatx_grid.global_actions = [ grids.GridAction( "Select more datasets",
dict( controller='requests_admin',
- action='manage_datasets',
- sample_id=sample_id ) ),
- grids.GridAction( "Select datasets",
- dict( controller='requests_admin',
- action='get_data',
+ action='select_datasets_to_transfer',
request_id=request_id,
sample_id=sample_id ) ),
grids.GridAction( "Browse target data library",
@@ -326,7 +332,11 @@ class RequestsAdmin( BaseController, Use
dict( controller='requests_common',
action='view_request',
cntrller='requests_admin',
- id=request_id ) ) ]
+ id=request_id ) ),
+ grids.GridAction( "Refresh page",
+ dict( controller='requests_admin',
+ action='manage_datasets',
+ sample_id=sample_id ) ) ]
return self.datatx_grid( trans, **kwd )
@web.expose
@web.require_admin
@@ -372,70 +382,68 @@ class RequestsAdmin( BaseController, Use
sample_id=sample_id ) )
@web.expose
@web.require_admin
- def get_data( self, trans, **kwd ):
+ def select_datasets_to_transfer( self, trans, **kwd ):
params = util.Params( kwd )
message = util.restore_text( params.get( 'message', '' ) )
status = params.get( 'status', 'done' )
request_id = kwd.get( 'request_id', None )
files = []
+ def handle_error( **kwd ):
+ kwd[ 'status' ] = 'error'
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
+ action='select_datasets_to_transfer',
+ **kwd ) )
try:
request = trans.sa_session.query( trans.model.Request ).get( trans.security.decode_id( request_id ) )
except:
return invalid_id_redirect( trans, 'requests_admin', request_id )
- selected_files = util.restore_text( params.get( 'selected_files', '' ) )
- if len( selected_files ):
- selected_files = selected_files.split(',')
+ selected_datasets_to_transfer = util.restore_text( params.get( 'selected_datasets_to_transfer', '' ) )
+ if selected_datasets_to_transfer:
+ selected_datasets_to_transfer = selected_datasets_to_transfer.split(',')
else:
- selected_files = []
- selected_sample_id = kwd.get( 'sample_id', 'none' )
- sample_id_select_field = self.__build_sample_id_select_field( trans, request, selected_sample_id )
+ selected_datasets_to_transfer = []
+ sample_id = kwd.get( 'sample_id', 'none' )
+ sample_id_select_field = self.__build_sample_id_select_field( trans, request, sample_id )
+ if sample_id != 'none':
+ sample = trans.sa_session.query( trans.model.Sample ).get( trans.security.decode_id( sample_id ) )
+ else:
+ sample = None
# The __get_files() method redirects here with a status of 'error' and a message if there
# was a problem retrieving the files.
- if params.get( 'select_show_datasets_button', False ) or params.get( 'select_more_button', False ):
- # get the sample these datasets are associated with
- try:
- sample = trans.sa_session.query( trans.model.Sample ).get( trans.security.decode_id( selected_sample_id ) )
- except:
- message = 'Select a sample before selecting its associated datasets.'
- return trans.fill_template( '/admin/requests/get_data.mako',
- cntrller='requests_admin',
- request=request,
- sample_id_select_field=sample_id_select_field,
- status='error',
- message=message )
+ if params.get( 'select_datasets_to_transfer_button', False ):
+ # Get the sample that was sequenced to produce these datasets.
+ if sample_id == 'none':
+ message = 'Select the sample that was sequenced to produce the datasets you want to transfer.'
+ kwd[ 'message' ] = message
+ del kwd[ 'select_datasets_to_transfer_button' ]
+ handle_error( **kwd )
if sample in sample.request.samples_without_library_destinations:
# Display an error if a sample has been selected that
# has not yet been associated with a destination library.
+ message = 'Select a target data library and folder for the sample before selecting the datasets.'
status = 'error'
- message = 'Select a sample with associated data library and folder before selecting the datasets.'
- return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='get_data',
- request_id=request_id,
- sample_id=sample.id,
+ return trans.response.send_redirect( web.url_for( controller='requests_common',
+ action='edit_samples',
+ cntrller='requests_admin',
+ id=trans.security.encode_id( request.id ),
+ editing_samples=True,
status=status,
message=message ) )
# Save the sample datasets
- sample_dataset_file_names = self.__save_sample_datasets( trans, sample, selected_files )
+ sample_dataset_file_names = self.__save_sample_datasets( trans, sample, selected_datasets_to_transfer )
if sample_dataset_file_names:
message = 'Datasets (%s) have been selected for sample (%s)' % \
( str( sample_dataset_file_names )[1:-1].replace( "'", "" ), sample.name )
- if params.get( 'select_show_datasets_button', False ):
- return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='manage_datasets',
- request_id=request_id,
- sample_id=selected_sample_id,
- message=message,
- status=status ) )
- else: # 'select_more_button' was clicked
- return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='get_data',
- request_id=request_id,
- sample_id=sample.id,
- message=message,
- status=status ) )
- return trans.fill_template( '/admin/requests/get_data.mako',
+ return trans.response.send_redirect( web.url_for( controller='requests_admin',
+ action='manage_datasets',
+ request_id=request_id,
+ sample_id=sample_id,
+ message=message,
+ status=status ) )
+ return trans.fill_template( '/admin/requests/select_datasets_to_transfer.mako',
cntrller='requests_admin',
request=request,
+ sample=sample,
sample_id_select_field=sample_id_select_field,
status=status,
message=message )
@@ -499,7 +507,7 @@ class RequestsAdmin( BaseController, Use
if ok:
return output.splitlines()
return trans.response.send_redirect( web.url_for( controller='requests_admin',
- action='get_data',
+ action='select_datasets_to_transfer',
request_id=trans.security.encode_id( request.id ),
status=status,
message=message ) )
@@ -508,24 +516,36 @@ class RequestsAdmin( BaseController, Use
if a_path and not a_path.endswith( os.sep ):
a_path += os.sep
return a_path
- def __save_sample_datasets( self, trans, sample, selected_files ):
+ def __save_sample_datasets( self, trans, sample, selected_datasets_to_transfer ):
sample_dataset_file_names = []
- if selected_files:
- for filepath in selected_files:
+ if selected_datasets_to_transfer:
+ for filepath in selected_datasets_to_transfer:
# FIXME: handle folder selection
# ignore folders for now
if filepath[-1] != os.sep:
name = self.__dataset_name( sample, filepath.split( '/' )[-1] )
+ status = trans.app.model.SampleDataset.transfer_status.NOT_STARTED
+ size = sample.get_untransferred_dataset_size( filepath )
sample_dataset = trans.model.SampleDataset( sample=sample,
file_path=filepath,
- status=trans.app.model.SampleDataset.transfer_status.NOT_STARTED,
+ status=status,
name=name,
error_msg='',
- size=sample.dataset_size( filepath ) )
+ size=size )
trans.sa_session.add( sample_dataset )
trans.sa_session.flush()
sample_dataset_file_names.append( str( sample_dataset.name ) )
return sample_dataset_file_names
+ def dataset_file_size( self, sample, filepath ):
+ def print_ticks(d):
+ pass
+ datatx_info = sample.request.type.datatx_info
+ cmd = 'ssh %s@%s "du -sh \'%s\'"' % ( datatx_info['username'], datatx_info['host'], filepath )
+ output = pexpect.run( cmd,
+ events={ '.ssword:*': datatx_info['password']+'\r\n',
+ pexpect.TIMEOUT:print_ticks},
+ timeout=10 )
+ return output.replace( filepath, '' ).strip()
def __dataset_name( self, sample, filepath ):
name = filepath.split( '/' )[-1]
options = sample.request.type.rename_dataset_options
@@ -610,38 +630,54 @@ class RequestsAdmin( BaseController, Use
if not datatx_info[ 'host' ] \
or not datatx_info[ 'username' ] \
or not datatx_info[ 'password' ]:
- err_msg = "Error in sequencer login information."
- # check if web API is enabled and API key exists
- if not trans.user.api_keys or not trans.app.config.enable_api:
- err_msg = "Could not start data transfer as Galaxy Web API is not enabled. Enable Galaxy Web API in the Galaxy config file and create an API key."
+ err_msg += "Error in sequencer login information. "
+ # Make sure web API is enabled and API key exists
+ if not trans.app.config.enable_api:
+ err_msg += "The 'enable_api = True' setting is not correctly set in the Galaxy config file. "
+ if not trans.user.api_keys:
+ err_msg += "Set your API Key in your User Preferences to transfer datasets."
# check if library_import_dir is set
if not trans.app.config.library_import_dir:
- err_msg = "'library_import_dir' config variable is not set in the Galaxy config file."
+ err_msg = "'The library_import_dir' setting is not set in the Galaxy config file."
# check the RabbitMQ server settings in the config file
for k, v in trans.app.config.amqp.items():
if not v:
- err_msg = 'Set RabbitMQ server settings in the "galaxy_amqp" section of the Galaxy config file. %s is not set.' % k
+ err_msg += 'Set RabbitMQ server settings in the "galaxy_amqp" section of the Galaxy config file. %s is not set.' % k
break
return err_msg
- def initiate_data_transfer( self, trans, sample, selected_sample_datasets ):
+ @web.expose
+ @web.require_admin
+ def initiate_data_transfer( self, trans, sample_id, sample_datasets=[], sample_dataset_id='' ):
'''
This method initiates the transfer of the datasets from the sequencer. It
happens in the following steps:
- - The current admin user needs to have ADD_LIBRARY_ITEM permission for the
+ - The current admin user needs to have LIBRARY_ADD permission for the
target library and folder
- Create an XML message encapsulating all the data transfer info and send it
to the message queue (RabbitMQ broker)
'''
- # check data transfer settings
+ try:
+ sample = trans.sa_session.query( trans.model.Sample ).get( trans.security.decode_id( sample_id ) )
+ except:
+ return invalid_id_redirect( trans, 'requests_admin', sample_id )
+ # Check data transfer settings
err_msg = self.__validate_data_transfer_settings( trans, sample )
if not err_msg:
- # check if the current user has add_library_item permission to the sample
- # target library & folder
+ # Make sure the current user has LIBRARY_ADD
+ # permission on the target library and folder.
self.__check_library_add_permission( trans, sample.library, sample.folder )
- # create the message
+ if sample_dataset_id and not sample_datasets:
+ # Either a list of SampleDataset objects or a comma-separated string of
+ # encoded SampleDataset ids can be received. If the latter, parse the
+ # sample_dataset_id to build the list of sample_datasets.
+ id_list = util.listify( sample_dataset_id )
+ for sample_dataset_id in id_list:
+ sample_dataset = trans.sa_session.query( trans.model.SampleDataset ).get( trans.security.decode_id( sample_dataset_id ) )
+ sample_datasets.append( sample_dataset )
+ # Create the message
message = self.__create_data_transfer_message( trans,
sample,
- selected_sample_datasets )
+ sample_datasets )
# Send the message
try:
conn = amqp.Connection( host=trans.app.config.amqp[ 'host' ] + ":" + trans.app.config.amqp[ 'port' ],
@@ -660,9 +696,9 @@ class RequestsAdmin( BaseController, Use
chan.close()
conn.close()
except Exception, e:
- err_msg = "Error in sending the data transfer message to the Galaxy AMQP message queue:<br/>%s" % str(e)
+ err_msg = "Error sending the data transfer message to the Galaxy AMQP message queue:<br/>%s" % str(e)
if not err_msg:
- err_msg = "%i datasets have been queued for transfer from the sequencer. Click the Refresh button above to monitor the transfer status." % len( selected_sample_datasets )
+ err_msg = "%i datasets have been queued for transfer from the sequencer. Click the Refresh button above to monitor the transfer status." % len( sample_datasets )
status = "done"
else:
status = 'error'
--- a/templates/requests/common/edit_samples.mako
+++ b/templates/requests/common/edit_samples.mako
@@ -19,12 +19,13 @@
is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
is_complete = request.is_complete
+ is_submitted = request.is_submitted
is_unsubmitted = request.is_unsubmitted
can_add_samples = is_unsubmitted
can_delete_samples = request.samples and not is_complete
can_edit_samples = request.samples and ( is_admin or not is_complete )
can_edit_request = ( is_admin and not request.is_complete ) or request.is_unsubmitted
- can_reject_or_transfer = is_admin and request.is_submitted
+ can_reject = is_admin and is_submitted
can_submit = request.samples and is_unsubmitted
%>
@@ -47,9 +48,8 @@
<a class="action-button" href="${h.url_for( controller='requests_common', action='edit_basic_request_info', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Edit</a>
%endif
<a class="action-button" href="${h.url_for( controller='requests_common', action='request_events', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">View history</a>
- %if can_reject_or_transfer:
+ %if can_reject:
<a class="action-button" href="${h.url_for( controller='requests_admin', action='reject_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Reject</a>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='get_data', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
%endif
</div></ul>
--- a/templates/requests/common/events.mako
+++ b/templates/requests/common/events.mako
@@ -20,7 +20,7 @@
%endif
%if is_admin and request.is_submitted:
<a class="action-button" href="${h.url_for( controller='requests_admin', action='reject_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Reject</a>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='get_data', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
+ <a class="action-button" href="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
%endif
</div></ul>
--- a/templates/requests/common/edit_basic_request_info.mako
+++ b/templates/requests/common/edit_basic_request_info.mako
@@ -17,7 +17,7 @@
<a class="action-button" href="${h.url_for( controller='requests_common', action='request_events', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">View history</a>
%if is_admin and request.is_submitted:
<a class="action-button" href="${h.url_for( controller='requests_admin', action='reject_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Reject</a>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='get_data', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
+ <a class="action-button" href="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
%endif
</div></ul>
--- a/templates/requests/common/view_request.mako
+++ b/templates/requests/common/view_request.mako
@@ -19,11 +19,13 @@
is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
is_complete = request.is_complete
+ is_submitted = request.is_submitted
is_unsubmitted = request.is_unsubmitted
+ can_add_samples = is_unsubmitted
can_edit_request = ( is_admin and not request.is_complete ) or request.is_unsubmitted
- can_add_samples = is_unsubmitted
can_delete_samples = request.samples and not is_complete
can_edit_samples = request.samples and ( is_admin or not is_complete )
+ can_reject = is_admin and is_submitted
can_submit = request.samples and is_unsubmitted
%>
@@ -35,13 +37,15 @@
%endif
<li><a class="action-button" id="request-${request.id}-popup" class="menubutton">Request actions</a></li><div popupmenu="request-${request.id}-popup">
+ %if request.deleted:
+ <a class="action-button" href="${h.url_for( controller='requests_common', action='undelete_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Undelete</a>
+ %endif
%if can_edit_request:
<a class="action-button" href="${h.url_for( controller='requests_common', action='edit_basic_request_info', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Edit</a>
%endif
<a class="action-button" href="${h.url_for( controller='requests_common', action='request_events', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">View history</a>
- %if is_admin and request.is_submitted:
+ %if can_reject:
<a class="action-button" href="${h.url_for( controller='requests_admin', action='reject_request', cntrller=cntrller, id=trans.security.encode_id( request.id ) )}">Reject</a>
- <a class="action-button" href="${h.url_for( controller='requests_admin', action='get_data', request_id=trans.security.encode_id( request.id ) )}">Select datasets to transfer</a>
%endif
</div></ul>
--- a/templates/admin/requests/dataset.mako
+++ /dev/null
@@ -1,69 +0,0 @@
-<%inherit file="/base.mako"/>
-<%namespace file="/message.mako" import="render_msg" />
-
-%if message:
- ${render_msg( message, status )}
-%endif
-
-<br/><br/>
-
-<% sample = sample_dataset.sample %>
-
-<ul class="manage-table-actions">
- <li>
- <a class="action-button" href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller='requests_admin', sample_id=trans.security.encode_id( sample.id ) )}">
- <span>Browse datasets</span></a>
- </li>
-</ul>
-
-<div class="toolForm">
- <div class="toolFormTitle">Dataset Information</div>
- <div class="toolFormBody">
- <div class="form-row">
- <label>Name:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.name}
- </div>
- <div style="clear: both"></div>
- </div>
- <div class="form-row">
- <label>File on the Sequencer:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.file_path}
- </div>
- <div style="clear: both"></div>
- </div>
- <div class="form-row">
- <label>Size:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.size}
- </div>
- <div style="clear: both"></div>
- </div>
- <div class="form-row">
- <label>Created on:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.create_time}
- </div>
- <div style="clear: both"></div>
- </div>
- <div class="form-row">
- <label>Updated on:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.update_time}
- </div>
- <div style="clear: both"></div>
- </div>
- <div class="form-row">
- <label>Transfer status:</label>
- <div style="float: left; width: 250px; margin-right: 10px;">
- ${sample_dataset.status}
- %if sample_dataset.status == trans.app.model.SampleDataset.transfer_status.ERROR:
- <br/>
- ${sample_dataset.error_msg}
- %endif
- </div>
- <div style="clear: both"></div>
- </div>
- </div>
-</div>
--- a/templates/requests/common/common.mako
+++ b/templates/requests/common/common.mako
@@ -168,15 +168,25 @@
%endif
<td valign="top">${current_sample['library_select_field'].get_html()}</td><td valign="top">${current_sample['folder_select_field'].get_html()}</td>
- %if display_datasets:
- <%
- if sample:
- label = str( len( sample.datasets ) )
- else:
- label = 'add'
- %>
- <td valign="top"><a href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${label}</a></td>
- <td valign="top"><a href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${label}</a></td>
+ %if display_datasets:
+ <td valign="top">
+ ## An admin can select the datasets to transfer, while a non-admin can only view what has been selected
+ %if is_admin:
+ <a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', cntrller=cntrller, request_id=trans.security.encode_id( request.id ), sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a>
+ %elif sample.datasets:
+ ## Only display a link if there is at least 1 selected dataset for the sample
+ <a href="${h.url_for( controller='requests_common', action='view_selected_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a></td>
+ %else:
+ ${len( sample.datasets )}
+ %endif
+ </td>
+ <td valign="top">
+ %if is_admin and sample.untransferred_dataset_files:
+ <a href="${h.url_for( controller='requests_common', action='manage_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.transferred_dataset_files )}</a>
+ %else:
+ ${len( sample.transferred_dataset_files )}
+ %endif
+ </td>
%endif
%if sample and ( is_admin or is_unsubmitted ) and not is_complete:
## Delete button
@@ -196,6 +206,7 @@
can_add_samples = request.is_unsubmitted
can_delete_samples = request.samples and not is_complete
can_edit_samples = request.samples and ( is_admin or not is_complete )
+ can_select_datasets = is_admin and current_samples and ( is_submitted or is_complete )
display_checkboxes = editing_samples and ( is_complete or is_rejected or is_submitted )
display_bar_code = request.samples and ( is_complete or is_rejected or is_submitted )
display_datasets = request.samples and ( is_complete or is_rejected or is_submitted )
@@ -280,9 +291,31 @@
%else:
<td></td>
%endif
- %if is_submitted or is_complete:
- <td><a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a></td>
- <td><a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_common', action='view_dataset_transfer', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.transferred_dataset_files )}</a></td>
+ %if is_submitted or is_complete:
+ <td>
+ ## An admin can select the datasets to transfer, while a non-admin can only view what has been selected
+ %if is_admin:
+ %if not sample.datasets:
+ ## If there are no selected datasets, display a page alowing the admin to select some.
+ <a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_admin', action='select_datasets_to_transfer', cntrller=cntrller, request_id=trans.security.encode_id( request.id ), sample_id= trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a>
+ %else:
+ ## If there are selected datasets, display them
+ <a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_common', action='view_selected_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a>
+ %endif
+ %elif sample.datasets:
+ ## Only display a link if there is at least 1 selected dataset for the sample
+ <a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_common', action='view_selected_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.datasets )}</a>
+ %else:
+ ${len( sample.datasets )}
+ %endif
+ </td>
+ <td>
+ %if is_admin and sample.untransferred_dataset_files:
+ <a id="sampleDatasets-${sample.id}" href="${h.url_for( controller='requests_admin', action='manage_datasets', cntrller=cntrller, sample_id=trans.security.encode_id( sample.id ) )}">${len( sample.transferred_dataset_files )}</a>
+ %else:
+ ${len( sample.transferred_dataset_files )}
+ %endif
+ </td>
%endif
</tr>
%else:
@@ -395,3 +428,52 @@
</table></div></%def>
+
+<%def name="render_sample_datasets( cntrller, sample, sample_datasets, title )">
+ %if sample_datasets:
+ <%
+ is_admin = cntrller == 'requests_admin' and trans.user_is_admin()
+ is_complete = sample.request.is_complete
+ is_submitted = sample.request.is_submitted
+ can_select_datasets = is_admin and ( is_complete or is_submitted )
+ can_transfer_datasets = is_admin and sample.untransferred_dataset_files
+ %>
+ <h3>${title}</h3>
+ <table class="grid">
+ <thead>
+ <tr>
+ <th>Name</th>
+ <th>Size</th>
+ <th>Status</th>
+ </tr>
+ <thead>
+ <tbody>
+ %for dataset in sample_datasets:
+ <tr>
+ <td>
+ %if is_admin:
+ <% encoded_id = trans.security.encode_id(dataset.id) %>
+ <span class="expandLink dataset-${dataset}-click"><span class="rowIcon"></span>
+ <div style="float: left; margin-left: 2px;" class="menubutton split popup" id="dataset-${dataset.id}-popup">
+ <a class="dataset-${encoded_id}-click" href="${h.url_for( controller='requests_admin', action='manage_datasets', operation='view', id=trans.security.encode_id( dataset.id ) )}">${dataset.name}</a>
+ </div>
+ </span>
+ <div popupmenu="dataset-${dataset.id}-popup">
+ %if can_transfer_datasets and dataset in sample.untransferred_dataset_files:
+ <li><a class="action-button" href="${h.url_for( controller='requests_admin', action='initiate_data_transfer', sample_id=trans.security.encode_id( sample.id ), sample_dataset_id=trans.security.encode_id( dataset.id ) )}">Transfer</a></li>
+ %endif
+ </div>
+ %else:
+ ${dataset.name}
+ %endif
+ </td>
+ <td>${dataset.size}</td>
+ <td>${dataset.status}</td>
+ </tr>
+ %endfor
+ </tbody>
+ </table>
+ %else:
+ No datasets for this sample.
+ %endif
+</%def>
1
0
galaxy-dist commit 9ee40043b826: rgHaploView tool version upgrade - now shows thumbnail of ld plots
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Ross Lazarus <ross.lazarus(a)gmail.com>
# Date 1289322752 18000
# Node ID 9ee40043b826b3bc1e29f84996f9fe14dd119a45
# Parent a77b2888759e94861252ca65437e11ec298b3058
rgHaploView tool version upgrade - now shows thumbnail of ld plots
--- a/tools/rgenetics/rgHaploView.xml
+++ b/tools/rgenetics/rgHaploView.xml
@@ -1,4 +1,4 @@
-<tool id="rgHaploView1" name="LD plots:" version="0.2">
+<tool id="rgHaploView1" name="LD plots:" version="0.3"><description>and comparisons with HapMap data</description>
--- a/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.html
+++ b/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.html
@@ -9,9 +9,11 @@
</head><body><div class="document">
-<h4>rgenetics for Galaxy rgHaploView.py, wrapping HaploView</h4><br><div><hr><ul>
+<h4>rgenetics for Galaxy rgHaploView.py, wrapping HaploView</h4><table><tr><td><a href="allnup.pdf"><img src="allnup.png" alt="Main combined LD image" hspace="10" align="middle"></td><td>Click the thumbnail at left to download the main combined LD image <a href=allnup.pdf>allnup.pdf</a></td></tr></table>
+<br><div><hr><ul><li><a href="alljoin.pdf">alljoin.pdf - All pdf plots, each on a separate page</a></li><li><a href="allnup.pdf">allnup.pdf - All pdf plots on a single page</a></li>
+<li><a href="allnup.png">allnup.png - allnup.png</a></li><li><a href="1_rgHaploViewtest1.pdf">1_rgHaploViewtest1.pdf - 1_rgHaploViewtest1.pdf</a></li><li><a href="1_rgHaploViewtest1.png">1_rgHaploViewtest1.png - 1_rgHaploViewtest1.png</a></li><li><a href="2_HapMap_YRI_22.pdf">2_HapMap_YRI_22.pdf - Hapmap data</a></li>
@@ -33,7 +35,7 @@ Haploview 4.2 Java Version: 1.6.0_03
-Arguments: -n -pairwiseTagging -pedfile /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22
+Arguments: -n -pairwiseTagging -pedfile /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22
@@ -41,9 +43,9 @@ Arguments: -n -pairwiseTagging -pedfile
Max LD comparison distance = 200000kb
-Using data file: /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped
+Using data file: /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped
-Using marker information file: /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info
+Using marker information file: /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info
Writing output to rgHaploViewtest1.ped.LD.PNG
@@ -79,27 +81,37 @@ Downloading chromosome 22, analysis pane
Writing output to Chromosome22YRI.LD.PNG
-This is pdfjoin version 1.20
+ ----
-Reading site configuration from /etc/pdfnup.conf
+ pdfjam: This is pdfjam version 2.06.
- Temporary LaTeX file for this job is /var/tmp/22578.tex
+ pdfjam: Reading any site-wide or user-specific defaults...
- Calling pdflatex...
+ (none found)
- Finished: output is /opt/galaxy/test-data/rgtestouts/rgHaploView/alljoin.pdf
+ pdfjam: Effective call for this run of pdfjam:
-This is pdfnup version 1.20
+ /usr/local/bin/pdfjam --fitpaper 'true' --rotateoversize 'true' --suffix joined --fitpaper 'true' --outfile alljoin.pdf -- 1_rgHaploViewtest1.pdf - 2_HapMap_YRI_22.pdf -
-Reading site configuration from /etc/pdfnup.conf
+ pdfjam: Calling pdflatex...
-Processing alljoin.pdf...
+ pdfjam: Finished. Output was to 'alljoin.pdf'.
- Temporary LaTeX file for this job is /var/tmp/22621-1.tex
+ ----
- Calling pdflatex...
+ pdfjam: This is pdfjam version 2.06.
- Finished: output is /opt/galaxy/test-data/rgtestouts/rgHaploView/allnup.pdf
+ pdfjam: Reading any site-wide or user-specific defaults...
+
+ (none found)
+
+ pdfjam: Effective call for this run of pdfjam:
+
+ /usr/local/bin/pdfjam --suffix nup --nup '2x1' --landscape --nup '1x2' --outfile allnup.pdf -- alljoin.pdf -
+
+ pdfjam: Calling pdflatex...
+
+ pdfjam: Finished. Output was to 'allnup.pdf'.
PATH=/usr/kerberos/bin:/usr/local/bin:/bin:/usr/bin:/home/rerla/bin
@@ -107,7 +119,7 @@ PATH=/usr/kerberos/bin:/usr/local/bin:/b
-## executing java -jar /opt/galaxy/tool-data/shared/jars/haploview.jar -n -memory 2048 -pairwiseTagging -pedfile /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22 returned 0
+## executing java -jar /opt/galaxy/tool-data/shared/jars/haploview.jar -n -memory 2048 -pairwiseTagging -pedfile /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22 returned 0
## executing mogrify -resize 800x400! *.PNG returned 0
@@ -123,7 +135,9 @@ PATH=/usr/kerberos/bin:/usr/local/bin:/b
## executing mogrify -format pdf -resize 800x400! *.png returned 0
-## executing pdfjoin "*.pdf" --fitpaper true --outfile alljoin.pdf returned 0
+## executing pdfjoin *.pdf --fitpaper true --outfile alljoin.pdf returned 0
## executing pdfnup alljoin.pdf --nup 1x2 --outfile allnup.pdf returned 0
+
+## executing convert -resize x300 allnup.pdf allnup.png returned 0
</pre><hr></div></body></html>
Binary file test-data/rgtestouts/rgHaploView/alljoin.pdf has changed
Binary file test-data/rgtestouts/rgHaploView/2_HapMap_YRI_22.png has changed
Binary file test-data/rgtestouts/rgHaploView/1_rgHaploViewtest1.pdf has changed
Binary file test-data/rgtestouts/rgHaploView/2_HapMap_YRI_22.pdf has changed
Binary file test-data/rgtestouts/rgHaploView/1_rgHaploViewtest1.png has changed
--- a/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped.TESTS
+++ b/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped.TESTS
@@ -1,9 +1,9 @@
rs2283804
rs756632
-rs4820537
-rs3788347
-rs2283802
-rs4822363
rs4820539
rs16997606
+rs4822363
rs2267000
+rs3788347
+rs4820537
+rs2283802
Binary file test-data/rgtestouts/rgHaploView/allnup.pdf has changed
--- a/tools/rgenetics/rgHaploView.py
+++ b/tools/rgenetics/rgHaploView.py
@@ -47,7 +47,7 @@ class ldPlot:
self.args=argv
self.parseArgs(argv=self.args)
self.setupRegions()
-
+
def parseArgs(self,argv=[]):
"""
"""
@@ -405,10 +405,10 @@ class ldPlot:
p=subprocess.Popen(vcl,shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
retval = p.wait()
self.lf.write('## executing %s returned %d\n' % (vcl,retval))
- #vcl = ['convert', 'allnup.pdf', 'allnup.png'] # this fails - bad pdf?
- #p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath)
- #retval = p.wait()
- #lf.write('## executing %s returned %d\n' % (vcl,retval))
+ vcl = '%s -resize x300 allnup.pdf allnup.png' % (self.convert)
+ p=subprocess.Popen(vcl,shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ self.lf.write('## executing %s returned %d\n' % (vcl,retval))
ste.close() # temp file used to catch haploview blather
hblather = open(blog,'r').readlines() # to catch the blather
os.unlink(blog)
@@ -425,20 +425,16 @@ class ldPlot:
outf.write(galhtmlprefix % progname)
s = '<h4>rgenetics for Galaxy %s, wrapping HaploView</h4>' % (progname)
outf.write(s)
- """
- as at ashg 2009, convert fails on allnup.pdf - probably too complex...
mainthumb = 'allnup.png'
mainpdf = 'allnup.pdf'
- if os.path.exists(mainpdf):
- if not os.path.exists(mainthumb):
+ if os.path.exists(os.path.join(self.outfpath,mainpdf)):
+ if not os.path.exists(os.path.join(self.outfpath,mainthumb)):
outf.write('<table><tr><td colspan="3"><a href="%s">Main combined LD plot</a></td></tr></table>\n' % (mainpdf))
else:
- outf.write('<table><tr><td><a href="%s"><img src="%s" alt="Main combined LD image" hspace="10" align="middle">')
- outf.write('</td><td>Click this thumbnail to display the main combined LD image</td></tr></table>\n' % (mainpdf,mainthumb))
+ outf.write('<table><tr><td><a href="%s"><img src="%s" alt="Main combined LD image" hspace="10" align="middle">' % (mainpdf,mainthumb))
+ outf.write('</td><td>Click the thumbnail at left to download the main combined LD image <a href=%s>%s</a></td></tr></table>\n' % (mainpdf,mainpdf))
else:
outf.write('(No main image was generated - this usually means a Haploview error connecting to Hapmap site - please try later)<br/>\n')
- outf.write('## Called as %s' % sys.argv)
- """
outf.write('<br><div><hr><ul>\n')
for i, data in enumerate( flist ):
dn = os.path.split(data)[-1]
@@ -515,3 +511,4 @@ if __name__ == "__main__":
ld.doPlots()
+
--- a/test-data/rgtestouts/rgHaploView/Log_rgHaploViewtest1.txt
+++ b/test-data/rgtestouts/rgHaploView/Log_rgHaploViewtest1.txt
@@ -3,12 +3,12 @@ Haploview 4.2 Java Version: 1.6.0_03
*****************************************************
-Arguments: -n -pairwiseTagging -pedfile /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22
+Arguments: -n -pairwiseTagging -pedfile /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22
Max LD comparison distance = 200000kb
-Using data file: /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped
-Using marker information file: /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info
+Using data file: /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped
+Using marker information file: /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info
Writing output to rgHaploViewtest1.ped.LD.PNG
Starting tagging.
Writing output to rgHaploViewtest1.ped.TAGS
@@ -26,21 +26,26 @@ Arguments: -n -chromosome 22 -panel YRI
Max LD comparison distance = 200000kb
Downloading chromosome 22, analysis panel YRI, 21784..21905 from HapMap release 21.
Writing output to Chromosome22YRI.LD.PNG
-This is pdfjoin version 1.20
-Reading site configuration from /etc/pdfnup.conf
- Temporary LaTeX file for this job is /var/tmp/22578.tex
- Calling pdflatex...
- Finished: output is /opt/galaxy/test-data/rgtestouts/rgHaploView/alljoin.pdf
-This is pdfnup version 1.20
-Reading site configuration from /etc/pdfnup.conf
-Processing alljoin.pdf...
- Temporary LaTeX file for this job is /var/tmp/22621-1.tex
- Calling pdflatex...
- Finished: output is /opt/galaxy/test-data/rgtestouts/rgHaploView/allnup.pdf
+ ----
+ pdfjam: This is pdfjam version 2.06.
+ pdfjam: Reading any site-wide or user-specific defaults...
+ (none found)
+ pdfjam: Effective call for this run of pdfjam:
+ /usr/local/bin/pdfjam --fitpaper 'true' --rotateoversize 'true' --suffix joined --fitpaper 'true' --outfile alljoin.pdf -- 1_rgHaploViewtest1.pdf - 2_HapMap_YRI_22.pdf -
+ pdfjam: Calling pdflatex...
+ pdfjam: Finished. Output was to 'alljoin.pdf'.
+ ----
+ pdfjam: This is pdfjam version 2.06.
+ pdfjam: Reading any site-wide or user-specific defaults...
+ (none found)
+ pdfjam: Effective call for this run of pdfjam:
+ /usr/local/bin/pdfjam --suffix nup --nup '2x1' --landscape --nup '1x2' --outfile allnup.pdf -- alljoin.pdf -
+ pdfjam: Calling pdflatex...
+ pdfjam: Finished. Output was to 'allnup.pdf'.
PATH=/usr/kerberos/bin:/usr/local/bin:/bin:/usr/bin:/home/rerla/bin
## rgHaploView.py looking for 10 rs (['rs2283802', 'rs2267000', 'rs16997606', 'rs4820537', 'rs3788347'])## rgHaploView.py: wrote 10 markers, 40 subjects for region
-## executing java -jar /opt/galaxy/tool-data/shared/jars/haploview.jar -n -memory 2048 -pairwiseTagging -pedfile /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /opt/galaxy/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22 returned 0
+## executing java -jar /opt/galaxy/tool-data/shared/jars/haploview.jar -n -memory 2048 -pairwiseTagging -pedfile /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped -info /tmp/foo/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.info -tagrsqcounts -tagrsqcutoff 0.8 -ldcolorscheme RSQ -maxDistance 200000 -compressedpng -chromosome 22 returned 0
## executing mogrify -resize 800x400! *.PNG returned 0
## executing convert -resize 800x400! rgHaploViewtest1.ped.LD.PNG rgHaploViewtest1.tmp.png returned 0
## executing convert -pointsize 25 -fill maroon -draw "text 10,300 'rgHaploViewtest1'" rgHaploViewtest1.tmp.png 1_rgHaploViewtest1.png returned 0
@@ -48,5 +53,6 @@ PATH=/usr/kerberos/bin:/usr/local/bin:/b
## executing convert -pointsize 25 -fill maroon -draw "text 10,300 'HapMap YRI'" rgHaploViewtest1.tmp.png 2_HapMap_YRI_22.png returned 0
### nimages=2
## executing mogrify -format pdf -resize 800x400! *.png returned 0
-## executing pdfjoin "*.pdf" --fitpaper true --outfile alljoin.pdf returned 0
+## executing pdfjoin *.pdf --fitpaper true --outfile alljoin.pdf returned 0
## executing pdfnup alljoin.pdf --nup 1x2 --outfile allnup.pdf returned 0
+## executing convert -resize x300 allnup.pdf allnup.png returned 0
--- a/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped.TAGS
+++ b/test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped.TAGS
@@ -14,12 +14,12 @@ rs2267006 rs2283804 1.0
rs4822363 rs4822363 1.0
Test Alleles Captured
-rs2283804 rs2283804,rs2267006
+rs2283804 rs2267006,rs2283804
rs756632 rs756632
-rs4820537 rs4820537
-rs3788347 rs3788347
-rs2283802 rs2283802
-rs4822363 rs4822363
rs4820539 rs4820539
rs16997606 rs16997606
+rs4822363 rs4822363
rs2267000 rs2267000
+rs3788347 rs3788347
+rs4820537 rs4820537
+rs2283802 rs2283802
Binary file test-data/rgtestouts/rgHaploView/rgHaploViewtest1.ped.LD.PNG has changed
1
0
galaxy-dist commit ecaf015e009a: (recommit): porocessTaxonomynow removes parenthesis fixing various tree drawing issues in metagenomic tools. Major rework of MG tools needed to ensure reproducibility
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Nate Coraor <nate(a)bx.psu.edu>
# Date 1289402803 18000
# Node ID ecaf015e009a35a3cf421a87fbab1c5d0bbba5b4
# Parent 2c2a22396a2641a52dc5f200d26a3d947cf11cbd
(recommit): porocessTaxonomynow removes parenthesis fixing various tree drawing issues in metagenomic tools. Major rework of MG tools needed to ensure reproducibility
--- a/scripts/taxonomy/processTaxonomy.sh
+++ b/scripts/taxonomy/processTaxonomy.sh
@@ -10,5 +10,9 @@ cat gi_taxid_nucl.dmp gi_taxid_prot.dmp
echo "Sorting gi2tax files..."
sort -n -k 1 gi_taxid_all.dmp > gi_taxid_sorted.txt
rm gi_taxid_nucl.dmp gi_taxid_prot.dmp gi_taxid_all.dmp
+echo "Removing parenthesis from names.dmp"
+cat names.dmp | sed s/\(/_/g | sed s/\)/_/g > names.temporary
+mv names.dmp names.dmp.orig
+mv names.temporary names.dmp
1
0
galaxy-dist commit 0e3fe3e7b21b: Allow display framework to work with workflows that contain tools that have been updated. Previously, this would cause a server error when trying to view a workflow or a page with an embedded workflow that contained an updated tool.
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Daniel Blankenberg <dan(a)bx.psu.edu>
# Date 1289341236 18000
# Node ID 0e3fe3e7b21bfd78461869817c6b43db827d77f0
# Parent 479b377ef455f2d676fb84363b0b6d437d6af5f6
Allow display framework to work with workflows that contain tools that have been updated. Previously, this would cause a server error when trying to view a workflow or a page with an embedded workflow that contained an updated tool.
--- a/templates/workflow/display.mako
+++ b/templates/workflow/display.mako
@@ -1,4 +1,5 @@
<%inherit file="/display_base.mako"/>
+<%namespace file="/display_common.mako" import="render_message" /><%!
from galaxy.tools.parameters import DataToolParameter, RuntimeValue
@@ -54,6 +55,9 @@
${param.value_to_display_text( value, app )}
%endif
</div>
+ %if hasattr( step, 'upgrade_messages' ) and step.upgrade_messages and param.name in step.upgrade_messages:
+ ${render_message( step.upgrade_messages[param.name], "info" )}
+ %endif
</div></%def>
--- a/lib/galaxy/web/base/controller.py
+++ b/lib/galaxy/web/base/controller.py
@@ -207,9 +207,12 @@ class UsesStoredWorkflow( SharableItemSe
def get_stored_workflow_steps( self, trans, stored_workflow ):
""" Restores states for a stored workflow's steps. """
for step in stored_workflow.latest_workflow.steps:
+ step.upgrade_messages = {}
if step.type == 'tool' or step.type is None:
# Restore the tool state for the step
module = module_factory.from_workflow_step( trans, step )
+ #Check if tool was upgraded
+ step.upgrade_messages = module.check_and_update_state()
# Any connected input needs to have value DummyDataset (these
# are not persisted so we need to do it every time)
module.add_dummy_datasets( connections=step.input_connections )
1
0
galaxy-dist commit d6a0dd8e55e2: Sample tracking functional tests refactored till add samples.
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User rc
# Date 1289406533 18000
# Node ID d6a0dd8e55e2f7d2077bc282bca3e42d98fbb7f2
# Parent ecaf015e009a35a3cf421a87fbab1c5d0bbba5b4
Sample tracking functional tests refactored till add samples.
Rest of the tests are disabled.
--- a/test/functional/test_sample_tracking.py
+++ b/test/functional/test_sample_tracking.py
@@ -17,6 +17,9 @@ address_dict = dict( short_desc="Office"
phone="007-007-0007" )
class TestFormsAndRequests( TwillTestCase ):
+ #
+ # ====== Setup Users, Groups & Roles required for this test suite =========
+ #
def test_000_initiate_users( self ):
"""Ensuring all required user accounts exist"""
self.logout()
@@ -50,9 +53,9 @@ class TestFormsAndRequests( TwillTestCas
def test_005_create_required_groups_and_roles( self ):
"""Testing creating all required groups and roles for this script"""
# Logged in as admin_user
- # Create role_one
- name = 'Role One'
- description = "This is Role One's description"
+ # Create role1
+ name = 'Role1'
+ description = "This is Role1's description"
user_ids = [ str( admin_user.id ), str( regular_user1.id ), str( regular_user3.id ) ]
self.create_role( name=name,
description=description,
@@ -61,25 +64,25 @@ class TestFormsAndRequests( TwillTestCas
create_group_for_role='no',
private_role=admin_user.email )
# Get the role object for later tests
- global role_one
- role_one = get_role_by_name( name )
- # Create group_one
- name = 'Group One'
- self.create_group( name=name, in_user_ids=[ str( regular_user1.id ) ], in_role_ids=[ str( role_one.id ) ] )
+ global role1
+ role1 = get_role_by_name( name )
+ # Create group1
+ name = 'Group1'
+ self.create_group( name=name, in_user_ids=[ str( regular_user1.id ) ], in_role_ids=[ str( role1.id ) ] )
# Get the group object for later tests
- global group_one
- group_one = get_group_by_name( name )
- assert group_one is not None, 'Problem retrieving group named "Group One" from the database'
+ global group1
+ group1 = get_group_by_name( name )
+ assert group1 is not None, 'Problem retrieving group named "Group1" from the database'
# NOTE: To get this to work with twill, all select lists on the ~/admin/role page must contain at least
# 1 option value or twill throws an exception, which is: ParseError: OPTION outside of SELECT
# Due to this bug in twill, we create the role, we bypass the page and visit the URL in the
# associate_users_and_groups_with_role() method.
#
- #create role_two
- name = 'Role Two'
- description = 'This is Role Two'
+ #create role2
+ name = 'Role2'
+ description = 'This is Role2'
user_ids = [ str( admin_user.id ) ]
- group_ids = [ str( group_one.id ) ]
+ group_ids = [ str( group1.id ) ]
private_role = admin_user.email
self.create_role( name=name,
description=description,
@@ -87,11 +90,14 @@ class TestFormsAndRequests( TwillTestCas
in_group_ids=group_ids,
private_role=private_role )
# Get the role object for later tests
- global role_two
- role_two = get_role_by_name( name )
- assert role_two is not None, 'Problem retrieving role named "Role Two" from the database'
- def test_010_create_request_form( self ):
- """Testing creating a request form definition, editing the name and description and adding fields"""
+ global role2
+ role2 = get_role_by_name( name )
+ assert role2 is not None, 'Problem retrieving role named "Role2" from the database'
+ #
+ # ====== Form definition test methods ================================================
+ #
+ def test_010_create_request_form_definition( self ):
+ """Testing creating a sequencing request form definition, editing the name and description and adding fields"""
# Logged in as admin_user
# Create a form definition
tmp_name = "Temp form"
@@ -107,23 +113,23 @@ class TestFormsAndRequests( TwillTestCas
# Edit the name and description of the form definition, and add 3 fields.
new_name = "Request Form"
new_desc = "Request Form description"
- global test_field_name1
- test_field_name1 = 'Test field name one'
- global test_field_name2
- test_field_name2 = 'Test field name two'
- global test_field_name3
- test_field_name3 = 'Test field name three'
- field_dicts = [ dict( name=test_field_name1,
- desc='Test field description one',
+ global request_field_name1
+ request_field_name1 = 'Request form field1'
+ global request_field_name2
+ request_field_name2 = 'Request form field2'
+ global request_field_name3
+ request_field_name3 = 'Request form field3'
+ field_dicts = [ dict( name=request_field_name1,
+ desc='Description of '+request_field_name1,
type='SelectField',
required='optional',
selectlist=[ 'option1', 'option2' ] ),
- dict( name=test_field_name2,
- desc='Test field description two',
+ dict( name=request_field_name2,
+ desc='Description of '+request_field_name2,
type='AddressField',
required='optional' ),
- dict( name=test_field_name3,
- desc='Test field description three',
+ dict( name=request_field_name3,
+ desc='Description of '+request_field_name3,
type='TextField',
required='required' ) ]
self.edit_form( id=self.security.encode_id( tmp_form.current.id ),
@@ -134,48 +140,99 @@ class TestFormsAndRequests( TwillTestCas
strings_displayed=[ 'Edit form definition "%s"' % tmp_name ],
strings_displayed_after_submit=[ "The form '%s' has been updated with the changes." % new_name ] )
# Get the form_definition object for later tests
- global form_one
- form_one = get_form( new_name )
- assert form_one is not None, 'Problem retrieving form named "%s" from the database' % new_name
- assert len( form_one.fields ) == len( tmp_form.fields ) + len( field_dicts )
- def test_015_create_sample_form( self ):
- """Testing creating sample form definition"""
+ global request_form_definition1
+ request_form_definition1 = get_form( new_name )
+ assert request_form_definition1 is not None, 'Problem retrieving form named "%s" from the database' % new_name
+ assert len( request_form_definition1.fields ) == len( tmp_form.fields ) + len( field_dicts )
+ # check form view
+ self.view_form( id=self.security.encode_id( request_form_definition1.current.id ),
+ form_name=new_name,
+ form_desc=new_desc,
+ form_type=form_type,
+ field_dicts=field_dicts )
+ def test_015_create_sample_form_definition( self ):
+ """Testing creating sequencing sample form definition and adding fields"""
name = "Sample Form"
- desc = "This is Form Two's description"
+ desc = "This is Sample Form's description"
form_type = galaxy.model.FormDefinition.types.SAMPLE
- form_layout_name = 'Layout Grid One'
+ global sample_form_layout_grid_name
+ sample_form_layout_grid_name = 'Layout Grid1'
self.create_form( name=name,
desc=desc,
form_type=form_type,
- form_layout_name=form_layout_name,
+ form_layout_name=sample_form_layout_grid_name,
+ num_fields=0,
strings_displayed=[ 'Create a new form definition' ],
strings_displayed_after_submit=[ "The form '%s' has been updated with the changes." % name ] )
- global form_two
- form_two = get_form( name )
- assert form_two is not None, "Error retrieving form %s from db" % name
+ tmp_form = get_form( name )
+ # now add fields to the sample form definition
+ global sample_field_name1
+ sample_field_name1 = 'Sample form field1'
+ global sample_field_name2
+ sample_field_name2 = 'Sample form field2'
+ global sample_field_name3
+ sample_field_name3 = 'Sample form field3'
+ field_dicts = [ dict( name=sample_field_name1,
+ desc='Description of '+sample_field_name1,
+ type='SelectField',
+ required='optional',
+ selectlist=[ 'option1', 'option2' ] ),
+ dict( name=sample_field_name2,
+ desc='Description of '+sample_field_name2,
+ type='TextField',
+ required='optional' ),
+ dict( name=sample_field_name3,
+ desc='Description of '+sample_field_name3,
+ type='TextField',
+ required='required' ) ]
+ self.edit_form( id=self.security.encode_id( tmp_form.current.id ),
+ new_form_name=name,
+ new_form_desc=desc,
+ field_dicts=field_dicts,
+ field_index=len( tmp_form.fields ),
+ strings_displayed=[ 'Edit form definition "%s"' % name ],
+ strings_displayed_after_submit=[ "The form '%s' has been updated with the changes." % name ] )
+ global sample_form_definition1
+ sample_form_definition1 = get_form( name )
+ assert sample_form_definition1 is not None, "Error retrieving form %s from db" % name
+ print len( sample_form_definition1.fields ), len( field_dicts )
+ print sample_form_definition1.fields
+ print field_dicts
+ assert len( sample_form_definition1.fields ) == len( field_dicts )
+ # check form view
+ self.view_form( id=self.security.encode_id( sample_form_definition1.current.id ),
+ form_name=name,
+ form_desc=desc,
+ form_type=form_type,
+ form_layout_name=sample_form_layout_grid_name,
+ field_dicts=field_dicts )
def test_020_create_request_type( self ):
"""Testing creating a request_type"""
- request_form = get_form( form_one.name )
- sample_form = get_form( form_two.name )
- name = 'Test Requestype'
+ name = 'Sequencer configuration1'
self.create_request_type( name,
"test sequencer configuration",
- self.security.encode_id( request_form.id ),
- self.security.encode_id( sample_form.id ),
+ self.security.encode_id( request_form_definition1.id ),
+ self.security.encode_id( sample_form_definition1.id ),
sample_states,
strings_displayed=[ 'Create a new sequencer configuration' ],
strings_displayed_after_submit=[ "Sequencer configuration (%s) has been created" % name ] )
global request_type1
request_type1 = get_request_type_by_name( name )
assert request_type1 is not None, 'Problem retrieving sequencer configuration named "%s" from the database' % name
+ # check view
+ self.view_request_type( self.security.encode_id( request_type1.id ),
+ request_type1.name,
+ strings_displayed=[ request_form_definition1.name,
+ sample_form_definition1.name ],
+ sample_states=sample_states)
# Set permissions
permissions_in = [ k for k, v in galaxy.model.RequestType.permitted_actions.items() ]
permissions_out = []
- # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted for
+ # Role1 members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted for
# REQUEST_TYPE_ACCESS on this request_type
self.request_type_permissions( self.security.encode_id( request_type1.id ),
request_type1.name,
- str( role_one.id ),
+ str( role1.id ),
permissions_in,
permissions_out )
# Make sure the request_type1 is not accessible by regular_user2 since regular_user2 does not have Role1.
@@ -189,8 +246,11 @@ class TestFormsAndRequests( TwillTestCas
pass
self.logout()
self.login( email=admin_user.email )
+ #
+ # ====== Sequencing request test methods - User perspective ================
+ #
def test_025_create_request( self ):
- """Testing creating a sequence run request"""
+ """Testing creating a sequencing request as a regular user"""
# logged in as admin_user
# Create a user_address
self.logout()
@@ -200,195 +260,223 @@ class TestFormsAndRequests( TwillTestCas
user_address1 = get_user_address( regular_user1, address_dict[ 'short_desc' ] )
# Set field values - the tuples in the field_values list include the field_value, and True if refresh_on_change
# is required for that field.
- field_value_tuples = [ ( 'option1', False ), ( str( user_address1.id ), True ), ( 'field three value', False ) ]
+ field_value_tuples = [ ( 'option1', False ), ( str( user_address1.id ), True ), ( 'field3 value', False ) ]
# Create the request
- name = 'Request One'
- desc = 'Request One Description'
+ name = 'Request1'
+ desc = 'Request1 Description'
self.create_request( cntrller='requests',
request_type_id=self.security.encode_id( request_type1.id ),
name=name,
desc=desc,
field_value_tuples=field_value_tuples,
strings_displayed=[ 'Create a new sequencing request',
- test_field_name1,
- test_field_name2,
- test_field_name3 ],
+ request_field_name1,
+ request_field_name2,
+ request_field_name3 ],
strings_displayed_after_submit=[ name, desc ] )
- global request_one
- request_one = get_request_by_name( name )
+ global request1
+ request1 = get_request_by_name( name )
# Make sure the request's state is now set to NEW
- assert request_one.state is not request_one.states.NEW, "The state of the request '%s' should be set to '%s'" \
- % ( request_one.name, request_one.states.NEW )
+ assert request1.state is not request1.states.NEW, "The state of the request '%s' should be set to '%s'" \
+ % ( request1.name, request1.states.NEW )
+ # check request page
+ self.view_request( cntrller='requests',
+ request_id=self.security.encode_id( request1.id ),
+ strings_displayed=[ 'Sequencing request "%s"' % request1.name,
+ 'There are no samples.',
+ sample_form_layout_grid_name ],
+ strings_not_displayed=[ request1.states.SUBMITTED,
+ request1.states.COMPLETE,
+ request1.states.REJECTED ] )
+ # check if the request is showing in the 'new' filter
+ self.check_request_grid( cntrller='requests',
+ state=request1.states.NEW,
+ strings_displayed=[ request1.name ] )
+ self.view_request_history( cntrller='requests',
+ request_id=self.security.encode_id( request1.id ),
+ strings_displayed=[ 'History of Sequencing Request "%s"' % request1.name,
+ request1.states.NEW,
+ 'Request created' ],
+ strings_not_displayed=[ request1.states.SUBMITTED,
+ request1.states.COMPLETE,
+ request1.states.REJECTED ] )
+ def test_030_edit_basic_request_info( self ):
+ """Testing editing the basic information of a sequencing request"""
+ # logged in as regular_user1
+ fields = [ 'option2', str( user_address1.id ), 'field3 value (edited)' ]
+ new_name=request1.name + ' (Renamed)'
+ new_desc=request1.desc + ' (Re-described)'
+ self.edit_basic_request_info( request_id=self.security.encode_id( request1.id ),
+ cntrller='requests',
+ name=request1.name,
+ new_name=new_name,
+ new_desc=new_desc,
+ new_fields=fields,
+ strings_displayed=[ 'Edit sequencing request "%s"' % request1.name ],
+ strings_displayed_after_submit=[ new_name, new_desc ] )
+ refresh( request1 )
+ def test_035_add_samples_to_request( self ):
+ """Testing adding samples to request"""
+ # logged in as regular_user1
# Sample fields - the tuple represents a sample name and a list of sample form field values
- sample_value_tuples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ),
- ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ]
+ sample_value_tuples = [ ( 'Sample1', [ 'option1', 'sample1 field2 value', 'sample1 field3 value' ] ),
+ ( 'Sample2', [ 'option2', 'sample2 field2 value', 'sample2 field3 value' ] ),
+ ( 'Sample3', [ 'option1', 'sample3 field2 value', 'sample3 field3 value' ] ) ]
strings_displayed_after_submit = [ 'Unsubmitted' ]
for sample_name, field_values in sample_value_tuples:
strings_displayed_after_submit.append( sample_name )
# Add samples to the request
self.add_samples( cntrller='requests',
- request_id=self.security.encode_id( request_one.id ),
- request_name=request_one.name,
+ request_id=self.security.encode_id( request1.id ),
+ request_name=request1.name,
sample_value_tuples=sample_value_tuples,
- strings_displayed=[ 'There are no samples.' ],
+ strings_displayed=[ 'Add Samples to Request "%s"' % request1.name,
+ '<input type="text" name="sample_0_name" value="Sample_1" size="10"/>' ], # sample name input field
strings_displayed_after_submit=strings_displayed_after_submit )
- def test_030_edit_basic_request_info( self ):
- """Testing editing the basic information of a sequence run request"""
- # logged in as regular_user1
- fields = [ 'option2', str( user_address1.id ), 'field three value (edited)' ]
- new_name=request_one.name + ' (Renamed)'
- new_desc=request_one.desc + ' (Re-described)'
- self.edit_basic_request_info( request_id=self.security.encode_id( request_one.id ),
- cntrller='requests',
- name=request_one.name,
- new_name=new_name,
- new_desc=new_desc,
- new_fields=fields,
- strings_displayed=[ 'Edit sequencing request "%s"' % request_one.name ],
- strings_displayed_after_submit=[ new_name, new_desc ] )
- refresh( request_one )
- # check if the request is showing in the 'new' filter
- self.check_request_grid( cntrller='requests',
- state=request_one.states.NEW,
- strings_displayed=[ request_one.name ] )
- def test_035_submit_request( self ):
- """Testing editing a sequence run request"""
- # logged in as regular_user1
- self.submit_request( cntrller='requests',
- request_id=self.security.encode_id( request_one.id ),
- request_name=request_one.name,
- strings_displayed_after_submit=[ 'The request has been submitted.' ] )
- refresh( request_one )
- # Make sure the request is showing in the 'submitted' filter
- self.check_request_grid( cntrller='requests',
- state=request_one.states.SUBMITTED,
- strings_displayed=[ request_one.name ] )
- # Make sure the request's state is now set to 'submitted'
- assert request_one.state is not request_one.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" \
- % ( request_one.name, request_one.states.SUBMITTED )
- def test_040_request_lifecycle( self ):
- """Testing request life-cycle as it goes through all the states"""
- # logged in as regular_user1
- self.logout()
- self.login( email=admin_user.email )
- self.check_request_grid( cntrller='requests_admin',
- state=request_one.states.SUBMITTED,
- strings_displayed=[ request_one.name ] )
- self.visit_url( "%s/requests_common/view_request?cntrller=requests&id=%s" % ( self.url, self.security.encode_id( request_one.id ) ) )
- # TODO: add some string for checking on the page above...
- # Set bar codes for the samples
- bar_codes = [ '1234567890', '0987654321' ]
- strings_displayed_after_submit=[ 'Changes made to the samples have been saved.' ]
- for bar_code in bar_codes:
- strings_displayed_after_submit.append( bar_code )
- self.add_bar_codes( request_id=self.security.encode_id( request_one.id ),
- request_name=request_one.name,
- bar_codes=bar_codes,
- samples=request_one.samples,
- strings_displayed_after_submit=strings_displayed_after_submit )
- # Change the states of all the samples of this request to ultimately be COMPLETE
- self.change_sample_state( request_id=self.security.encode_id( request_one.id ),
- request_name=request_one.name,
- sample_names=[ sample.name for sample in request_one.samples ],
- sample_ids=[ sample.id for sample in request_one.samples ],
- new_sample_state_id=request_type1.states[1].id,
- new_state_name=request_type1.states[1].name )
- self.change_sample_state( request_id=self.security.encode_id( request_one.id ),
- request_name=request_one.name,
- sample_names=[ sample.name for sample in request_one.samples ],
- sample_ids=[ sample.id for sample in request_one.samples ],
- new_sample_state_id=request_type1.states[2].id,
- new_state_name=request_type1.states[2].name )
- refresh( request_one )
- self.logout()
- self.login( email=regular_user1.email )
- # check if the request's state is now set to 'complete'
- self.check_request_grid( cntrller='requests',
- state='Complete',
- strings_displayed=[ request_one.name ] )
- assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" \
- % ( request_one.name, request_one.states.COMPLETE )
-
- def test_045_admin_create_request_on_behalf_of_regular_user( self ):
- """Testing creating and submitting a request as an admin on behalf of a regular user"""
- # Logged in as regular_user1
- self.logout()
- self.login( email=admin_user.email )
- # Create the request
- name = "RequestTwo"
- desc = 'Request Two Description'
- # Set field values - the tuples in the field_values list include the field_value, and True if refresh_on_change
- # is required for that field.
- field_value_tuples = [ ( 'option2', False ), ( str( user_address1.id ), True ), ( 'field_2_value', False ) ]
- self.create_request( cntrller='requests_admin',
- request_type_id=self.security.encode_id( request_type1.id ),
- other_users_id=self.security.encode_id( regular_user1.id ),
- name=name,
- desc=desc,
- field_value_tuples=field_value_tuples,
- strings_displayed=[ 'Create a new sequencing request',
- test_field_name1,
- test_field_name2,
- test_field_name3 ],
- strings_displayed_after_submit=[ "The request has been created." ] )
- global request_two
- request_two = get_request_by_name( name )
- # Make sure the request is showing in the 'new' filter
- self.check_request_grid( cntrller='requests_admin',
- state=request_two.states.NEW,
- strings_displayed=[ request_two.name ] )
- # Make sure the request's state is now set to 'new'
- assert request_two.state is not request_two.states.NEW, "The state of the request '%s' should be set to '%s'" \
- % ( request_two.name, request_two.states.NEW )
- # Sample fields - the tuple represents a sample name and a list of sample form field values
- sample_value_tuples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ),
- ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ]
- strings_displayed_after_submit = [ 'Unsubmitted' ]
- for sample_name, field_values in sample_value_tuples:
- strings_displayed_after_submit.append( sample_name )
- # Add samples to the request
- self.add_samples( cntrller='requests_admin',
- request_id=self.security.encode_id( request_two.id ),
- request_name=request_two.name,
- sample_value_tuples=sample_value_tuples,
- strings_displayed=[ 'There are no samples.' ],
- strings_displayed_after_submit=strings_displayed_after_submit )
- # Submit the request
- self.submit_request( cntrller='requests_admin',
- request_id=self.security.encode_id( request_two.id ),
- request_name=request_two.name,
- strings_displayed_after_submit=[ 'The request has been submitted.' ] )
- refresh( request_two )
- # Make sure the request is showing in the 'submitted' filter
- self.check_request_grid( cntrller='requests_admin',
- state=request_two.states.SUBMITTED,
- strings_displayed=[ request_two.name ] )
- # Make sure the request's state is now set to 'submitted'
- assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" \
- % ( request_two.name, request_two.states.SUBMITTED )
- # Make sure both requests are showing in the 'All' filter
- self.check_request_grid( cntrller='requests_admin',
- state='All',
- strings_displayed=[ request_one.name, request_two.name ] )
- def test_050_reject_request( self ):
- """Testing rejecting a request"""
- # Logged in as admin_user
- self.reject_request( request_id=self.security.encode_id( request_two.id ),
- request_name=request_two.name,
- comment="Rejection test comment",
- strings_displayed=[ 'Reject Sequencing Request "%s"' % request_two.name ],
- strings_displayed_after_submit=[ 'Request (%s) has been rejected.' % request_two.name ] )
- refresh( request_two )
- # Make sure the request is showing in the 'rejected' filter
- self.check_request_grid( cntrller='requests_admin',
- state=request_two.states.REJECTED,
- strings_displayed=[ request_two.name ] )
- # Make sure the request's state is now set to REJECTED
- assert request_two.state is not request_two.states.REJECTED, "The state of the request '%s' should be set to '%s'" \
- % ( request_two.name, request_two.states.REJECTED )
+# def test_040_edit_samples_of_new_request( self ):
+# """Testing editing the sample information of new request1"""
+# # logged in as regular_user1
+# pass
+# def test_035_submit_request( self ):
+# """Testing editing a sequence run request"""
+# # logged in as regular_user1
+# self.submit_request( cntrller='requests',
+# request_id=self.security.encode_id( request1.id ),
+# request_name=request1.name,
+# strings_displayed_after_submit=[ 'The request has been submitted.' ] )
+# refresh( request1 )
+# # Make sure the request is showing in the 'submitted' filter
+# self.check_request_grid( cntrller='requests',
+# state=request1.states.SUBMITTED,
+# strings_displayed=[ request1.name ] )
+# # Make sure the request's state is now set to 'submitted'
+# assert request1.state is not request1.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" \
+# % ( request1.name, request1.states.SUBMITTED )
+# def test_040_request_lifecycle( self ):
+# """Testing request life-cycle as it goes through all the states"""
+# # logged in as regular_user1
+# self.logout()
+# self.login( email=admin_user.email )
+# self.check_request_grid( cntrller='requests_admin',
+# state=request1.states.SUBMITTED,
+# strings_displayed=[ request1.name ] )
+# self.visit_url( "%s/requests_common/view_request?cntrller=requests&id=%s" % ( self.url, self.security.encode_id( request1.id ) ) )
+# # TODO: add some string for checking on the page above...
+# # Set bar codes for the samples
+# bar_codes = [ '1234567890', '0987654321' ]
+# strings_displayed_after_submit=[ 'Changes made to the samples have been saved.' ]
+# for bar_code in bar_codes:
+# strings_displayed_after_submit.append( bar_code )
+# self.add_bar_codes( request_id=self.security.encode_id( request1.id ),
+# request_name=request1.name,
+# bar_codes=bar_codes,
+# samples=request1.samples,
+# strings_displayed_after_submit=strings_displayed_after_submit )
+# # Change the states of all the samples of this request to ultimately be COMPLETE
+# self.change_sample_state( request_id=self.security.encode_id( request1.id ),
+# request_name=request1.name,
+# sample_names=[ sample.name for sample in request1.samples ],
+# sample_ids=[ sample.id for sample in request1.samples ],
+# new_sample_state_id=request_type1.states[1].id,
+# new_state_name=request_type1.states[1].name )
+# self.change_sample_state( request_id=self.security.encode_id( request1.id ),
+# request_name=request1.name,
+# sample_names=[ sample.name for sample in request1.samples ],
+# sample_ids=[ sample.id for sample in request1.samples ],
+# new_sample_state_id=request_type1.states[2].id,
+# new_state_name=request_type1.states[2].name )
+# refresh( request1 )
+# self.logout()
+# self.login( email=regular_user1.email )
+# # check if the request's state is now set to 'complete'
+# self.check_request_grid( cntrller='requests',
+# state='Complete',
+# strings_displayed=[ request1.name ] )
+# assert request1.state is not request1.states.COMPLETE, "The state of the request '%s' should be set to '%s'" \
+# % ( request1.name, request1.states.COMPLETE )
+#
+# def test_045_admin_create_request_on_behalf_of_regular_user( self ):
+# """Testing creating and submitting a request as an admin on behalf of a regular user"""
+# # Logged in as regular_user1
+# self.logout()
+# self.login( email=admin_user.email )
+# # Create the request
+# name = "Request2"
+# desc = 'Request2 Description'
+# # Set field values - the tuples in the field_values list include the field_value, and True if refresh_on_change
+# # is required for that field.
+# field_value_tuples = [ ( 'option2', False ), ( str( user_address1.id ), True ), ( 'field_2_value', False ) ]
+# self.create_request( cntrller='requests_admin',
+# request_type_id=self.security.encode_id( request_type1.id ),
+# other_users_id=self.security.encode_id( regular_user1.id ),
+# name=name,
+# desc=desc,
+# field_value_tuples=field_value_tuples,
+# strings_displayed=[ 'Create a new sequencing request',
+# request_field_name1,
+# request_field_name2,
+# request_field_name3 ],
+# strings_displayed_after_submit=[ "The request has been created." ] )
+# global request2
+# request2 = get_request_by_name( name )
+# # Make sure the request is showing in the 'new' filter
+# self.check_request_grid( cntrller='requests_admin',
+# state=request2.states.NEW,
+# strings_displayed=[ request2.name ] )
+# # Make sure the request's state is now set to 'new'
+# assert request2.state is not request2.states.NEW, "The state of the request '%s' should be set to '%s'" \
+# % ( request2.name, request2.states.NEW )
+# # Sample fields - the tuple represents a sample name and a list of sample form field values
+# sample_value_tuples = [ ( 'Sample1', [ 'S1 Field 0 Value' ] ),
+# ( 'Sample2', [ 'S2 Field 0 Value' ] ) ]
+# strings_displayed_after_submit = [ 'Unsubmitted' ]
+# for sample_name, field_values in sample_value_tuples:
+# strings_displayed_after_submit.append( sample_name )
+# # Add samples to the request
+# self.add_samples( cntrller='requests_admin',
+# request_id=self.security.encode_id( request2.id ),
+# request_name=request2.name,
+# sample_value_tuples=sample_value_tuples,
+# strings_displayed=[ 'There are no samples.' ],
+# strings_displayed_after_submit=strings_displayed_after_submit )
+# # Submit the request
+# self.submit_request( cntrller='requests_admin',
+# request_id=self.security.encode_id( request2.id ),
+# request_name=request2.name,
+# strings_displayed_after_submit=[ 'The request has been submitted.' ] )
+# refresh( request2 )
+# # Make sure the request is showing in the 'submitted' filter
+# self.check_request_grid( cntrller='requests_admin',
+# state=request2.states.SUBMITTED,
+# strings_displayed=[ request2.name ] )
+# # Make sure the request's state is now set to 'submitted'
+# assert request2.state is not request2.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" \
+# % ( request2.name, request2.states.SUBMITTED )
+# # Make sure both requests are showing in the 'All' filter
+# self.check_request_grid( cntrller='requests_admin',
+# state='All',
+# strings_displayed=[ request1.name, request2.name ] )
+# def test_050_reject_request( self ):
+# """Testing rejecting a request"""
+# # Logged in as admin_user
+# self.reject_request( request_id=self.security.encode_id( request2.id ),
+# request_name=request2.name,
+# comment="Rejection test comment",
+# strings_displayed=[ 'Reject Sequencing Request "%s"' % request2.name ],
+# strings_displayed_after_submit=[ 'Request (%s) has been rejected.' % request2.name ] )
+# refresh( request2 )
+# # Make sure the request is showing in the 'rejected' filter
+# self.check_request_grid( cntrller='requests_admin',
+# state=request2.states.REJECTED,
+# strings_displayed=[ request2.name ] )
+# # Make sure the request's state is now set to REJECTED
+# assert request2.state is not request2.states.REJECTED, "The state of the request '%s' should be set to '%s'" \
+# % ( request2.name, request2.states.REJECTED )
def test_055_reset_data_for_later_test_runs( self ):
"""Reseting data to enable later test runs to pass"""
# Logged in as admin_user
+ self.logout()
+ self.login( email=admin_user.email )
##################
# Delete request_type permissions
##################
@@ -402,12 +490,12 @@ class TestFormsAndRequests( TwillTestCas
##################
# Mark all requests deleted
##################
- for request in [ request_one, request_two ]:
+ for request in [ request1 ]:
mark_obj_deleted( request )
##################
# Mark all forms deleted
##################
- for form in [ form_one, form_two ]:
+ for form in [ request_form_definition1, sample_form_definition1 ]:
self.mark_form_deleted( self.security.encode_id( form.current.id ) )
##################
# Mark all user_addresses deleted
@@ -417,18 +505,18 @@ class TestFormsAndRequests( TwillTestCas
##################
# Delete all non-private roles
##################
- for role in [ role_one, role_two ]:
+ for role in [ role1, role2 ]:
self.mark_role_deleted( self.security.encode_id( role.id ), role.name )
self.purge_role( self.security.encode_id( role.id ), role.name )
# Manually delete the role from the database
refresh( role )
- delete( role )
+ delete_obj( role )
##################
# Delete all groups
##################
- for group in [ group_one ]:
+ for group in [ group1 ]:
self.mark_group_deleted( self.security.encode_id( group.id ), group.name )
self.purge_group( self.security.encode_id( group.id ), group.name )
# Manually delete the group from the database
refresh( group )
- delete( group )
+ delete_obj( group )
--- a/test/base/twilltestcase.py
+++ b/test/base/twilltestcase.py
@@ -870,6 +870,14 @@ class TwillTestCase( unittest.TestCase )
fname = self.write_temp_file( page )
errmsg = "no match to '%s'\npage content written to '%s'" % ( patt, fname )
raise AssertionError( errmsg )
+
+ def check_string_not_in_page( self, patt ):
+ """Checks to make sure 'patt' is NOT in the page."""
+ page = self.last_page()
+ if page.find( patt ) != -1:
+ fname = self.write_temp_file( page )
+ errmsg = "string (%s) incorrectly displayed in page.\npage content written to '%s'" % ( patt, fname )
+ raise AssertionError( errmsg )
def write_temp_file( self, content, suffix='.html' ):
fd, fname = tempfile.mkstemp( suffix=suffix, prefix='twilltestcase-' )
@@ -1330,6 +1338,9 @@ class TwillTestCase( unittest.TestCase )
if form_type == "Sequencing Sample Form":
tc.submit( "add_layout_grid" )
tc.fv( "1", "grid_layout0", form_layout_name )
+ # if not adding any fields at this time, remove the default empty field
+ if num_fields == 0:
+ tc.submit( "remove_button" )
# Add fields to the new form definition
for index1 in range( num_fields ):
field_name = 'field_name_%i' % index1
@@ -1357,9 +1368,8 @@ class TwillTestCase( unittest.TestCase )
else:
tc.fv( "1", "field_type_0", field_type )
tc.fv( "1", field_default, field_default_contents )
+ # All done... now save
tc.submit( "save_changes_button" )
- if num_fields == 0:
- self.visit_url( "%s/forms/manage" % self.url )
for check_str in strings_displayed_after_submit:
self.check_page_for_string( check_str )
self.home()
@@ -1392,7 +1402,7 @@ class TwillTestCase( unittest.TestCase )
# SelectFields require a refresh_on_change
self.refresh_form( field_type, field_type_value )
for option_index, option in enumerate( field_dict[ 'selectlist' ] ):
- tc.submit( "addoption_0" )
+ tc.submit( "addoption_%i" % index )
tc.fv( "1", "field_%i_option_%i" % ( index, option_index ), option )
else:
tc.fv( "1", field_type, field_type_value )
@@ -1400,6 +1410,22 @@ class TwillTestCase( unittest.TestCase )
for check_str in strings_displayed_after_submit:
self.check_page_for_string( check_str )
self.home()
+ def view_form( self, id, form_type='', form_name='', form_desc='', form_layout_name='', field_dicts=[] ):
+ '''View form details'''
+ self.home()
+ self.visit_url( "%s/forms/manage?operation=view&id=%s" % ( self.url, id ) )
+ self.check_page_for_string( form_type )
+ self.check_page_for_string( form_name )
+ self.check_page_for_string( form_desc )
+ self.check_page_for_string( form_layout_name )
+ for i, field_dict in enumerate( field_dicts ):
+ self.check_page_for_string( field_dict[ 'name' ] )
+ self.check_page_for_string( field_dict[ 'desc' ] )
+ self.check_page_for_string( field_dict[ 'type' ] )
+ if field_dict[ 'type' ].lower() == 'selectfield':
+ for option_index, option in enumerate( field_dict[ 'selectlist' ] ):
+ self.check_page_for_string( option )
+ self.home()
def mark_form_deleted( self, form_id ):
"""Mark a form_definition as deleted"""
self.home()
@@ -1445,6 +1471,17 @@ class TwillTestCase( unittest.TestCase )
check_str = "Permissions updated for sequencer configuration '%s'" % request_type_name
self.check_page_for_string( check_str )
self.home()
+ def view_request_type( self, request_type_id, request_type_name, sample_states, strings_displayed=[] ):
+ '''View request_type details'''
+ self.home()
+ self.visit_url( "%s/requests_admin/browse_request_types?operation=view&id=%s" % ( self.url, request_type_id ) )
+ self.check_page_for_string( 'Sequencer configuration information' )
+ self.check_page_for_string( request_type_name )
+ for name, desc in sample_states:
+ self.check_page_for_string( name )
+ self.check_page_for_string( desc )
+ for check_str in strings_displayed:
+ self.check_page_for_string( check_str )
def create_request( self, cntrller, request_type_id, name, desc, field_value_tuples, other_users_id='',
strings_displayed=[], strings_displayed_after_submit=[] ):
self.visit_url( "%s/requests_common/create_request?cntrller=%s" % ( self.url, cntrller ) )
@@ -1473,6 +1510,18 @@ class TwillTestCase( unittest.TestCase )
for check_str in strings_displayed_after_submit:
self.check_page_for_string( check_str )
self.home()
+ def view_request( self, cntrller, request_id, strings_displayed=[], strings_not_displayed=[] ):
+ self.visit_url( "%s/%s/browse_requests?operation=view_request&id=%s" % ( self.url, cntrller, request_id ) )
+ for check_str in strings_displayed:
+ self.check_page_for_string( check_str )
+ for check_str in strings_not_displayed:
+ self.check_string_not_in_page( check_str )
+ def view_request_history( self, cntrller, request_id, strings_displayed=[], strings_not_displayed=[] ):
+ self.visit_url( "%s/requests_common/request_events?cntrller=%s&id=%s" % ( self.url, cntrller, request_id ) )
+ for check_str in strings_displayed:
+ self.check_page_for_string( check_str )
+ for check_str in strings_not_displayed:
+ self.check_string_not_in_page( check_str )
def edit_basic_request_info( self, cntrller, request_id, name, new_name='', new_desc='', new_fields=[],
strings_displayed=[], strings_displayed_after_submit=[] ):
self.visit_url( "%s/requests_common/edit_basic_request_info?cntrller=%s&id=%s" % ( self.url, cntrller, request_id ) )
@@ -1489,40 +1538,22 @@ class TwillTestCase( unittest.TestCase )
for check_str in strings_displayed_after_submit:
self.check_page_for_string( check_str )
def add_samples( self, cntrller, request_id, request_name, sample_value_tuples, strings_displayed=[], strings_displayed_after_submit=[] ):
- self.visit_url( "%s/requests_common/edit_samples?cntrller=%s&id=%s&editing_samples=False" % ( self.url, cntrller, request_id ) )
+ url = "%s/requests_common/add_sample?cntrller=%s&request_id=%s&add_sample_button=Add+sample" % ( self.url, cntrller, request_id )
+ self.visit_url( url )
for check_str in strings_displayed:
self.check_page_for_string( check_str )
- # Simulate clicking the add-sample_button on the form. (gvk: 9/21/10 - TODO : There must be a bug in the mako template
- # because twill cannot find any forms on the page, but I cannot find it although I've spent time cleaning up the
- # template code and looking for any problems.
- url = "%s/requests_common/edit_samples?cntrller=%s&id=%s&editing_samples=False" % ( self.url, cntrller, request_id )
- # This should work, but although twill does not thorw any exceptions, the button click never occurs
- # There are multiple forms on this page, and we'll only be using the form named edit_samples.
- # for sample_index, sample_value_tuple in enumerate( sample_value_tuples ):
- # # Add the following form value to the already populated hidden field so that the edit_samples
- # # form is the current form
- # tc.fv( "1", "id", request_id )
- # tc.submit( 'add_sample_button' )
- for sample_index, sample_value_tuple in enumerate( sample_value_tuples ):
- sample_name, field_values = sample_value_tuple
- sample_name = sample_name.replace( ' ', '+' )
- field_name = "sample_%i_name" % sample_index
- # The following form_value setting should work but since twill barfed on submitting the add_sample_button
- # above, we have to simulate it by appending to the url.
- # tc.fv( "1", field_name, sample_name )
- url += "&%s=%s" % ( field_name, sample_name )
- for field_index, field_value in enumerate( field_values ):
- field_name = "sample_%i_field_%i" % ( sample_index, field_index )
- field_value = field_value.replace( ' ', '+' )
- # The following form_value setting should work but since twill barfed on submitting the add_sample_button
- # above, we have to simulate it by appending to the url.
- # tc.fv( "1", field_name, field_value )
- url += "&%s=%s" % ( field_name , field_value )
- # The following button submit should work but since twill barfed on submitting the add_sample_button
- # above, we have to simulate it by appending to the url.
- # tc.submit( "save_samples_button" )
- url += "&save_samples_button=Save"
- self.visit_url( url )
+ for sample_index, sample_info in enumerate( sample_value_tuples ):
+ sample_name = sample_info[0]
+ sample_field_values = sample_info[1]
+ tc.fv( "1", "sample_%i_name" % sample_index, sample_name )
+ for field_index, field_value in enumerate( sample_field_values ):
+ tc.fv( "1", "sample_%i_field_%i" % ( sample_index, field_index ), field_value )
+ # Do not click on Add sample button when all the sample have been added
+ if sample_index < len( sample_value_tuples ) - 1:
+ tc.submit( "add_sample_button" )
+ # select the correct form before submitting it
+ tc.fv( "1", "copy_sample_index", "-1" )
+ tc.submit( "save_samples_button" )
for check_str in strings_displayed_after_submit:
self.check_page_for_string( check_str )
def submit_request( self, cntrller, request_id, request_name, strings_displayed_after_submit=[] ):
--- a/templates/requests/common/edit_samples.mako
+++ b/templates/requests/common/edit_samples.mako
@@ -136,8 +136,10 @@
%endif
<p/><div class="form-row">
+ ## hidden element to make twill work.
+ <input type="hidden" name="hidden_input" value=""/>
%if ( request.samples or current_samples ) and ( editing_samples or len( current_samples ) > len( request.samples ) ):
- <input type="submit" name="add_sample_button" value="Add sample"/>
+ <input type="submit" name="add_sample_button" value="Add sample" /><input type="submit" name="save_samples_button" value="Save"/><input type="submit" name="cancel_changes_button" value="Cancel"/><div class="toolParamHelp" style="clear: both;">
1
0
galaxy-dist commit 2f02897723c2: Updated Samtools test files to work with version 0.1.9 and cleaned up some formatting and comments in the wrappers
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kelly Vincent <kpvincent(a)bx.psu.edu>
# Date 1289246454 18000
# Node ID 2f02897723c2f3c1d0d7be8c14f4c664409e1c59
# Parent 1ebd342fb4eb29c095b19a960503402f75cbe944
Updated Samtools test files to work with version 0.1.9 and cleaned up some formatting and comments in the wrappers
--- a/tools/samtools/sam_merge.xml
+++ b/tools/samtools/sam_merge.xml
@@ -4,7 +4,7 @@
<requirement type="package">samtools</requirement></requirements><command interpreter="python">
- sam_merge.py
+ sam_merge.py
$input1
$output1
$input2
@@ -40,7 +40,7 @@
<test><!--
Bam merge command:
- samtools merge test-data/sam_merge_out2.bam test-data/sam_merge_in1.bam test-data/sam_merge_in2.bam test-data/sam_merge_in3.bam
+ samtools merge sam_merge_out2.bam test-data/sam_merge_in1.bam test-data/sam_merge_in2.bam test-data/sam_merge_in3.bam
--><param name="input1" value="sam_merge_in1.bam" ftype="bam" /><param name="input2" value="sam_merge_in2.bam" ftype="bam" />
--- a/tools/samtools/sam_to_bam.xml
+++ b/tools/samtools/sam_to_bam.xml
@@ -4,13 +4,16 @@
<requirement type="package">samtools</requirement></requirements><command interpreter="python">
-sam_to_bam.py --input1=$source.input1 --dbkey=${input1.metadata.dbkey}
-#if $source.index_source == "history":
---ref_file=$source.ref_file
-#else
---ref_file="None"
-#end if
---output1=$output1 --index_dir=${GALAXY_DATA_INDEX_DIR}
+ sam_to_bam.py
+ --input1=$source.input1
+ --dbkey=${input1.metadata.dbkey}
+ #if $source.index_source == "history":
+ --ref_file=$source.ref_file
+ #else
+ --ref_file="None"
+ #end if
+ --output1=$output1
+ --index_dir=${GALAXY_DATA_INDEX_DIR}
</command><inputs><conditional name="source">
--- a/test-data/sam_pileup_out2.pileup
+++ b/test-data/sam_pileup_out2.pileup
@@ -1,224 +1,224 @@
-chrM 23 A A 25 0 25 1 ^:. I
-chrM 24 A A 25 0 25 1 . I
-chrM 25 G G 25 0 25 1 . I
-chrM 26 C C 25 0 25 1 . I
-chrM 27 A A 25 0 25 1 . I
-chrM 28 A A 25 0 25 1 . I
-chrM 29 G G 25 0 25 1 . I
-chrM 30 G A 4 4 25 1 N "
-chrM 31 C A 4 4 25 1 N "
-chrM 32 A A 25 0 25 1 . I
-chrM 33 C C 25 0 25 1 . I
-chrM 34 T T 25 0 25 1 . I
-chrM 35 G G 25 0 25 1 . I
-chrM 36 A A 25 0 25 1 . I
-chrM 37 A A 25 0 25 1 . I
-chrM 38 A A 25 0 25 1 . I
-chrM 39 A A 25 0 25 1 . I
-chrM 40 T T 25 0 25 1 . I
-chrM 41 G G 25 0 25 1 . I
-chrM 42 C C 25 0 25 1 . I
-chrM 43 C C 25 0 25 1 . I
-chrM 44 T T 25 0 25 1 . I
-chrM 45 A A 25 0 25 1 . I
-chrM 46 G G 25 0 25 1 . I
-chrM 47 A A 25 0 25 1 . E
-chrM 48 T T 25 0 25 1 . I
-chrM 49 G G 25 0 25 1 . I
-chrM 50 A A 25 0 25 1 . I
-chrM 51 G G 25 0 25 1 . I
-chrM 52 T T 25 0 25 1 . I
-chrM 53 A A 25 0 25 1 . I
-chrM 54 T T 25 0 25 1 . I
-chrM 55 T T 25 0 25 1 . I
-chrM 56 C C 25 0 25 1 . I
-chrM 57 T T 25 0 25 1 . I
-chrM 58 T T 25 0 25 1 .$ I
-chrM 96 T T 25 0 25 1 ^:. I
-chrM 97 T T 25 0 25 1 . I
-chrM 98 A A 25 0 25 1 . I
-chrM 99 G G 25 0 25 1 . I
-chrM 100 T T 25 0 25 1 . I
-chrM 101 T T 25 0 25 1 . I
-chrM 102 A A 25 0 25 1 . I
-chrM 103 T A 4 4 25 1 N "
-chrM 104 T A 4 4 25 1 N "
-chrM 105 A A 25 0 25 1 . I
-chrM 106 A A 25 0 25 1 . I
-chrM 107 T T 25 0 25 1 . I
-chrM 108 A A 25 0 25 1 . I
-chrM 109 G G 25 0 25 1 . I
-chrM 110 A A 25 0 25 1 . I
-chrM 111 A A 25 0 25 1 . I
-chrM 112 T T 25 0 25 1 . I
-chrM 113 T T 25 0 25 1 . I
-chrM 114 A A 25 0 25 1 . I
-chrM 115 C C 25 0 25 1 . I
-chrM 116 A A 25 0 25 1 . I
-chrM 117 C C 25 0 25 1 . I
-chrM 118 A A 25 0 25 1 . H
-chrM 119 T T 25 0 25 1 . I
-chrM 120 G G 25 0 25 1 . I
-chrM 121 C C 25 0 25 1 . I
-chrM 122 A A 25 0 25 1 . E
-chrM 123 A A 25 0 25 1 . I
-chrM 124 G G 20 0 25 1 . 5
-chrM 125 T T 25 0 25 1 . I
-chrM 126 A A 25 0 25 1 . I
-chrM 127 T T 25 0 25 1 . I
-chrM 128 C C 25 0 25 1 . I
-chrM 129 C C 25 0 25 1 . I
-chrM 130 G G 19 0 25 1 . 4
-chrM 131 C C 25 0 25 1 .$ I
-chrM 492 A A 25 0 25 1 ^:, I
-chrM 493 A A 25 0 25 1 , I
-chrM 494 A A 25 0 25 1 , I
-chrM 495 C C 25 0 25 1 , E
-chrM 496 T T 25 0 25 1 , I
-chrM 497 G G 25 0 25 1 , I
-chrM 498 G G 25 0 25 1 , I
-chrM 499 G G 25 0 25 1 , I
-chrM 500 A A 25 0 25 1 , I
-chrM 501 T T 25 0 25 1 , I
-chrM 502 T T 25 0 25 1 , I
-chrM 503 A A 25 0 25 1 , I
-chrM 504 G G 25 0 25 1 , I
-chrM 505 A A 25 0 25 1 , I
-chrM 506 T T 25 0 25 1 , I
-chrM 507 A A 25 0 25 1 , I
-chrM 508 C C 25 0 25 1 , I
-chrM 509 C C 25 0 25 1 , I
-chrM 510 C C 25 0 25 1 , I
-chrM 511 C C 25 0 25 1 , I
-chrM 512 A A 25 0 25 1 , I
-chrM 513 C C 25 0 25 1 , I
-chrM 514 T T 25 0 25 1 , I
-chrM 515 A A 25 0 25 1 , I
-chrM 516 T T 25 0 25 1 , I
-chrM 517 G G 25 0 25 1 , I
-chrM 518 C C 25 0 25 1 , I
-chrM 519 T A 4 4 25 1 n "
-chrM 520 T A 4 4 25 1 n "
-chrM 521 A A 25 0 25 1 , I
-chrM 522 G G 25 0 25 1 , I
-chrM 523 C C 25 0 25 1 , I
-chrM 524 C C 25 0 25 1 , I
-chrM 525 C C 25 0 25 1 , I
-chrM 526 T T 25 0 25 1 , I
-chrM 527 A A 25 0 25 1 ,$ I
-chrM 893 G G 21 0 25 1 ^:, 6
-chrM 894 C C 15 0 25 1 , 0
-chrM 895 T T 19 0 25 1 , 4
-chrM 896 T T 25 0 25 1 , I
-chrM 897 A A 25 0 25 1 , I
-chrM 898 A A 25 0 25 1 , I
-chrM 899 T T 25 0 25 1 , ?
-chrM 900 T T 25 0 25 1 , I
-chrM 901 G G 25 0 25 1 , I
-chrM 902 A A 25 0 25 1 , I
-chrM 903 A A 25 0 25 1 , I
-chrM 904 T T 25 0 25 1 , <
-chrM 905 C C 25 0 25 1 , I
-chrM 906 A A 25 0 25 1 , I
-chrM 907 G G 25 0 25 1 , I
-chrM 908 G G 25 0 25 1 , I
-chrM 909 C C 25 0 25 1 , I
-chrM 910 C C 25 0 25 1 , I
-chrM 911 A A 25 0 25 1 , I
-chrM 912 T T 25 0 25 1 , I
-chrM 913 G G 25 0 25 1 , I
-chrM 914 A A 25 0 25 1 , I
-chrM 915 A A 25 0 25 1 , I
-chrM 916 G G 25 0 25 1 , I
-chrM 917 C C 25 0 25 1 , I
-chrM 918 G G 25 0 25 1 , I
-chrM 919 C C 25 0 25 1 , I
-chrM 920 G A 4 4 25 1 n "
-chrM 921 C A 4 4 25 1 n "
-chrM 922 A A 25 0 25 1 , I
-chrM 923 C C 25 0 25 1 , I
-chrM 924 A A 25 0 25 1 , I
-chrM 925 C C 25 0 25 1 , I
-chrM 926 A A 25 0 25 1 , I
-chrM 927 C C 25 0 25 1 , I
-chrM 928 C C 25 0 25 1 ,$ I
-chrM 1159 T T 25 0 25 1 ^:. I
-chrM 1160 T T 25 0 25 1 . I
-chrM 1161 A A 25 0 25 1 . I
-chrM 1162 A A 25 0 25 1 . I
-chrM 1163 C C 25 0 25 1 . I
-chrM 1164 T T 25 0 25 1 . I
-chrM 1165 A A 25 0 25 1 . I
-chrM 1166 A A 4 0 25 1 N "
-chrM 1167 A A 4 0 25 1 N "
-chrM 1168 A A 25 0 25 1 . I
-chrM 1169 C C 25 0 25 1 . I
-chrM 1170 A A 25 0 25 1 . I
-chrM 1171 T T 25 0 25 1 . I
-chrM 1172 T T 25 0 25 1 . I
-chrM 1173 C C 25 0 25 1 . I
-chrM 1174 A A 25 0 25 1 . I
-chrM 1175 C C 25 0 25 1 . I
-chrM 1176 C C 25 0 25 1 . I
-chrM 1177 A A 25 0 25 1 . I
-chrM 1178 A A 25 0 25 1 . I
-chrM 1179 A A 25 0 25 1 . A
-chrM 1180 C C 25 0 25 1 . I
-chrM 1181 C C 25 0 25 1 . I
-chrM 1182 A A 25 0 25 1 . =
-chrM 1183 T T 25 0 25 1 . I
-chrM 1184 T T 25 0 25 1 . I
-chrM 1185 A A 25 0 25 1 . B
-chrM 1186 A A 20 0 25 1 . 5
-chrM 1187 A A 23 0 25 1 . 8
-chrM 1188 G G 25 0 25 1 . I
-chrM 1189 T T 25 0 25 1 . =
-chrM 1190 A A 25 0 25 1 . <
-chrM 1191 T T 25 0 25 1 . I
-chrM 1192 A A 33 0 25 2 .^:. ;I
-chrM 1193 G G 33 0 25 2 .. II
-chrM 1194 G G 33 0 25 2 .$. II
-chrM 1195 A A 25 0 25 1 . I
-chrM 1196 G G 25 0 25 1 . I
-chrM 1197 A A 25 0 25 1 . I
-chrM 1198 T T 25 0 25 1 . I
-chrM 1199 A A 4 0 25 1 N "
-chrM 1200 G A 4 4 25 1 N "
-chrM 1201 A A 25 0 25 1 . I
-chrM 1202 A A 25 0 25 1 . I
-chrM 1203 A A 25 0 25 1 . I
-chrM 1204 T T 25 0 25 1 . I
-chrM 1205 T T 25 0 25 1 . I
-chrM 1206 T T 25 0 25 1 . I
-chrM 1207 T T 25 0 25 1 . I
-chrM 1208 A A 25 0 25 1 . I
-chrM 1209 A A 25 0 25 1 . I
-chrM 1210 C C 25 0 25 1 . I
-chrM 1211 T T 25 0 25 1 . I
-chrM 1212 T T 25 0 25 1 . I
-chrM 1213 G G 25 0 25 1 . I
-chrM 1214 G G 25 0 25 1 . I
-chrM 1215 C C 25 0 25 1 . I
-chrM 1216 G G 25 0 25 1 . I
-chrM 1217 C C 25 0 25 1 . I
-chrM 1218 T T 25 0 25 1 . I
-chrM 1219 A A 25 0 25 1 . I
-chrM 1220 T T 25 0 25 1 . I
-chrM 1221 A A 25 0 25 1 . C
-chrM 1222 G G 25 0 25 1 . <
-chrM 1223 A A 25 0 25 1 . I
-chrM 1224 G G 25 0 25 1 . H
-chrM 1225 A A 25 0 25 1 . I
-chrM 1226 A A 25 0 25 1 . I
-chrM 1227 A A 25 0 25 1 .$ I
-chrM 1499 A A 25 0 25 1 ^:, I
-chrM 1500 A A 25 0 25 1 , I
-chrM 1501 A A 25 0 25 1 , I
-chrM 1502 T T 25 0 25 1 , I
-chrM 1503 T T 33 0 25 2 ,^:, EI
-chrM 1504 T T 33 0 25 2 ,, II
+chrM 23 A A 30 0 25 1 ^:. >
+chrM 24 A A 30 0 25 1 . >
+chrM 25 G G 30 0 25 1 . I
+chrM 26 C C 30 0 25 1 . I
+chrM 27 A A 30 0 25 1 . I
+chrM 28 A A 30 0 25 1 . I
+chrM 29 G G 30 0 25 1 . I
+chrM 30 G N 0 0 0 1 N "
+chrM 31 C N 0 0 0 1 N "
+chrM 32 A A 30 0 25 1 . I
+chrM 33 C C 30 0 25 1 . I
+chrM 34 T T 30 0 25 1 . I
+chrM 35 G G 30 0 25 1 . I
+chrM 36 A A 30 0 25 1 . I
+chrM 37 A A 30 0 25 1 . I
+chrM 38 A A 30 0 25 1 . I
+chrM 39 A A 30 0 25 1 . I
+chrM 40 T T 30 0 25 1 . I
+chrM 41 G G 30 0 25 1 . I
+chrM 42 C C 30 0 25 1 . I
+chrM 43 C C 30 0 25 1 . I
+chrM 44 T T 30 0 25 1 . I
+chrM 45 A A 30 0 25 1 . I
+chrM 46 G G 30 0 25 1 . I
+chrM 47 A A 30 0 25 1 . E
+chrM 48 T T 30 0 25 1 . I
+chrM 49 G G 30 0 25 1 . I
+chrM 50 A A 30 0 25 1 . I
+chrM 51 G G 30 0 25 1 . I
+chrM 52 T T 30 0 25 1 . I
+chrM 53 A A 30 0 25 1 . I
+chrM 54 T T 30 0 25 1 . I
+chrM 55 T T 30 0 25 1 . I
+chrM 56 C C 30 0 25 1 . I
+chrM 57 T T 30 0 25 1 . E
+chrM 58 T T 30 0 25 1 .$ B
+chrM 96 T T 30 0 25 1 ^:. B
+chrM 97 T T 30 0 25 1 . E
+chrM 98 A A 30 0 25 1 . I
+chrM 99 G G 30 0 25 1 . I
+chrM 100 T T 30 0 25 1 . I
+chrM 101 T T 30 0 25 1 . I
+chrM 102 A A 30 0 25 1 . I
+chrM 103 T N 0 0 0 1 N "
+chrM 104 T N 0 0 0 1 N "
+chrM 105 A A 30 0 25 1 . I
+chrM 106 A A 30 0 25 1 . I
+chrM 107 T T 30 0 25 1 . I
+chrM 108 A A 30 0 25 1 . I
+chrM 109 G G 30 0 25 1 . I
+chrM 110 A A 30 0 25 1 . I
+chrM 111 A A 30 0 25 1 . I
+chrM 112 T T 30 0 25 1 . I
+chrM 113 T T 30 0 25 1 . I
+chrM 114 A A 30 0 25 1 . I
+chrM 115 C C 30 0 25 1 . I
+chrM 116 A A 30 0 25 1 . I
+chrM 117 C C 30 0 25 1 . I
+chrM 118 A A 30 0 25 1 . H
+chrM 119 T T 30 0 25 1 . I
+chrM 120 G G 30 0 25 1 . I
+chrM 121 C C 30 0 25 1 . I
+chrM 122 A A 30 0 25 1 . E
+chrM 123 A A 30 0 25 1 . I
+chrM 124 G G 30 0 25 1 . 5
+chrM 125 T T 30 0 25 1 . I
+chrM 126 A A 30 0 25 1 . I
+chrM 127 T T 30 0 25 1 . I
+chrM 128 C C 30 0 25 1 . I
+chrM 129 C C 30 0 25 1 . I
+chrM 130 G G 30 0 25 1 . 4
+chrM 131 C C 30 0 25 1 .$ C
+chrM 492 A A 30 0 25 1 ^:, A
+chrM 493 A A 30 0 25 1 , B
+chrM 494 A A 30 0 25 1 , E
+chrM 495 C C 30 0 25 1 , E
+chrM 496 T T 30 0 25 1 , I
+chrM 497 G G 30 0 25 1 , I
+chrM 498 G G 30 0 25 1 , I
+chrM 499 G G 30 0 25 1 , I
+chrM 500 A A 30 0 25 1 , I
+chrM 501 T T 30 0 25 1 , I
+chrM 502 T T 30 0 25 1 , I
+chrM 503 A A 30 0 25 1 , I
+chrM 504 G G 30 0 25 1 , I
+chrM 505 A A 30 0 25 1 , I
+chrM 506 T T 30 0 25 1 , I
+chrM 507 A A 30 0 25 1 , I
+chrM 508 C C 30 0 25 1 , I
+chrM 509 C C 30 0 25 1 , I
+chrM 510 C C 30 0 25 1 , I
+chrM 511 C C 30 0 25 1 , I
+chrM 512 A A 30 0 25 1 , I
+chrM 513 C C 30 0 25 1 , I
+chrM 514 T T 30 0 25 1 , I
+chrM 515 A A 30 0 25 1 , I
+chrM 516 T T 30 0 25 1 , I
+chrM 517 G G 30 0 25 1 , I
+chrM 518 C C 30 0 25 1 , I
+chrM 519 T N 0 0 0 1 n "
+chrM 520 T N 0 0 0 1 n "
+chrM 521 A A 30 0 25 1 , I
+chrM 522 G G 30 0 25 1 , I
+chrM 523 C C 30 0 25 1 , I
+chrM 524 C C 30 0 25 1 , I
+chrM 525 C C 30 0 25 1 , I
+chrM 526 T T 30 0 25 1 , I
+chrM 527 A A 30 0 25 1 ,$ >
+chrM 893 G G 30 0 25 1 ^:, 6
+chrM 894 C C 30 0 25 1 , 0
+chrM 895 T T 30 0 25 1 , 4
+chrM 896 T T 30 0 25 1 , I
+chrM 897 A A 30 0 25 1 , I
+chrM 898 A A 30 0 25 1 , I
+chrM 899 T T 30 0 25 1 , ?
+chrM 900 T T 30 0 25 1 , I
+chrM 901 G G 30 0 25 1 , I
+chrM 902 A A 30 0 25 1 , I
+chrM 903 A A 30 0 25 1 , I
+chrM 904 T T 30 0 25 1 , <
+chrM 905 C C 30 0 25 1 , I
+chrM 906 A A 30 0 25 1 , I
+chrM 907 G G 30 0 25 1 , I
+chrM 908 G G 30 0 25 1 , I
+chrM 909 C C 30 0 25 1 , I
+chrM 910 C C 30 0 25 1 , I
+chrM 911 A A 30 0 25 1 , I
+chrM 912 T T 30 0 25 1 , I
+chrM 913 G G 30 0 25 1 , I
+chrM 914 A A 30 0 25 1 , I
+chrM 915 A A 30 0 25 1 , I
+chrM 916 G G 30 0 25 1 , I
+chrM 917 C C 30 0 25 1 , I
+chrM 918 G G 30 0 25 1 , I
+chrM 919 C C 30 0 25 1 , I
+chrM 920 G N 0 0 0 1 n "
+chrM 921 C N 0 0 0 1 n "
+chrM 922 A A 30 0 25 1 , I
+chrM 923 C C 30 0 25 1 , I
+chrM 924 A A 30 0 25 1 , I
+chrM 925 C C 30 0 25 1 , I
+chrM 926 A A 30 0 25 1 , I
+chrM 927 C C 30 0 25 1 , E
+chrM 928 C C 30 0 25 1 ,$ A
+chrM 1159 T T 30 0 25 1 ^:. B
+chrM 1160 T T 30 0 25 1 . E
+chrM 1161 A A 30 0 25 1 . I
+chrM 1162 A A 30 0 25 1 . I
+chrM 1163 C C 30 0 25 1 . I
+chrM 1164 T T 30 0 25 1 . I
+chrM 1165 A A 30 0 25 1 . I
+chrM 1166 A N 0 0 0 1 N "
+chrM 1167 A N 0 0 0 1 N "
+chrM 1168 A A 30 0 25 1 . I
+chrM 1169 C C 30 0 25 1 . I
+chrM 1170 A A 30 0 25 1 . I
+chrM 1171 T T 30 0 25 1 . I
+chrM 1172 T T 30 0 25 1 . I
+chrM 1173 C C 30 0 25 1 . I
+chrM 1174 A A 30 0 25 1 . I
+chrM 1175 C C 30 0 25 1 . I
+chrM 1176 C C 30 0 25 1 . I
+chrM 1177 A A 30 0 25 1 . I
+chrM 1178 A A 30 0 25 1 . I
+chrM 1179 A A 30 0 25 1 . A
+chrM 1180 C C 30 0 25 1 . I
+chrM 1181 C C 30 0 25 1 . I
+chrM 1182 A A 30 0 25 1 . =
+chrM 1183 T T 30 0 25 1 . I
+chrM 1184 T T 30 0 25 1 . I
+chrM 1185 A A 30 0 25 1 . B
+chrM 1186 A A 30 0 25 1 . 5
+chrM 1187 A A 30 0 25 1 . 8
+chrM 1188 G G 30 0 25 1 . I
+chrM 1189 T T 30 0 25 1 . =
+chrM 1190 A A 30 0 25 1 . <
+chrM 1191 T T 30 0 25 1 . I
+chrM 1192 A A 33 0 25 2 .^:. ;E
+chrM 1193 G G 33 0 25 2 .. EI
+chrM 1194 G G 33 0 25 2 .$. AI
+chrM 1195 A A 30 0 25 1 . I
+chrM 1196 G G 30 0 25 1 . I
+chrM 1197 A A 30 0 25 1 . I
+chrM 1198 T T 30 0 25 1 . I
+chrM 1199 A N 0 0 0 1 N "
+chrM 1200 G N 0 0 0 1 N "
+chrM 1201 A A 30 0 25 1 . I
+chrM 1202 A A 30 0 25 1 . I
+chrM 1203 A A 30 0 25 1 . I
+chrM 1204 T T 30 0 25 1 . I
+chrM 1205 T T 30 0 25 1 . I
+chrM 1206 T T 30 0 25 1 . I
+chrM 1207 T T 30 0 25 1 . I
+chrM 1208 A A 30 0 25 1 . I
+chrM 1209 A A 30 0 25 1 . I
+chrM 1210 C C 30 0 25 1 . I
+chrM 1211 T T 30 0 25 1 . I
+chrM 1212 T T 30 0 25 1 . I
+chrM 1213 G G 30 0 25 1 . I
+chrM 1214 G G 30 0 25 1 . I
+chrM 1215 C C 30 0 25 1 . I
+chrM 1216 G G 30 0 25 1 . I
+chrM 1217 C C 30 0 25 1 . I
+chrM 1218 T T 30 0 25 1 . I
+chrM 1219 A A 30 0 25 1 . I
+chrM 1220 T T 30 0 25 1 . I
+chrM 1221 A A 30 0 25 1 . C
+chrM 1222 G G 30 0 25 1 . <
+chrM 1223 A A 30 0 25 1 . I
+chrM 1224 G G 30 0 25 1 . H
+chrM 1225 A A 30 0 25 1 . E
+chrM 1226 A A 30 0 25 1 . B
+chrM 1227 A A 30 0 25 1 .$ @
+chrM 1499 A A 30 0 25 1 ^:, A
+chrM 1500 A A 30 0 25 1 , B
+chrM 1501 A A 30 0 25 1 , E
+chrM 1502 T T 30 0 25 1 , I
+chrM 1503 T T 33 0 25 2 ,^:, E>
+chrM 1504 T T 33 0 25 2 ,, I>
chrM 1505 A A 33 0 25 2 ,, II
-chrM 1506 C C 20 0 25 2 ,, +,
+chrM 1506 C N 0 0 0 2 ,, +,
chrM 1507 C C 33 0 25 2 ,, EH
chrM 1508 T T 33 0 25 2 ,, II
chrM 1509 A A 33 0 25 2 ,, II
@@ -238,821 +238,821 @@ chrM 1522 T T 33 0 25 2 ,, II
chrM 1523 T T 33 0 25 2 ,, II
chrM 1524 C C 33 0 25 2 ,, II
chrM 1525 T T 33 0 25 2 ,, II
-chrM 1526 A A 28 0 25 2 n, "I
-chrM 1527 A A 28 0 25 2 n, "I
+chrM 1526 A A 30 0 25 2 n, "I
+chrM 1527 A A 30 0 25 2 n, "I
chrM 1528 T T 33 0 25 2 ,, II
chrM 1529 G G 33 0 25 2 ,, II
-chrM 1530 T T 19 0 25 2 ,n I"
-chrM 1531 A A 28 0 25 2 ,n I"
+chrM 1530 T T 30 0 25 2 ,n I"
+chrM 1531 A A 30 0 25 2 ,n I"
chrM 1532 A A 33 0 25 2 ,, II
chrM 1533 A A 33 0 25 2 ,, II
-chrM 1534 T T 33 0 25 2 ,$, II
-chrM 1535 T T 25 0 25 1 , I
-chrM 1536 T T 25 0 25 1 , I
-chrM 1537 A A 25 0 25 1 , I
-chrM 1538 A A 25 0 25 1 ,$ I
-chrM 1616 A A 25 0 25 1 ^:. I
-chrM 1617 G G 25 0 25 1 . I
-chrM 1618 T T 25 0 25 1 . I
-chrM 1619 T T 25 0 25 1 . I
-chrM 1620 G G 25 0 25 1 . I
-chrM 1621 G G 25 0 25 1 . I
-chrM 1622 C C 25 0 25 1 . I
-chrM 1623 T A 4 4 25 1 N "
-chrM 1624 T A 4 4 25 1 N "
-chrM 1625 A A 25 0 25 1 . I
-chrM 1626 A A 25 0 25 1 . I
-chrM 1627 A A 25 0 25 1 . I
-chrM 1628 A A 25 0 25 1 . I
-chrM 1629 G G 25 0 25 1 . I
-chrM 1630 C C 25 0 25 1 . I
-chrM 1631 A A 25 0 25 1 . I
-chrM 1632 G G 25 0 25 1 . I
-chrM 1633 C C 25 0 25 1 . I
-chrM 1634 C C 25 0 25 1 . I
-chrM 1635 A A 25 0 25 1 . C
-chrM 1636 T T 25 0 25 1 . I
-chrM 1637 C C 25 0 25 1 . I
-chrM 1638 A A 25 0 25 1 . =
-chrM 1639 A A 25 0 25 1 . G
-chrM 1640 T T 25 0 25 1 . I
-chrM 1641 T T 25 0 25 1 . I
-chrM 1642 A A 25 0 25 1 . I
-chrM 1643 A A 25 0 25 1 . I
-chrM 1644 G G 25 0 25 1 . I
-chrM 1645 A A 25 0 25 1 . @
-chrM 1646 A A 25 0 25 1 . I
-chrM 1647 A A 25 0 25 1 . G
-chrM 1648 G G 25 0 25 1 . I
-chrM 1649 C C 25 0 25 1 . I
-chrM 1650 G G 25 0 25 1 . I
-chrM 1651 T T 25 0 25 1 .$ I
-chrM 2261 C C 25 0 25 1 ^:, I
-chrM 2262 A A 25 0 25 1 , I
-chrM 2263 G G 25 0 25 1 , I
-chrM 2264 C C 25 0 25 1 , I
-chrM 2265 A A 25 0 25 1 , G
-chrM 2266 A A 25 0 25 1 , I
-chrM 2267 T T 17 0 25 1 , 2
-chrM 2268 T T 25 0 25 1 , =
-chrM 2269 T T 18 0 25 1 , 3
-chrM 2270 C C 25 0 25 1 , I
-chrM 2271 G G 25 0 25 1 , I
-chrM 2272 G G 25 0 25 1 , I
-chrM 2273 T T 25 0 25 1 , I
-chrM 2274 T T 25 0 25 1 , I
-chrM 2275 G G 25 0 25 1 , I
-chrM 2276 G G 25 0 25 1 , I
-chrM 2277 G G 25 0 25 1 , I
-chrM 2278 G G 25 0 25 1 , I
-chrM 2279 T T 25 0 25 1 , I
-chrM 2280 G G 25 0 25 1 , I
-chrM 2281 A A 25 0 25 1 , I
-chrM 2282 C C 25 0 25 1 , I
-chrM 2283 C C 25 0 25 1 , I
-chrM 2284 T T 25 0 25 1 , I
-chrM 2285 C C 25 0 25 1 , I
-chrM 2286 G G 25 0 25 1 , I
-chrM 2287 G G 25 0 25 1 , I
-chrM 2288 A A 4 0 25 1 n "
-chrM 2289 G A 4 4 25 1 n "
-chrM 2290 A A 25 0 25 1 , I
-chrM 2291 A A 25 0 25 1 , I
-chrM 2292 C C 25 0 25 1 , I
-chrM 2293 A A 25 0 25 1 , I
-chrM 2294 A A 25 0 25 1 , I
-chrM 2295 A A 25 0 25 1 , I
-chrM 2296 A A 25 0 25 1 ,$ I
-chrM 2334 A A 25 0 25 1 ^:, I
-chrM 2335 A A 25 0 25 1 , I
-chrM 2336 A A 25 0 25 1 , I
-chrM 2337 T T 25 0 25 1 , I
-chrM 2338 A A 25 0 25 1 , I
-chrM 2339 T T 25 0 25 1 , H
-chrM 2340 A A 25 0 25 1 , I
-chrM 2341 T T 25 0 25 1 , =
-chrM 2342 A A 25 0 25 1 , I
-chrM 2343 A A 25 0 25 1 , I
-chrM 2344 T T 25 0 25 1 , C
-chrM 2345 C C 25 0 25 1 , I
-chrM 2346 A A 25 0 25 1 , I
-chrM 2347 C C 25 0 25 1 , I
-chrM 2348 T T 25 0 25 1 , ?
-chrM 2349 T T 25 0 25 1 , I
-chrM 2350 A A 25 0 25 1 , I
-chrM 2351 T T 25 0 25 1 , I
-chrM 2352 T T 25 0 25 1 , I
-chrM 2353 G G 25 0 25 1 , I
-chrM 2354 A A 25 0 25 1 , I
-chrM 2355 T T 25 0 25 1 , D
-chrM 2356 C C 25 0 25 1 , I
-chrM 2357 C C 25 0 25 1 , I
-chrM 2358 A A 25 0 25 1 , I
-chrM 2359 A A 25 0 25 1 , I
-chrM 2360 A A 25 0 25 1 , I
-chrM 2361 C A 4 4 25 1 n "
-chrM 2362 C A 4 4 25 1 n "
-chrM 2363 A A 25 0 25 1 , I
-chrM 2364 T T 25 0 25 1 , I
-chrM 2365 T T 25 0 25 1 , I
-chrM 2366 G G 25 0 25 1 , I
-chrM 2367 A A 25 0 25 1 , I
-chrM 2368 T T 25 0 25 1 , I
-chrM 2369 C C 25 0 25 1 ,$ I
-chrM 2389 G G 25 0 25 1 ^:, I
-chrM 2390 G G 23 0 25 1 , 8
-chrM 2391 G G 25 0 25 1 , I
-chrM 2392 A A 25 0 25 1 , I
-chrM 2393 T T 25 0 25 1 , I
-chrM 2394 A A 25 0 25 1 , I
-chrM 2395 A A 25 0 25 1 , I
-chrM 2396 C C 23 0 25 1 , 8
-chrM 2397 A A 25 0 25 1 , I
-chrM 2398 G G 25 0 25 1 , I
-chrM 2399 C C 25 0 25 1 , I
-chrM 2400 G G 25 0 25 1 , I
-chrM 2401 C C 25 0 25 1 , I
-chrM 2402 A A 25 0 25 1 , I
-chrM 2403 A A 25 0 25 1 , I
-chrM 2404 T T 25 0 25 1 , I
-chrM 2405 C C 25 0 25 1 , I
-chrM 2406 C C 25 0 25 1 , I
-chrM 2407 T T 25 0 25 1 , G
-chrM 2408 A A 25 0 25 1 , I
-chrM 2409 T T 25 0 25 1 , I
-chrM 2410 T T 25 0 25 1 , B
-chrM 2411 C C 25 0 25 1 , I
-chrM 2412 C C 25 0 25 1 , I
-chrM 2413 A A 25 0 25 1 , I
-chrM 2414 G G 25 0 25 1 , I
-chrM 2415 A A 25 0 25 1 , I
-chrM 2416 G A 4 4 25 1 n "
-chrM 2417 T A 4 4 25 1 n "
-chrM 2418 C C 25 0 25 1 , I
-chrM 2419 C C 25 0 25 1 , I
-chrM 2420 A A 25 0 25 1 , I
-chrM 2421 T T 25 0 25 1 , I
-chrM 2422 A A 25 0 25 1 , I
-chrM 2423 T T 25 0 25 1 , I
-chrM 2424 C C 25 0 25 1 ,$ I
-chrM 2735 t T 25 0 25 1 ^:, I
-chrM 2736 t T 24 0 25 1 , 9
-chrM 2737 t T 25 0 25 1 , I
-chrM 2738 a A 25 0 25 1 , I
-chrM 2739 c C 25 0 25 1 , I
-chrM 2740 a A 25 0 25 1 , I
-chrM 2741 c C 25 0 25 1 , I
-chrM 2742 t T 20 0 25 1 , 5
-chrM 2743 c C 25 0 25 1 , I
-chrM 2744 a A 25 0 25 1 , I
-chrM 2745 g G 25 0 25 1 , I
-chrM 2746 a A 25 0 25 1 , I
-chrM 2747 g G 25 0 25 1 , I
-chrM 2748 g G 25 0 25 1 , I
-chrM 2749 t T 25 0 25 1 , I
-chrM 2750 t T 25 0 25 1 , I
-chrM 2751 c C 25 0 25 1 , I
-chrM 2752 a A 25 0 25 1 , I
-chrM 2753 a A 25 0 25 1 , I
-chrM 2754 c C 25 0 25 1 , I
-chrM 2755 t T 25 0 25 1 , I
-chrM 2756 c C 25 0 25 1 , I
-chrM 2757 c C 25 0 25 1 , I
-chrM 2758 t T 25 0 25 1 , I
-chrM 2759 c C 25 0 25 1 , I
-chrM 2760 t T 25 0 25 1 , I
-chrM 2761 c C 25 0 25 1 , I
-chrM 2762 c A 4 4 25 1 n "
-chrM 2763 c A 4 4 25 1 n "
-chrM 2764 t T 25 0 25 1 , I
-chrM 2765 a A 25 0 25 1 , I
-chrM 2766 a A 25 0 25 1 , I
-chrM 2767 c C 25 0 25 1 , I
-chrM 2768 a A 25 0 25 1 , I
-chrM 2769 a A 25 0 25 1 , I
-chrM 2770 c C 25 0 25 1 ,$ I
-chrM 2844 G G 25 0 25 1 ^:. I
-chrM 2845 A A 25 0 25 1 . I
-chrM 2846 A A 25 0 25 1 . I
-chrM 2847 A A 25 0 25 1 . I
-chrM 2848 A A 25 0 25 1 . I
-chrM 2849 G G 25 0 25 1 . I
-chrM 2850 T T 25 0 25 1 . I
-chrM 2851 C A 4 4 25 1 N "
-chrM 2852 T A 4 4 25 1 N "
-chrM 2853 T T 25 0 25 1 . I
-chrM 2854 A A 25 0 25 1 . I
-chrM 2855 G G 25 0 25 1 . I
-chrM 2856 G G 25 0 25 1 . I
-chrM 2857 C C 25 0 25 1 . I
-chrM 2858 T T 25 0 25 1 . I
-chrM 2859 A A 25 0 25 1 . I
-chrM 2860 T T 25 0 25 1 . I
-chrM 2861 A A 25 0 25 1 . B
-chrM 2862 T T 25 0 25 1 . I
-chrM 2863 G G 25 0 25 1 . I
-chrM 2864 C C 25 0 25 1 . I
-chrM 2865 A A 25 0 25 1 . I
-chrM 2866 A A 25 0 25 1 . B
-chrM 2867 C C 25 0 25 1 . I
-chrM 2868 T T 25 0 25 1 . I
-chrM 2869 T T 25 0 25 1 . I
-chrM 2870 C C 25 0 25 1 . I
-chrM 2871 G G 25 0 25 1 . =
-chrM 2872 C C 25 0 25 1 . I
-chrM 2873 A A 25 0 25 1 . @
-chrM 2874 A A 24 0 25 1 . 9
-chrM 2875 A A 21 0 25 1 . 6
-chrM 2876 G G 25 0 25 1 . D
-chrM 2877 G G 17 0 25 1 . 2
-chrM 2878 A A 9 0 25 1 . *
-chrM 2879 C C 25 0 25 1 .$ I
-chrM 3080 T T 25 0 25 1 ^:. I
-chrM 3081 T T 25 0 25 1 . I
-chrM 3082 C C 25 0 25 1 . I
-chrM 3083 A A 25 0 25 1 . I
-chrM 3084 T T 25 0 25 1 . I
-chrM 3085 A A 25 0 25 1 . I
-chrM 3086 C C 25 0 25 1 . I
-chrM 3087 T A 4 4 25 1 N "
-chrM 3088 A A 4 0 25 1 N "
-chrM 3089 G G 25 0 25 1 . I
-chrM 3090 C C 25 0 25 1 . I
-chrM 3091 C C 25 0 25 1 . I
-chrM 3092 A A 25 0 25 1 . I
-chrM 3093 T T 25 0 25 1 . I
-chrM 3094 G G 25 0 25 1 . I
-chrM 3095 T T 25 0 25 1 . I
-chrM 3096 C C 25 0 25 1 . I
-chrM 3097 C C 25 0 25 1 . I
-chrM 3098 A A 25 0 25 1 . I
-chrM 3099 G G 25 0 25 1 . H
-chrM 3100 C C 25 0 25 1 . I
-chrM 3101 C C 25 0 25 1 . I
-chrM 3102 T T 25 0 25 1 . I
-chrM 3103 A A 25 0 25 1 . I
-chrM 3104 G G 25 0 25 1 . I
-chrM 3105 C C 25 0 25 1 . I
-chrM 3106 T T 25 0 25 1 . I
-chrM 3107 G G 25 0 25 1 . I
-chrM 3108 T T 25 0 25 1 . I
-chrM 3109 C C 25 0 25 1 . I
-chrM 3110 T T 25 0 25 1 . I
-chrM 3111 A A 25 0 25 1 . <
-chrM 3112 C C 25 0 25 1 . I
-chrM 3113 T T 25 0 25 1 . I
-chrM 3114 C C 25 0 25 1 . I
-chrM 3115 A A 25 0 25 1 .$ F
-chrM 3188 A A 25 0 25 1 ^:, I
-chrM 3189 T T 25 0 25 1 , =
-chrM 3190 C C 25 0 25 1 , I
-chrM 3191 T T 25 0 25 1 , I
-chrM 3192 C C 25 0 25 1 , I
-chrM 3193 A A 25 0 25 1 , I
-chrM 3194 T T 25 0 25 1 , I
-chrM 3195 A A 25 0 25 1 , I
-chrM 3196 C C 25 0 25 1 , I
-chrM 3197 G G 25 0 25 1 , @
-chrM 3198 A A 25 0 25 1 , I
-chrM 3199 A A 25 0 25 1 , I
-chrM 3200 G G 25 0 25 1 , I
-chrM 3201 T T 25 0 25 1 , I
-chrM 3202 A A 25 0 25 1 , I
-chrM 3203 A A 25 0 25 1 , I
-chrM 3204 C C 25 0 25 1 , I
-chrM 3205 T T 25 0 25 1 , I
-chrM 3206 C C 25 0 25 1 , I
-chrM 3207 T T 25 0 25 1 , I
-chrM 3208 A A 25 0 25 1 , I
-chrM 3209 G G 25 0 25 1 , I
-chrM 3210 C C 25 0 25 1 , I
-chrM 3211 A A 25 0 25 1 , I
-chrM 3212 A A 25 0 25 1 , I
-chrM 3213 T T 25 0 25 1 , I
-chrM 3214 C C 25 0 25 1 , I
-chrM 3215 A A 4 0 25 1 n "
-chrM 3216 T A 4 4 25 1 n "
-chrM 3217 C C 25 0 25 1 , I
-chrM 3218 C C 25 0 25 1 , I
-chrM 3219 T T 25 0 25 1 , I
-chrM 3220 A A 25 0 25 1 , I
-chrM 3221 C C 25 0 25 1 , I
-chrM 3222 T T 25 0 25 1 , I
-chrM 3223 C C 25 0 25 1 ,$ I
-chrM 3502 A A 25 0 25 1 ^:. I
-chrM 3503 G G 25 0 25 1 . I
-chrM 3504 C C 25 0 25 1 . I
-chrM 3505 A A 25 0 25 1 . I
-chrM 3506 T T 25 0 25 1 . I
-chrM 3507 T T 25 0 25 1 . I
-chrM 3508 T T 25 0 25 1 . I
-chrM 3509 C A 4 4 25 1 N "
-chrM 3510 A A 4 0 25 1 N "
-chrM 3511 C C 25 0 25 1 . I
-chrM 3512 A A 25 0 25 1 . I
-chrM 3513 A A 25 0 25 1 . I
-chrM 3514 C C 25 0 25 1 . I
-chrM 3515 C C 25 0 25 1 . I
-chrM 3516 C C 25 0 25 1 . I
-chrM 3517 C C 25 0 25 1 . I
-chrM 3518 T T 25 0 25 1 . I
-chrM 3519 A A 25 0 25 1 . I
-chrM 3520 C C 25 0 25 1 . I
-chrM 3521 C C 25 0 25 1 . I
-chrM 3522 T T 25 0 25 1 . I
-chrM 3523 G G 25 0 25 1 . I
-chrM 3524 C C 25 0 25 1 . I
-chrM 3525 C C 25 0 25 1 . I
-chrM 3526 A A 25 0 25 1 . >
-chrM 3527 G G 25 0 25 1 . I
-chrM 3528 A A 19 0 25 1 . 4
-chrM 3529 A A 25 0 25 1 . @
-chrM 3530 C C 25 0 25 1 . I
-chrM 3531 T T 25 0 25 1 . I
-chrM 3532 C C 25 0 25 1 . I
-chrM 3533 T T 25 0 25 1 . I
-chrM 3534 A A 25 0 25 1 . I
-chrM 3535 C C 25 0 25 1 . I
-chrM 3536 T T 25 0 25 1 . I
-chrM 3537 C C 25 0 25 1 .$ I
-chrM 3678 G G 25 0 25 1 ^:. I
-chrM 3679 A A 25 0 25 1 . I
-chrM 3680 C C 25 0 25 1 . I
-chrM 3681 A A 25 0 25 1 . I
-chrM 3682 C C 25 0 25 1 . I
-chrM 3683 G G 25 0 25 1 . I
-chrM 3684 T T 25 0 25 1 . I
-chrM 3685 C A 4 4 25 1 N "
-chrM 3686 T A 4 4 25 1 N "
-chrM 3687 C C 25 0 25 1 . I
-chrM 3688 A A 25 0 25 1 . I
-chrM 3689 C C 25 0 25 1 . I
-chrM 3690 T T 25 0 25 1 . I
-chrM 3691 T T 25 0 25 1 . I
-chrM 3692 C C 25 0 25 1 . I
-chrM 3693 C C 25 0 25 1 . I
-chrM 3694 A A 25 0 25 1 . I
-chrM 3695 A A 25 0 25 1 . :
-chrM 3696 T T 25 0 25 1 . I
-chrM 3697 C C 25 0 25 1 . I
-chrM 3698 A A 25 0 25 1 . I
-chrM 3699 T T 25 0 25 1 . I
-chrM 3700 A A 23 0 25 1 . 8
-chrM 3701 C C 25 0 25 1 . I
-chrM 3702 T T 25 0 25 1 . I
-chrM 3703 A A 25 0 25 1 . E
-chrM 3704 T T 25 0 25 1 . I
-chrM 3705 C C 25 0 25 1 . I
-chrM 3706 C C 25 0 25 1 . I
-chrM 3707 A A 25 0 25 1 . I
-chrM 3708 G G 12 0 25 1 . -
-chrM 3709 C C 25 0 25 1 . I
-chrM 3710 A A 25 0 25 1 . A
-chrM 3711 T T 25 0 25 1 . I
-chrM 3712 C C 25 0 25 1 . I
-chrM 3713 C C 25 0 25 1 .$ I
-chrM 3753 T T 25 0 25 1 ^:. I
-chrM 3754 T T 25 0 25 1 . I
-chrM 3755 T T 25 0 25 1 . I
-chrM 3756 G G 25 0 25 1 . I
-chrM 3757 A A 25 0 25 1 . I
-chrM 3758 T T 25 0 25 1 . I
-chrM 3759 A A 25 0 25 1 . I
-chrM 3760 G A 4 4 25 1 N "
-chrM 3761 A A 4 0 25 1 N "
-chrM 3762 G G 25 0 25 1 . I
-chrM 3763 T T 25 0 25 1 . I
-chrM 3764 A A 25 0 25 1 . I
-chrM 3765 A A 25 0 25 1 . I
-chrM 3766 A A 25 0 25 1 . I
-chrM 3767 A A 25 0 25 1 . I
-chrM 3768 C C 25 0 25 1 . I
-chrM 3769 A A 25 0 25 1 . I
-chrM 3770 T T 25 0 25 1 . I
-chrM 3771 A A 25 0 25 1 . I
-chrM 3772 G G 25 0 25 1 . I
-chrM 3773 A A 25 0 25 1 . I
-chrM 3774 G G 25 0 25 1 . I
-chrM 3775 G G 25 0 25 1 . I
-chrM 3776 C C 25 0 25 1 . I
-chrM 3777 T T 25 0 25 1 . I
-chrM 3778 C C 25 0 25 1 . I
-chrM 3779 A A 25 0 25 1 . C
-chrM 3780 A A 25 0 25 1 . I
-chrM 3781 A A 25 0 25 1 . I
-chrM 3782 C C 25 0 25 1 . I
-chrM 3783 C C 25 0 25 1 . I
-chrM 3784 C C 25 0 25 1 . I
-chrM 3785 T T 25 0 25 1 . I
-chrM 3786 C C 25 0 25 1 . I
-chrM 3787 T T 25 0 25 1 . I
-chrM 3788 T T 25 0 25 1 .$ I
-chrM 3841 t T 25 0 25 1 ^:, G
-chrM 3842 g G 25 0 25 1 , I
-chrM 3843 c C 10 0 25 1 , +
-chrM 3844 t T 25 0 25 1 , I
-chrM 3845 a A 25 0 25 1 , I
-chrM 3846 c C 4 0 25 1 , %
-chrM 3847 c C 7 0 25 1 , (
-chrM 3848 g G 25 0 25 1 , I
-chrM 3849 a A 25 0 25 1 , I
-chrM 3850 a A 25 0 25 1 , I
-chrM 3851 t T 25 0 25 1 , I
-chrM 3852 t T 25 0 25 1 , I
-chrM 3853 a A 25 0 25 1 , I
-chrM 3854 c C 25 0 25 1 , I
-chrM 3855 a A 25 0 25 1 , I
-chrM 3856 c C 25 0 25 1 , I
-chrM 3857 c C 25 0 25 1 , I
-chrM 3858 a A 25 0 25 1 , I
-chrM 3859 t T 25 0 25 1 , I
-chrM 3860 g G 25 0 25 1 , I
-chrM 3861 t T 25 0 25 1 , I
-chrM 3862 c C 25 0 25 1 , I
-chrM 3863 c C 25 0 25 1 , I
-chrM 3864 t T 25 0 25 1 , I
-chrM 3865 a A 25 0 25 1 , I
-chrM 3866 C C 25 0 25 1 , I
-chrM 3867 A A 25 0 25 1 , I
-chrM 3868 A A 4 0 25 1 n "
-chrM 3869 G A 4 4 25 1 n "
-chrM 3870 T T 25 0 25 1 , I
-chrM 3871 A A 25 0 25 1 , I
-chrM 3872 A A 25 0 25 1 , I
-chrM 3873 G G 25 0 25 1 , I
-chrM 3874 G G 25 0 25 1 , I
-chrM 3875 T T 25 0 25 1 , I
-chrM 3876 C C 25 0 25 1 ,$ I
-chrM 3921 C C 25 0 25 1 ^:, I
-chrM 3922 A A 25 0 25 1 , I
-chrM 3923 C C 25 0 25 1 , I
-chrM 3924 C C 25 0 25 1 , I
-chrM 3925 C C 25 0 25 1 , I
-chrM 3926 T T 25 0 25 1 , =
-chrM 3927 T T 25 0 25 1 , A
-chrM 3928 C C 25 0 25 1 , I
-chrM 3929 C C 25 0 25 1 , I
-chrM 3930 C C 25 0 25 1 , I
-chrM 3931 G G 25 0 25 1 , I
-chrM 3932 T T 25 0 25 1 , I
-chrM 3933 A A 25 0 25 1 , I
-chrM 3934 C C 25 0 25 1 , I
-chrM 3935 T T 25 0 25 1 , I
-chrM 3936 A A 25 0 25 1 , I
-chrM 3937 A A 25 0 25 1 , I
-chrM 3938 T T 25 0 25 1 , I
-chrM 3939 A A 25 0 25 1 , I
-chrM 3940 A A 25 0 25 1 , I
-chrM 3941 A A 25 0 25 1 , I
-chrM 3942 T T 25 0 25 1 , B
-chrM 3943 C C 25 0 25 1 , I
-chrM 3944 C C 25 0 25 1 , I
-chrM 3945 C C 25 0 25 1 , I
-chrM 3946 C C 25 0 25 1 , I
-chrM 3947 T T 25 0 25 1 , I
-chrM 3948 T A 4 4 25 1 n "
-chrM 3949 A A 4 0 25 1 n "
-chrM 3950 T T 25 0 25 1 , I
-chrM 3951 C C 25 0 25 1 , I
-chrM 3952 T T 25 0 25 1 , I
-chrM 3953 T T 25 0 25 1 , I
-chrM 3954 C C 25 0 25 1 , I
-chrM 3955 A A 25 0 25 1 , I
-chrM 3956 C C 25 0 25 1 ,$ I
-chrM 4249 A A 25 0 25 1 ^:, I
-chrM 4250 A A 25 0 25 1 , I
-chrM 4251 A A 25 0 25 1 , I
-chrM 4252 C C 25 0 25 1 , I
-chrM 4253 T T 20 0 25 1 , 5
-chrM 4254 T T 21 0 25 1 , 6
-chrM 4255 G G 25 0 25 1 , I
-chrM 4256 G G 25 0 25 1 , I
-chrM 4257 A A 25 0 25 1 , I
-chrM 4258 C C 25 0 25 1 , I
-chrM 4259 T T 25 0 25 1 , I
-chrM 4260 C C 25 0 25 1 , I
-chrM 4261 A A 25 0 25 1 , I
-chrM 4262 C C 25 0 25 1 , I
-chrM 4263 A A 25 0 25 1 , I
-chrM 4264 C C 25 0 25 1 , I
-chrM 4265 C C 25 0 25 1 , I
-chrM 4266 A A 25 0 25 1 , I
-chrM 4267 T T 25 0 25 1 , I
-chrM 4268 T T 25 0 25 1 , I
-chrM 4269 C C 25 0 25 1 , I
-chrM 4270 C C 25 0 25 1 , I
-chrM 4271 A A 25 0 25 1 , I
-chrM 4272 C C 25 0 25 1 , I
-chrM 4273 T T 25 0 25 1 , I
-chrM 4274 T T 25 0 25 1 , I
-chrM 4275 C C 25 0 25 1 , I
-chrM 4276 T A 4 4 25 1 n "
-chrM 4277 G A 4 4 25 1 n "
-chrM 4278 A A 25 0 25 1 , I
-chrM 4279 G G 25 0 25 1 , I
-chrM 4280 T T 25 0 25 1 , I
-chrM 4281 A A 25 0 25 1 , I
-chrM 4282 C C 25 0 25 1 , I
-chrM 4283 C C 25 0 25 1 , I
-chrM 4284 C C 25 0 25 1 ,$ I
-chrM 4552 T T 25 0 25 1 ^:. I
-chrM 4553 T T 25 0 25 1 . I
-chrM 4554 A A 25 0 25 1 . I
-chrM 4555 A A 25 0 25 1 . I
-chrM 4556 T T 25 0 25 1 . I
-chrM 4557 T T 25 0 25 1 . I
-chrM 4558 T T 25 0 25 1 . I
-chrM 4559 A A 4 0 25 1 N "
-chrM 4560 C A 4 4 25 1 N "
-chrM 4561 A A 25 0 25 1 . I
-chrM 4562 T T 25 0 25 1 . I
-chrM 4563 T T 25 0 25 1 . I
-chrM 4564 A A 25 0 25 1 . I
-chrM 4565 T T 25 0 25 1 . I
-chrM 4566 A A 25 0 25 1 . I
-chrM 4567 A A 25 0 25 1 . I
-chrM 4568 T T 25 0 25 1 . I
-chrM 4569 A A 25 0 25 1 . I
-chrM 4570 A A 25 0 25 1 . I
-chrM 4571 C C 25 0 25 1 . I
-chrM 4572 A A 25 0 25 1 . I
-chrM 4573 C C 25 0 25 1 . I
-chrM 4574 T T 25 0 25 1 . I
-chrM 4575 C C 25 0 25 1 . I
-chrM 4576 A A 25 0 25 1 . I
-chrM 4577 C C 25 0 25 1 . I
-chrM 4578 A A 25 0 25 1 . I
-chrM 4579 A A 25 0 25 1 . ?
-chrM 4580 T T 25 0 25 1 . I
-chrM 4581 A A 21 0 25 1 . 6
-chrM 4582 T T 25 0 25 1 . I
-chrM 4583 T T 25 0 25 1 . I
-chrM 4584 C C 25 0 25 1 . I
-chrM 4585 A A 25 0 25 1 . I
-chrM 4586 T T 25 0 25 1 . I
-chrM 4587 A A 21 0 25 1 .$ 6
-chrM 4697 T T 20 0 25 1 ^:, 5
-chrM 4698 C C 25 0 25 1 , =
-chrM 4699 C C 19 0 25 1 , 4
-chrM 4700 C C 5 0 25 1 , &
-chrM 4701 C C 25 0 25 1 , G
-chrM 4702 C C 16 0 25 1 , 1
-chrM 4703 C C 18 0 25 1 , 3
-chrM 4704 A A 25 0 25 1 , I
-chrM 4705 C C 13 0 25 1 , .
-chrM 4706 T T 25 0 25 1 , ?
-chrM 4707 A A 25 0 25 1 , I
-chrM 4708 T T 25 0 25 1 , I
-chrM 4709 C C 25 0 25 1 , I
-chrM 4710 A A 25 0 25 1 , I
-chrM 4711 G G 25 0 25 1 , I
-chrM 4712 G G 25 0 25 1 , I
-chrM 4713 A A 25 0 25 1 , I
-chrM 4714 T T 25 0 25 1 , I
-chrM 4715 T T 25 0 25 1 , I
-chrM 4716 C C 25 0 25 1 , I
-chrM 4717 A A 25 0 25 1 , I
-chrM 4718 T T 25 0 25 1 , I
-chrM 4719 A A 25 0 25 1 , I
-chrM 4720 C C 25 0 25 1 , I
-chrM 4721 C C 25 0 25 1 , I
-chrM 4722 C C 25 0 25 1 , I
-chrM 4723 A A 25 0 25 1 , I
-chrM 4724 A A 4 0 25 1 n "
-chrM 4725 A A 4 0 25 1 n "
-chrM 4726 T T 25 0 25 1 , I
-chrM 4727 G G 25 0 25 1 , I
-chrM 4728 A A 25 0 25 1 , I
-chrM 4729 A A 25 0 25 1 , I
-chrM 4730 T T 25 0 25 1 , I
-chrM 4731 A A 25 0 25 1 , I
-chrM 4732 A A 25 0 25 1 ,$ I
-chrM 4742 A A 25 0 25 1 ^:. I
-chrM 4743 G G 25 0 25 1 . I
-chrM 4744 C C 25 0 25 1 . I
-chrM 4745 T T 25 0 25 1 . I
-chrM 4746 C C 25 0 25 1 . I
-chrM 4747 A A 25 0 25 1 . I
-chrM 4748 C C 25 0 25 1 . I
-chrM 4749 C A 4 4 25 1 N "
-chrM 4750 A A 4 0 25 1 N "
-chrM 4751 A A 25 0 25 1 . I
-chrM 4752 A A 25 0 25 1 . I
-chrM 4753 A A 25 0 25 1 . I
-chrM 4754 A A 25 0 25 1 . I
-chrM 4755 T T 25 0 25 1 . I
-chrM 4756 A A 25 0 25 1 . I
-chrM 4757 G G 25 0 25 1 . I
-chrM 4758 C C 25 0 25 1 . I
-chrM 4759 A A 25 0 25 1 . I
-chrM 4760 G G 25 0 25 1 . I
-chrM 4761 C C 25 0 25 1 . I
-chrM 4762 A A 25 0 25 1 . I
-chrM 4763 T T 25 0 25 1 . I
-chrM 4764 C C 25 0 25 1 . I
-chrM 4765 A A 25 0 25 1 . I
-chrM 4766 T T 25 0 25 1 . I
-chrM 4767 C C 25 0 25 1 . I
-chrM 4768 C C 25 0 25 1 . I
-chrM 4769 T T 25 0 25 1 . I
-chrM 4770 C C 25 0 25 1 . I
-chrM 4771 C C 25 0 25 1 . I
-chrM 4772 C C 25 0 25 1 . I
-chrM 4773 C C 25 0 25 1 . I
-chrM 4774 A A 23 0 25 1 . 8
-chrM 4775 C C 25 0 25 1 . I
-chrM 4776 A A 25 0 25 1 . :
-chrM 4777 C C 25 0 25 1 .$ I
-chrM 4932 C C 25 0 25 1 ^:, I
-chrM 4933 T T 12 0 25 1 , -
-chrM 4934 C C 25 0 25 1 , A
-chrM 4935 C C 25 0 25 1 , I
-chrM 4936 C C 25 0 25 1 , I
-chrM 4937 T T 22 0 25 1 , 7
-chrM 4938 A A 25 0 25 1 , I
-chrM 4939 C C 25 0 25 1 , I
-chrM 4940 T T 20 0 25 1 , 5
-chrM 4941 C C 25 0 25 1 , I
-chrM 4942 C C 25 0 25 1 , I
-chrM 4943 T T 25 0 25 1 , :
-chrM 4944 C C 25 0 25 1 , I
-chrM 4945 C C 25 0 25 1 , I
-chrM 4946 C C 25 0 25 1 , I
-chrM 4947 C C 25 0 25 1 , I
-chrM 4948 C C 25 0 25 1 , I
-chrM 4949 T T 25 0 25 1 , I
-chrM 4950 A A 25 0 25 1 , I
-chrM 4951 A A 25 0 25 1 , I
-chrM 4952 C C 25 0 25 1 , I
-chrM 4953 C C 25 0 25 1 , I
-chrM 4954 C C 25 0 25 1 , I
-chrM 4955 C C 25 0 25 1 , I
-chrM 4956 C C 25 0 25 1 , I
-chrM 4957 A A 25 0 25 1 , I
-chrM 4958 T T 25 0 25 1 , I
-chrM 4959 A A 4 0 25 1 n "
-chrM 4960 C A 4 4 25 1 n "
-chrM 4961 T T 25 0 25 1 , I
-chrM 4962 A A 25 0 25 1 , I
-chrM 4963 T T 25 0 25 1 , I
-chrM 4964 C C 25 0 25 1 , I
-chrM 4965 A A 25 0 25 1 , I
-chrM 4966 A A 25 0 25 1 , I
-chrM 4967 T T 25 0 25 1 ,$ I
-chrM 5155 G G 22 0 25 1 ^:, 7
-chrM 5156 T T 25 0 25 1 , I
-chrM 5157 T T 25 0 25 1 , I
-chrM 5158 A A 25 0 25 1 , I
-chrM 5159 A A 25 0 25 1 , I
-chrM 5160 C C 25 0 25 1 , I
-chrM 5161 A A 25 0 25 1 , I
-chrM 5162 G G 25 0 25 1 , I
-chrM 5163 C C 25 0 25 1 , I
-chrM 5164 T T 25 0 25 1 , I
-chrM 5165 A A 25 0 25 1 , I
-chrM 5166 A A 25 0 25 1 , I
-chrM 5167 A A 25 0 25 1 , I
-chrM 5168 T T 25 0 25 1 , I
-chrM 5169 A A 25 0 25 1 , I
-chrM 5170 C C 25 0 25 1 , I
-chrM 5171 C C 25 0 25 1 , I
-chrM 5172 C C 25 0 25 1 , I
-chrM 5173 T T 25 0 25 1 , I
-chrM 5174 A A 25 0 25 1 , I
-chrM 5175 A A 25 0 25 1 , I
-chrM 5176 T T 25 0 25 1 , I
-chrM 5177 C C 25 0 25 1 , I
-chrM 5178 A A 25 0 25 1 , I
-chrM 5179 A A 25 0 25 1 , I
-chrM 5180 C C 25 0 25 1 , I
-chrM 5181 T T 25 0 25 1 , I
-chrM 5182 G A 4 4 25 1 n "
-chrM 5183 G A 4 4 25 1 n "
-chrM 5184 C C 25 0 25 1 , I
-chrM 5185 T T 25 0 25 1 , I
-chrM 5186 T T 25 0 25 1 , I
-chrM 5187 C C 25 0 25 1 , I
-chrM 5188 A A 25 0 25 1 , I
-chrM 5189 A A 25 0 25 1 , I
-chrM 5190 T T 25 0 25 1 ,$ I
-chrM 5309 T T 25 0 25 1 ^:, I
-chrM 5310 C C 25 0 25 1 , I
-chrM 5311 C C 25 0 25 1 , I
-chrM 5312 A A 25 0 25 1 , I
-chrM 5313 A A 25 0 25 1 , I
-chrM 5314 C C 25 0 25 1 , I
-chrM 5315 C C 25 0 25 1 , I
-chrM 5316 C C 25 0 25 1 , I
-chrM 5317 C C 25 0 25 1 , I
-chrM 5318 T T 25 0 25 1 , I
-chrM 5319 G G 25 0 25 1 , I
-chrM 5320 T T 25 0 25 1 , I
-chrM 5321 C C 25 0 25 1 , I
-chrM 5322 T T 25 0 25 1 , I
-chrM 5323 T T 25 0 25 1 , I
-chrM 5324 T T 25 0 25 1 , I
-chrM 5325 A A 25 0 25 1 , I
-chrM 5326 G G 25 0 25 1 , I
-chrM 5327 A A 25 0 25 1 , I
-chrM 5328 T T 25 0 25 1 , I
-chrM 5329 T T 25 0 25 1 , I
-chrM 5330 T T 25 0 25 1 , I
-chrM 5331 A A 25 0 25 1 , I
-chrM 5332 C C 25 0 25 1 , I
-chrM 5333 A A 25 0 25 1 , I
-chrM 5334 G G 25 0 25 1 , I
-chrM 5335 T T 25 0 25 1 , I
-chrM 5336 C A 4 4 25 1 n "
-chrM 5337 T A 4 4 25 1 n "
-chrM 5338 A A 25 0 25 1 , I
-chrM 5339 A A 25 0 25 1 , I
-chrM 5340 T T 25 0 25 1 , I
-chrM 5341 G G 25 0 25 1 , I
-chrM 5342 C C 25 0 25 1 , I
-chrM 5343 T T 25 0 25 1 , I
-chrM 5344 T T 25 0 25 1 ,$ I
-chrM 5540 C C 25 0 25 1 ^:, ?
-chrM 5541 C C 25 0 25 1 , :
-chrM 5542 C C 25 0 25 1 , ;
-chrM 5543 A A 25 0 25 1 , I
-chrM 5544 T T 24 0 25 1 , 9
-chrM 5545 G G 25 0 25 1 , D
-chrM 5546 C C 25 0 25 1 , D
-chrM 5547 A A 25 0 25 1 , I
-chrM 5548 T T 25 0 25 1 , B
-chrM 5549 T T 25 0 25 1 , E
-chrM 5550 C C 25 0 25 1 , I
-chrM 5551 G G 25 0 25 1 , I
-chrM 5552 T T 25 0 25 1 , I
-chrM 5553 A A 25 0 25 1 , I
-chrM 5554 A A 25 0 25 1 , I
-chrM 5555 T T 25 0 25 1 , I
-chrM 5556 A A 25 0 25 1 , I
-chrM 5557 A A 25 0 25 1 , I
-chrM 5558 T T 25 0 25 1 , E
-chrM 5559 T T 25 0 25 1 , I
-chrM 5560 T T 25 0 25 1 , E
-chrM 5561 T T 25 0 25 1 , I
-chrM 5562 C C 25 0 25 1 , I
-chrM 5563 T T 25 0 25 1 , I
-chrM 5564 T T 25 0 25 1 , I
-chrM 5565 T T 25 0 25 1 , I
-chrM 5566 A A 25 0 25 1 , I
-chrM 5567 T A 4 4 25 1 n "
-chrM 5568 G A 4 4 25 1 n "
-chrM 5569 G G 25 0 25 1 , I
-chrM 5570 T T 25 0 25 1 , I
-chrM 5571 C C 25 0 25 1 , I
-chrM 5572 A A 25 0 25 1 , I
-chrM 5573 T T 25 0 25 1 , I
-chrM 5574 A A 25 0 25 1 , I
-chrM 5575 C C 25 0 25 1 ,$ I
-chrM 6016 T T 25 0 25 1 ^:, @
-chrM 6017 T T 22 0 25 1 , 7
-chrM 6018 C C 25 0 25 1 , I
-chrM 6019 T T 25 0 25 1 , <
-chrM 6020 T T 25 0 25 1 , ?
-chrM 6021 C C 25 0 25 1 , I
-chrM 6022 G G 25 0 25 1 , I
-chrM 6023 A A 25 0 25 1 , I
-chrM 6024 C C 25 0 25 1 , I
-chrM 6025 C C 25 0 25 1 , I
-chrM 6026 C C 25 0 25 1 , I
-chrM 6027 C C 25 0 25 1 , I
-chrM 6028 G G 25 0 25 1 , I
-chrM 6029 C C 25 0 25 1 , I
-chrM 6030 A A 25 0 25 1 , I
-chrM 6031 G G 25 0 25 1 , I
-chrM 6032 G G 25 0 25 1 , I
-chrM 6033 A A 25 0 25 1 , I
-chrM 6034 G G 25 0 25 1 , I
-chrM 6035 G G 25 0 25 1 , I
-chrM 6036 A A 25 0 25 1 , I
-chrM 6037 G G 25 0 25 1 , I
-chrM 6038 G G 25 0 25 1 , I
-chrM 6039 G G 25 0 25 1 , I
-chrM 6040 G G 33 0 25 2 ,^:. II
+chrM 1534 T T 33 0 25 2 ,$, >I
+chrM 1535 T T 30 0 25 1 , I
+chrM 1536 T T 30 0 25 1 , I
+chrM 1537 A A 30 0 25 1 , >
+chrM 1538 A A 30 0 25 1 ,$ ;
+chrM 1616 A A 30 0 25 1 ^:. E
+chrM 1617 G G 30 0 25 1 . I
+chrM 1618 T T 30 0 25 1 . I
+chrM 1619 T T 30 0 25 1 . I
+chrM 1620 G G 30 0 25 1 . I
+chrM 1621 G G 30 0 25 1 . I
+chrM 1622 C C 30 0 25 1 . I
+chrM 1623 T N 0 0 0 1 N "
+chrM 1624 T N 0 0 0 1 N "
+chrM 1625 A A 30 0 25 1 . I
+chrM 1626 A A 30 0 25 1 . I
+chrM 1627 A A 30 0 25 1 . I
+chrM 1628 A A 30 0 25 1 . I
+chrM 1629 G G 30 0 25 1 . I
+chrM 1630 C C 30 0 25 1 . I
+chrM 1631 A A 30 0 25 1 . I
+chrM 1632 G G 30 0 25 1 . I
+chrM 1633 C C 30 0 25 1 . I
+chrM 1634 C C 30 0 25 1 . I
+chrM 1635 A A 30 0 25 1 . C
+chrM 1636 T T 30 0 25 1 . I
+chrM 1637 C C 30 0 25 1 . I
+chrM 1638 A A 30 0 25 1 . =
+chrM 1639 A A 30 0 25 1 . G
+chrM 1640 T T 30 0 25 1 . I
+chrM 1641 T T 30 0 25 1 . I
+chrM 1642 A A 30 0 25 1 . I
+chrM 1643 A A 30 0 25 1 . I
+chrM 1644 G G 30 0 25 1 . I
+chrM 1645 A A 30 0 25 1 . @
+chrM 1646 A A 30 0 25 1 . I
+chrM 1647 A A 30 0 25 1 . G
+chrM 1648 G G 30 0 25 1 . I
+chrM 1649 C C 30 0 25 1 . I
+chrM 1650 G G 30 0 25 1 . I
+chrM 1651 T T 30 0 25 1 .$ >
+chrM 2261 C C 30 0 25 1 ^:, E
+chrM 2262 A A 30 0 25 1 , I
+chrM 2263 G G 30 0 25 1 , I
+chrM 2264 C C 30 0 25 1 , I
+chrM 2265 A A 30 0 25 1 , G
+chrM 2266 A A 30 0 25 1 , I
+chrM 2267 T T 30 0 25 1 , 2
+chrM 2268 T T 30 0 25 1 , =
+chrM 2269 T T 30 0 25 1 , 3
+chrM 2270 C C 30 0 25 1 , I
+chrM 2271 G G 30 0 25 1 , I
+chrM 2272 G G 30 0 25 1 , I
+chrM 2273 T T 30 0 25 1 , I
+chrM 2274 T T 30 0 25 1 , I
+chrM 2275 G G 30 0 25 1 , I
+chrM 2276 G G 30 0 25 1 , I
+chrM 2277 G G 30 0 25 1 , I
+chrM 2278 G G 30 0 25 1 , I
+chrM 2279 T T 30 0 25 1 , I
+chrM 2280 G G 30 0 25 1 , I
+chrM 2281 A A 30 0 25 1 , I
+chrM 2282 C C 30 0 25 1 , I
+chrM 2283 C C 30 0 25 1 , I
+chrM 2284 T T 30 0 25 1 , I
+chrM 2285 C C 30 0 25 1 , I
+chrM 2286 G G 30 0 25 1 , I
+chrM 2287 G G 30 0 25 1 , I
+chrM 2288 A N 0 0 0 1 n "
+chrM 2289 G N 0 0 0 1 n "
+chrM 2290 A A 30 0 25 1 , I
+chrM 2291 A A 30 0 25 1 , I
+chrM 2292 C C 30 0 25 1 , I
+chrM 2293 A A 30 0 25 1 , E
+chrM 2294 A A 30 0 25 1 , B
+chrM 2295 A A 30 0 25 1 , @
+chrM 2296 A A 30 0 25 1 ,$ ?
+chrM 2334 A A 30 0 25 1 ^:, ;
+chrM 2335 A A 30 0 25 1 , ;
+chrM 2336 A A 30 0 25 1 , >
+chrM 2337 T T 30 0 25 1 , I
+chrM 2338 A A 30 0 25 1 , I
+chrM 2339 T T 30 0 25 1 , H
+chrM 2340 A A 30 0 25 1 , I
+chrM 2341 T T 30 0 25 1 , =
+chrM 2342 A A 30 0 25 1 , I
+chrM 2343 A A 30 0 25 1 , I
+chrM 2344 T T 30 0 25 1 , C
+chrM 2345 C C 30 0 25 1 , I
+chrM 2346 A A 30 0 25 1 , I
+chrM 2347 C C 30 0 25 1 , I
+chrM 2348 T T 30 0 25 1 , ?
+chrM 2349 T T 30 0 25 1 , I
+chrM 2350 A A 30 0 25 1 , I
+chrM 2351 T T 30 0 25 1 , I
+chrM 2352 T T 30 0 25 1 , I
+chrM 2353 G G 30 0 25 1 , I
+chrM 2354 A A 30 0 25 1 , I
+chrM 2355 T T 30 0 25 1 , D
+chrM 2356 C C 30 0 25 1 , I
+chrM 2357 C C 30 0 25 1 , I
+chrM 2358 A A 30 0 25 1 , I
+chrM 2359 A A 30 0 25 1 , I
+chrM 2360 A A 30 0 25 1 , I
+chrM 2361 C N 0 0 0 1 n "
+chrM 2362 C N 0 0 0 1 n "
+chrM 2363 A A 30 0 25 1 , I
+chrM 2364 T T 30 0 25 1 , I
+chrM 2365 T T 30 0 25 1 , I
+chrM 2366 G G 30 0 25 1 , I
+chrM 2367 A A 30 0 25 1 , I
+chrM 2368 T T 30 0 25 1 , I
+chrM 2369 C C 30 0 25 1 ,$ E
+chrM 2389 G G 30 0 25 1 ^:, A
+chrM 2390 G G 30 0 25 1 , 8
+chrM 2391 G G 30 0 25 1 , E
+chrM 2392 A A 30 0 25 1 , I
+chrM 2393 T T 30 0 25 1 , I
+chrM 2394 A A 30 0 25 1 , I
+chrM 2395 A A 30 0 25 1 , I
+chrM 2396 C C 30 0 25 1 , 8
+chrM 2397 A A 30 0 25 1 , I
+chrM 2398 G G 30 0 25 1 , I
+chrM 2399 C C 30 0 25 1 , I
+chrM 2400 G G 30 0 25 1 , I
+chrM 2401 C C 30 0 25 1 , I
+chrM 2402 A A 30 0 25 1 , I
+chrM 2403 A A 30 0 25 1 , I
+chrM 2404 T T 30 0 25 1 , I
+chrM 2405 C C 30 0 25 1 , I
+chrM 2406 C C 30 0 25 1 , I
+chrM 2407 T T 30 0 25 1 , G
+chrM 2408 A A 30 0 25 1 , I
+chrM 2409 T T 30 0 25 1 , I
+chrM 2410 T T 30 0 25 1 , B
+chrM 2411 C C 30 0 25 1 , I
+chrM 2412 C C 30 0 25 1 , I
+chrM 2413 A A 30 0 25 1 , I
+chrM 2414 G G 30 0 25 1 , I
+chrM 2415 A A 30 0 25 1 , I
+chrM 2416 G N 0 0 0 1 n "
+chrM 2417 T N 0 0 0 1 n "
+chrM 2418 C C 30 0 25 1 , I
+chrM 2419 C C 30 0 25 1 , I
+chrM 2420 A A 30 0 25 1 , I
+chrM 2421 T T 30 0 25 1 , I
+chrM 2422 A A 30 0 25 1 , I
+chrM 2423 T T 30 0 25 1 , I
+chrM 2424 C C 30 0 25 1 ,$ E
+chrM 2735 t T 30 0 25 1 ^:, A
+chrM 2736 t T 30 0 25 1 , 9
+chrM 2737 t T 30 0 25 1 , E
+chrM 2738 a A 30 0 25 1 , I
+chrM 2739 c C 30 0 25 1 , I
+chrM 2740 a A 30 0 25 1 , I
+chrM 2741 c C 30 0 25 1 , I
+chrM 2742 t T 30 0 25 1 , 5
+chrM 2743 c C 30 0 25 1 , I
+chrM 2744 a A 30 0 25 1 , I
+chrM 2745 g G 30 0 25 1 , I
+chrM 2746 a A 30 0 25 1 , I
+chrM 2747 g G 30 0 25 1 , I
+chrM 2748 g G 30 0 25 1 , I
+chrM 2749 t T 30 0 25 1 , I
+chrM 2750 t T 30 0 25 1 , I
+chrM 2751 c C 30 0 25 1 , I
+chrM 2752 a A 30 0 25 1 , I
+chrM 2753 a A 30 0 25 1 , I
+chrM 2754 c C 30 0 25 1 , I
+chrM 2755 t T 30 0 25 1 , I
+chrM 2756 c C 30 0 25 1 , I
+chrM 2757 c C 30 0 25 1 , I
+chrM 2758 t T 30 0 25 1 , I
+chrM 2759 c C 30 0 25 1 , I
+chrM 2760 t T 30 0 25 1 , I
+chrM 2761 c C 30 0 25 1 , I
+chrM 2762 c N 0 0 0 1 n "
+chrM 2763 c N 0 0 0 1 n "
+chrM 2764 t T 30 0 25 1 , I
+chrM 2765 a A 30 0 25 1 , I
+chrM 2766 a A 30 0 25 1 , I
+chrM 2767 c C 30 0 25 1 , I
+chrM 2768 a A 30 0 25 1 , I
+chrM 2769 a A 30 0 25 1 , I
+chrM 2770 c C 30 0 25 1 ,$ E
+chrM 2844 G G 30 0 25 1 ^:. E
+chrM 2845 A A 30 0 25 1 . I
+chrM 2846 A A 30 0 25 1 . I
+chrM 2847 A A 30 0 25 1 . I
+chrM 2848 A A 30 0 25 1 . I
+chrM 2849 G G 30 0 25 1 . I
+chrM 2850 T T 30 0 25 1 . I
+chrM 2851 C N 0 0 0 1 N "
+chrM 2852 T N 0 0 0 1 N "
+chrM 2853 T T 30 0 25 1 . I
+chrM 2854 A A 30 0 25 1 . I
+chrM 2855 G G 30 0 25 1 . I
+chrM 2856 G G 30 0 25 1 . I
+chrM 2857 C C 30 0 25 1 . I
+chrM 2858 T T 30 0 25 1 . I
+chrM 2859 A A 30 0 25 1 . I
+chrM 2860 T T 30 0 25 1 . I
+chrM 2861 A A 30 0 25 1 . B
+chrM 2862 T T 30 0 25 1 . I
+chrM 2863 G G 30 0 25 1 . I
+chrM 2864 C C 30 0 25 1 . I
+chrM 2865 A A 30 0 25 1 . I
+chrM 2866 A A 30 0 25 1 . B
+chrM 2867 C C 30 0 25 1 . I
+chrM 2868 T T 30 0 25 1 . I
+chrM 2869 T T 30 0 25 1 . I
+chrM 2870 C C 30 0 25 1 . I
+chrM 2871 G G 30 0 25 1 . =
+chrM 2872 C C 30 0 25 1 . I
+chrM 2873 A A 30 0 25 1 . @
+chrM 2874 A A 30 0 25 1 . 9
+chrM 2875 A A 30 0 25 1 . 6
+chrM 2876 G G 30 0 25 1 . D
+chrM 2877 G G 30 0 25 1 . 2
+chrM 2878 A N 0 0 0 1 . *
+chrM 2879 C C 30 0 25 1 .$ >
+chrM 3080 T T 30 0 25 1 ^:. B
+chrM 3081 T T 30 0 25 1 . E
+chrM 3082 C C 30 0 25 1 . I
+chrM 3083 A A 30 0 25 1 . I
+chrM 3084 T T 30 0 25 1 . I
+chrM 3085 A A 30 0 25 1 . I
+chrM 3086 C C 30 0 25 1 . I
+chrM 3087 T N 0 0 0 1 N "
+chrM 3088 A N 0 0 0 1 N "
+chrM 3089 G G 30 0 25 1 . I
+chrM 3090 C C 30 0 25 1 . I
+chrM 3091 C C 30 0 25 1 . I
+chrM 3092 A A 30 0 25 1 . I
+chrM 3093 T T 30 0 25 1 . I
+chrM 3094 G G 30 0 25 1 . I
+chrM 3095 T T 30 0 25 1 . I
+chrM 3096 C C 30 0 25 1 . I
+chrM 3097 C C 30 0 25 1 . I
+chrM 3098 A A 30 0 25 1 . I
+chrM 3099 G G 30 0 25 1 . H
+chrM 3100 C C 30 0 25 1 . I
+chrM 3101 C C 30 0 25 1 . I
+chrM 3102 T T 30 0 25 1 . I
+chrM 3103 A A 30 0 25 1 . I
+chrM 3104 G G 30 0 25 1 . I
+chrM 3105 C C 30 0 25 1 . I
+chrM 3106 T T 30 0 25 1 . I
+chrM 3107 G G 30 0 25 1 . I
+chrM 3108 T T 30 0 25 1 . I
+chrM 3109 C C 30 0 25 1 . I
+chrM 3110 T T 30 0 25 1 . I
+chrM 3111 A A 30 0 25 1 . <
+chrM 3112 C C 30 0 25 1 . I
+chrM 3113 T T 30 0 25 1 . I
+chrM 3114 C C 30 0 25 1 . I
+chrM 3115 A A 30 0 25 1 .$ >
+chrM 3188 A A 30 0 25 1 ^:, E
+chrM 3189 T T 30 0 25 1 , =
+chrM 3190 C C 30 0 25 1 , I
+chrM 3191 T T 30 0 25 1 , I
+chrM 3192 C C 30 0 25 1 , I
+chrM 3193 A A 30 0 25 1 , I
+chrM 3194 T T 30 0 25 1 , I
+chrM 3195 A A 30 0 25 1 , I
+chrM 3196 C C 30 0 25 1 , I
+chrM 3197 G G 30 0 25 1 , @
+chrM 3198 A A 30 0 25 1 , I
+chrM 3199 A A 30 0 25 1 , I
+chrM 3200 G G 30 0 25 1 , I
+chrM 3201 T T 30 0 25 1 , I
+chrM 3202 A A 30 0 25 1 , I
+chrM 3203 A A 30 0 25 1 , I
+chrM 3204 C C 30 0 25 1 , I
+chrM 3205 T T 30 0 25 1 , I
+chrM 3206 C C 30 0 25 1 , I
+chrM 3207 T T 30 0 25 1 , I
+chrM 3208 A A 30 0 25 1 , I
+chrM 3209 G G 30 0 25 1 , I
+chrM 3210 C C 30 0 25 1 , I
+chrM 3211 A A 30 0 25 1 , I
+chrM 3212 A A 30 0 25 1 , I
+chrM 3213 T T 30 0 25 1 , I
+chrM 3214 C C 30 0 25 1 , I
+chrM 3215 A N 0 0 0 1 n "
+chrM 3216 T N 0 0 0 1 n "
+chrM 3217 C C 30 0 25 1 , I
+chrM 3218 C C 30 0 25 1 , I
+chrM 3219 T T 30 0 25 1 , I
+chrM 3220 A A 30 0 25 1 , I
+chrM 3221 C C 30 0 25 1 , I
+chrM 3222 T T 30 0 25 1 , F
+chrM 3223 C C 30 0 25 1 ,$ B
+chrM 3502 A A 30 0 25 1 ^:. E
+chrM 3503 G G 30 0 25 1 . I
+chrM 3504 C C 30 0 25 1 . I
+chrM 3505 A A 30 0 25 1 . I
+chrM 3506 T T 30 0 25 1 . I
+chrM 3507 T T 30 0 25 1 . I
+chrM 3508 T T 30 0 25 1 . I
+chrM 3509 C N 0 0 0 1 N "
+chrM 3510 A N 0 0 0 1 N "
+chrM 3511 C C 30 0 25 1 . I
+chrM 3512 A A 30 0 25 1 . I
+chrM 3513 A A 30 0 25 1 . I
+chrM 3514 C C 30 0 25 1 . I
+chrM 3515 C C 30 0 25 1 . I
+chrM 3516 C C 30 0 25 1 . I
+chrM 3517 C C 30 0 25 1 . I
+chrM 3518 T T 30 0 25 1 . I
+chrM 3519 A A 30 0 25 1 . I
+chrM 3520 C C 30 0 25 1 . I
+chrM 3521 C C 30 0 25 1 . I
+chrM 3522 T T 30 0 25 1 . I
+chrM 3523 G G 30 0 25 1 . I
+chrM 3524 C C 30 0 25 1 . I
+chrM 3525 C C 30 0 25 1 . I
+chrM 3526 A A 30 0 25 1 . >
+chrM 3527 G G 30 0 25 1 . I
+chrM 3528 A A 30 0 25 1 . 4
+chrM 3529 A A 30 0 25 1 . @
+chrM 3530 C C 30 0 25 1 . I
+chrM 3531 T T 30 0 25 1 . I
+chrM 3532 C C 30 0 25 1 . I
+chrM 3533 T T 30 0 25 1 . I
+chrM 3534 A A 30 0 25 1 . I
+chrM 3535 C C 30 0 25 1 . I
+chrM 3536 T T 30 0 25 1 . I
+chrM 3537 C C 30 0 25 1 .$ E
+chrM 3678 G G 30 0 25 1 ^:. E
+chrM 3679 A A 30 0 25 1 . I
+chrM 3680 C C 30 0 25 1 . I
+chrM 3681 A A 30 0 25 1 . I
+chrM 3682 C C 30 0 25 1 . I
+chrM 3683 G G 30 0 25 1 . I
+chrM 3684 T T 30 0 25 1 . I
+chrM 3685 C N 0 0 0 1 N "
+chrM 3686 T N 0 0 0 1 N "
+chrM 3687 C C 30 0 25 1 . I
+chrM 3688 A A 30 0 25 1 . I
+chrM 3689 C C 30 0 25 1 . I
+chrM 3690 T T 30 0 25 1 . I
+chrM 3691 T T 30 0 25 1 . I
+chrM 3692 C C 30 0 25 1 . I
+chrM 3693 C C 30 0 25 1 . I
+chrM 3694 A A 30 0 25 1 . I
+chrM 3695 A A 30 0 25 1 . :
+chrM 3696 T T 30 0 25 1 . I
+chrM 3697 C C 30 0 25 1 . I
+chrM 3698 A A 30 0 25 1 . I
+chrM 3699 T T 30 0 25 1 . I
+chrM 3700 A A 30 0 25 1 . 8
+chrM 3701 C C 30 0 25 1 . I
+chrM 3702 T T 30 0 25 1 . I
+chrM 3703 A A 30 0 25 1 . E
+chrM 3704 T T 30 0 25 1 . I
+chrM 3705 C C 30 0 25 1 . I
+chrM 3706 C C 30 0 25 1 . I
+chrM 3707 A A 30 0 25 1 . I
+chrM 3708 G N 0 0 0 1 . -
+chrM 3709 C C 30 0 25 1 . I
+chrM 3710 A A 30 0 25 1 . A
+chrM 3711 T T 30 0 25 1 . I
+chrM 3712 C C 30 0 25 1 . >
+chrM 3713 C C 30 0 25 1 .$ ;
+chrM 3753 T T 30 0 25 1 ^:. A
+chrM 3754 T T 30 0 25 1 . B
+chrM 3755 T T 30 0 25 1 . E
+chrM 3756 G G 30 0 25 1 . I
+chrM 3757 A A 30 0 25 1 . I
+chrM 3758 T T 30 0 25 1 . I
+chrM 3759 A A 30 0 25 1 . I
+chrM 3760 G N 0 0 0 1 N "
+chrM 3761 A N 0 0 0 1 N "
+chrM 3762 G G 30 0 25 1 . I
+chrM 3763 T T 30 0 25 1 . I
+chrM 3764 A A 30 0 25 1 . I
+chrM 3765 A A 30 0 25 1 . I
+chrM 3766 A A 30 0 25 1 . I
+chrM 3767 A A 30 0 25 1 . I
+chrM 3768 C C 30 0 25 1 . I
+chrM 3769 A A 30 0 25 1 . I
+chrM 3770 T T 30 0 25 1 . I
+chrM 3771 A A 30 0 25 1 . I
+chrM 3772 G G 30 0 25 1 . I
+chrM 3773 A A 30 0 25 1 . I
+chrM 3774 G G 30 0 25 1 . I
+chrM 3775 G G 30 0 25 1 . I
+chrM 3776 C C 30 0 25 1 . I
+chrM 3777 T T 30 0 25 1 . I
+chrM 3778 C C 30 0 25 1 . I
+chrM 3779 A A 30 0 25 1 . C
+chrM 3780 A A 30 0 25 1 . I
+chrM 3781 A A 30 0 25 1 . I
+chrM 3782 C C 30 0 25 1 . I
+chrM 3783 C C 30 0 25 1 . I
+chrM 3784 C C 30 0 25 1 . I
+chrM 3785 T T 30 0 25 1 . I
+chrM 3786 C C 30 0 25 1 . I
+chrM 3787 T T 30 0 25 1 . E
+chrM 3788 T T 30 0 25 1 .$ A
+chrM 3841 t T 30 0 25 1 ^:, E
+chrM 3842 g G 30 0 25 1 , I
+chrM 3843 c N 0 0 0 1 , +
+chrM 3844 t T 30 0 25 1 , I
+chrM 3845 a A 30 0 25 1 , I
+chrM 3846 c N 0 0 0 1 , %
+chrM 3847 c N 0 0 0 1 , (
+chrM 3848 g G 30 0 25 1 , I
+chrM 3849 a A 30 0 25 1 , I
+chrM 3850 a A 30 0 25 1 , I
+chrM 3851 t T 30 0 25 1 , I
+chrM 3852 t T 30 0 25 1 , I
+chrM 3853 a A 30 0 25 1 , I
+chrM 3854 c C 30 0 25 1 , I
+chrM 3855 a A 30 0 25 1 , I
+chrM 3856 c C 30 0 25 1 , I
+chrM 3857 c C 30 0 25 1 , I
+chrM 3858 a A 30 0 25 1 , I
+chrM 3859 t T 30 0 25 1 , I
+chrM 3860 g G 30 0 25 1 , I
+chrM 3861 t T 30 0 25 1 , I
+chrM 3862 c C 30 0 25 1 , I
+chrM 3863 c C 30 0 25 1 , I
+chrM 3864 t T 30 0 25 1 , I
+chrM 3865 a A 30 0 25 1 , I
+chrM 3866 C C 30 0 25 1 , I
+chrM 3867 A A 30 0 25 1 , I
+chrM 3868 A N 0 0 0 1 n "
+chrM 3869 G N 0 0 0 1 n "
+chrM 3870 T T 30 0 25 1 , I
+chrM 3871 A A 30 0 25 1 , I
+chrM 3872 A A 30 0 25 1 , I
+chrM 3873 G G 30 0 25 1 , I
+chrM 3874 G G 30 0 25 1 , I
+chrM 3875 T T 30 0 25 1 , I
+chrM 3876 C C 30 0 25 1 ,$ E
+chrM 3921 C C 30 0 25 1 ^:, E
+chrM 3922 A A 30 0 25 1 , I
+chrM 3923 C C 30 0 25 1 , I
+chrM 3924 C C 30 0 25 1 , I
+chrM 3925 C C 30 0 25 1 , I
+chrM 3926 T T 30 0 25 1 , =
+chrM 3927 T T 30 0 25 1 , A
+chrM 3928 C C 30 0 25 1 , I
+chrM 3929 C C 30 0 25 1 , I
+chrM 3930 C C 30 0 25 1 , I
+chrM 3931 G G 30 0 25 1 , I
+chrM 3932 T T 30 0 25 1 , I
+chrM 3933 A A 30 0 25 1 , I
+chrM 3934 C C 30 0 25 1 , I
+chrM 3935 T T 30 0 25 1 , I
+chrM 3936 A A 30 0 25 1 , I
+chrM 3937 A A 30 0 25 1 , I
+chrM 3938 T T 30 0 25 1 , I
+chrM 3939 A A 30 0 25 1 , I
+chrM 3940 A A 30 0 25 1 , I
+chrM 3941 A A 30 0 25 1 , I
+chrM 3942 T T 30 0 25 1 , B
+chrM 3943 C C 30 0 25 1 , I
+chrM 3944 C C 30 0 25 1 , I
+chrM 3945 C C 30 0 25 1 , I
+chrM 3946 C C 30 0 25 1 , I
+chrM 3947 T T 30 0 25 1 , I
+chrM 3948 T N 0 0 0 1 n "
+chrM 3949 A N 0 0 0 1 n "
+chrM 3950 T T 30 0 25 1 , I
+chrM 3951 C C 30 0 25 1 , I
+chrM 3952 T T 30 0 25 1 , I
+chrM 3953 T T 30 0 25 1 , I
+chrM 3954 C C 30 0 25 1 , I
+chrM 3955 A A 30 0 25 1 , I
+chrM 3956 C C 30 0 25 1 ,$ E
+chrM 4249 A A 30 0 25 1 ^:, ;
+chrM 4250 A A 30 0 25 1 , ;
+chrM 4251 A A 30 0 25 1 , >
+chrM 4252 C C 30 0 25 1 , I
+chrM 4253 T T 30 0 25 1 , 5
+chrM 4254 T T 30 0 25 1 , 6
+chrM 4255 G G 30 0 25 1 , I
+chrM 4256 G G 30 0 25 1 , I
+chrM 4257 A A 30 0 25 1 , I
+chrM 4258 C C 30 0 25 1 , I
+chrM 4259 T T 30 0 25 1 , I
+chrM 4260 C C 30 0 25 1 , I
+chrM 4261 A A 30 0 25 1 , I
+chrM 4262 C C 30 0 25 1 , I
+chrM 4263 A A 30 0 25 1 , I
+chrM 4264 C C 30 0 25 1 , I
+chrM 4265 C C 30 0 25 1 , I
+chrM 4266 A A 30 0 25 1 , I
+chrM 4267 T T 30 0 25 1 , I
+chrM 4268 T T 30 0 25 1 , I
+chrM 4269 C C 30 0 25 1 , I
+chrM 4270 C C 30 0 25 1 , I
+chrM 4271 A A 30 0 25 1 , I
+chrM 4272 C C 30 0 25 1 , I
+chrM 4273 T T 30 0 25 1 , I
+chrM 4274 T T 30 0 25 1 , I
+chrM 4275 C C 30 0 25 1 , I
+chrM 4276 T N 0 0 0 1 n "
+chrM 4277 G N 0 0 0 1 n "
+chrM 4278 A A 30 0 25 1 , I
+chrM 4279 G G 30 0 25 1 , I
+chrM 4280 T T 30 0 25 1 , I
+chrM 4281 A A 30 0 25 1 , I
+chrM 4282 C C 30 0 25 1 , E
+chrM 4283 C C 30 0 25 1 , B
+chrM 4284 C C 30 0 25 1 ,$ @
+chrM 4552 T T 30 0 25 1 ^:. B
+chrM 4553 T T 30 0 25 1 . E
+chrM 4554 A A 30 0 25 1 . I
+chrM 4555 A A 30 0 25 1 . I
+chrM 4556 T T 30 0 25 1 . I
+chrM 4557 T T 30 0 25 1 . I
+chrM 4558 T T 30 0 25 1 . I
+chrM 4559 A N 0 0 0 1 N "
+chrM 4560 C N 0 0 0 1 N "
+chrM 4561 A A 30 0 25 1 . I
+chrM 4562 T T 30 0 25 1 . I
+chrM 4563 T T 30 0 25 1 . I
+chrM 4564 A A 30 0 25 1 . I
+chrM 4565 T T 30 0 25 1 . I
+chrM 4566 A A 30 0 25 1 . I
+chrM 4567 A A 30 0 25 1 . I
+chrM 4568 T T 30 0 25 1 . I
+chrM 4569 A A 30 0 25 1 . I
+chrM 4570 A A 30 0 25 1 . I
+chrM 4571 C C 30 0 25 1 . I
+chrM 4572 A A 30 0 25 1 . I
+chrM 4573 C C 30 0 25 1 . I
+chrM 4574 T T 30 0 25 1 . I
+chrM 4575 C C 30 0 25 1 . I
+chrM 4576 A A 30 0 25 1 . I
+chrM 4577 C C 30 0 25 1 . I
+chrM 4578 A A 30 0 25 1 . I
+chrM 4579 A A 30 0 25 1 . ?
+chrM 4580 T T 30 0 25 1 . I
+chrM 4581 A A 30 0 25 1 . 6
+chrM 4582 T T 30 0 25 1 . I
+chrM 4583 T T 30 0 25 1 . I
+chrM 4584 C C 30 0 25 1 . I
+chrM 4585 A A 30 0 25 1 . I
+chrM 4586 T T 30 0 25 1 . I
+chrM 4587 A A 30 0 25 1 .$ 6
+chrM 4697 T T 30 0 25 1 ^:, 5
+chrM 4698 C C 30 0 25 1 , =
+chrM 4699 C C 30 0 25 1 , 4
+chrM 4700 C N 0 0 0 1 , &
+chrM 4701 C C 30 0 25 1 , G
+chrM 4702 C C 30 0 25 1 , 1
+chrM 4703 C C 30 0 25 1 , 3
+chrM 4704 A A 30 0 25 1 , I
+chrM 4705 C C 30 0 25 1 , .
+chrM 4706 T T 30 0 25 1 , ?
+chrM 4707 A A 30 0 25 1 , I
+chrM 4708 T T 30 0 25 1 , I
+chrM 4709 C C 30 0 25 1 , I
+chrM 4710 A A 30 0 25 1 , I
+chrM 4711 G G 30 0 25 1 , I
+chrM 4712 G G 30 0 25 1 , I
+chrM 4713 A A 30 0 25 1 , I
+chrM 4714 T T 30 0 25 1 , I
+chrM 4715 T T 30 0 25 1 , I
+chrM 4716 C C 30 0 25 1 , I
+chrM 4717 A A 30 0 25 1 , I
+chrM 4718 T T 30 0 25 1 , I
+chrM 4719 A A 30 0 25 1 , I
+chrM 4720 C C 30 0 25 1 , I
+chrM 4721 C C 30 0 25 1 , I
+chrM 4722 C C 30 0 25 1 , I
+chrM 4723 A A 30 0 25 1 , I
+chrM 4724 A N 0 0 0 1 n "
+chrM 4725 A N 0 0 0 1 n "
+chrM 4726 T T 30 0 25 1 , I
+chrM 4727 G G 30 0 25 1 , I
+chrM 4728 A A 30 0 25 1 , I
+chrM 4729 A A 30 0 25 1 , I
+chrM 4730 T T 30 0 25 1 , I
+chrM 4731 A A 30 0 25 1 , E
+chrM 4732 A A 30 0 25 1 ,$ B
+chrM 4742 A A 30 0 25 1 ^:. D
+chrM 4743 G G 30 0 25 1 . I
+chrM 4744 C C 30 0 25 1 . I
+chrM 4745 T T 30 0 25 1 . I
+chrM 4746 C C 30 0 25 1 . I
+chrM 4747 A A 30 0 25 1 . I
+chrM 4748 C C 30 0 25 1 . I
+chrM 4749 C N 0 0 0 1 N "
+chrM 4750 A N 0 0 0 1 N "
+chrM 4751 A A 30 0 25 1 . I
+chrM 4752 A A 30 0 25 1 . I
+chrM 4753 A A 30 0 25 1 . I
+chrM 4754 A A 30 0 25 1 . I
+chrM 4755 T T 30 0 25 1 . I
+chrM 4756 A A 30 0 25 1 . I
+chrM 4757 G G 30 0 25 1 . I
+chrM 4758 C C 30 0 25 1 . I
+chrM 4759 A A 30 0 25 1 . I
+chrM 4760 G G 30 0 25 1 . I
+chrM 4761 C C 30 0 25 1 . I
+chrM 4762 A A 30 0 25 1 . I
+chrM 4763 T T 30 0 25 1 . I
+chrM 4764 C C 30 0 25 1 . I
+chrM 4765 A A 30 0 25 1 . I
+chrM 4766 T T 30 0 25 1 . I
+chrM 4767 C C 30 0 25 1 . I
+chrM 4768 C C 30 0 25 1 . I
+chrM 4769 T T 30 0 25 1 . I
+chrM 4770 C C 30 0 25 1 . I
+chrM 4771 C C 30 0 25 1 . I
+chrM 4772 C C 30 0 25 1 . I
+chrM 4773 C C 30 0 25 1 . I
+chrM 4774 A A 30 0 25 1 . 8
+chrM 4775 C C 30 0 25 1 . I
+chrM 4776 A A 30 0 25 1 . :
+chrM 4777 C C 30 0 25 1 .$ E
+chrM 4932 C C 30 0 25 1 ^:, E
+chrM 4933 T N 0 0 0 1 , -
+chrM 4934 C C 30 0 25 1 , A
+chrM 4935 C C 30 0 25 1 , I
+chrM 4936 C C 30 0 25 1 , I
+chrM 4937 T T 30 0 25 1 , 7
+chrM 4938 A A 30 0 25 1 , I
+chrM 4939 C C 30 0 25 1 , I
+chrM 4940 T T 30 0 25 1 , 5
+chrM 4941 C C 30 0 25 1 , I
+chrM 4942 C C 30 0 25 1 , I
+chrM 4943 T T 30 0 25 1 , :
+chrM 4944 C C 30 0 25 1 , I
+chrM 4945 C C 30 0 25 1 , I
+chrM 4946 C C 30 0 25 1 , I
+chrM 4947 C C 30 0 25 1 , I
+chrM 4948 C C 30 0 25 1 , I
+chrM 4949 T T 30 0 25 1 , I
+chrM 4950 A A 30 0 25 1 , I
+chrM 4951 A A 30 0 25 1 , I
+chrM 4952 C C 30 0 25 1 , I
+chrM 4953 C C 30 0 25 1 , I
+chrM 4954 C C 30 0 25 1 , I
+chrM 4955 C C 30 0 25 1 , I
+chrM 4956 C C 30 0 25 1 , I
+chrM 4957 A A 30 0 25 1 , I
+chrM 4958 T T 30 0 25 1 , I
+chrM 4959 A N 0 0 0 1 n "
+chrM 4960 C N 0 0 0 1 n "
+chrM 4961 T T 30 0 25 1 , I
+chrM 4962 A A 30 0 25 1 , I
+chrM 4963 T T 30 0 25 1 , I
+chrM 4964 C C 30 0 25 1 , I
+chrM 4965 A A 30 0 25 1 , I
+chrM 4966 A A 30 0 25 1 , I
+chrM 4967 T T 30 0 25 1 ,$ >
+chrM 5155 G G 30 0 25 1 ^:, 7
+chrM 5156 T T 30 0 25 1 , I
+chrM 5157 T T 30 0 25 1 , I
+chrM 5158 A A 30 0 25 1 , I
+chrM 5159 A A 30 0 25 1 , I
+chrM 5160 C C 30 0 25 1 , I
+chrM 5161 A A 30 0 25 1 , I
+chrM 5162 G G 30 0 25 1 , I
+chrM 5163 C C 30 0 25 1 , I
+chrM 5164 T T 30 0 25 1 , I
+chrM 5165 A A 30 0 25 1 , I
+chrM 5166 A A 30 0 25 1 , I
+chrM 5167 A A 30 0 25 1 , I
+chrM 5168 T T 30 0 25 1 , I
+chrM 5169 A A 30 0 25 1 , I
+chrM 5170 C C 30 0 25 1 , I
+chrM 5171 C C 30 0 25 1 , I
+chrM 5172 C C 30 0 25 1 , I
+chrM 5173 T T 30 0 25 1 , I
+chrM 5174 A A 30 0 25 1 , I
+chrM 5175 A A 30 0 25 1 , I
+chrM 5176 T T 30 0 25 1 , I
+chrM 5177 C C 30 0 25 1 , I
+chrM 5178 A A 30 0 25 1 , I
+chrM 5179 A A 30 0 25 1 , I
+chrM 5180 C C 30 0 25 1 , I
+chrM 5181 T T 30 0 25 1 , I
+chrM 5182 G N 0 0 0 1 n "
+chrM 5183 G N 0 0 0 1 n "
+chrM 5184 C C 30 0 25 1 , I
+chrM 5185 T T 30 0 25 1 , I
+chrM 5186 T T 30 0 25 1 , I
+chrM 5187 C C 30 0 25 1 , I
+chrM 5188 A A 30 0 25 1 , I
+chrM 5189 A A 30 0 25 1 , I
+chrM 5190 T T 30 0 25 1 ,$ D
+chrM 5309 T T 30 0 25 1 ^:, E
+chrM 5310 C C 30 0 25 1 , I
+chrM 5311 C C 30 0 25 1 , I
+chrM 5312 A A 30 0 25 1 , I
+chrM 5313 A A 30 0 25 1 , I
+chrM 5314 C C 30 0 25 1 , I
+chrM 5315 C C 30 0 25 1 , I
+chrM 5316 C C 30 0 25 1 , I
+chrM 5317 C C 30 0 25 1 , I
+chrM 5318 T T 30 0 25 1 , I
+chrM 5319 G G 30 0 25 1 , I
+chrM 5320 T T 30 0 25 1 , I
+chrM 5321 C C 30 0 25 1 , I
+chrM 5322 T T 30 0 25 1 , I
+chrM 5323 T T 30 0 25 1 , I
+chrM 5324 T T 30 0 25 1 , I
+chrM 5325 A A 30 0 25 1 , I
+chrM 5326 G G 30 0 25 1 , I
+chrM 5327 A A 30 0 25 1 , I
+chrM 5328 T T 30 0 25 1 , I
+chrM 5329 T T 30 0 25 1 , I
+chrM 5330 T T 30 0 25 1 , I
+chrM 5331 A A 30 0 25 1 , I
+chrM 5332 C C 30 0 25 1 , I
+chrM 5333 A A 30 0 25 1 , I
+chrM 5334 G G 30 0 25 1 , I
+chrM 5335 T T 30 0 25 1 , I
+chrM 5336 C N 0 0 0 1 n "
+chrM 5337 T N 0 0 0 1 n "
+chrM 5338 A A 30 0 25 1 , I
+chrM 5339 A A 30 0 25 1 , I
+chrM 5340 T T 30 0 25 1 , I
+chrM 5341 G G 30 0 25 1 , I
+chrM 5342 C C 30 0 25 1 , I
+chrM 5343 T T 30 0 25 1 , E
+chrM 5344 T T 30 0 25 1 ,$ B
+chrM 5540 C C 30 0 25 1 ^:, ?
+chrM 5541 C C 30 0 25 1 , :
+chrM 5542 C C 30 0 25 1 , ;
+chrM 5543 A A 30 0 25 1 , I
+chrM 5544 T T 30 0 25 1 , 9
+chrM 5545 G G 30 0 25 1 , D
+chrM 5546 C C 30 0 25 1 , D
+chrM 5547 A A 30 0 25 1 , I
+chrM 5548 T T 30 0 25 1 , B
+chrM 5549 T T 30 0 25 1 , E
+chrM 5550 C C 30 0 25 1 , I
+chrM 5551 G G 30 0 25 1 , I
+chrM 5552 T T 30 0 25 1 , I
+chrM 5553 A A 30 0 25 1 , I
+chrM 5554 A A 30 0 25 1 , I
+chrM 5555 T T 30 0 25 1 , I
+chrM 5556 A A 30 0 25 1 , I
+chrM 5557 A A 30 0 25 1 , I
+chrM 5558 T T 30 0 25 1 , E
+chrM 5559 T T 30 0 25 1 , I
+chrM 5560 T T 30 0 25 1 , E
+chrM 5561 T T 30 0 25 1 , I
+chrM 5562 C C 30 0 25 1 , I
+chrM 5563 T T 30 0 25 1 , I
+chrM 5564 T T 30 0 25 1 , I
+chrM 5565 T T 30 0 25 1 , I
+chrM 5566 A A 30 0 25 1 , I
+chrM 5567 T N 0 0 0 1 n "
+chrM 5568 G N 0 0 0 1 n "
+chrM 5569 G G 30 0 25 1 , I
+chrM 5570 T T 30 0 25 1 , I
+chrM 5571 C C 30 0 25 1 , I
+chrM 5572 A A 30 0 25 1 , I
+chrM 5573 T T 30 0 25 1 , I
+chrM 5574 A A 30 0 25 1 , I
+chrM 5575 C C 30 0 25 1 ,$ >
+chrM 6016 T T 30 0 25 1 ^:, >
+chrM 6017 T T 30 0 25 1 , 7
+chrM 6018 C C 30 0 25 1 , I
+chrM 6019 T T 30 0 25 1 , <
+chrM 6020 T T 30 0 25 1 , ?
+chrM 6021 C C 30 0 25 1 , I
+chrM 6022 G G 30 0 25 1 , I
+chrM 6023 A A 30 0 25 1 , I
+chrM 6024 C C 30 0 25 1 , I
+chrM 6025 C C 30 0 25 1 , I
+chrM 6026 C C 30 0 25 1 , I
+chrM 6027 C C 30 0 25 1 , I
+chrM 6028 G G 30 0 25 1 , I
+chrM 6029 C C 30 0 25 1 , I
+chrM 6030 A A 30 0 25 1 , I
+chrM 6031 G G 30 0 25 1 , I
+chrM 6032 G G 30 0 25 1 , I
+chrM 6033 A A 30 0 25 1 , I
+chrM 6034 G G 30 0 25 1 , I
+chrM 6035 G G 30 0 25 1 , I
+chrM 6036 A A 30 0 25 1 , I
+chrM 6037 G G 30 0 25 1 , I
+chrM 6038 G G 30 0 25 1 , I
+chrM 6039 G G 30 0 25 1 , I
+chrM 6040 G G 33 0 25 2 ,^:. IE
chrM 6041 A A 33 0 25 2 ,. II
chrM 6042 T T 33 0 25 2 ,. II
-chrM 6043 C C 19 0 25 2 n. "I
-chrM 6044 C C 19 0 25 2 n. "I
+chrM 6043 C C 30 0 25 2 n. "I
+chrM 6044 C C 30 0 25 2 n. "I
chrM 6045 A A 33 0 25 2 ,. II
chrM 6046 A A 33 0 25 2 ,. II
-chrM 6047 T T 19 0 25 2 ,N I"
-chrM 6048 C C 19 0 25 2 ,N I"
+chrM 6047 T T 30 0 25 2 ,N I"
+chrM 6048 C C 30 0 25 2 ,N I"
chrM 6049 C C 33 0 25 2 ,. II
-chrM 6050 T T 33 0 25 2 ,. II
-chrM 6051 T T 33 0 25 2 ,$. II
-chrM 6052 T T 25 0 25 1 . I
-chrM 6053 A A 33 0 25 2 .^:. II
+chrM 6050 T T 33 0 25 2 ,. >I
+chrM 6051 T T 33 0 25 2 ,$. ;I
+chrM 6052 T T 30 0 25 1 . I
+chrM 6053 A A 33 0 25 2 .^:. IE
chrM 6054 T T 33 0 25 2 .. II
chrM 6055 C C 33 0 25 2 .. II
chrM 6056 A A 33 0 25 2 .. II
chrM 6057 A A 33 0 25 2 .. II
chrM 6058 C C 33 0 25 2 .. II
chrM 6059 A A 33 0 25 2 .. II
-chrM 6060 C C 19 0 25 2 .N I"
-chrM 6061 C C 19 0 25 2 .N I"
+chrM 6060 C C 30 0 25 2 .N I"
+chrM 6061 C C 30 0 25 2 .N I"
chrM 6062 T T 33 0 25 2 .. II
chrM 6063 A A 33 0 25 2 .. II
chrM 6064 T T 33 0 25 2 .. II
@@ -1066,109 +1066,109 @@ chrM 6071 T T 33 0 25 2 .. II
chrM 6072 C C 33 0 25 2 .. II
chrM 6073 T T 33 0 25 2 .. II
chrM 6074 T T 33 0 25 2 .. II
-chrM 6075 C C 33 0 25 2 .$. II
-chrM 6076 G G 25 0 25 1 . I
-chrM 6077 G G 25 0 25 1 . I
-chrM 6078 A A 25 0 25 1 . I
-chrM 6079 C C 25 0 25 1 . I
-chrM 6080 A A 25 0 25 1 . A
-chrM 6081 C C 25 0 25 1 . I
-chrM 6082 C C 25 0 25 1 . I
-chrM 6083 C C 25 0 25 1 . I
-chrM 6084 C C 25 0 25 1 . I
-chrM 6085 G G 25 0 25 1 . F
-chrM 6086 A A 7 0 25 1 . (
-chrM 6087 A A 13 0 25 1 . .
-chrM 6088 G G 25 0 25 1 .$ I
-chrM 6379 T T 25 0 25 1 ^:. I
-chrM 6380 G G 25 0 25 1 . I
-chrM 6381 A A 25 0 25 1 . I
-chrM 6382 G G 25 0 25 1 . I
-chrM 6383 C C 25 0 25 1 . I
-chrM 6384 T T 25 0 25 1 . I
-chrM 6385 C C 25 0 25 1 . I
-chrM 6386 T A 4 4 25 1 N "
-chrM 6387 A A 4 0 25 1 N "
-chrM 6388 G G 25 0 25 1 . I
-chrM 6389 G G 25 0 25 1 . I
-chrM 6390 C C 25 0 25 1 . I
-chrM 6391 T T 25 0 25 1 . I
-chrM 6392 T T 25 0 25 1 . I
-chrM 6393 C C 25 0 25 1 . I
-chrM 6394 A A 25 0 25 1 . C
-chrM 6395 T T 25 0 25 1 . I
-chrM 6396 C C 25 0 25 1 . I
-chrM 6397 T T 25 0 25 1 . I
-chrM 6398 T T 25 0 25 1 . I
-chrM 6399 C C 25 0 25 1 . I
-chrM 6400 T T 25 0 25 1 . I
-chrM 6401 T T 25 0 25 1 . I
-chrM 6402 A A 25 0 25 1 . I
-chrM 6403 T T 25 0 25 1 . I
-chrM 6404 T T 25 0 25 1 . I
-chrM 6405 C C 25 0 25 1 . I
-chrM 6406 A A 25 0 25 1 . I
-chrM 6407 C C 25 0 25 1 . I
-chrM 6408 A A 25 0 25 1 . I
-chrM 6409 G G 25 0 25 1 . @
-chrM 6410 T T 25 0 25 1 . I
-chrM 6411 A A 25 0 25 1 . I
-chrM 6412 G G 20 0 25 1 . 5
-chrM 6413 G G 25 0 25 1 . @
-chrM 6414 A A 25 0 25 1 .$ F
-chrM 6591 A A 25 0 25 1 ^:. I
-chrM 6592 A A 25 0 25 1 . I
-chrM 6593 A A 25 0 25 1 . I
-chrM 6594 A A 25 0 25 1 . I
-chrM 6595 A A 25 0 25 1 . I
-chrM 6596 T T 25 0 25 1 . I
-chrM 6597 C C 25 0 25 1 . I
-chrM 6598 C A 4 4 25 1 N "
-chrM 6599 A A 4 0 25 1 N "
-chrM 6600 C C 25 0 25 1 . I
-chrM 6601 T T 25 0 25 1 . I
-chrM 6602 T T 25 0 25 1 . I
-chrM 6603 T T 25 0 25 1 . I
-chrM 6604 A A 25 0 25 1 . I
-chrM 6605 C C 25 0 25 1 . I
-chrM 6606 A A 25 0 25 1 . I
-chrM 6607 A A 25 0 25 1 . I
-chrM 6608 T T 25 0 25 1 . I
-chrM 6609 T T 25 0 25 1 . I
-chrM 6610 A A 25 0 25 1 . I
-chrM 6611 T T 25 0 25 1 . I
-chrM 6612 A A 25 0 25 1 . I
-chrM 6613 T T 25 0 25 1 . I
-chrM 6614 T T 25 0 25 1 . I
-chrM 6615 C C 25 0 25 1 . I
-chrM 6616 G G 25 0 25 1 . F
-chrM 6617 T T 25 0 25 1 . I
-chrM 6618 A A 25 0 25 1 . I
-chrM 6619 G G 25 0 25 1 . I
-chrM 6620 G G 21 0 25 1 . 6
-chrM 6621 G G 25 0 25 1 . A
-chrM 6622 G G 25 0 25 1 . I
-chrM 6623 T T 25 0 25 1 . I
-chrM 6624 A A 25 0 25 1 . I
-chrM 6625 A A 25 0 25 1 . G
-chrM 6626 A A 25 0 25 1 .$ I
-chrM 6695 A A 25 0 25 1 ^:. I
-chrM 6696 C C 25 0 25 1 . I
-chrM 6697 G G 25 0 25 1 . I
-chrM 6698 C C 25 0 25 1 . I
-chrM 6699 A A 25 0 25 1 . I
-chrM 6700 T T 25 0 25 1 . I
-chrM 6701 A A 25 0 25 1 . I
-chrM 6702 T A 4 4 25 1 N "
-chrM 6703 A A 28 0 25 2 N^:. "I
+chrM 6075 C C 33 0 25 2 .$. EI
+chrM 6076 G G 30 0 25 1 . I
+chrM 6077 G G 30 0 25 1 . I
+chrM 6078 A A 30 0 25 1 . I
+chrM 6079 C C 30 0 25 1 . I
+chrM 6080 A A 30 0 25 1 . A
+chrM 6081 C C 30 0 25 1 . I
+chrM 6082 C C 30 0 25 1 . I
+chrM 6083 C C 30 0 25 1 . I
+chrM 6084 C C 30 0 25 1 . I
+chrM 6085 G G 30 0 25 1 . F
+chrM 6086 A N 0 0 0 1 . (
+chrM 6087 A A 30 0 25 1 . .
+chrM 6088 G G 30 0 25 1 .$ E
+chrM 6379 T T 30 0 25 1 ^:. E
+chrM 6380 G G 30 0 25 1 . I
+chrM 6381 A A 30 0 25 1 . I
+chrM 6382 G G 30 0 25 1 . I
+chrM 6383 C C 30 0 25 1 . I
+chrM 6384 T T 30 0 25 1 . I
+chrM 6385 C C 30 0 25 1 . I
+chrM 6386 T N 0 0 0 1 N "
+chrM 6387 A N 0 0 0 1 N "
+chrM 6388 G G 30 0 25 1 . I
+chrM 6389 G G 30 0 25 1 . I
+chrM 6390 C C 30 0 25 1 . I
+chrM 6391 T T 30 0 25 1 . I
+chrM 6392 T T 30 0 25 1 . I
+chrM 6393 C C 30 0 25 1 . I
+chrM 6394 A A 30 0 25 1 . C
+chrM 6395 T T 30 0 25 1 . I
+chrM 6396 C C 30 0 25 1 . I
+chrM 6397 T T 30 0 25 1 . I
+chrM 6398 T T 30 0 25 1 . I
+chrM 6399 C C 30 0 25 1 . I
+chrM 6400 T T 30 0 25 1 . I
+chrM 6401 T T 30 0 25 1 . I
+chrM 6402 A A 30 0 25 1 . I
+chrM 6403 T T 30 0 25 1 . I
+chrM 6404 T T 30 0 25 1 . I
+chrM 6405 C C 30 0 25 1 . I
+chrM 6406 A A 30 0 25 1 . I
+chrM 6407 C C 30 0 25 1 . I
+chrM 6408 A A 30 0 25 1 . I
+chrM 6409 G G 30 0 25 1 . @
+chrM 6410 T T 30 0 25 1 . I
+chrM 6411 A A 30 0 25 1 . I
+chrM 6412 G G 30 0 25 1 . 5
+chrM 6413 G G 30 0 25 1 . @
+chrM 6414 A A 30 0 25 1 .$ E
+chrM 6591 A A 30 0 25 1 ^:. >
+chrM 6592 A A 30 0 25 1 . ?
+chrM 6593 A A 30 0 25 1 . A
+chrM 6594 A A 30 0 25 1 . B
+chrM 6595 A A 30 0 25 1 . E
+chrM 6596 T T 30 0 25 1 . I
+chrM 6597 C C 30 0 25 1 . I
+chrM 6598 C N 0 0 0 1 N "
+chrM 6599 A N 0 0 0 1 N "
+chrM 6600 C C 30 0 25 1 . I
+chrM 6601 T T 30 0 25 1 . I
+chrM 6602 T T 30 0 25 1 . I
+chrM 6603 T T 30 0 25 1 . I
+chrM 6604 A A 30 0 25 1 . I
+chrM 6605 C C 30 0 25 1 . I
+chrM 6606 A A 30 0 25 1 . I
+chrM 6607 A A 30 0 25 1 . I
+chrM 6608 T T 30 0 25 1 . I
+chrM 6609 T T 30 0 25 1 . I
+chrM 6610 A A 30 0 25 1 . I
+chrM 6611 T T 30 0 25 1 . I
+chrM 6612 A A 30 0 25 1 . I
+chrM 6613 T T 30 0 25 1 . I
+chrM 6614 T T 30 0 25 1 . I
+chrM 6615 C C 30 0 25 1 . I
+chrM 6616 G G 30 0 25 1 . F
+chrM 6617 T T 30 0 25 1 . I
+chrM 6618 A A 30 0 25 1 . I
+chrM 6619 G G 30 0 25 1 . I
+chrM 6620 G G 30 0 25 1 . 6
+chrM 6621 G G 30 0 25 1 . A
+chrM 6622 G G 30 0 25 1 . I
+chrM 6623 T T 30 0 25 1 . I
+chrM 6624 A A 30 0 25 1 . E
+chrM 6625 A A 30 0 25 1 . B
+chrM 6626 A A 30 0 25 1 .$ @
+chrM 6695 A A 30 0 25 1 ^:. E
+chrM 6696 C C 30 0 25 1 . I
+chrM 6697 G G 30 0 25 1 . I
+chrM 6698 C C 30 0 25 1 . I
+chrM 6699 A A 30 0 25 1 . I
+chrM 6700 T T 30 0 25 1 . I
+chrM 6701 A A 30 0 25 1 . I
+chrM 6702 T N 0 0 0 1 N "
+chrM 6703 A A 30 0 25 2 N^:. "E
chrM 6704 C C 33 0 25 2 .. II
chrM 6705 A A 33 0 25 2 .. II
chrM 6706 A A 33 0 25 2 .. II
chrM 6707 C C 33 0 25 2 .. II
chrM 6708 A A 33 0 25 2 .. II
chrM 6709 T T 33 0 25 2 .. II
-chrM 6710 G G 19 0 25 2 .N I"
-chrM 6711 A A 28 0 25 2 .N I"
+chrM 6710 G G 30 0 25 2 .N I"
+chrM 6711 A A 30 0 25 2 .N I"
chrM 6712 A A 33 0 25 2 .. II
chrM 6713 A A 33 0 25 2 .. II
chrM 6714 T T 33 0 25 2 .. II
@@ -1187,489 +1187,489 @@ chrM 6726 C C 33 0 25 2 .. II
chrM 6727 A A 33 0 25 2 .. I>
chrM 6728 T T 33 0 25 2 .. II
chrM 6729 A A 33 0 25 2 .. GI
-chrM 6730 G G 33 0 25 2 .$. IH
-chrM 6731 G G 25 0 25 1 . I
-chrM 6732 A A 25 0 25 1 . =
-chrM 6733 T T 25 0 25 1 . I
-chrM 6734 C C 25 0 25 1 . I
-chrM 6735 T T 25 0 25 1 . I
-chrM 6736 T T 25 0 25 1 . I
-chrM 6737 T T 25 0 25 1 . I
-chrM 6738 T T 25 0 25 1 .$ I
-chrM 6809 C C 8 0 25 1 ^:, )
-chrM 6810 T T 25 0 25 1 , I
-chrM 6811 A A 25 0 25 1 , I
-chrM 6812 C C 5 0 25 1 , &
-chrM 6813 A A 25 0 25 1 , I
-chrM 6814 G G 25 0 25 1 , I
-chrM 6815 T T 25 0 25 1 , I
-chrM 6816 A A 25 0 25 1 , I
-chrM 6817 G G 25 0 25 1 , I
-chrM 6818 A A 25 0 25 1 , I
-chrM 6819 A A 25 0 25 1 , I
-chrM 6820 T T 25 0 25 1 , I
-chrM 6821 T T 25 0 25 1 , I
-chrM 6822 A A 25 0 25 1 , I
-chrM 6823 A A 25 0 25 1 , I
-chrM 6824 C C 16 0 25 1 , 1
-chrM 6825 C C 25 0 25 1 , I
-chrM 6826 T T 25 0 25 1 , I
-chrM 6827 C C 25 0 25 1 , I
-chrM 6828 A A 25 0 25 1 , I
-chrM 6829 A A 25 0 25 1 , I
-chrM 6830 C C 25 0 25 1 , I
-chrM 6831 T T 25 0 25 1 , I
-chrM 6832 A A 25 0 25 1 , I
-chrM 6833 A A 25 0 25 1 , I
-chrM 6834 T T 25 0 25 1 , I
-chrM 6835 C C 25 0 25 1 , I
-chrM 6836 T A 4 4 25 1 n "
-chrM 6837 G A 4 4 25 1 n "
-chrM 6838 G G 25 0 25 1 , I
-chrM 6839 A A 25 0 25 1 , I
-chrM 6840 A A 25 0 25 1 , I
-chrM 6841 T T 25 0 25 1 , I
-chrM 6842 G G 25 0 25 1 , I
-chrM 6843 A A 25 0 25 1 , I
-chrM 6844 C C 25 0 25 1 ,$ I
-chrM 7018 A A 25 0 25 1 ^:. I
-chrM 7019 A A 25 0 25 1 . I
-chrM 7020 A A 25 0 25 1 . I
-chrM 7021 T T 25 0 25 1 . I
-chrM 7022 T T 25 0 25 1 . I
-chrM 7023 A A 25 0 25 1 . I
-chrM 7024 T T 25 0 25 1 . I
-chrM 7025 A A 4 0 25 1 N "
-chrM 7026 G A 4 4 25 1 N "
-chrM 7027 G G 25 0 25 1 . I
-chrM 7028 T T 25 0 25 1 . I
-chrM 7029 T T 25 0 25 1 . I
-chrM 7030 A A 25 0 25 1 . I
-chrM 7031 A A 25 0 25 1 . I
-chrM 7032 A A 25 0 25 1 . I
-chrM 7033 C C 25 0 25 1 . I
-chrM 7034 C C 25 0 25 1 . I
-chrM 7035 C C 25 0 25 1 . I
-chrM 7036 C C 25 0 25 1 . I
-chrM 7037 T T 25 0 25 1 . I
-chrM 7038 A A 25 0 25 1 . I
-chrM 7039 T T 25 0 25 1 . I
-chrM 7040 A A 25 0 25 1 . B
-chrM 7041 T T 25 0 25 1 . I
-chrM 7042 A A 25 0 25 1 . D
-chrM 7043 C C 25 0 25 1 . I
-chrM 7044 C C 25 0 25 1 . I
-chrM 7045 T T 25 0 25 1 . I
-chrM 7046 C C 25 0 25 1 . I
-chrM 7047 T T 25 0 25 1 . I
-chrM 7048 A A 15 0 25 1 . 0
-chrM 7049 T T 25 0 25 1 . I
-chrM 7050 G G 25 0 25 1 . I
-chrM 7051 G G 12 0 25 1 . -
-chrM 7052 C C 25 0 25 1 . I
-chrM 7053 C C 25 0 25 1 .$ G
-chrM 7122 C C 25 0 25 1 ^:, I
-chrM 7123 C C 25 0 25 1 , I
-chrM 7124 A A 25 0 25 1 , I
-chrM 7125 C C 19 0 25 1 , 4
-chrM 7126 A A 25 0 25 1 , I
-chrM 7127 C C 25 0 25 1 , I
-chrM 7128 A A 25 0 25 1 , I
-chrM 7129 C C 25 0 25 1 , I
-chrM 7130 T T 25 0 25 1 , I
-chrM 7131 A A 25 0 25 1 , I
-chrM 7132 A A 25 0 25 1 , I
-chrM 7133 T T 25 0 25 1 , I
-chrM 7134 A A 25 0 25 1 , I
-chrM 7135 A A 25 0 25 1 , I
-chrM 7136 T T 25 0 25 1 , I
-chrM 7137 C C 25 0 25 1 , I
-chrM 7138 G G 25 0 25 1 , I
-chrM 7139 T T 25 0 25 1 , I
-chrM 7140 A A 25 0 25 1 , I
-chrM 7141 T T 25 0 25 1 , I
-chrM 7142 T T 25 0 25 1 , I
-chrM 7143 C C 25 0 25 1 , I
-chrM 7144 C C 25 0 25 1 , I
-chrM 7145 T T 25 0 25 1 , I
-chrM 7146 A A 25 0 25 1 , I
-chrM 7147 A A 25 0 25 1 , I
-chrM 7148 T T 25 0 25 1 , I
-chrM 7149 T A 4 4 25 1 n "
-chrM 7150 A A 4 0 25 1 n "
-chrM 7151 G G 25 0 25 1 , I
-chrM 7152 C C 25 0 25 1 , I
-chrM 7153 T T 25 0 25 1 , I
-chrM 7154 C C 25 0 25 1 , I
-chrM 7155 T T 25 0 25 1 , I
-chrM 7156 C C 25 0 25 1 , I
-chrM 7157 T T 25 0 25 1 ,$ I
-chrM 7191 T T 25 0 25 1 ^:, <
-chrM 7192 A A 25 0 25 1 , I
-chrM 7193 A A 25 0 25 1 , I
-chrM 7194 A A 25 0 25 1 , I
-chrM 7195 T T 15 0 25 1 , 0
-chrM 7196 T T 25 0 25 1 , E
-chrM 7197 A A 25 0 25 1 , I
-chrM 7198 A A 25 0 25 1 , I
-chrM 7199 C C 18 0 25 1 , 3
-chrM 7200 C C 10 0 25 1 , +
-chrM 7201 C C 18 0 25 1 , 3
-chrM 7202 A A 25 0 25 1 , I
-chrM 7203 T T 17 0 25 1 , 2
-chrM 7204 A A 24 0 25 1 , 9
-chrM 7205 C C 25 0 25 1 , I
-chrM 7206 C C 25 0 25 1 , >
-chrM 7207 A A 25 0 25 1 , I
-chrM 7208 G G 25 0 25 1 , I
-chrM 7209 C C 25 0 25 1 , I
-chrM 7210 A A 23 0 25 1 , 8
-chrM 7211 C C 25 0 25 1 , A
-chrM 7212 C C 25 0 25 1 , I
-chrM 7213 A A 25 0 25 1 , I
-chrM 7214 T T 25 0 25 1 , I
-chrM 7215 A A 25 0 25 1 , I
-chrM 7216 G G 25 0 25 1 , I
-chrM 7217 A A 25 0 25 1 , I
-chrM 7218 T A 4 4 25 1 n "
-chrM 7219 G A 4 4 25 1 n "
-chrM 7220 C C 25 0 25 1 , I
-chrM 7221 T T 25 0 25 1 , I
-chrM 7222 C C 25 0 25 1 , I
-chrM 7223 A A 25 0 25 1 , I
-chrM 7224 A A 25 0 25 1 , I
-chrM 7225 G G 25 0 25 1 , I
-chrM 7226 A A 25 0 25 1 ,$ I
-chrM 7348 G G 25 0 25 1 ^:, I
-chrM 7349 G G 25 0 25 1 , I
-chrM 7350 C C 14 0 25 1 , /
-chrM 7351 C C 25 0 25 1 , <
-chrM 7352 A A 8 0 25 1 , )
-chrM 7353 C C 17 0 25 1 , 2
-chrM 7354 C C 25 0 25 1 , I
-chrM 7355 A A 25 0 25 1 , I
-chrM 7356 A A 25 0 25 1 , I
-chrM 7357 T T 25 0 25 1 , I
-chrM 7358 G G 25 0 25 1 , I
-chrM 7359 A A 25 0 25 1 , I
-chrM 7360 T T 25 0 25 1 , I
-chrM 7361 A A 25 0 25 1 , I
-chrM 7362 C C 25 0 25 1 , I
-chrM 7363 T T 25 0 25 1 , I
-chrM 7364 G G 25 0 25 1 , I
-chrM 7365 A A 25 0 25 1 , I
-chrM 7366 A A 25 0 25 1 , I
-chrM 7367 G G 25 0 25 1 , I
-chrM 7368 C C 25 0 25 1 , I
-chrM 7369 T T 25 0 25 1 , I
-chrM 7370 A A 25 0 25 1 , I
-chrM 7371 C C 25 0 25 1 , I
-chrM 7372 G G 25 0 25 1 , I
-chrM 7373 A A 25 0 25 1 , I
-chrM 7374 G G 25 0 25 1 , I
-chrM 7375 T A 4 4 25 1 n "
-chrM 7376 A A 4 0 25 1 n "
-chrM 7377 T T 25 0 25 1 , I
-chrM 7378 A A 25 0 25 1 , I
-chrM 7379 C C 25 0 25 1 , I
-chrM 7380 C C 25 0 25 1 , I
-chrM 7381 G G 25 0 25 1 , I
-chrM 7382 A A 25 0 25 1 , I
-chrM 7383 T T 25 0 25 1 ,$ I
-chrM 7398 C C 25 0 25 1 ^:, I
-chrM 7399 T T 25 0 25 1 , E
-chrM 7400 T T 25 0 25 1 , I
-chrM 7401 T T 25 0 25 1 , I
-chrM 7402 G G 25 0 25 1 , I
-chrM 7403 A A 25 0 25 1 , I
-chrM 7404 C C 25 0 25 1 , I
-chrM 7405 T T 25 0 25 1 , I
-chrM 7406 C C 25 0 25 1 , I
-chrM 7407 C C 25 0 25 1 , I
-chrM 7408 T T 25 0 25 1 , I
-chrM 7409 A A 25 0 25 1 , I
-chrM 7410 C C 25 0 25 1 , I
-chrM 7411 A A 25 0 25 1 , I
-chrM 7412 T T 25 0 25 1 , I
-chrM 7413 G G 25 0 25 1 , I
-chrM 7414 A A 25 0 25 1 , I
-chrM 7415 T T 25 0 25 1 , I
-chrM 7416 C C 25 0 25 1 , I
-chrM 7417 C C 25 0 25 1 , I
-chrM 7418 C C 25 0 25 1 , I
-chrM 7419 C C 25 0 25 1 , I
-chrM 7420 A A 25 0 25 1 , I
-chrM 7421 C C 25 0 25 1 , I
-chrM 7422 A A 25 0 25 1 , I
-chrM 7423 T T 25 0 25 1 , I
-chrM 7424 C C 25 0 25 1 , I
-chrM 7425 A A 4 0 25 1 n "
-chrM 7426 G A 4 4 25 1 n "
-chrM 7427 A A 25 0 25 1 , I
-chrM 7428 C C 25 0 25 1 , I
-chrM 7429 C C 25 0 25 1 , I
-chrM 7430 T T 25 0 25 1 , I
-chrM 7431 A A 25 0 25 1 , I
-chrM 7432 A A 25 0 25 1 , I
-chrM 7433 A A 25 0 25 1 ,$ I
-chrM 7564 G G 20 0 25 1 ^:, 5
-chrM 7565 A A 25 0 25 1 , I
-chrM 7566 C C 25 0 25 1 , I
-chrM 7567 G G 25 0 25 1 , I
-chrM 7568 C C 25 0 25 1 , @
-chrM 7569 T T 21 0 25 1 , 6
-chrM 7570 A A 25 0 25 1 , I
-chrM 7571 T T 25 0 25 1 , I
-chrM 7572 C C 25 0 25 1 , I
-chrM 7573 C C 25 0 25 1 , I
-chrM 7574 C C 25 0 25 1 , I
-chrM 7575 T T 25 0 25 1 , >
-chrM 7576 G G 25 0 25 1 , I
-chrM 7577 G G 25 0 25 1 , I
-chrM 7578 G G 25 0 25 1 , I
-chrM 7579 C C 20 0 25 1 , 5
-chrM 7580 G G 25 0 25 1 , I
-chrM 7581 C C 25 0 25 1 , I
-chrM 7582 C C 25 0 25 1 , I
-chrM 7583 T T 25 0 25 1 , I
-chrM 7584 A A 25 0 25 1 , I
-chrM 7585 A A 25 0 25 1 , I
-chrM 7586 A A 25 0 25 1 , I
-chrM 7587 T T 25 0 25 1 , I
-chrM 7588 C C 25 0 25 1 , I
-chrM 7589 A A 25 0 25 1 , I
-chrM 7590 G G 25 0 25 1 , I
-chrM 7591 A A 4 0 25 1 n "
-chrM 7592 C A 4 4 25 1 n "
-chrM 7593 A A 25 0 25 1 , I
-chrM 7594 A A 25 0 25 1 , I
-chrM 7595 C C 25 0 25 1 , I
-chrM 7596 T T 25 0 25 1 , I
-chrM 7597 C C 25 0 25 1 , I
-chrM 7598 T T 25 0 25 1 , I
-chrM 7599 C C 25 0 25 1 ,$ I
-chrM 7752 A A 25 0 25 1 ^:. I
-chrM 7753 G G 25 0 25 1 . I
-chrM 7754 C C 25 0 25 1 . I
-chrM 7755 A A 25 0 25 1 . I
-chrM 7756 T T 25 0 25 1 . I
-chrM 7757 T T 25 0 25 1 . I
-chrM 7758 A A 25 0 25 1 . I
-chrM 7759 A A 4 0 25 1 N "
-chrM 7760 C A 4 4 25 1 N "
-chrM 7761 C C 25 0 25 1 . I
-chrM 7762 T T 25 0 25 1 . I
-chrM 7763 T T 25 0 25 1 . I
-chrM 7764 T T 25 0 25 1 . I
-chrM 7765 T T 25 0 25 1 . I
-chrM 7766 A A 25 0 25 1 . I
-chrM 7767 A A 11 0 25 1 . ,
-chrM 7768 G G 25 0 25 1 . I
-chrM 7769 T T 25 0 25 1 . I
-chrM 7770 T T 25 0 25 1 . I
-chrM 7771 A A 25 0 25 1 . B
-chrM 7772 A A 25 0 25 1 . ;
-chrM 7773 A A 25 0 25 1 . B
-chrM 7774 G G 25 0 25 1 . I
-chrM 7775 A A 25 0 25 1 . <
-chrM 7776 T T 25 0 25 1 . I
-chrM 7777 T T 25 0 25 1 . I
-chrM 7778 G G 25 0 25 1 . I
-chrM 7779 A A 25 0 25 1 . I
-chrM 7780 G G 25 0 25 1 . I
-chrM 7781 G G 25 0 25 1 . I
-chrM 7782 G G 10 0 25 1 . +
-chrM 7783 T T 25 0 25 1 . I
-chrM 7784 T T 25 0 25 1 . I
-chrM 7785 C C 25 0 25 1 . I
-chrM 7786 A A 25 0 25 1 . B
-chrM 7787 A A 25 0 25 1 .$ I
-chrM 7971 G G 25 0 25 1 ^:, @
-chrM 7972 A A 25 0 25 1 , I
-chrM 7973 A A 25 0 25 1 , I
-chrM 7974 A A 25 0 25 1 , I
-chrM 7975 A A 25 0 25 1 , I
-chrM 7976 T T 22 0 25 1 , 7
-chrM 7977 C C 25 0 25 1 , I
-chrM 7978 T T 25 0 25 1 , I
-chrM 7979 A A 25 0 25 1 , I
-chrM 7980 T T 25 0 25 1 , D
-chrM 7981 T T 25 0 25 1 , C
-chrM 7982 C C 25 0 25 1 , I
-chrM 7983 G G 25 0 25 1 , I
-chrM 7984 C C 25 0 25 1 , I
-chrM 7985 C C 25 0 25 1 , I
-chrM 7986 T T 25 0 25 1 , B
-chrM 7987 C C 25 0 25 1 , I
-chrM 7988 T T 25 0 25 1 , I
-chrM 7989 T T 25 0 25 1 , I
-chrM 7990 T T 25 0 25 1 , I
-chrM 7991 C C 25 0 25 1 , I
-chrM 7992 G G 25 0 25 1 , I
-chrM 7993 C C 25 0 25 1 , I
-chrM 7994 T T 25 0 25 1 , I
-chrM 7995 A A 25 0 25 1 , I
-chrM 7996 C C 25 0 25 1 , I
-chrM 7997 C C 25 0 25 1 , I
-chrM 7998 C A 4 4 25 1 n "
-chrM 7999 C A 4 4 25 1 n "
-chrM 8000 A A 25 0 25 1 , I
-chrM 8001 A A 25 0 25 1 , I
-chrM 8002 C C 25 0 25 1 , I
-chrM 8003 A A 25 0 25 1 , I
-chrM 8004 A A 25 0 25 1 , I
-chrM 8005 T T 25 0 25 1 , I
-chrM 8006 A A 25 0 25 1 ,$ I
-chrM 8346 T T 25 0 25 1 ^:. I
-chrM 8347 T T 25 0 25 1 . I
-chrM 8348 T T 25 0 25 1 . I
-chrM 8349 C C 25 0 25 1 . I
-chrM 8350 T T 25 0 25 1 . I
-chrM 8351 A A 25 0 25 1 . I
-chrM 8352 C C 25 0 25 1 . I
-chrM 8353 C A 4 4 25 1 N "
-chrM 8354 T A 4 4 25 1 N "
-chrM 8355 C C 25 0 25 1 . I
-chrM 8356 A A 25 0 25 1 . I
-chrM 8357 A A 25 0 25 1 . I
-chrM 8358 G G 25 0 25 1 . I
-chrM 8359 G G 25 0 25 1 . I
-chrM 8360 G G 25 0 25 1 . =
-chrM 8361 A A 25 0 25 1 . I
-chrM 8362 C C 22 0 25 1 . 7
-chrM 8363 G G 25 0 25 1 . I
-chrM 8364 C C 25 0 25 1 . I
-chrM 8365 C C 25 0 25 1 . I
-chrM 8366 C C 25 0 25 1 . I
-chrM 8367 A A 18 0 25 1 . 3
-chrM 8368 T T 25 0 25 1 . I
-chrM 8369 T T 25 0 25 1 . I
-chrM 8370 T T 25 0 25 1 . I
-chrM 8371 T T 25 0 25 1 . I
-chrM 8372 C C 25 0 25 1 . I
-chrM 8373 C C 25 0 25 1 . I
-chrM 8374 T T 25 0 25 1 . I
-chrM 8375 C C 25 0 25 1 . I
-chrM 8376 A A 14 0 25 1 . /
-chrM 8377 T T 25 0 25 1 . I
-chrM 8378 C C 25 0 25 1 . D
-chrM 8379 C C 25 0 25 1 . @
-chrM 8380 C C 25 0 25 1 . I
-chrM 8381 C C 25 0 25 1 .$ I
-chrM 8421 C C 25 0 25 1 ^:, I
-chrM 8422 C C 25 0 25 1 , I
-chrM 8423 T T 4 0 25 1 , %
-chrM 8424 G G 25 0 25 1 , :
-chrM 8425 T T 25 0 25 1 , :
-chrM 8426 A A 25 0 25 1 , I
-chrM 8427 G G 25 0 25 1 , <
-chrM 8428 C C 25 0 25 1 , I
-chrM 8429 C C 25 0 25 1 , I
-chrM 8430 C C 25 0 25 1 , I
-chrM 8431 T T 25 0 25 1 , I
-chrM 8432 A A 25 0 25 1 , I
-chrM 8433 G G 25 0 25 1 , E
-chrM 8434 C C 25 0 25 1 , I
-chrM 8435 C C 25 0 25 1 , I
-chrM 8436 G G 25 0 25 1 , I
-chrM 8437 T T 23 0 25 1 , 8
-chrM 8438 G G 25 0 25 1 , I
-chrM 8439 C C 25 0 25 1 , I
-chrM 8440 G G 25 0 25 1 , I
-chrM 8441 G G 25 0 25 1 , I
-chrM 8442 C C 25 0 25 1 , I
-chrM 8443 T T 25 0 25 1 , I
-chrM 8444 A A 25 0 25 1 , I
-chrM 8445 A A 25 0 25 1 , I
-chrM 8446 C C 25 0 25 1 , I
-chrM 8447 C C 25 0 25 1 , I
-chrM 8448 G A 4 4 25 1 n "
-chrM 8449 C A 4 4 25 1 n "
-chrM 8450 T T 33 0 25 2 ,^:, II
+chrM 6730 G G 33 0 25 2 .$. >H
+chrM 6731 G G 30 0 25 1 . I
+chrM 6732 A A 30 0 25 1 . =
+chrM 6733 T T 30 0 25 1 . I
+chrM 6734 C C 30 0 25 1 . I
+chrM 6735 T T 30 0 25 1 . E
+chrM 6736 T T 30 0 25 1 . B
+chrM 6737 T T 30 0 25 1 . A
+chrM 6738 T T 30 0 25 1 .$ ?
+chrM 6809 C N 0 0 0 1 ^:, )
+chrM 6810 T T 30 0 25 1 , I
+chrM 6811 A A 30 0 25 1 , I
+chrM 6812 C N 0 0 0 1 , &
+chrM 6813 A A 30 0 25 1 , I
+chrM 6814 G G 30 0 25 1 , I
+chrM 6815 T T 30 0 25 1 , I
+chrM 6816 A A 30 0 25 1 , I
+chrM 6817 G G 30 0 25 1 , I
+chrM 6818 A A 30 0 25 1 , I
+chrM 6819 A A 30 0 25 1 , I
+chrM 6820 T T 30 0 25 1 , I
+chrM 6821 T T 30 0 25 1 , I
+chrM 6822 A A 30 0 25 1 , I
+chrM 6823 A A 30 0 25 1 , I
+chrM 6824 C C 30 0 25 1 , 1
+chrM 6825 C C 30 0 25 1 , I
+chrM 6826 T T 30 0 25 1 , I
+chrM 6827 C C 30 0 25 1 , I
+chrM 6828 A A 30 0 25 1 , I
+chrM 6829 A A 30 0 25 1 , I
+chrM 6830 C C 30 0 25 1 , I
+chrM 6831 T T 30 0 25 1 , I
+chrM 6832 A A 30 0 25 1 , I
+chrM 6833 A A 30 0 25 1 , I
+chrM 6834 T T 30 0 25 1 , I
+chrM 6835 C C 30 0 25 1 , I
+chrM 6836 T N 0 0 0 1 n "
+chrM 6837 G N 0 0 0 1 n "
+chrM 6838 G G 30 0 25 1 , I
+chrM 6839 A A 30 0 25 1 , I
+chrM 6840 A A 30 0 25 1 , I
+chrM 6841 T T 30 0 25 1 , I
+chrM 6842 G G 30 0 25 1 , I
+chrM 6843 A A 30 0 25 1 , I
+chrM 6844 C C 30 0 25 1 ,$ E
+chrM 7018 A A 30 0 25 1 ^:. A
+chrM 7019 A A 30 0 25 1 . B
+chrM 7020 A A 30 0 25 1 . E
+chrM 7021 T T 30 0 25 1 . I
+chrM 7022 T T 30 0 25 1 . I
+chrM 7023 A A 30 0 25 1 . I
+chrM 7024 T T 30 0 25 1 . I
+chrM 7025 A N 0 0 0 1 N "
+chrM 7026 G N 0 0 0 1 N "
+chrM 7027 G G 30 0 25 1 . I
+chrM 7028 T T 30 0 25 1 . I
+chrM 7029 T T 30 0 25 1 . I
+chrM 7030 A A 30 0 25 1 . I
+chrM 7031 A A 30 0 25 1 . I
+chrM 7032 A A 30 0 25 1 . I
+chrM 7033 C C 30 0 25 1 . I
+chrM 7034 C C 30 0 25 1 . I
+chrM 7035 C C 30 0 25 1 . I
+chrM 7036 C C 30 0 25 1 . I
+chrM 7037 T T 30 0 25 1 . I
+chrM 7038 A A 30 0 25 1 . I
+chrM 7039 T T 30 0 25 1 . I
+chrM 7040 A A 30 0 25 1 . B
+chrM 7041 T T 30 0 25 1 . I
+chrM 7042 A A 30 0 25 1 . D
+chrM 7043 C C 30 0 25 1 . I
+chrM 7044 C C 30 0 25 1 . I
+chrM 7045 T T 30 0 25 1 . I
+chrM 7046 C C 30 0 25 1 . I
+chrM 7047 T T 30 0 25 1 . I
+chrM 7048 A A 30 0 25 1 . 0
+chrM 7049 T T 30 0 25 1 . I
+chrM 7050 G G 30 0 25 1 . I
+chrM 7051 G N 0 0 0 1 . -
+chrM 7052 C C 30 0 25 1 . E
+chrM 7053 C C 30 0 25 1 .$ B
+chrM 7122 C C 30 0 25 1 ^:, B
+chrM 7123 C C 30 0 25 1 , E
+chrM 7124 A A 30 0 25 1 , I
+chrM 7125 C C 30 0 25 1 , 4
+chrM 7126 A A 30 0 25 1 , I
+chrM 7127 C C 30 0 25 1 , I
+chrM 7128 A A 30 0 25 1 , I
+chrM 7129 C C 30 0 25 1 , I
+chrM 7130 T T 30 0 25 1 , I
+chrM 7131 A A 30 0 25 1 , I
+chrM 7132 A A 30 0 25 1 , I
+chrM 7133 T T 30 0 25 1 , I
+chrM 7134 A A 30 0 25 1 , I
+chrM 7135 A A 30 0 25 1 , I
+chrM 7136 T T 30 0 25 1 , I
+chrM 7137 C C 30 0 25 1 , I
+chrM 7138 G G 30 0 25 1 , I
+chrM 7139 T T 30 0 25 1 , I
+chrM 7140 A A 30 0 25 1 , I
+chrM 7141 T T 30 0 25 1 , I
+chrM 7142 T T 30 0 25 1 , I
+chrM 7143 C C 30 0 25 1 , I
+chrM 7144 C C 30 0 25 1 , I
+chrM 7145 T T 30 0 25 1 , I
+chrM 7146 A A 30 0 25 1 , I
+chrM 7147 A A 30 0 25 1 , I
+chrM 7148 T T 30 0 25 1 , I
+chrM 7149 T N 0 0 0 1 n "
+chrM 7150 A N 0 0 0 1 n "
+chrM 7151 G G 30 0 25 1 , I
+chrM 7152 C C 30 0 25 1 , I
+chrM 7153 T T 30 0 25 1 , I
+chrM 7154 C C 30 0 25 1 , I
+chrM 7155 T T 30 0 25 1 , I
+chrM 7156 C C 30 0 25 1 , I
+chrM 7157 T T 30 0 25 1 ,$ D
+chrM 7191 T T 30 0 25 1 ^:, <
+chrM 7192 A A 30 0 25 1 , I
+chrM 7193 A A 30 0 25 1 , I
+chrM 7194 A A 30 0 25 1 , I
+chrM 7195 T T 30 0 25 1 , 0
+chrM 7196 T T 30 0 25 1 , E
+chrM 7197 A A 30 0 25 1 , I
+chrM 7198 A A 30 0 25 1 , I
+chrM 7199 C C 30 0 25 1 , 3
+chrM 7200 C N 0 0 0 1 , +
+chrM 7201 C C 30 0 25 1 , 3
+chrM 7202 A A 30 0 25 1 , I
+chrM 7203 T T 30 0 25 1 , 2
+chrM 7204 A A 30 0 25 1 , 9
+chrM 7205 C C 30 0 25 1 , I
+chrM 7206 C C 30 0 25 1 , >
+chrM 7207 A A 30 0 25 1 , I
+chrM 7208 G G 30 0 25 1 , I
+chrM 7209 C C 30 0 25 1 , I
+chrM 7210 A A 30 0 25 1 , 8
+chrM 7211 C C 30 0 25 1 , A
+chrM 7212 C C 30 0 25 1 , I
+chrM 7213 A A 30 0 25 1 , I
+chrM 7214 T T 30 0 25 1 , I
+chrM 7215 A A 30 0 25 1 , I
+chrM 7216 G G 30 0 25 1 , I
+chrM 7217 A A 30 0 25 1 , I
+chrM 7218 T N 0 0 0 1 n "
+chrM 7219 G N 0 0 0 1 n "
+chrM 7220 C C 30 0 25 1 , I
+chrM 7221 T T 30 0 25 1 , I
+chrM 7222 C C 30 0 25 1 , I
+chrM 7223 A A 30 0 25 1 , I
+chrM 7224 A A 30 0 25 1 , I
+chrM 7225 G G 30 0 25 1 , I
+chrM 7226 A A 30 0 25 1 ,$ >
+chrM 7348 G G 30 0 25 1 ^:, B
+chrM 7349 G G 30 0 25 1 , E
+chrM 7350 C C 30 0 25 1 , /
+chrM 7351 C C 30 0 25 1 , <
+chrM 7352 A N 0 0 0 1 , )
+chrM 7353 C C 30 0 25 1 , 2
+chrM 7354 C C 30 0 25 1 , I
+chrM 7355 A A 30 0 25 1 , I
+chrM 7356 A A 30 0 25 1 , I
+chrM 7357 T T 30 0 25 1 , I
+chrM 7358 G G 30 0 25 1 , I
+chrM 7359 A A 30 0 25 1 , I
+chrM 7360 T T 30 0 25 1 , I
+chrM 7361 A A 30 0 25 1 , I
+chrM 7362 C C 30 0 25 1 , I
+chrM 7363 T T 30 0 25 1 , I
+chrM 7364 G G 30 0 25 1 , I
+chrM 7365 A A 30 0 25 1 , I
+chrM 7366 A A 30 0 25 1 , I
+chrM 7367 G G 30 0 25 1 , I
+chrM 7368 C C 30 0 25 1 , I
+chrM 7369 T T 30 0 25 1 , I
+chrM 7370 A A 30 0 25 1 , I
+chrM 7371 C C 30 0 25 1 , I
+chrM 7372 G G 30 0 25 1 , I
+chrM 7373 A A 30 0 25 1 , I
+chrM 7374 G G 30 0 25 1 , I
+chrM 7375 T N 0 0 0 1 n "
+chrM 7376 A N 0 0 0 1 n "
+chrM 7377 T T 30 0 25 1 , I
+chrM 7378 A A 30 0 25 1 , I
+chrM 7379 C C 30 0 25 1 , I
+chrM 7380 C C 30 0 25 1 , I
+chrM 7381 G G 30 0 25 1 , I
+chrM 7382 A A 30 0 25 1 , I
+chrM 7383 T T 30 0 25 1 ,$ >
+chrM 7398 C C 30 0 25 1 ^:, E
+chrM 7399 T T 30 0 25 1 , E
+chrM 7400 T T 30 0 25 1 , I
+chrM 7401 T T 30 0 25 1 , I
+chrM 7402 G G 30 0 25 1 , I
+chrM 7403 A A 30 0 25 1 , I
+chrM 7404 C C 30 0 25 1 , I
+chrM 7405 T T 30 0 25 1 , I
+chrM 7406 C C 30 0 25 1 , I
+chrM 7407 C C 30 0 25 1 , I
+chrM 7408 T T 30 0 25 1 , I
+chrM 7409 A A 30 0 25 1 , I
+chrM 7410 C C 30 0 25 1 , I
+chrM 7411 A A 30 0 25 1 , I
+chrM 7412 T T 30 0 25 1 , I
+chrM 7413 G G 30 0 25 1 , I
+chrM 7414 A A 30 0 25 1 , I
+chrM 7415 T T 30 0 25 1 , I
+chrM 7416 C C 30 0 25 1 , I
+chrM 7417 C C 30 0 25 1 , I
+chrM 7418 C C 30 0 25 1 , I
+chrM 7419 C C 30 0 25 1 , I
+chrM 7420 A A 30 0 25 1 , I
+chrM 7421 C C 30 0 25 1 , I
+chrM 7422 A A 30 0 25 1 , I
+chrM 7423 T T 30 0 25 1 , I
+chrM 7424 C C 30 0 25 1 , I
+chrM 7425 A N 0 0 0 1 n "
+chrM 7426 G N 0 0 0 1 n "
+chrM 7427 A A 30 0 25 1 , I
+chrM 7428 C C 30 0 25 1 , I
+chrM 7429 C C 30 0 25 1 , I
+chrM 7430 T T 30 0 25 1 , I
+chrM 7431 A A 30 0 25 1 , >
+chrM 7432 A A 30 0 25 1 , ;
+chrM 7433 A A 30 0 25 1 ,$ :
+chrM 7564 G G 30 0 25 1 ^:, 5
+chrM 7565 A A 30 0 25 1 , I
+chrM 7566 C C 30 0 25 1 , I
+chrM 7567 G G 30 0 25 1 , I
+chrM 7568 C C 30 0 25 1 , @
+chrM 7569 T T 30 0 25 1 , 6
+chrM 7570 A A 30 0 25 1 , I
+chrM 7571 T T 30 0 25 1 , I
+chrM 7572 C C 30 0 25 1 , I
+chrM 7573 C C 30 0 25 1 , I
+chrM 7574 C C 30 0 25 1 , I
+chrM 7575 T T 30 0 25 1 , >
+chrM 7576 G G 30 0 25 1 , I
+chrM 7577 G G 30 0 25 1 , I
+chrM 7578 G G 30 0 25 1 , I
+chrM 7579 C C 30 0 25 1 , 5
+chrM 7580 G G 30 0 25 1 , I
+chrM 7581 C C 30 0 25 1 , I
+chrM 7582 C C 30 0 25 1 , I
+chrM 7583 T T 30 0 25 1 , I
+chrM 7584 A A 30 0 25 1 , I
+chrM 7585 A A 30 0 25 1 , I
+chrM 7586 A A 30 0 25 1 , I
+chrM 7587 T T 30 0 25 1 , I
+chrM 7588 C C 30 0 25 1 , I
+chrM 7589 A A 30 0 25 1 , I
+chrM 7590 G G 30 0 25 1 , I
+chrM 7591 A N 0 0 0 1 n "
+chrM 7592 C N 0 0 0 1 n "
+chrM 7593 A A 30 0 25 1 , I
+chrM 7594 A A 30 0 25 1 , I
+chrM 7595 C C 30 0 25 1 , I
+chrM 7596 T T 30 0 25 1 , I
+chrM 7597 C C 30 0 25 1 , I
+chrM 7598 T T 30 0 25 1 , I
+chrM 7599 C C 30 0 25 1 ,$ E
+chrM 7752 A A 30 0 25 1 ^:. E
+chrM 7753 G G 30 0 25 1 . I
+chrM 7754 C C 30 0 25 1 . I
+chrM 7755 A A 30 0 25 1 . I
+chrM 7756 T T 30 0 25 1 . I
+chrM 7757 T T 30 0 25 1 . I
+chrM 7758 A A 30 0 25 1 . I
+chrM 7759 A N 0 0 0 1 N "
+chrM 7760 C N 0 0 0 1 N "
+chrM 7761 C C 30 0 25 1 . I
+chrM 7762 T T 30 0 25 1 . I
+chrM 7763 T T 30 0 25 1 . I
+chrM 7764 T T 30 0 25 1 . I
+chrM 7765 T T 30 0 25 1 . I
+chrM 7766 A A 30 0 25 1 . I
+chrM 7767 A N 0 0 0 1 . ,
+chrM 7768 G G 30 0 25 1 . I
+chrM 7769 T T 30 0 25 1 . I
+chrM 7770 T T 30 0 25 1 . I
+chrM 7771 A A 30 0 25 1 . B
+chrM 7772 A A 30 0 25 1 . ;
+chrM 7773 A A 30 0 25 1 . B
+chrM 7774 G G 30 0 25 1 . I
+chrM 7775 A A 30 0 25 1 . <
+chrM 7776 T T 30 0 25 1 . I
+chrM 7777 T T 30 0 25 1 . I
+chrM 7778 G G 30 0 25 1 . I
+chrM 7779 A A 30 0 25 1 . I
+chrM 7780 G G 30 0 25 1 . I
+chrM 7781 G G 30 0 25 1 . I
+chrM 7782 G N 0 0 0 1 . +
+chrM 7783 T T 30 0 25 1 . I
+chrM 7784 T T 30 0 25 1 . I
+chrM 7785 C C 30 0 25 1 . I
+chrM 7786 A A 30 0 25 1 . B
+chrM 7787 A A 30 0 25 1 .$ B
+chrM 7971 G G 30 0 25 1 ^:, @
+chrM 7972 A A 30 0 25 1 , I
+chrM 7973 A A 30 0 25 1 , I
+chrM 7974 A A 30 0 25 1 , I
+chrM 7975 A A 30 0 25 1 , I
+chrM 7976 T T 30 0 25 1 , 7
+chrM 7977 C C 30 0 25 1 , I
+chrM 7978 T T 30 0 25 1 , I
+chrM 7979 A A 30 0 25 1 , I
+chrM 7980 T T 30 0 25 1 , D
+chrM 7981 T T 30 0 25 1 , C
+chrM 7982 C C 30 0 25 1 , I
+chrM 7983 G G 30 0 25 1 , I
+chrM 7984 C C 30 0 25 1 , I
+chrM 7985 C C 30 0 25 1 , I
+chrM 7986 T T 30 0 25 1 , B
+chrM 7987 C C 30 0 25 1 , I
+chrM 7988 T T 30 0 25 1 , I
+chrM 7989 T T 30 0 25 1 , I
+chrM 7990 T T 30 0 25 1 , I
+chrM 7991 C C 30 0 25 1 , I
+chrM 7992 G G 30 0 25 1 , I
+chrM 7993 C C 30 0 25 1 , I
+chrM 7994 T T 30 0 25 1 , I
+chrM 7995 A A 30 0 25 1 , I
+chrM 7996 C C 30 0 25 1 , I
+chrM 7997 C C 30 0 25 1 , I
+chrM 7998 C N 0 0 0 1 n "
+chrM 7999 C N 0 0 0 1 n "
+chrM 8000 A A 30 0 25 1 , I
+chrM 8001 A A 30 0 25 1 , I
+chrM 8002 C C 30 0 25 1 , I
+chrM 8003 A A 30 0 25 1 , I
+chrM 8004 A A 30 0 25 1 , I
+chrM 8005 T T 30 0 25 1 , I
+chrM 8006 A A 30 0 25 1 ,$ E
+chrM 8346 T T 30 0 25 1 ^:. A
+chrM 8347 T T 30 0 25 1 . B
+chrM 8348 T T 30 0 25 1 . E
+chrM 8349 C C 30 0 25 1 . I
+chrM 8350 T T 30 0 25 1 . I
+chrM 8351 A A 30 0 25 1 . I
+chrM 8352 C C 30 0 25 1 . I
+chrM 8353 C N 0 0 0 1 N "
+chrM 8354 T N 0 0 0 1 N "
+chrM 8355 C C 30 0 25 1 . I
+chrM 8356 A A 30 0 25 1 . I
+chrM 8357 A A 30 0 25 1 . I
+chrM 8358 G G 30 0 25 1 . I
+chrM 8359 G G 30 0 25 1 . I
+chrM 8360 G G 30 0 25 1 . =
+chrM 8361 A A 30 0 25 1 . I
+chrM 8362 C C 30 0 25 1 . 7
+chrM 8363 G G 30 0 25 1 . I
+chrM 8364 C C 30 0 25 1 . I
+chrM 8365 C C 30 0 25 1 . I
+chrM 8366 C C 30 0 25 1 . I
+chrM 8367 A A 30 0 25 1 . 3
+chrM 8368 T T 30 0 25 1 . I
+chrM 8369 T T 30 0 25 1 . I
+chrM 8370 T T 30 0 25 1 . I
+chrM 8371 T T 30 0 25 1 . I
+chrM 8372 C C 30 0 25 1 . I
+chrM 8373 C C 30 0 25 1 . I
+chrM 8374 T T 30 0 25 1 . I
+chrM 8375 C C 30 0 25 1 . I
+chrM 8376 A A 30 0 25 1 . /
+chrM 8377 T T 30 0 25 1 . I
+chrM 8378 C C 30 0 25 1 . D
+chrM 8379 C C 30 0 25 1 . @
+chrM 8380 C C 30 0 25 1 . A
+chrM 8381 C C 30 0 25 1 .$ ?
+chrM 8421 C C 30 0 25 1 ^:, B
+chrM 8422 C C 30 0 25 1 , E
+chrM 8423 T N 0 0 0 1 , %
+chrM 8424 G G 30 0 25 1 , :
+chrM 8425 T T 30 0 25 1 , :
+chrM 8426 A A 30 0 25 1 , I
+chrM 8427 G G 30 0 25 1 , <
+chrM 8428 C C 30 0 25 1 , I
+chrM 8429 C C 30 0 25 1 , I
+chrM 8430 C C 30 0 25 1 , I
+chrM 8431 T T 30 0 25 1 , I
+chrM 8432 A A 30 0 25 1 , I
+chrM 8433 G G 30 0 25 1 , E
+chrM 8434 C C 30 0 25 1 , I
+chrM 8435 C C 30 0 25 1 , I
+chrM 8436 G G 30 0 25 1 , I
+chrM 8437 T T 30 0 25 1 , 8
+chrM 8438 G G 30 0 25 1 , I
+chrM 8439 C C 30 0 25 1 , I
+chrM 8440 G G 30 0 25 1 , I
+chrM 8441 G G 30 0 25 1 , I
+chrM 8442 C C 30 0 25 1 , I
+chrM 8443 T T 30 0 25 1 , I
+chrM 8444 A A 30 0 25 1 , I
+chrM 8445 A A 30 0 25 1 , I
+chrM 8446 C C 30 0 25 1 , I
+chrM 8447 C C 30 0 25 1 , I
+chrM 8448 G N 0 0 0 1 n "
+chrM 8449 C N 0 0 0 1 n "
+chrM 8450 T T 33 0 25 2 ,^:, IE
chrM 8451 A A 33 0 25 2 ,, II
chrM 8452 A A 33 0 25 2 ,, II
chrM 8453 C C 33 0 25 2 ,, II
chrM 8454 A A 33 0 25 2 ,, II
-chrM 8455 T T 33 0 25 2 ,, I>
-chrM 8456 T T 33 0 25 2 ,$, I1
-chrM 8457 A A 25 0 25 1 , I
-chrM 8458 C C 25 0 25 1 , I
-chrM 8459 C C 25 0 25 1 , I
-chrM 8460 G G 25 0 25 1 , I
-chrM 8461 C C 25 0 25 1 , I
-chrM 8462 C C 25 0 25 1 , I
-chrM 8463 G G 25 0 25 1 , I
-chrM 8464 G G 25 0 25 1 , I
-chrM 8465 A A 25 0 25 1 , I
-chrM 8466 C C 25 0 25 1 , I
-chrM 8467 A A 25 0 25 1 , I
-chrM 8468 C C 25 0 25 1 , I
-chrM 8469 C C 25 0 25 1 , I
-chrM 8470 T T 25 0 25 1 , I
-chrM 8471 C C 25 0 25 1 , I
-chrM 8472 C C 25 0 25 1 , I
-chrM 8473 T T 25 0 25 1 , I
-chrM 8474 A A 25 0 25 1 , I
-chrM 8475 A A 25 0 25 1 , I
-chrM 8476 T T 25 0 25 1 , I
-chrM 8477 A A 4 0 25 1 n "
-chrM 8478 C A 4 4 25 1 n "
-chrM 8479 A A 25 0 25 1 , I
-chrM 8480 C C 25 0 25 1 , I
-chrM 8481 C C 25 0 25 1 , I
-chrM 8482 T T 25 0 25 1 , I
-chrM 8483 C C 25 0 25 1 , I
-chrM 8484 A A 25 0 25 1 , I
-chrM 8485 T T 25 0 25 1 ,$ I
-chrM 8630 A A 25 0 25 1 ^:. I
-chrM 8631 C C 25 0 25 1 . I
-chrM 8632 A A 25 0 25 1 . I
-chrM 8633 C C 25 0 25 1 . I
-chrM 8634 G G 25 0 25 1 . I
-chrM 8635 A A 25 0 25 1 . I
-chrM 8636 C C 25 0 25 1 . I
-chrM 8637 A A 4 0 25 1 N "
-chrM 8638 A A 4 0 25 1 N "
-chrM 8639 C C 25 0 25 1 . I
-chrM 8640 A A 25 0 25 1 . I
-chrM 8641 C C 25 0 25 1 . I
-chrM 8642 C C 25 0 25 1 . I
-chrM 8643 T T 25 0 25 1 . I
-chrM 8644 A A 25 0 25 1 . I
-chrM 8645 A A 25 0 25 1 . I
-chrM 8646 T T 25 0 25 1 . I
-chrM 8647 G G 25 0 25 1 . I
-chrM 8648 A A 25 0 25 1 . I
-chrM 8649 C C 25 0 25 1 . I
-chrM 8650 C C 25 0 25 1 . I
-chrM 8651 C C 25 0 25 1 . I
-chrM 8652 A A 25 0 25 1 . I
-chrM 8653 C C 25 0 25 1 . I
-chrM 8654 C C 25 0 25 1 . I
-chrM 8655 A A 25 0 25 1 . >
-chrM 8656 A A 25 0 25 1 . C
-chrM 8657 A A 25 0 25 1 . :
-chrM 8658 C C 25 0 25 1 . I
-chrM 8659 C C 25 0 25 1 . I
-chrM 8660 C C 25 0 25 1 . I
-chrM 8661 A A 25 0 25 1 . D
-chrM 8662 C C 25 0 25 1 . I
-chrM 8663 G G 25 0 25 1 . <
-chrM 8664 C C 25 0 25 1 . I
-chrM 8665 T T 25 0 25 1 .$ I
-chrM 8752 C C 25 0 25 1 ^:, I
-chrM 8753 T T 25 0 25 1 , B
-chrM 8754 T T 25 0 25 1 , I
-chrM 8755 T T 25 0 25 1 , I
-chrM 8756 A A 25 0 25 1 , I
-chrM 8757 A A 25 0 25 1 , I
-chrM 8758 C C 25 0 25 1 , I
-chrM 8759 T T 25 0 25 1 , I
-chrM 8760 C C 25 0 25 1 , I
-chrM 8761 A A 25 0 25 1 , I
-chrM 8762 A A 25 0 25 1 , I
-chrM 8763 C C 25 0 25 1 , I
-chrM 8764 C C 33 0 25 2 ,^:, II
+chrM 8455 T T 33 0 25 2 ,, E>
+chrM 8456 T T 33 0 25 2 ,$, B1
+chrM 8457 A A 30 0 25 1 , I
+chrM 8458 C C 30 0 25 1 , I
+chrM 8459 C C 30 0 25 1 , I
+chrM 8460 G G 30 0 25 1 , I
+chrM 8461 C C 30 0 25 1 , I
+chrM 8462 C C 30 0 25 1 , I
+chrM 8463 G G 30 0 25 1 , I
+chrM 8464 G G 30 0 25 1 , I
+chrM 8465 A A 30 0 25 1 , I
+chrM 8466 C C 30 0 25 1 , I
+chrM 8467 A A 30 0 25 1 , I
+chrM 8468 C C 30 0 25 1 , I
+chrM 8469 C C 30 0 25 1 , I
+chrM 8470 T T 30 0 25 1 , I
+chrM 8471 C C 30 0 25 1 , I
+chrM 8472 C C 30 0 25 1 , I
+chrM 8473 T T 30 0 25 1 , I
+chrM 8474 A A 30 0 25 1 , I
+chrM 8475 A A 30 0 25 1 , I
+chrM 8476 T T 30 0 25 1 , I
+chrM 8477 A N 0 0 0 1 n "
+chrM 8478 C N 0 0 0 1 n "
+chrM 8479 A A 30 0 25 1 , I
+chrM 8480 C C 30 0 25 1 , I
+chrM 8481 C C 30 0 25 1 , I
+chrM 8482 T T 30 0 25 1 , I
+chrM 8483 C C 30 0 25 1 , I
+chrM 8484 A A 30 0 25 1 , I
+chrM 8485 T T 30 0 25 1 ,$ E
+chrM 8630 A A 30 0 25 1 ^:. E
+chrM 8631 C C 30 0 25 1 . I
+chrM 8632 A A 30 0 25 1 . I
+chrM 8633 C C 30 0 25 1 . I
+chrM 8634 G G 30 0 25 1 . I
+chrM 8635 A A 30 0 25 1 . I
+chrM 8636 C C 30 0 25 1 . I
+chrM 8637 A N 0 0 0 1 N "
+chrM 8638 A N 0 0 0 1 N "
+chrM 8639 C C 30 0 25 1 . I
+chrM 8640 A A 30 0 25 1 . I
+chrM 8641 C C 30 0 25 1 . I
+chrM 8642 C C 30 0 25 1 . I
+chrM 8643 T T 30 0 25 1 . I
+chrM 8644 A A 30 0 25 1 . I
+chrM 8645 A A 30 0 25 1 . I
+chrM 8646 T T 30 0 25 1 . I
+chrM 8647 G G 30 0 25 1 . I
+chrM 8648 A A 30 0 25 1 . I
+chrM 8649 C C 30 0 25 1 . I
+chrM 8650 C C 30 0 25 1 . I
+chrM 8651 C C 30 0 25 1 . I
+chrM 8652 A A 30 0 25 1 . I
+chrM 8653 C C 30 0 25 1 . I
+chrM 8654 C C 30 0 25 1 . I
+chrM 8655 A A 30 0 25 1 . >
+chrM 8656 A A 30 0 25 1 . C
+chrM 8657 A A 30 0 25 1 . :
+chrM 8658 C C 30 0 25 1 . I
+chrM 8659 C C 30 0 25 1 . I
+chrM 8660 C C 30 0 25 1 . I
+chrM 8661 A A 30 0 25 1 . D
+chrM 8662 C C 30 0 25 1 . I
+chrM 8663 G G 30 0 25 1 . <
+chrM 8664 C C 30 0 25 1 . I
+chrM 8665 T T 30 0 25 1 .$ >
+chrM 8752 C C 30 0 25 1 ^:, E
+chrM 8753 T T 30 0 25 1 , B
+chrM 8754 T T 30 0 25 1 , I
+chrM 8755 T T 30 0 25 1 , I
+chrM 8756 A A 30 0 25 1 , I
+chrM 8757 A A 30 0 25 1 , I
+chrM 8758 C C 30 0 25 1 , I
+chrM 8759 T T 30 0 25 1 , I
+chrM 8760 C C 30 0 25 1 , I
+chrM 8761 A A 30 0 25 1 , I
+chrM 8762 A A 30 0 25 1 , I
+chrM 8763 C C 30 0 25 1 , I
+chrM 8764 C C 33 0 25 2 ,^:, IE
chrM 8765 T T 33 0 25 2 ,, IA
chrM 8766 T T 33 0 25 2 ,, IA
chrM 8767 A A 33 0 25 2 ,, II
@@ -1684,593 +1684,593 @@ chrM 8775 C C 33 0 25 2 ,, II
chrM 8776 T T 33 0 25 2 ,, II
chrM 8777 A A 33 0 25 2 ,, II
chrM 8778 T T 33 0 25 2 ,, II
-chrM 8779 A A 28 0 25 2 n, "I
-chrM 8780 G G 19 0 25 2 n, "I
+chrM 8779 A A 30 0 25 2 n, "I
+chrM 8780 G G 30 0 25 2 n, "I
chrM 8781 G G 33 0 25 2 ,, II
chrM 8782 G G 33 0 25 2 ,, II
chrM 8783 C C 33 0 25 2 ,, II
chrM 8784 T T 33 0 25 2 ,, II
chrM 8785 A A 33 0 25 2 ,, II
-chrM 8786 T T 33 0 25 2 ,, II
-chrM 8787 T T 33 0 25 2 ,$, II
-chrM 8788 A A 25 0 25 1 , I
-chrM 8789 A A 25 0 25 1 , I
-chrM 8790 C C 25 0 25 1 , I
-chrM 8791 T A 4 4 25 1 n "
-chrM 8792 A A 4 0 25 1 n "
-chrM 8793 A A 25 0 25 1 , I
-chrM 8794 C C 25 0 25 1 , I
-chrM 8795 A A 25 0 25 1 , I
-chrM 8796 T T 25 0 25 1 , I
-chrM 8797 C C 25 0 25 1 , I
-chrM 8798 C C 25 0 25 1 , I
-chrM 8799 T T 25 0 25 1 ,$ I
-chrM 8908 C C 25 0 25 1 ^:, I
-chrM 8909 T T 25 0 25 1 , :
-chrM 8910 C C 25 0 25 1 , I
-chrM 8911 A A 25 0 25 1 , I
-chrM 8912 G G 25 0 25 1 , D
-chrM 8913 A A 25 0 25 1 , I
-chrM 8914 A A 25 0 25 1 , I
-chrM 8915 G G 25 0 25 1 , I
-chrM 8916 T T 25 0 25 1 , I
-chrM 8917 C C 25 0 25 1 , I
-chrM 8918 T T 25 0 25 1 , I
-chrM 8919 T T 25 0 25 1 , <
-chrM 8920 C C 25 0 25 1 , I
-chrM 8921 T T 25 0 25 1 , F
-chrM 8922 T T 25 0 25 1 , I
-chrM 8923 C C 25 0 25 1 , I
-chrM 8924 T T 25 0 25 1 , F
-chrM 8925 T T 25 0 25 1 , E
-chrM 8926 C C 25 0 25 1 , I
-chrM 8927 T T 25 0 25 1 , H
-chrM 8928 C C 25 0 25 1 , I
-chrM 8929 T T 33 0 25 2 ,^:, II
+chrM 8786 T T 33 0 25 2 ,, EI
+chrM 8787 T T 33 0 25 2 ,$, BI
+chrM 8788 A A 30 0 25 1 , I
+chrM 8789 A A 30 0 25 1 , I
+chrM 8790 C C 30 0 25 1 , I
+chrM 8791 T N 0 0 0 1 n "
+chrM 8792 A N 0 0 0 1 n "
+chrM 8793 A A 30 0 25 1 , I
+chrM 8794 C C 30 0 25 1 , I
+chrM 8795 A A 30 0 25 1 , I
+chrM 8796 T T 30 0 25 1 , I
+chrM 8797 C C 30 0 25 1 , I
+chrM 8798 C C 30 0 25 1 , I
+chrM 8799 T T 30 0 25 1 ,$ >
+chrM 8908 C C 30 0 25 1 ^:, E
+chrM 8909 T T 30 0 25 1 , :
+chrM 8910 C C 30 0 25 1 , I
+chrM 8911 A A 30 0 25 1 , I
+chrM 8912 G G 30 0 25 1 , D
+chrM 8913 A A 30 0 25 1 , I
+chrM 8914 A A 30 0 25 1 , I
+chrM 8915 G G 30 0 25 1 , I
+chrM 8916 T T 30 0 25 1 , I
+chrM 8917 C C 30 0 25 1 , I
+chrM 8918 T T 30 0 25 1 , I
+chrM 8919 T T 30 0 25 1 , <
+chrM 8920 C C 30 0 25 1 , I
+chrM 8921 T T 30 0 25 1 , F
+chrM 8922 T T 30 0 25 1 , I
+chrM 8923 C C 30 0 25 1 , I
+chrM 8924 T T 30 0 25 1 , F
+chrM 8925 T T 30 0 25 1 , E
+chrM 8926 C C 30 0 25 1 , I
+chrM 8927 T T 30 0 25 1 , H
+chrM 8928 C C 30 0 25 1 , I
+chrM 8929 T T 33 0 25 2 ,^:, IE
chrM 8930 G G 33 0 25 2 ,, II
chrM 8931 G G 33 0 25 2 ,, II
chrM 8932 C C 33 0 25 2 ,, II
chrM 8933 T T 33 0 25 2 ,, II
chrM 8934 T T 33 0 25 2 ,, II
-chrM 8935 C C 19 0 25 2 n, "I
-chrM 8936 T T 19 0 25 2 n, ";
+chrM 8935 C C 30 0 25 2 n, "I
+chrM 8936 T T 30 0 25 2 n, ";
chrM 8937 T T 33 0 25 2 ,, IG
chrM 8938 C C 33 0 25 2 ,, II
chrM 8939 T T 33 0 25 2 ,, IE
chrM 8940 G G 33 0 25 2 ,, II
chrM 8941 A A 33 0 25 2 ,, II
chrM 8942 G G 33 0 25 2 ,, II
-chrM 8943 C C 33 0 25 2 ,$, II
-chrM 8944 C C 25 0 25 1 , I
-chrM 8945 T T 25 0 25 1 , I
-chrM 8946 T T 25 0 25 1 , I
-chrM 8947 T T 25 0 25 1 , I
-chrM 8948 T T 25 0 25 1 , I
-chrM 8949 A A 25 0 25 1 , I
-chrM 8950 C C 25 0 25 1 , I
-chrM 8951 C C 25 0 25 1 , I
-chrM 8952 A A 25 0 25 1 , I
-chrM 8953 C C 25 0 25 1 , I
-chrM 8954 T T 25 0 25 1 , I
-chrM 8955 C C 25 0 25 1 , I
-chrM 8956 A A 4 0 25 1 n "
-chrM 8957 A A 4 0 25 1 n "
-chrM 8958 G G 25 0 25 1 , I
-chrM 8959 C C 25 0 25 1 , I
-chrM 8960 C C 25 0 25 1 , I
-chrM 8961 T T 25 0 25 1 , I
-chrM 8962 A A 25 0 25 1 , I
-chrM 8963 G G 25 0 25 1 , I
-chrM 8964 C C 25 0 25 1 ,$ I
-chrM 9111 G G 25 0 25 1 ^:. I
-chrM 9112 T T 25 0 25 1 . I
-chrM 9113 A A 25 0 25 1 . I
-chrM 9114 A A 25 0 25 1 . I
-chrM 9115 A A 25 0 25 1 . I
-chrM 9116 A A 25 0 25 1 . I
-chrM 9117 A A 25 0 25 1 . I
-chrM 9118 T A 4 4 25 1 N "
-chrM 9119 A A 4 0 25 1 N "
-chrM 9120 T T 25 0 25 1 . I
-chrM 9121 G G 25 0 25 1 . I
-chrM 9122 C C 25 0 25 1 . I
-chrM 9123 T T 25 0 25 1 . I
-chrM 9124 C C 25 0 25 1 . I
-chrM 9125 C C 25 0 25 1 . I
-chrM 9126 A A 25 0 25 1 . I
-chrM 9127 A A 25 0 25 1 . I
-chrM 9128 G G 25 0 25 1 . I
-chrM 9129 G G 25 0 25 1 . I
-chrM 9130 C C 25 0 25 1 . I
-chrM 9131 C C 25 0 25 1 . I
-chrM 9132 T T 25 0 25 1 . I
-chrM 9133 A A 25 0 25 1 . I
-chrM 9134 T T 25 0 25 1 . I
-chrM 9135 T T 25 0 25 1 . I
-chrM 9136 C C 25 0 25 1 . I
-chrM 9137 A A 25 0 25 1 . I
-chrM 9138 T T 25 0 25 1 . I
-chrM 9139 C C 25 0 25 1 . I
-chrM 9140 A A 25 0 25 1 . E
-chrM 9141 C C 25 0 25 1 . I
-chrM 9142 A A 25 0 25 1 . B
-chrM 9143 A A 23 0 25 1 . 8
-chrM 9144 T T 25 0 25 1 . I
-chrM 9145 T T 25 0 25 1 . I
-chrM 9146 T T 25 0 25 1 .$ I
-chrM 9331 C C 5 0 25 1 ^:, &
-chrM 9332 A A 11 0 25 1 , ,
-chrM 9333 G G 9 0 25 1 , *
-chrM 9334 C C 25 0 25 1 , I
-chrM 9335 C C 25 0 25 1 , I
-chrM 9336 A A 12 0 25 1 , -
-chrM 9337 C C 25 0 25 1 , <
-chrM 9338 C C 25 0 25 1 , ?
-chrM 9339 A A 25 0 25 1 , <
-chrM 9340 C C 25 0 25 1 , I
-chrM 9341 T T 25 0 25 1 , I
-chrM 9342 T T 19 0 25 1 , 4
-chrM 9343 C C 25 0 25 1 , I
-chrM 9344 G G 7 0 25 1 , (
-chrM 9345 G G 25 0 25 1 , I
-chrM 9346 A A 16 0 25 1 , 1
-chrM 9347 T T 25 0 25 1 , I
-chrM 9348 T T 25 0 25 1 , I
-chrM 9349 C C 25 0 25 1 , I
-chrM 9350 G G 33 0 25 2 ,^:. II
+chrM 8943 C C 33 0 25 2 ,$, >I
+chrM 8944 C C 30 0 25 1 , I
+chrM 8945 T T 30 0 25 1 , I
+chrM 8946 T T 30 0 25 1 , I
+chrM 8947 T T 30 0 25 1 , I
+chrM 8948 T T 30 0 25 1 , I
+chrM 8949 A A 30 0 25 1 , I
+chrM 8950 C C 30 0 25 1 , I
+chrM 8951 C C 30 0 25 1 , I
+chrM 8952 A A 30 0 25 1 , I
+chrM 8953 C C 30 0 25 1 , I
+chrM 8954 T T 30 0 25 1 , I
+chrM 8955 C C 30 0 25 1 , I
+chrM 8956 A N 0 0 0 1 n "
+chrM 8957 A N 0 0 0 1 n "
+chrM 8958 G G 30 0 25 1 , I
+chrM 8959 C C 30 0 25 1 , I
+chrM 8960 C C 30 0 25 1 , I
+chrM 8961 T T 30 0 25 1 , I
+chrM 8962 A A 30 0 25 1 , I
+chrM 8963 G G 30 0 25 1 , I
+chrM 8964 C C 30 0 25 1 ,$ >
+chrM 9111 G G 30 0 25 1 ^:. E
+chrM 9112 T T 30 0 25 1 . I
+chrM 9113 A A 30 0 25 1 . I
+chrM 9114 A A 30 0 25 1 . I
+chrM 9115 A A 30 0 25 1 . I
+chrM 9116 A A 30 0 25 1 . I
+chrM 9117 A A 30 0 25 1 . I
+chrM 9118 T N 0 0 0 1 N "
+chrM 9119 A N 0 0 0 1 N "
+chrM 9120 T T 30 0 25 1 . I
+chrM 9121 G G 30 0 25 1 . I
+chrM 9122 C C 30 0 25 1 . I
+chrM 9123 T T 30 0 25 1 . I
+chrM 9124 C C 30 0 25 1 . I
+chrM 9125 C C 30 0 25 1 . I
+chrM 9126 A A 30 0 25 1 . I
+chrM 9127 A A 30 0 25 1 . I
+chrM 9128 G G 30 0 25 1 . I
+chrM 9129 G G 30 0 25 1 . I
+chrM 9130 C C 30 0 25 1 . I
+chrM 9131 C C 30 0 25 1 . I
+chrM 9132 T T 30 0 25 1 . I
+chrM 9133 A A 30 0 25 1 . I
+chrM 9134 T T 30 0 25 1 . I
+chrM 9135 T T 30 0 25 1 . I
+chrM 9136 C C 30 0 25 1 . I
+chrM 9137 A A 30 0 25 1 . I
+chrM 9138 T T 30 0 25 1 . I
+chrM 9139 C C 30 0 25 1 . I
+chrM 9140 A A 30 0 25 1 . E
+chrM 9141 C C 30 0 25 1 . I
+chrM 9142 A A 30 0 25 1 . B
+chrM 9143 A A 30 0 25 1 . 8
+chrM 9144 T T 30 0 25 1 . E
+chrM 9145 T T 30 0 25 1 . B
+chrM 9146 T T 30 0 25 1 .$ @
+chrM 9331 C N 0 0 0 1 ^:, &
+chrM 9332 A N 0 0 0 1 , ,
+chrM 9333 G N 0 0 0 1 , *
+chrM 9334 C C 30 0 25 1 , I
+chrM 9335 C C 30 0 25 1 , I
+chrM 9336 A N 0 0 0 1 , -
+chrM 9337 C C 30 0 25 1 , <
+chrM 9338 C C 30 0 25 1 , ?
+chrM 9339 A A 30 0 25 1 , <
+chrM 9340 C C 30 0 25 1 , I
+chrM 9341 T T 30 0 25 1 , I
+chrM 9342 T T 30 0 25 1 , 4
+chrM 9343 C C 30 0 25 1 , I
+chrM 9344 G N 0 0 0 1 , (
+chrM 9345 G G 30 0 25 1 , I
+chrM 9346 A A 30 0 25 1 , 1
+chrM 9347 T T 30 0 25 1 , I
+chrM 9348 T T 30 0 25 1 , I
+chrM 9349 C C 30 0 25 1 , I
+chrM 9350 G G 33 0 25 2 ,^:. IE
chrM 9351 A A 33 0 25 2 ,. II
chrM 9352 A A 33 0 25 2 ,. DI
chrM 9353 G G 33 0 25 2 ,. II
chrM 9354 C C 33 0 25 2 ,. II
chrM 9355 A A 33 0 25 2 ,. II
chrM 9356 G G 33 0 25 2 ,. II
-chrM 9357 C C 19 0 25 2 ,N I"
-chrM 9358 C A 8 8 25 2 nN ""
-chrM 9359 G G 19 0 25 2 n. "I
+chrM 9357 C C 30 0 25 2 ,N I"
+chrM 9358 C N 0 0 0 2 nN ""
+chrM 9359 G G 30 0 25 2 n. "I
chrM 9360 C C 33 0 25 2 ,. II
chrM 9361 T T 33 0 25 2 ,. II
chrM 9362 T T 33 0 25 2 ,. II
chrM 9363 G G 33 0 25 2 ,. II
chrM 9364 A A 33 0 25 2 ,. II
chrM 9365 T T 33 0 25 2 ,. II
-chrM 9366 A A 33 0 25 2 ,$. II
-chrM 9367 C C 25 0 25 1 . I
-chrM 9368 T T 25 0 25 1 . I
-chrM 9369 G G 25 0 25 1 . I
-chrM 9370 A A 25 0 25 1 . I
-chrM 9371 C C 25 0 25 1 . I
-chrM 9372 A A 25 0 25 1 . I
-chrM 9373 C C 25 0 25 1 . I
-chrM 9374 T T 25 0 25 1 . I
-chrM 9375 T T 25 0 25 1 . I
-chrM 9376 C C 25 0 25 1 . I
-chrM 9377 G G 25 0 25 1 . I
-chrM 9378 T T 25 0 25 1 . I
-chrM 9379 C C 25 0 25 1 . I
-chrM 9380 G G 25 0 25 1 . I
-chrM 9381 A A 24 0 25 1 . 9
-chrM 9382 C C 25 0 25 1 . I
-chrM 9383 G G 25 0 25 1 . I
-chrM 9384 T T 25 0 25 1 . D
-chrM 9385 A A 25 0 25 1 .$ F
-chrM 9563 C C 25 0 25 1 ^:, I
-chrM 9564 T T 10 0 25 1 , +
-chrM 9565 G G 12 0 25 1 , -
-chrM 9566 A A 25 0 25 1 , I
-chrM 9567 C C 25 0 25 1 , I
-chrM 9568 T T 25 0 25 1 , ?
-chrM 9569 A A 25 0 25 1 , I
-chrM 9570 C C 25 0 25 1 , D
-chrM 9571 C C 25 0 25 1 , I
-chrM 9572 A A 25 0 25 1 , I
-chrM 9573 C C 25 0 25 1 , I
-chrM 9574 A A 25 0 25 1 , I
-chrM 9575 A A 25 0 25 1 , I
-chrM 9576 C C 25 0 25 1 , I
-chrM 9577 T T 25 0 25 1 , I
-chrM 9578 A A 25 0 25 1 , I
-chrM 9579 A A 25 0 25 1 , I
-chrM 9580 A A 25 0 25 1 , I
-chrM 9581 C C 25 0 25 1 , I
-chrM 9582 A A 25 0 25 1 , I
-chrM 9583 T T 25 0 25 1 , I
-chrM 9584 C C 25 0 25 1 , I
-chrM 9585 T T 25 0 25 1 , I
-chrM 9586 A A 25 0 25 1 , I
-chrM 9587 T T 25 0 25 1 , I
-chrM 9588 G G 25 0 25 1 , I
-chrM 9589 C C 25 0 25 1 , I
-chrM 9590 A A 4 0 25 1 n "
-chrM 9591 G A 4 4 25 1 n "
-chrM 9592 A A 25 0 25 1 , I
-chrM 9593 A A 25 0 25 1 , I
-chrM 9594 A A 25 0 25 1 , I
-chrM 9595 A A 25 0 25 1 , I
-chrM 9596 A A 25 0 25 1 , I
-chrM 9597 A A 25 0 25 1 , I
-chrM 9598 C C 25 0 25 1 ,$ I
-chrM 9689 A A 11 0 25 1 ^:, ,
-chrM 9690 T T 25 0 25 1 , C
-chrM 9691 T T 25 0 25 1 , I
-chrM 9692 C C 25 0 25 1 , I
-chrM 9693 G G 25 0 25 1 , I
-chrM 9694 A A 13 0 25 1 , .
-chrM 9695 C C 25 0 25 1 , I
-chrM 9696 T T 25 0 25 1 , I
-chrM 9697 T T 15 0 25 1 , 0
-chrM 9698 A A 25 0 25 1 , I
-chrM 9699 G G 25 0 25 1 , <
-chrM 9700 A A 25 0 25 1 , I
-chrM 9701 A A 25 0 25 1 , F
-chrM 9702 A A 25 0 25 1 , I
-chrM 9703 T T 25 0 25 1 , ;
-chrM 9704 T T 25 0 25 1 , I
-chrM 9705 G G 25 0 25 1 , I
-chrM 9706 C C 25 0 25 1 , I
-chrM 9707 C C 25 0 25 1 , I
-chrM 9708 C C 25 0 25 1 , I
-chrM 9709 T T 25 0 25 1 , D
-chrM 9710 C C 25 0 25 1 , I
-chrM 9711 C C 25 0 25 1 , I
-chrM 9712 T T 25 0 25 1 , I
-chrM 9713 A A 25 0 25 1 , I
-chrM 9714 T T 25 0 25 1 , I
-chrM 9715 T T 25 0 25 1 , I
-chrM 9716 A A 4 0 25 1 n "
-chrM 9717 C A 4 4 25 1 n "
-chrM 9718 C C 25 0 25 1 , I
-chrM 9719 C C 25 0 25 1 , I
-chrM 9720 C C 25 0 25 1 , I
-chrM 9721 T T 25 0 25 1 , I
-chrM 9722 T T 5 0 25 1 , &
-chrM 9723 C C 25 0 25 1 , I
-chrM 9724 C C 25 0 25 1 ,$ I
-chrM 9810 G G 25 0 25 1 ^:, A
-chrM 9811 A A 25 0 25 1 , I
-chrM 9812 A A 25 0 25 1 , I
-chrM 9813 T T 25 0 25 1 , I
-chrM 9814 G G 25 0 25 1 , I
-chrM 9815 A A 25 0 25 1 , I
-chrM 9816 A A 25 0 25 1 , I
-chrM 9817 C C 25 0 25 1 , ?
-chrM 9818 C C 17 0 25 1 , 2
-chrM 9819 C C 17 0 25 1 , 2
-chrM 9820 A A 25 0 25 1 , I
-chrM 9821 A A 25 0 25 1 , I
-chrM 9822 A A 25 0 25 1 , I
-chrM 9823 A A 25 0 25 1 , I
-chrM 9824 A A 25 0 25 1 , I
-chrM 9825 G G 25 0 25 1 , I
-chrM 9826 G G 25 0 25 1 , I
-chrM 9827 A A 25 0 25 1 , I
-chrM 9828 C C 25 0 25 1 , I
-chrM 9829 T T 25 0 25 1 , I
-chrM 9830 A A 25 0 25 1 , I
-chrM 9831 G G 25 0 25 1 , I
-chrM 9832 A A 25 0 25 1 , I
-chrM 9833 A A 25 0 25 1 , I
-chrM 9834 T T 25 0 25 1 , I
-chrM 9835 G G 25 0 25 1 , I
-chrM 9836 A A 25 0 25 1 , I
-chrM 9837 A A 4 0 25 1 n "
-chrM 9838 C A 4 4 25 1 n "
-chrM 9839 T T 25 0 25 1 , I
-chrM 9840 G G 25 0 25 1 , I
-chrM 9841 A A 25 0 25 1 , I
-chrM 9842 G G 25 0 25 1 , I
-chrM 9843 T T 25 0 25 1 , I
-chrM 9844 A A 25 0 25 1 , I
-chrM 9845 T T 25 0 25 1 ,$ I
-chrM 9916 T T 25 0 25 1 ^:. I
-chrM 9917 G G 25 0 25 1 . I
-chrM 9918 T T 25 0 25 1 . I
-chrM 9919 C C 25 0 25 1 . I
-chrM 9920 A A 25 0 25 1 . I
-chrM 9921 C C 25 0 25 1 . I
-chrM 9922 T T 25 0 25 1 . I
-chrM 9923 A A 4 0 25 1 N "
-chrM 9924 G A 4 4 25 1 N "
-chrM 9925 T T 25 0 25 1 . I
-chrM 9926 C C 25 0 25 1 . I
-chrM 9927 C C 25 0 25 1 . I
-chrM 9928 A A 25 0 25 1 . I
-chrM 9929 T T 25 0 25 1 . I
-chrM 9930 A A 25 0 25 1 . =
-chrM 9931 T T 25 0 25 1 . I
-chrM 9932 T T 25 0 25 1 . I
-chrM 9933 A A 25 0 25 1 . I
-chrM 9934 A A 24 0 25 1 . 9
-chrM 9935 T T 25 0 25 1 . I
-chrM 9936 A A 25 0 25 1 . @
-chrM 9937 T T 25 0 25 1 . I
-chrM 9938 C C 25 0 25 1 . I
-chrM 9939 T T 25 0 25 1 . I
-chrM 9940 T T 25 0 25 1 . I
-chrM 9941 C C 25 0 25 1 . I
-chrM 9942 C C 25 0 25 1 . I
-chrM 9943 T T 25 0 25 1 . I
-chrM 9944 A A 25 0 25 1 . B
-chrM 9945 G G 25 0 25 1 . I
-chrM 9946 C C 25 0 25 1 . I
-chrM 9947 A A 25 0 25 1 . E
-chrM 9948 T T 25 0 25 1 . I
-chrM 9949 T T 25 0 25 1 . I
-chrM 9950 C C 25 0 25 1 . I
-chrM 9951 A A 25 0 25 1 .$ >
-chrM 10002 C C 25 0 25 1 ^:, I
-chrM 10003 T T 25 0 25 1 , :
-chrM 10004 C C 17 0 25 1 , 2
-chrM 10005 C C 25 0 25 1 , I
-chrM 10006 T T 25 0 25 1 , E
-chrM 10007 A A 25 0 25 1 , I
-chrM 10008 T T 25 0 25 1 , :
-chrM 10009 G G 25 0 25 1 , I
-chrM 10010 C C 25 0 25 1 , I
-chrM 10011 C C 25 0 25 1 , D
-chrM 10012 T T 25 0 25 1 , I
-chrM 10013 A A 25 0 25 1 , I
-chrM 10014 G G 25 0 25 1 , I
-chrM 10015 A A 25 0 25 1 , I
-chrM 10016 A A 25 0 25 1 , I
-chrM 10017 G G 25 0 25 1 , I
-chrM 10018 G G 19 0 25 1 , 4
-chrM 10019 A A 25 0 25 1 , I
-chrM 10020 A A 25 0 25 1 , I
-chrM 10021 T T 25 0 25 1 , I
-chrM 10022 A A 25 0 25 1 , I
-chrM 10023 A A 25 0 25 1 , I
-chrM 10024 T T 25 0 25 1 , I
-chrM 10025 A A 25 0 25 1 , I
-chrM 10026 C C 25 0 25 1 , I
-chrM 10027 T T 25 0 25 1 , I
-chrM 10028 A A 25 0 25 1 , I
-chrM 10029 T A 4 4 25 1 n "
-chrM 10030 C A 4 4 25 1 n "
-chrM 10031 A A 25 0 25 1 , I
-chrM 10032 C C 25 0 25 1 , I
-chrM 10033 T T 25 0 25 1 , I
-chrM 10034 A A 25 0 25 1 , I
-chrM 10035 T T 25 0 25 1 , I
-chrM 10036 T T 25 0 25 1 , I
-chrM 10037 C C 25 0 25 1 ,$ I
-chrM 10391 G G 25 0 25 1 ^:. I
-chrM 10392 C C 25 0 25 1 . I
-chrM 10393 C C 25 0 25 1 . I
-chrM 10394 C C 25 0 25 1 . I
-chrM 10395 C C 25 0 25 1 . I
-chrM 10396 A A 25 0 25 1 . I
-chrM 10397 C C 25 0 25 1 . I
-chrM 10398 T A 4 4 25 1 N "
-chrM 10399 T A 4 4 25 1 N "
-chrM 10400 C C 25 0 25 1 . I
-chrM 10401 T T 25 0 25 1 . I
-chrM 10402 G G 25 0 25 1 . I
-chrM 10403 G G 25 0 25 1 . I
-chrM 10404 T T 25 0 25 1 . I
-chrM 10405 G G 25 0 25 1 . I
-chrM 10406 T T 25 0 25 1 . I
-chrM 10407 T T 25 0 25 1 . I
-chrM 10408 G G 25 0 25 1 . I
-chrM 10409 A A 25 0 25 1 . I
-chrM 10410 C C 25 0 25 1 . I
-chrM 10411 A A 25 0 25 1 . I
-chrM 10412 A A 25 0 25 1 . I
-chrM 10413 C C 25 0 25 1 . I
-chrM 10414 A A 25 0 25 1 . =
-chrM 10415 T T 25 0 25 1 . I
-chrM 10416 G G 9 0 25 1 . *
-chrM 10417 A A 20 0 25 1 . 5
-chrM 10418 C C 25 0 25 1 . I
-chrM 10419 T T 25 0 25 1 . I
-chrM 10420 A A 25 0 25 1 . <
-chrM 10421 C C 25 0 25 1 . I
-chrM 10422 T T 25 0 25 1 . I
-chrM 10423 G G 6 0 25 1 . '
-chrM 10424 C C 25 0 25 1 . I
-chrM 10425 C C 25 0 25 1 . I
-chrM 10426 A A 7 0 25 1 .$ (
-chrM 10597 T T 25 0 25 1 ^:, H
-chrM 10598 A A 25 0 25 1 , I
-chrM 10599 T T 25 0 25 1 , <
-chrM 10600 C C 25 0 25 1 , I
-chrM 10601 A A 25 0 25 1 , I
-chrM 10602 T T 25 0 25 1 , ;
-chrM 10603 C C 25 0 25 1 , I
-chrM 10604 A A 25 0 25 1 , I
-chrM 10605 C C 25 0 25 1 , I
-chrM 10606 C C 25 0 25 1 , I
-chrM 10607 C C 25 0 25 1 , I
-chrM 10608 G G 25 0 25 1 , I
-chrM 10609 C C 25 0 25 1 , I
-chrM 10610 T T 25 0 25 1 , I
-chrM 10611 G G 25 0 25 1 , I
-chrM 10612 A A 25 0 25 1 , I
-chrM 10613 G G 25 0 25 1 , I
-chrM 10614 G G 25 0 25 1 , I
-chrM 10615 C C 25 0 25 1 , I
-chrM 10616 A A 25 0 25 1 , I
-chrM 10617 A A 33 0 25 2 ,^:, II
+chrM 9366 A A 33 0 25 2 ,$. EI
+chrM 9367 C C 30 0 25 1 . I
+chrM 9368 T T 30 0 25 1 . I
+chrM 9369 G G 30 0 25 1 . I
+chrM 9370 A A 30 0 25 1 . I
+chrM 9371 C C 30 0 25 1 . I
+chrM 9372 A A 30 0 25 1 . I
+chrM 9373 C C 30 0 25 1 . I
+chrM 9374 T T 30 0 25 1 . I
+chrM 9375 T T 30 0 25 1 . I
+chrM 9376 C C 30 0 25 1 . I
+chrM 9377 G G 30 0 25 1 . I
+chrM 9378 T T 30 0 25 1 . I
+chrM 9379 C C 30 0 25 1 . I
+chrM 9380 G G 30 0 25 1 . I
+chrM 9381 A A 30 0 25 1 . 9
+chrM 9382 C C 30 0 25 1 . I
+chrM 9383 G G 30 0 25 1 . I
+chrM 9384 T T 30 0 25 1 . D
+chrM 9385 A A 30 0 25 1 .$ E
+chrM 9563 C C 30 0 25 1 ^:, E
+chrM 9564 T N 0 0 0 1 , +
+chrM 9565 G N 0 0 0 1 , -
+chrM 9566 A A 30 0 25 1 , I
+chrM 9567 C C 30 0 25 1 , I
+chrM 9568 T T 30 0 25 1 , ?
+chrM 9569 A A 30 0 25 1 , I
+chrM 9570 C C 30 0 25 1 , D
+chrM 9571 C C 30 0 25 1 , I
+chrM 9572 A A 30 0 25 1 , I
+chrM 9573 C C 30 0 25 1 , I
+chrM 9574 A A 30 0 25 1 , I
+chrM 9575 A A 30 0 25 1 , I
+chrM 9576 C C 30 0 25 1 , I
+chrM 9577 T T 30 0 25 1 , I
+chrM 9578 A A 30 0 25 1 , I
+chrM 9579 A A 30 0 25 1 , I
+chrM 9580 A A 30 0 25 1 , I
+chrM 9581 C C 30 0 25 1 , I
+chrM 9582 A A 30 0 25 1 , I
+chrM 9583 T T 30 0 25 1 , I
+chrM 9584 C C 30 0 25 1 , I
+chrM 9585 T T 30 0 25 1 , I
+chrM 9586 A A 30 0 25 1 , I
+chrM 9587 T T 30 0 25 1 , I
+chrM 9588 G G 30 0 25 1 , I
+chrM 9589 C C 30 0 25 1 , I
+chrM 9590 A N 0 0 0 1 n "
+chrM 9591 G N 0 0 0 1 n "
+chrM 9592 A A 30 0 25 1 , I
+chrM 9593 A A 30 0 25 1 , I
+chrM 9594 A A 30 0 25 1 , I
+chrM 9595 A A 30 0 25 1 , I
+chrM 9596 A A 30 0 25 1 , I
+chrM 9597 A A 30 0 25 1 , I
+chrM 9598 C C 30 0 25 1 ,$ >
+chrM 9689 A N 0 0 0 1 ^:, ,
+chrM 9690 T T 30 0 25 1 , C
+chrM 9691 T T 30 0 25 1 , I
+chrM 9692 C C 30 0 25 1 , I
+chrM 9693 G G 30 0 25 1 , I
+chrM 9694 A A 30 0 25 1 , .
+chrM 9695 C C 30 0 25 1 , I
+chrM 9696 T T 30 0 25 1 , I
+chrM 9697 T T 30 0 25 1 , 0
+chrM 9698 A A 30 0 25 1 , I
+chrM 9699 G G 30 0 25 1 , <
+chrM 9700 A A 30 0 25 1 , I
+chrM 9701 A A 30 0 25 1 , F
+chrM 9702 A A 30 0 25 1 , I
+chrM 9703 T T 30 0 25 1 , ;
+chrM 9704 T T 30 0 25 1 , I
+chrM 9705 G G 30 0 25 1 , I
+chrM 9706 C C 30 0 25 1 , I
+chrM 9707 C C 30 0 25 1 , I
+chrM 9708 C C 30 0 25 1 , I
+chrM 9709 T T 30 0 25 1 , D
+chrM 9710 C C 30 0 25 1 , I
+chrM 9711 C C 30 0 25 1 , I
+chrM 9712 T T 30 0 25 1 , I
+chrM 9713 A A 30 0 25 1 , I
+chrM 9714 T T 30 0 25 1 , I
+chrM 9715 T T 30 0 25 1 , I
+chrM 9716 A N 0 0 0 1 n "
+chrM 9717 C N 0 0 0 1 n "
+chrM 9718 C C 30 0 25 1 , I
+chrM 9719 C C 30 0 25 1 , I
+chrM 9720 C C 30 0 25 1 , I
+chrM 9721 T T 30 0 25 1 , I
+chrM 9722 T N 0 0 0 1 , &
+chrM 9723 C C 30 0 25 1 , E
+chrM 9724 C C 30 0 25 1 ,$ B
+chrM 9810 G G 30 0 25 1 ^:, A
+chrM 9811 A A 30 0 25 1 , I
+chrM 9812 A A 30 0 25 1 , I
+chrM 9813 T T 30 0 25 1 , I
+chrM 9814 G G 30 0 25 1 , I
+chrM 9815 A A 30 0 25 1 , I
+chrM 9816 A A 30 0 25 1 , I
+chrM 9817 C C 30 0 25 1 , ?
+chrM 9818 C C 30 0 25 1 , 2
+chrM 9819 C C 30 0 25 1 , 2
+chrM 9820 A A 30 0 25 1 , I
+chrM 9821 A A 30 0 25 1 , I
+chrM 9822 A A 30 0 25 1 , I
+chrM 9823 A A 30 0 25 1 , I
+chrM 9824 A A 30 0 25 1 , I
+chrM 9825 G G 30 0 25 1 , I
+chrM 9826 G G 30 0 25 1 , I
+chrM 9827 A A 30 0 25 1 , I
+chrM 9828 C C 30 0 25 1 , I
+chrM 9829 T T 30 0 25 1 , I
+chrM 9830 A A 30 0 25 1 , I
+chrM 9831 G G 30 0 25 1 , I
+chrM 9832 A A 30 0 25 1 , I
+chrM 9833 A A 30 0 25 1 , I
+chrM 9834 T T 30 0 25 1 , I
+chrM 9835 G G 30 0 25 1 , I
+chrM 9836 A A 30 0 25 1 , I
+chrM 9837 A N 0 0 0 1 n "
+chrM 9838 C N 0 0 0 1 n "
+chrM 9839 T T 30 0 25 1 , I
+chrM 9840 G G 30 0 25 1 , I
+chrM 9841 A A 30 0 25 1 , I
+chrM 9842 G G 30 0 25 1 , I
+chrM 9843 T T 30 0 25 1 , I
+chrM 9844 A A 30 0 25 1 , I
+chrM 9845 T T 30 0 25 1 ,$ E
+chrM 9916 T T 30 0 25 1 ^:. E
+chrM 9917 G G 30 0 25 1 . I
+chrM 9918 T T 30 0 25 1 . I
+chrM 9919 C C 30 0 25 1 . I
+chrM 9920 A A 30 0 25 1 . I
+chrM 9921 C C 30 0 25 1 . I
+chrM 9922 T T 30 0 25 1 . I
+chrM 9923 A N 0 0 0 1 N "
+chrM 9924 G N 0 0 0 1 N "
+chrM 9925 T T 30 0 25 1 . I
+chrM 9926 C C 30 0 25 1 . I
+chrM 9927 C C 30 0 25 1 . I
+chrM 9928 A A 30 0 25 1 . I
+chrM 9929 T T 30 0 25 1 . I
+chrM 9930 A A 30 0 25 1 . =
+chrM 9931 T T 30 0 25 1 . I
+chrM 9932 T T 30 0 25 1 . I
+chrM 9933 A A 30 0 25 1 . I
+chrM 9934 A A 30 0 25 1 . 9
+chrM 9935 T T 30 0 25 1 . I
+chrM 9936 A A 30 0 25 1 . @
+chrM 9937 T T 30 0 25 1 . I
+chrM 9938 C C 30 0 25 1 . I
+chrM 9939 T T 30 0 25 1 . I
+chrM 9940 T T 30 0 25 1 . I
+chrM 9941 C C 30 0 25 1 . I
+chrM 9942 C C 30 0 25 1 . I
+chrM 9943 T T 30 0 25 1 . I
+chrM 9944 A A 30 0 25 1 . B
+chrM 9945 G G 30 0 25 1 . I
+chrM 9946 C C 30 0 25 1 . I
+chrM 9947 A A 30 0 25 1 . E
+chrM 9948 T T 30 0 25 1 . I
+chrM 9949 T T 30 0 25 1 . I
+chrM 9950 C C 30 0 25 1 . I
+chrM 9951 A A 30 0 25 1 .$ >
+chrM 10002 C C 30 0 25 1 ^:, E
+chrM 10003 T T 30 0 25 1 , :
+chrM 10004 C C 30 0 25 1 , 2
+chrM 10005 C C 30 0 25 1 , I
+chrM 10006 T T 30 0 25 1 , E
+chrM 10007 A A 30 0 25 1 , I
+chrM 10008 T T 30 0 25 1 , :
+chrM 10009 G G 30 0 25 1 , I
+chrM 10010 C C 30 0 25 1 , I
+chrM 10011 C C 30 0 25 1 , D
+chrM 10012 T T 30 0 25 1 , I
+chrM 10013 A A 30 0 25 1 , I
+chrM 10014 G G 30 0 25 1 , I
+chrM 10015 A A 30 0 25 1 , I
+chrM 10016 A A 30 0 25 1 , I
+chrM 10017 G G 30 0 25 1 , I
+chrM 10018 G G 30 0 25 1 , 4
+chrM 10019 A A 30 0 25 1 , I
+chrM 10020 A A 30 0 25 1 , I
+chrM 10021 T T 30 0 25 1 , I
+chrM 10022 A A 30 0 25 1 , I
+chrM 10023 A A 30 0 25 1 , I
+chrM 10024 T T 30 0 25 1 , I
+chrM 10025 A A 30 0 25 1 , I
+chrM 10026 C C 30 0 25 1 , I
+chrM 10027 T T 30 0 25 1 , I
+chrM 10028 A A 30 0 25 1 , I
+chrM 10029 T N 0 0 0 1 n "
+chrM 10030 C N 0 0 0 1 n "
+chrM 10031 A A 30 0 25 1 , I
+chrM 10032 C C 30 0 25 1 , I
+chrM 10033 T T 30 0 25 1 , I
+chrM 10034 A A 30 0 25 1 , I
+chrM 10035 T T 30 0 25 1 , I
+chrM 10036 T T 30 0 25 1 , I
+chrM 10037 C C 30 0 25 1 ,$ E
+chrM 10391 G G 30 0 25 1 ^:. E
+chrM 10392 C C 30 0 25 1 . I
+chrM 10393 C C 30 0 25 1 . I
+chrM 10394 C C 30 0 25 1 . I
+chrM 10395 C C 30 0 25 1 . I
+chrM 10396 A A 30 0 25 1 . I
+chrM 10397 C C 30 0 25 1 . I
+chrM 10398 T N 0 0 0 1 N "
+chrM 10399 T N 0 0 0 1 N "
+chrM 10400 C C 30 0 25 1 . I
+chrM 10401 T T 30 0 25 1 . I
+chrM 10402 G G 30 0 25 1 . I
+chrM 10403 G G 30 0 25 1 . I
+chrM 10404 T T 30 0 25 1 . I
+chrM 10405 G G 30 0 25 1 . I
+chrM 10406 T T 30 0 25 1 . I
+chrM 10407 T T 30 0 25 1 . I
+chrM 10408 G G 30 0 25 1 . I
+chrM 10409 A A 30 0 25 1 . I
+chrM 10410 C C 30 0 25 1 . I
+chrM 10411 A A 30 0 25 1 . I
+chrM 10412 A A 30 0 25 1 . I
+chrM 10413 C C 30 0 25 1 . I
+chrM 10414 A A 30 0 25 1 . =
+chrM 10415 T T 30 0 25 1 . I
+chrM 10416 G N 0 0 0 1 . *
+chrM 10417 A A 30 0 25 1 . 5
+chrM 10418 C C 30 0 25 1 . I
+chrM 10419 T T 30 0 25 1 . I
+chrM 10420 A A 30 0 25 1 . <
+chrM 10421 C C 30 0 25 1 . I
+chrM 10422 T T 30 0 25 1 . I
+chrM 10423 G N 0 0 0 1 . '
+chrM 10424 C C 30 0 25 1 . I
+chrM 10425 C C 30 0 25 1 . I
+chrM 10426 A N 0 0 0 1 .$ (
+chrM 10597 T T 30 0 25 1 ^:, E
+chrM 10598 A A 30 0 25 1 , I
+chrM 10599 T T 30 0 25 1 , <
+chrM 10600 C C 30 0 25 1 , I
+chrM 10601 A A 30 0 25 1 , I
+chrM 10602 T T 30 0 25 1 , ;
+chrM 10603 C C 30 0 25 1 , I
+chrM 10604 A A 30 0 25 1 , I
+chrM 10605 C C 30 0 25 1 , I
+chrM 10606 C C 30 0 25 1 , I
+chrM 10607 C C 30 0 25 1 , I
+chrM 10608 G G 30 0 25 1 , I
+chrM 10609 C C 30 0 25 1 , I
+chrM 10610 T T 30 0 25 1 , I
+chrM 10611 G G 30 0 25 1 , I
+chrM 10612 A A 30 0 25 1 , I
+chrM 10613 G G 30 0 25 1 , I
+chrM 10614 G G 30 0 25 1 , I
+chrM 10615 C C 30 0 25 1 , I
+chrM 10616 A A 30 0 25 1 , I
+chrM 10617 A A 33 0 25 2 ,^:, IE
chrM 10618 C C 33 0 25 2 ,, II
chrM 10619 C C 33 0 25 2 ,, II
chrM 10620 A A 33 0 25 2 ,, II
chrM 10621 A A 33 0 25 2 ,, II
chrM 10622 A A 33 0 25 2 ,, II
chrM 10623 C C 33 0 25 2 ,, II
-chrM 10624 A A 28 0 25 2 n, "I
-chrM 10625 G G 19 0 25 2 n, "I
+chrM 10624 A A 30 0 25 2 n, "I
+chrM 10625 G G 30 0 25 2 n, "I
chrM 10626 A A 33 0 25 2 ,, II
chrM 10627 A A 33 0 25 2 ,, II
chrM 10628 C C 33 0 25 2 ,, II
chrM 10629 G G 33 0 25 2 ,, II
chrM 10630 C C 33 0 25 2 ,, II
chrM 10631 C C 33 0 25 2 ,, II
-chrM 10632 T T 33 0 25 2 ,$, II
-chrM 10633 G G 25 0 25 1 , I
-chrM 10634 A A 25 0 25 1 , I
-chrM 10635 A A 25 0 25 1 , I
-chrM 10636 C C 25 0 25 1 , I
-chrM 10637 G G 25 0 25 1 , I
-chrM 10638 C C 25 0 25 1 , I
-chrM 10639 A A 25 0 25 1 , I
-chrM 10640 G G 25 0 25 1 , I
-chrM 10641 G G 25 0 25 1 , I
-chrM 10642 C C 25 0 25 1 , I
-chrM 10643 C C 25 0 25 1 , I
-chrM 10644 T A 4 4 25 1 n "
-chrM 10645 C A 4 4 25 1 n "
-chrM 10646 T T 25 0 25 1 , I
-chrM 10647 A A 25 0 25 1 , I
-chrM 10648 C C 25 0 25 1 , I
-chrM 10649 T T 25 0 25 1 , I
-chrM 10650 T T 25 0 25 1 , I
-chrM 10651 C C 25 0 25 1 , I
-chrM 10652 C C 25 0 25 1 ,$ I
-chrM 10669 A A 25 0 25 1 ^:, I
-chrM 10670 G G 25 0 25 1 , I
-chrM 10671 G G 25 0 25 1 , I
-chrM 10672 T T 25 0 25 1 , I
-chrM 10673 T T 25 0 25 1 , <
-chrM 10674 C C 25 0 25 1 , I
-chrM 10675 C C 25 0 25 1 , I
-chrM 10676 C C 25 0 25 1 , I
-chrM 10677 T T 25 0 25 1 , C
-chrM 10678 C C 25 0 25 1 , I
-chrM 10679 C C 25 0 25 1 , I
-chrM 10680 C C 25 0 25 1 , I
-chrM 10681 A A 25 0 25 1 , I
-chrM 10682 C C 25 0 25 1 , I
-chrM 10683 T T 25 0 25 1 , I
-chrM 10684 C C 25 0 25 1 , I
-chrM 10685 T T 25 0 25 1 , F
-chrM 10686 T T 25 0 25 1 , I
-chrM 10687 A A 25 0 25 1 , I
-chrM 10688 G G 25 0 25 1 , I
-chrM 10689 T T 25 0 25 1 , I
-chrM 10690 T T 25 0 25 1 , I
-chrM 10691 G G 25 0 25 1 , I
-chrM 10692 C C 25 0 25 1 , I
-chrM 10693 A A 25 0 25 1 , I
-chrM 10694 C C 25 0 25 1 , I
-chrM 10695 T T 25 0 25 1 , I
-chrM 10696 A A 4 0 25 1 n "
-chrM 10697 A A 4 0 25 1 n "
-chrM 10698 T T 25 0 25 1 , I
-chrM 10699 C C 25 0 25 1 , I
-chrM 10700 T T 25 0 25 1 , I
-chrM 10701 C C 25 0 25 1 , I
-chrM 10702 T T 25 0 25 1 , I
-chrM 10703 A A 25 0 25 1 , I
-chrM 10704 T T 25 0 25 1 ,$ I
-chrM 10731 T T 25 0 25 1 ^:. I
-chrM 10732 C C 25 0 25 1 . I
-chrM 10733 C C 25 0 25 1 . I
-chrM 10734 T T 25 0 25 1 . I
-chrM 10735 A A 25 0 25 1 . I
-chrM 10736 T T 25 0 25 1 . I
-chrM 10737 T T 25 0 25 1 . I
-chrM 10738 A A 4 0 25 1 N "
-chrM 10739 A A 4 0 25 1 N "
-chrM 10740 T T 25 0 25 1 . I
-chrM 10741 T T 25 0 25 1 . I
-chrM 10742 C C 25 0 25 1 . I
-chrM 10743 A A 25 0 25 1 . I
-chrM 10744 A A 25 0 25 1 . I
-chrM 10745 T T 25 0 25 1 . I
-chrM 10746 A A 25 0 25 1 . I
-chrM 10747 C C 25 0 25 1 . I
-chrM 10748 T T 25 0 25 1 . I
-chrM 10749 G G 25 0 25 1 . I
-chrM 10750 A A 25 0 25 1 . I
-chrM 10751 A A 25 0 25 1 . I
-chrM 10752 A A 25 0 25 1 . I
-chrM 10753 C C 25 0 25 1 . I
-chrM 10754 C C 25 0 25 1 . I
-chrM 10755 A A 25 0 25 1 . I
-chrM 10756 A A 25 0 25 1 . F
-chrM 10757 G G 25 0 25 1 . I
-chrM 10758 C C 25 0 25 1 . I
-chrM 10759 A A 25 0 25 1 . I
-chrM 10760 C C 25 0 25 1 . I
-chrM 10761 T T 25 0 25 1 . I
-chrM 10762 A A 25 0 25 1 . @
-chrM 10763 C C 25 0 25 1 . I
-chrM 10764 C C 25 0 25 1 . I
-chrM 10765 C C 25 0 25 1 . I
-chrM 10766 G G 25 0 25 1 .$ H
-chrM 10784 T T 25 0 25 1 ^:, E
-chrM 10785 T T 24 0 25 1 , 9
-chrM 10786 C C 25 0 25 1 , I
-chrM 10787 C C 14 0 25 1 , /
-chrM 10788 T T 25 0 25 1 , B
-chrM 10789 A A 25 0 25 1 , I
-chrM 10790 T T 25 0 25 1 , I
-chrM 10791 G G 25 0 25 1 , I
-chrM 10792 A A 25 0 25 1 , I
-chrM 10793 C C 25 0 25 1 , C
-chrM 10794 T T 25 0 25 1 , I
-chrM 10795 A A 25 0 25 1 , I
-chrM 10796 G G 25 0 25 1 , I
-chrM 10797 C C 25 0 25 1 , I
-chrM 10798 A A 25 0 25 1 , I
-chrM 10799 T T 25 0 25 1 , F
-chrM 10800 G G 25 0 25 1 , I
-chrM 10801 T T 25 0 25 1 , I
-chrM 10802 A A 25 0 25 1 , I
-chrM 10803 T T 25 0 25 1 , I
-chrM 10804 A A 25 0 25 1 , I
-chrM 10805 A A 25 0 25 1 , I
-chrM 10806 T T 25 0 25 1 , I
-chrM 10807 A A 25 0 25 1 , I
-chrM 10808 G G 25 0 25 1 , I
-chrM 10809 C C 25 0 25 1 , I
-chrM 10810 A A 25 0 25 1 , I
-chrM 10811 T A 4 4 25 1 n "
-chrM 10812 T A 4 4 25 1 n "
-chrM 10813 C C 25 0 25 1 , I
-chrM 10814 A A 25 0 25 1 , I
-chrM 10815 T T 25 0 25 1 , I
-chrM 10816 A A 25 0 25 1 , I
-chrM 10817 G G 25 0 25 1 , I
-chrM 10818 T T 25 0 25 1 , I
-chrM 10819 C C 25 0 25 1 ,$ I
-chrM 10864 T T 25 0 25 1 ^:, D
-chrM 10865 G G 25 0 25 1 , B
-chrM 10866 T T 25 0 25 1 , A
-chrM 10867 A A 25 0 25 1 , I
-chrM 10868 G G 25 0 25 1 , I
-chrM 10869 A A 25 0 25 1 , I
-chrM 10870 A A 25 0 25 1 , I
-chrM 10871 G G 25 0 25 1 , I
-chrM 10872 C C 25 0 25 1 , I
-chrM 10873 C C 25 0 25 1 , I
-chrM 10874 C C 25 0 25 1 , I
-chrM 10875 C C 25 0 25 1 , I
-chrM 10876 A A 25 0 25 1 , I
-chrM 10877 A A 25 0 25 1 , I
-chrM 10878 T T 25 0 25 1 , F
-chrM 10879 T T 25 0 25 1 , I
-chrM 10880 G G 25 0 25 1 , I
-chrM 10881 C C 25 0 25 1 , I
-chrM 10882 C C 25 0 25 1 , I
-chrM 10883 G G 25 0 25 1 , I
-chrM 10884 G G 25 0 25 1 , I
-chrM 10885 A A 25 0 25 1 , I
-chrM 10886 T T 25 0 25 1 , I
-chrM 10887 C C 25 0 25 1 , I
-chrM 10888 C C 25 0 25 1 , I
-chrM 10889 A A 25 0 25 1 , I
-chrM 10890 T T 25 0 25 1 , I
-chrM 10891 A A 23 0 25 2 n^:, "5
-chrM 10892 G G 16 0 25 2 n, "7
-chrM 10893 T T 33 0 25 2 ,, I-
+chrM 10632 T T 33 0 25 2 ,$, EI
+chrM 10633 G G 30 0 25 1 , I
+chrM 10634 A A 30 0 25 1 , I
+chrM 10635 A A 30 0 25 1 , I
+chrM 10636 C C 30 0 25 1 , I
+chrM 10637 G G 30 0 25 1 , I
+chrM 10638 C C 30 0 25 1 , I
+chrM 10639 A A 30 0 25 1 , I
+chrM 10640 G G 30 0 25 1 , I
+chrM 10641 G G 30 0 25 1 , I
+chrM 10642 C C 30 0 25 1 , I
+chrM 10643 C C 30 0 25 1 , I
+chrM 10644 T N 0 0 0 1 n "
+chrM 10645 C N 0 0 0 1 n "
+chrM 10646 T T 30 0 25 1 , I
+chrM 10647 A A 30 0 25 1 , I
+chrM 10648 C C 30 0 25 1 , I
+chrM 10649 T T 30 0 25 1 , I
+chrM 10650 T T 30 0 25 1 , I
+chrM 10651 C C 30 0 25 1 , E
+chrM 10652 C C 30 0 25 1 ,$ B
+chrM 10669 A A 30 0 25 1 ^:, E
+chrM 10670 G G 30 0 25 1 , I
+chrM 10671 G G 30 0 25 1 , I
+chrM 10672 T T 30 0 25 1 , I
+chrM 10673 T T 30 0 25 1 , <
+chrM 10674 C C 30 0 25 1 , I
+chrM 10675 C C 30 0 25 1 , I
+chrM 10676 C C 30 0 25 1 , I
+chrM 10677 T T 30 0 25 1 , C
+chrM 10678 C C 30 0 25 1 , I
+chrM 10679 C C 30 0 25 1 , I
+chrM 10680 C C 30 0 25 1 , I
+chrM 10681 A A 30 0 25 1 , I
+chrM 10682 C C 30 0 25 1 , I
+chrM 10683 T T 30 0 25 1 , I
+chrM 10684 C C 30 0 25 1 , I
+chrM 10685 T T 30 0 25 1 , F
+chrM 10686 T T 30 0 25 1 , I
+chrM 10687 A A 30 0 25 1 , I
+chrM 10688 G G 30 0 25 1 , I
+chrM 10689 T T 30 0 25 1 , I
+chrM 10690 T T 30 0 25 1 , I
+chrM 10691 G G 30 0 25 1 , I
+chrM 10692 C C 30 0 25 1 , I
+chrM 10693 A A 30 0 25 1 , I
+chrM 10694 C C 30 0 25 1 , I
+chrM 10695 T T 30 0 25 1 , I
+chrM 10696 A N 0 0 0 1 n "
+chrM 10697 A N 0 0 0 1 n "
+chrM 10698 T T 30 0 25 1 , I
+chrM 10699 C C 30 0 25 1 , I
+chrM 10700 T T 30 0 25 1 , I
+chrM 10701 C C 30 0 25 1 , I
+chrM 10702 T T 30 0 25 1 , I
+chrM 10703 A A 30 0 25 1 , I
+chrM 10704 T T 30 0 25 1 ,$ E
+chrM 10731 T T 30 0 25 1 ^:. E
+chrM 10732 C C 30 0 25 1 . I
+chrM 10733 C C 30 0 25 1 . I
+chrM 10734 T T 30 0 25 1 . I
+chrM 10735 A A 30 0 25 1 . I
+chrM 10736 T T 30 0 25 1 . I
+chrM 10737 T T 30 0 25 1 . I
+chrM 10738 A N 0 0 0 1 N "
+chrM 10739 A N 0 0 0 1 N "
+chrM 10740 T T 30 0 25 1 . I
+chrM 10741 T T 30 0 25 1 . I
+chrM 10742 C C 30 0 25 1 . I
+chrM 10743 A A 30 0 25 1 . I
+chrM 10744 A A 30 0 25 1 . I
+chrM 10745 T T 30 0 25 1 . I
+chrM 10746 A A 30 0 25 1 . I
+chrM 10747 C C 30 0 25 1 . I
+chrM 10748 T T 30 0 25 1 . I
+chrM 10749 G G 30 0 25 1 . I
+chrM 10750 A A 30 0 25 1 . I
+chrM 10751 A A 30 0 25 1 . I
+chrM 10752 A A 30 0 25 1 . I
+chrM 10753 C C 30 0 25 1 . I
+chrM 10754 C C 30 0 25 1 . I
+chrM 10755 A A 30 0 25 1 . I
+chrM 10756 A A 30 0 25 1 . F
+chrM 10757 G G 30 0 25 1 . I
+chrM 10758 C C 30 0 25 1 . I
+chrM 10759 A A 30 0 25 1 . I
+chrM 10760 C C 30 0 25 1 . I
+chrM 10761 T T 30 0 25 1 . I
+chrM 10762 A A 30 0 25 1 . @
+chrM 10763 C C 30 0 25 1 . I
+chrM 10764 C C 30 0 25 1 . I
+chrM 10765 C C 30 0 25 1 . I
+chrM 10766 G G 30 0 25 1 .$ E
+chrM 10784 T T 30 0 25 1 ^:, =
+chrM 10785 T T 30 0 25 1 , 9
+chrM 10786 C C 30 0 25 1 , I
+chrM 10787 C C 30 0 25 1 , /
+chrM 10788 T T 30 0 25 1 , B
+chrM 10789 A A 30 0 25 1 , I
+chrM 10790 T T 30 0 25 1 , I
+chrM 10791 G G 30 0 25 1 , I
+chrM 10792 A A 30 0 25 1 , I
+chrM 10793 C C 30 0 25 1 , C
+chrM 10794 T T 30 0 25 1 , I
+chrM 10795 A A 30 0 25 1 , I
+chrM 10796 G G 30 0 25 1 , I
+chrM 10797 C C 30 0 25 1 , I
+chrM 10798 A A 30 0 25 1 , I
+chrM 10799 T T 30 0 25 1 , F
+chrM 10800 G G 30 0 25 1 , I
+chrM 10801 T T 30 0 25 1 , I
+chrM 10802 A A 30 0 25 1 , I
+chrM 10803 T T 30 0 25 1 , I
+chrM 10804 A A 30 0 25 1 , I
+chrM 10805 A A 30 0 25 1 , I
+chrM 10806 T T 30 0 25 1 , I
+chrM 10807 A A 30 0 25 1 , I
+chrM 10808 G G 30 0 25 1 , I
+chrM 10809 C C 30 0 25 1 , I
+chrM 10810 A A 30 0 25 1 , I
+chrM 10811 T N 0 0 0 1 n "
+chrM 10812 T N 0 0 0 1 n "
+chrM 10813 C C 30 0 25 1 , I
+chrM 10814 A A 30 0 25 1 , I
+chrM 10815 T T 30 0 25 1 , I
+chrM 10816 A A 30 0 25 1 , I
+chrM 10817 G G 30 0 25 1 , I
+chrM 10818 T T 30 0 25 1 , I
+chrM 10819 C C 30 0 25 1 ,$ E
+chrM 10864 T T 30 0 25 1 ^:, D
+chrM 10865 G G 30 0 25 1 , B
+chrM 10866 T T 30 0 25 1 , A
+chrM 10867 A A 30 0 25 1 , I
+chrM 10868 G G 30 0 25 1 , I
+chrM 10869 A A 30 0 25 1 , I
+chrM 10870 A A 30 0 25 1 , I
+chrM 10871 G G 30 0 25 1 , I
+chrM 10872 C C 30 0 25 1 , I
+chrM 10873 C C 30 0 25 1 , I
+chrM 10874 C C 30 0 25 1 , I
+chrM 10875 C C 30 0 25 1 , I
+chrM 10876 A A 30 0 25 1 , I
+chrM 10877 A A 30 0 25 1 , I
+chrM 10878 T T 30 0 25 1 , F
+chrM 10879 T T 30 0 25 1 , I
+chrM 10880 G G 30 0 25 1 , I
+chrM 10881 C C 30 0 25 1 , I
+chrM 10882 C C 30 0 25 1 , I
+chrM 10883 G G 30 0 25 1 , I
+chrM 10884 G G 30 0 25 1 , I
+chrM 10885 A A 30 0 25 1 , I
+chrM 10886 T T 30 0 25 1 , I
+chrM 10887 C C 30 0 25 1 , I
+chrM 10888 C C 30 0 25 1 , I
+chrM 10889 A A 30 0 25 1 , I
+chrM 10890 T T 30 0 25 1 , I
+chrM 10891 A A 30 0 25 2 n^:, "5
+chrM 10892 G G 30 0 25 2 n, "7
+chrM 10893 T T 30 0 25 2 ,, I-
chrM 10894 G G 33 0 25 2 ,, IC
chrM 10895 C C 33 0 25 2 ,, I5
-chrM 10896 T T 33 0 25 2 ,, I,
+chrM 10896 T T 30 0 25 2 ,, I,
chrM 10897 A A 33 0 25 2 ,, II
chrM 10898 G G 33 0 25 2 ,, I5
-chrM 10899 C C 33 0 25 2 ,$, II
-chrM 10900 A A 25 0 25 1 , I
-chrM 10901 G G 25 0 25 1 , I
+chrM 10899 C C 33 0 25 2 ,$, DI
+chrM 10900 A A 30 0 25 1 , I
+chrM 10901 G G 30 0 25 1 , I
chrM 10902 C C 30 0 25 2 ,^:, I'
chrM 10903 C C 33 0 25 2 ,, IA
chrM 10904 A A 33 0 25 2 ,, II
@@ -2287,579 +2287,579 @@ chrM 10914 A A 33 0 25 2 ,, II
chrM 10915 A A 33 0 25 2 ,, I8
chrM 10916 C C 33 0 25 2 ,, I6
chrM 10917 T T 33 0 25 2 ,, I.
-chrM 10918 A A 28 0 25 2 n, "I
-chrM 10919 G G 19 0 25 2 n, "I
+chrM 10918 A A 30 0 25 2 n, "I
+chrM 10919 G G 30 0 25 2 n, "I
chrM 10920 G G 33 0 25 2 ,, II
chrM 10921 A A 33 0 25 2 ,, II
chrM 10922 G G 33 0 25 2 ,, II
chrM 10923 G G 33 0 25 2 ,, II
chrM 10924 C C 33 0 25 2 ,, II
chrM 10925 T T 33 0 25 2 ,, II
-chrM 10926 A A 33 0 25 2 ,$, II
-chrM 10927 C C 25 0 25 1 , I
-chrM 10928 G G 25 0 25 1 , I
-chrM 10929 G A 4 4 25 1 n "
-chrM 10930 A A 4 0 25 1 n "
-chrM 10931 A A 25 0 25 1 , I
-chrM 10932 T T 25 0 25 1 , I
-chrM 10933 A A 25 0 25 1 , I
-chrM 10934 C C 25 0 25 1 , I
-chrM 10935 T T 25 0 25 1 , I
-chrM 10936 A A 25 0 25 1 , I
-chrM 10937 C C 22 0 25 1 ,$ 7
-chrM 10991 A A 25 0 25 1 ^:. I
-chrM 10992 T T 25 0 25 1 . I
-chrM 10993 A A 25 0 25 1 . I
-chrM 10994 C C 25 0 25 1 . I
-chrM 10995 T T 25 0 25 1 . I
-chrM 10996 A A 25 0 25 1 . I
-chrM 10997 T T 25 0 25 1 . I
-chrM 10998 C A 4 4 25 1 N "
-chrM 10999 C A 4 4 25 1 N "
-chrM 11000 C C 25 0 25 1 . I
-chrM 11001 T T 25 0 25 1 . I
-chrM 11002 G G 25 0 25 1 . I
-chrM 11003 T T 25 0 25 1 . I
-chrM 11004 G G 25 0 25 1 . I
-chrM 11005 A A 17 0 25 1 . 2
-chrM 11006 G G 25 0 25 1 . I
-chrM 11007 G G 25 0 25 1 . I
-chrM 11008 A A 25 0 25 1 . I
-chrM 11009 A A 25 0 25 1 . I
-chrM 11010 T T 25 0 25 1 . I
-chrM 11011 A A 25 0 25 1 . I
-chrM 11012 A A 25 0 25 1 . I
-chrM 11013 T T 25 0 25 1 . I
-chrM 11014 C C 25 0 25 1 . I
-chrM 11015 A A 25 0 25 1 . I
-chrM 11016 T T 25 0 25 1 . I
-chrM 11017 A A 25 0 25 1 . F
-chrM 11018 A A 25 0 25 1 . I
-chrM 11019 C C 25 0 25 1 . I
-chrM 11020 T T 25 0 25 1 . I
-chrM 11021 A A 25 0 25 1 . :
-chrM 11022 G G 25 0 25 1 . I
-chrM 11023 T T 25 0 25 1 . I
-chrM 11024 T T 25 0 25 1 . I
-chrM 11025 C C 25 0 25 1 . I
-chrM 11026 C C 25 0 25 1 .$ I
-chrM 11036 C C 25 0 25 1 ^:, I
-chrM 11037 G G 25 0 25 1 , I
-chrM 11038 A A 25 0 25 1 , I
-chrM 11039 C C 25 0 25 1 , I
-chrM 11040 A A 25 0 25 1 , I
-chrM 11041 A A 25 0 25 1 , I
-chrM 11042 A A 25 0 25 1 , I
-chrM 11043 C C 25 0 25 1 , I
-chrM 11044 C C 25 0 25 1 , I
-chrM 11045 G G 25 0 25 1 , I
-chrM 11046 A A 25 0 25 1 , I
-chrM 11047 T T 25 0 25 1 , I
-chrM 11048 C C 25 0 25 1 , I
-chrM 11049 T T 25 0 25 1 , I
-chrM 11050 A A 25 0 25 1 , I
-chrM 11051 A A 25 0 25 1 , I
-chrM 11052 A A 25 0 25 1 , I
-chrM 11053 A A 25 0 25 1 , I
-chrM 11054 T T 25 0 25 1 , I
-chrM 11055 C C 25 0 25 1 , I
-chrM 11056 A A 25 0 25 1 , I
-chrM 11057 C C 25 0 25 1 , I
-chrM 11058 T T 25 0 25 1 , I
-chrM 11059 T T 25 0 25 1 , I
-chrM 11060 A A 25 0 25 1 , I
-chrM 11061 T T 25 0 25 1 , I
-chrM 11062 T T 25 0 25 1 , I
-chrM 11063 G A 4 4 25 1 n "
-chrM 11064 C A 4 4 25 1 n "
-chrM 11065 A A 25 0 25 1 , I
-chrM 11066 T T 25 0 25 1 , I
-chrM 11067 A A 25 0 25 1 , I
-chrM 11068 C C 25 0 25 1 , I
-chrM 11069 T T 25 0 25 1 , I
-chrM 11070 C C 25 0 25 1 , I
-chrM 11071 C C 25 0 25 1 ,$ I
-chrM 11086 A A 25 0 25 1 ^:, I
-chrM 11087 G G 16 0 25 1 , 1
-chrM 11088 C C 6 0 25 1 , '
-chrM 11089 C C 25 0 25 1 , =
-chrM 11090 C C 25 0 25 1 , D
-chrM 11091 T T 15 0 25 1 , 0
-chrM 11092 A A 25 0 25 1 , I
-chrM 11093 G G 25 0 25 1 , @
-chrM 11094 T T 19 0 25 1 , 4
-chrM 11095 A A 25 0 25 1 , I
-chrM 11096 A A 25 0 25 1 , I
-chrM 11097 T T 25 0 25 1 , A
-chrM 11098 C C 25 0 25 1 , I
-chrM 11099 G G 25 0 25 1 , I
-chrM 11100 T T 25 0 25 1 , D
-chrM 11101 A A 25 0 25 1 , I
-chrM 11102 G G 25 0 25 1 , I
-chrM 11103 C C 25 0 25 1 , I
-chrM 11104 C C 25 0 25 1 , I
-chrM 11105 G G 25 0 25 1 , I
-chrM 11106 T T 25 0 25 1 , I
-chrM 11107 C C 25 0 25 1 , I
-chrM 11108 C C 25 0 25 1 , I
-chrM 11109 T T 25 0 25 1 , I
-chrM 11110 C C 25 0 25 1 , I
-chrM 11111 A A 25 0 25 1 , I
-chrM 11112 T T 25 0 25 1 , I
-chrM 11113 C A 4 4 25 1 n "
-chrM 11114 C A 4 4 25 1 n "
-chrM 11115 A A 25 0 25 1 , I
-chrM 11116 A A 25 0 25 1 , I
-chrM 11117 A A 25 0 25 1 , I
-chrM 11118 C C 25 0 25 1 , I
-chrM 11119 A A 25 0 25 1 , I
-chrM 11120 C C 25 0 25 1 , I
-chrM 11121 C C 25 0 25 1 ,$ I
-chrM 11375 A A 25 0 25 1 ^:. I
-chrM 11376 T T 25 0 25 1 . I
-chrM 11377 T T 25 0 25 1 . I
-chrM 11378 A A 25 0 25 1 . I
-chrM 11379 C C 25 0 25 1 . I
-chrM 11380 C C 25 0 25 1 . I
-chrM 11381 A A 25 0 25 1 . I
-chrM 11382 T A 4 4 25 1 N "
-chrM 11383 T A 4 4 25 1 N "
-chrM 11384 A A 25 0 25 1 . I
-chrM 11385 T T 25 0 25 1 . I
-chrM 11386 C C 25 0 25 1 . I
-chrM 11387 C C 25 0 25 1 . I
-chrM 11388 T T 25 0 25 1 . I
-chrM 11389 A A 25 0 25 1 . I
-chrM 11390 A A 25 0 25 1 . I
-chrM 11391 T T 25 0 25 1 . I
-chrM 11392 A A 25 0 25 1 . G
-chrM 11393 G G 25 0 25 1 . I
-chrM 11394 G G 25 0 25 1 . I
-chrM 11395 A A 25 0 25 1 . I
-chrM 11396 G G 25 0 25 1 . I
-chrM 11397 C C 25 0 25 1 . I
-chrM 11398 C C 25 0 25 1 . I
-chrM 11399 A A 25 0 25 1 . I
-chrM 11400 A A 25 0 25 1 . I
-chrM 11401 T T 25 0 25 1 . I
-chrM 11402 A A 25 0 25 1 . I
-chrM 11403 T T 25 0 25 1 . I
-chrM 11404 C C 25 0 25 1 . I
-chrM 11405 A A 25 0 25 1 . @
-chrM 11406 C C 25 0 25 1 . I
-chrM 11407 C C 25 0 25 1 . I
-chrM 11408 A A 19 0 25 1 . 4
-chrM 11409 T T 25 0 25 1 . I
-chrM 11410 C C 25 0 25 1 .$ I
-chrM 11457 A A 25 0 25 1 ^:. I
-chrM 11458 A A 25 0 25 1 . I
-chrM 11459 T T 25 0 25 1 . I
-chrM 11460 A A 25 0 25 1 . I
-chrM 11461 C C 25 0 25 1 . I
-chrM 11462 A A 25 0 25 1 . I
-chrM 11463 C C 25 0 25 1 . I
-chrM 11464 A A 4 0 25 1 N "
-chrM 11465 C A 4 4 25 1 N "
-chrM 11466 A A 25 0 25 1 . I
-chrM 11467 C C 25 0 25 1 . I
-chrM 11468 C C 25 0 25 1 . I
-chrM 11469 A A 25 0 25 1 . I
-chrM 11470 T T 25 0 25 1 . I
-chrM 11471 A A 25 0 25 1 . I
-chrM 11472 T T 25 0 25 1 . I
-chrM 11473 C C 25 0 25 1 . I
-chrM 11474 A A 25 0 25 1 . I
-chrM 11475 A A 25 0 25 1 . I
-chrM 11476 C C 25 0 25 1 . I
-chrM 11477 A A 25 0 25 1 . I
-chrM 11478 G G 25 0 25 1 . I
-chrM 11479 C C 25 0 25 1 . I
-chrM 11480 A A 25 0 25 1 . I
-chrM 11481 T T 25 0 25 1 . I
-chrM 11482 T T 25 0 25 1 . I
-chrM 11483 A A 25 0 25 1 . I
-chrM 11484 A A 25 0 25 1 . I
-chrM 11485 A A 25 0 25 1 . I
-chrM 11486 C C 25 0 25 1 . I
-chrM 11487 C C 25 0 25 1 . I
-chrM 11488 T T 25 0 25 1 . I
-chrM 11489 T T 25 0 25 1 . I
-chrM 11490 C C 25 0 25 1 . I
-chrM 11491 A A 25 0 25 1 . @
-chrM 11492 T T 25 0 25 1 .$ I
-chrM 11616 G G 25 0 25 1 ^:, I
-chrM 11617 A A 25 0 25 1 , I
-chrM 11618 T T 24 0 25 1 , 9
-chrM 11619 C C 25 0 25 1 , I
-chrM 11620 T T 25 0 25 1 , I
-chrM 11621 A A 25 0 25 1 , I
-chrM 11622 G G 25 0 25 1 , I
-chrM 11623 A A 25 0 25 1 , I
-chrM 11624 A A 25 0 25 1 , I
-chrM 11625 A A 25 0 25 1 , I
-chrM 11626 C C 25 0 25 1 , I
-chrM 11627 A A 25 0 25 1 , I
-chrM 11628 G G 25 0 25 1 , I
-chrM 11629 A A 25 0 25 1 , I
-chrM 11630 A A 25 0 25 1 , I
-chrM 11631 A A 25 0 25 1 , I
-chrM 11632 C C 25 0 25 1 , I
-chrM 11633 T T 25 0 25 1 , I
-chrM 11634 T T 25 0 25 1 , I
-chrM 11635 A A 25 0 25 1 , I
-chrM 11636 A A 25 0 25 1 , I
-chrM 11637 T T 25 0 25 1 , I
-chrM 11638 A A 25 0 25 1 , I
-chrM 11639 T T 25 0 25 1 , I
-chrM 11640 T T 25 0 25 1 , I
-chrM 11641 T T 25 0 25 1 , I
-chrM 11642 C C 25 0 25 1 , I
-chrM 11643 T A 4 4 25 1 n "
-chrM 11644 T A 4 4 25 1 n "
-chrM 11645 A A 25 0 25 1 , I
-chrM 11646 T T 25 0 25 1 , I
-chrM 11647 T T 25 0 25 1 , I
-chrM 11648 T T 25 0 25 1 , I
-chrM 11649 A A 25 0 25 1 , I
-chrM 11650 C C 25 0 25 1 , I
-chrM 11651 C C 25 0 25 1 ,$ I
-chrM 11721 A A 25 0 25 1 ^:. I
-chrM 11722 G G 25 0 25 1 . I
-chrM 11723 G G 25 0 25 1 . I
-chrM 11724 A A 25 0 25 1 . I
-chrM 11725 T T 25 0 25 1 . I
-chrM 11726 A A 25 0 25 1 . I
-chrM 11727 G G 25 0 25 1 . I
-chrM 11728 G A 4 4 25 1 N "
-chrM 11729 A A 4 0 25 1 N "
-chrM 11730 G G 25 0 25 1 . I
-chrM 11731 C C 25 0 25 1 . I
-chrM 11732 T T 25 0 25 1 . I
-chrM 11733 A A 25 0 25 1 . I
-chrM 11734 T T 25 0 25 1 . I
-chrM 11735 C C 25 0 25 1 . I
-chrM 11736 C C 25 0 25 1 . I
-chrM 11737 G G 25 0 25 1 . I
-chrM 11738 T T 25 0 25 1 . I
-chrM 11739 T T 25 0 25 1 . I
-chrM 11740 G G 25 0 25 1 . I
-chrM 11741 G G 25 0 25 1 . I
-chrM 11742 T T 25 0 25 1 . I
-chrM 11743 C C 25 0 25 1 . I
-chrM 11744 T T 25 0 25 1 . I
-chrM 11745 T T 25 0 25 1 . I
-chrM 11746 A A 25 0 25 1 . I
-chrM 11747 G G 25 0 25 1 . I
-chrM 11748 G G 25 0 25 1 . I
-chrM 11749 A A 25 0 25 1 . F
-chrM 11750 A A 25 0 25 1 . I
-chrM 11751 C C 25 0 25 1 . I
-chrM 11752 C C 25 0 25 1 . I
-chrM 11753 A A 25 0 25 1 . H
-chrM 11754 A A 25 0 25 1 . :
-chrM 11755 A A 21 0 25 1 . 6
-chrM 11756 A A 25 0 25 1 .$ I
-chrM 12013 C C 25 0 25 1 ^:, I
-chrM 12014 C C 25 0 25 1 , I
-chrM 12015 T T 25 0 25 1 , I
-chrM 12016 A A 25 0 25 1 , I
-chrM 12017 A A 25 0 25 1 , I
-chrM 12018 G G 25 0 25 1 , I
-chrM 12019 C C 25 0 25 1 , I
-chrM 12020 T T 25 0 25 1 , I
-chrM 12021 T T 25 0 25 1 , F
-chrM 12022 C C 25 0 25 1 , I
-chrM 12023 A A 25 0 25 1 , I
-chrM 12024 A A 25 0 25 1 , I
-chrM 12025 A A 25 0 25 1 , I
-chrM 12026 C C 25 0 25 1 , I
-chrM 12027 T T 25 0 25 1 , I
-chrM 12028 A A 25 0 25 1 , I
-chrM 12029 G G 25 0 25 1 , I
-chrM 12030 A A 25 0 25 1 , I
-chrM 12031 T T 25 0 25 1 , I
-chrM 12032 T T 25 0 25 1 , I
-chrM 12033 A A 25 0 25 1 , I
-chrM 12034 C C 25 0 25 1 , I
-chrM 12035 T T 25 0 25 1 , I
-chrM 12036 T T 25 0 25 1 , I
-chrM 12037 C C 25 0 25 1 , I
-chrM 12038 T T 25 0 25 1 , I
-chrM 12039 C C 25 0 25 1 , I
-chrM 12040 A A 4 0 25 1 n "
-chrM 12041 A A 4 0 25 1 n "
-chrM 12042 T T 25 0 25 1 , I
-chrM 12043 A A 25 0 25 1 , I
-chrM 12044 A A 25 0 25 1 , I
-chrM 12045 T T 25 0 25 1 , I
-chrM 12046 T T 25 0 25 1 , I
-chrM 12047 T T 25 0 25 1 , I
-chrM 12048 T T 25 0 25 1 ,$ I
-chrM 12295 A A 25 0 25 1 ^:. I
-chrM 12296 A A 25 0 25 1 . I
-chrM 12297 T T 25 0 25 1 . I
-chrM 12298 C C 25 0 25 1 . I
-chrM 12299 C C 25 0 25 1 . I
-chrM 12300 T T 25 0 25 1 . I
-chrM 12301 T T 25 0 25 1 . I
-chrM 12302 T A 4 4 25 1 N "
-chrM 12303 A A 4 0 25 1 N "
-chrM 12304 T T 25 0 25 1 . I
-chrM 12305 A A 25 0 25 1 . I
-chrM 12306 A A 25 0 25 1 . I
-chrM 12307 C C 25 0 25 1 . I
-chrM 12308 C C 25 0 25 1 . I
-chrM 12309 G G 25 0 25 1 . I
-chrM 12310 C C 25 0 25 1 . I
-chrM 12311 A A 25 0 25 1 . I
-chrM 12312 T T 25 0 25 1 . I
-chrM 12313 C C 25 0 25 1 . I
-chrM 12314 G G 25 0 25 1 . I
-chrM 12315 G G 25 0 25 1 . I
-chrM 12316 G G 25 0 25 1 . I
-chrM 12317 G G 25 0 25 1 . I
-chrM 12318 A A 25 0 25 1 . I
-chrM 12319 T T 25 0 25 1 . I
-chrM 12320 A A 25 0 25 1 . I
-chrM 12321 T T 25 0 25 1 . I
-chrM 12322 C C 25 0 25 1 . I
-chrM 12323 G G 25 0 25 1 . I
-chrM 12324 G G 25 0 25 1 . I
-chrM 12325 C C 25 0 25 1 . I
-chrM 12326 T T 25 0 25 1 . I
-chrM 12327 T T 25 0 25 1 . I
-chrM 12328 C C 25 0 25 1 . :
-chrM 12329 A A 7 0 25 1 . (
-chrM 12330 T T 25 0 25 1 .$ D
-chrM 12387 T T 25 0 25 1 ^:, F
-chrM 12388 C C 25 0 25 1 , I
-chrM 12389 A A 25 0 25 1 , I
-chrM 12390 T T 25 0 25 1 , H
-chrM 12391 A A 25 0 25 1 , I
-chrM 12392 C C 25 0 25 1 , I
-chrM 12393 T T 25 0 25 1 , ;
-chrM 12394 C C 25 0 25 1 , I
-chrM 12395 G G 25 0 25 1 , I
-chrM 12396 A A 25 0 25 1 , I
-chrM 12397 C C 25 0 25 1 , I
-chrM 12398 C C 25 0 25 1 , I
-chrM 12399 C C 25 0 25 1 , I
-chrM 12400 C C 25 0 25 1 , I
-chrM 12401 A A 25 0 25 1 , I
-chrM 12402 A A 25 0 25 1 , I
-chrM 12403 C C 25 0 25 1 , I
-chrM 12404 C C 25 0 25 1 , I
-chrM 12405 T T 25 0 25 1 , I
-chrM 12406 T T 25 0 25 1 , I
-chrM 12407 A A 25 0 25 1 , I
-chrM 12408 C C 25 0 25 1 , I
-chrM 12409 C C 25 0 25 1 , I
-chrM 12410 A A 25 0 25 1 , I
-chrM 12411 A A 25 0 25 1 , I
-chrM 12412 C C 25 0 25 1 , I
-chrM 12413 C C 25 0 25 1 , I
-chrM 12414 T A 4 4 25 1 n "
-chrM 12415 C A 4 4 25 1 n "
-chrM 12416 C C 25 0 25 1 , I
-chrM 12417 C C 25 0 25 1 , I
-chrM 12418 G G 25 0 25 1 , I
-chrM 12419 C C 25 0 25 1 , I
-chrM 12420 T T 25 0 25 1 , I
-chrM 12421 C C 25 0 25 1 , I
-chrM 12422 C C 25 0 25 1 ,$ I
-chrM 12584 G G 25 0 25 1 ^:. I
-chrM 12585 A A 25 0 25 1 . I
-chrM 12586 A A 25 0 25 1 . I
-chrM 12587 A A 25 0 25 1 . I
-chrM 12588 A A 25 0 25 1 . I
-chrM 12589 C C 25 0 25 1 . I
-chrM 12590 A A 25 0 25 1 . I
-chrM 12591 A A 4 0 25 1 N "
-chrM 12592 C A 4 4 25 1 N "
-chrM 12593 A A 25 0 25 1 . I
-chrM 12594 A A 25 0 25 1 . I
-chrM 12595 A A 25 0 25 1 . I
-chrM 12596 A A 25 0 25 1 . I
-chrM 12597 C C 25 0 25 1 . I
-chrM 12598 A A 25 0 25 1 . I
-chrM 12599 A A 25 0 25 1 . I
-chrM 12600 T T 25 0 25 1 . I
-chrM 12601 C C 25 0 25 1 . I
-chrM 12602 C C 25 0 25 1 . I
-chrM 12603 A A 25 0 25 1 . I
-chrM 12604 G G 25 0 25 1 . I
-chrM 12605 T T 25 0 25 1 . I
-chrM 12606 C C 25 0 25 1 . I
-chrM 12607 A A 25 0 25 1 . I
-chrM 12608 C C 25 0 25 1 . I
-chrM 12609 T T 25 0 25 1 . I
-chrM 12610 T T 25 0 25 1 . I
-chrM 12611 A A 25 0 25 1 . I
-chrM 12612 C C 25 0 25 1 . I
-chrM 12613 C C 25 0 25 1 . I
-chrM 12614 C C 25 0 25 1 . I
-chrM 12615 T T 25 0 25 1 . I
-chrM 12616 A A 25 0 25 1 . @
-chrM 12617 T T 25 0 25 1 . I
-chrM 12618 G G 25 0 25 1 . I
-chrM 12619 C C 25 0 25 1 .$ I
-chrM 12988 G G 25 0 25 1 ^:. I
-chrM 12989 T T 25 0 25 1 . I
-chrM 12990 A A 25 0 25 1 . I
-chrM 12991 C C 25 0 25 1 . I
-chrM 12992 A A 25 0 25 1 . I
-chrM 12993 C C 25 0 25 1 . I
-chrM 12994 C C 25 0 25 1 . I
-chrM 12995 A A 4 0 25 1 N "
-chrM 12996 A A 4 0 25 1 N "
-chrM 12997 C C 25 0 25 1 . I
-chrM 12998 G G 25 0 25 1 . I
-chrM 12999 C C 25 0 25 1 . I
-chrM 13000 C C 25 0 25 1 . I
-chrM 13001 T T 25 0 25 1 . I
-chrM 13002 G G 25 0 25 1 . I
-chrM 13003 A A 24 0 25 1 . 9
-chrM 13004 G G 25 0 25 1 . I
-chrM 13005 C C 25 0 25 1 . I
-chrM 13006 C C 25 0 25 1 . I
-chrM 13007 C C 25 0 25 1 . I
-chrM 13008 T T 25 0 25 1 . I
-chrM 13009 A A 25 0 25 1 . I
-chrM 13010 C C 25 0 25 1 . E
-chrM 13011 T T 25 0 25 1 . I
-chrM 13012 A A 7 0 25 1 . (
-chrM 13013 A A 25 0 25 1 . I
-chrM 13014 T T 25 0 25 1 . I
-chrM 13015 A A 24 0 25 1 . 9
-chrM 13016 A A 13 0 25 1 . .
-chrM 13017 C C 25 0 25 1 . I
-chrM 13018 T T 19 0 25 1 . 4
-chrM 13019 C C 25 0 25 1 . I
-chrM 13020 T T 25 0 25 1 . I
-chrM 13021 C C 25 0 25 1 . I
-chrM 13022 A A 11 0 25 1 . ,
-chrM 13023 T T 25 0 25 1 .$ I
-chrM 13560 T T 25 0 25 1 ^:, I
-chrM 13561 C C 25 0 25 1 , I
-chrM 13562 A A 25 0 25 1 , I
-chrM 13563 C C 25 0 25 1 , I
-chrM 13564 C C 25 0 25 1 , I
-chrM 13565 C C 25 0 25 1 , I
-chrM 13566 T T 25 0 25 1 , I
-chrM 13567 T T 25 0 25 1 , I
-chrM 13568 A A 25 0 25 1 , I
-chrM 13569 C C 25 0 25 1 , I
-chrM 13570 C C 25 0 25 1 , I
-chrM 13571 C C 25 0 25 1 , I
-chrM 13572 T T 25 0 25 1 , I
-chrM 13573 A A 25 0 25 1 , I
-chrM 13574 A A 25 0 25 1 , I
-chrM 13575 G G 25 0 25 1 , I
-chrM 13576 C C 25 0 25 1 , I
-chrM 13577 A A 25 0 25 1 , I
-chrM 13578 T T 25 0 25 1 , I
-chrM 13579 A A 25 0 25 1 , I
-chrM 13580 C C 25 0 25 1 , I
-chrM 13581 T T 25 0 25 1 , I
-chrM 13582 A A 25 0 25 1 , I
-chrM 13583 C C 25 0 25 1 , I
-chrM 13584 T T 25 0 25 1 , I
-chrM 13585 T T 25 0 25 1 , I
-chrM 13586 T T 25 0 25 1 , I
-chrM 13587 T A 4 4 25 1 n "
-chrM 13588 T A 4 4 25 1 n "
-chrM 13589 A A 25 0 25 1 , I
-chrM 13590 A A 25 0 25 1 , I
-chrM 13591 T T 25 0 25 1 , I
-chrM 13592 C C 25 0 25 1 , I
-chrM 13593 T T 25 0 25 1 , I
-chrM 13594 C C 25 0 25 1 , I
-chrM 13595 C C 25 0 25 1 ,$ I
-chrM 13783 T T 25 0 25 1 ^:. I
-chrM 13784 C C 25 0 25 1 . I
-chrM 13785 A A 25 0 25 1 . I
-chrM 13786 C C 25 0 25 1 . I
-chrM 13787 T T 25 0 25 1 . I
-chrM 13788 C C 25 0 25 1 . I
-chrM 13789 T T 25 0 25 1 . I
-chrM 13790 T A 4 4 25 1 N "
-chrM 13791 C A 4 4 25 1 N "
-chrM 13792 A A 25 0 25 1 . I
-chrM 13793 G G 25 0 25 1 . I
-chrM 13794 A A 25 0 25 1 . I
-chrM 13795 A A 25 0 25 1 . I
-chrM 13796 C C 25 0 25 1 . I
-chrM 13797 A A 25 0 25 1 . I
-chrM 13798 T T 25 0 25 1 . I
-chrM 13799 A A 25 0 25 1 . I
-chrM 13800 T T 25 0 25 1 . I
-chrM 13801 A A 25 0 25 1 . I
-chrM 13802 A A 25 0 25 1 . I
-chrM 13803 A A 25 0 25 1 . I
-chrM 13804 A A 25 0 25 1 . I
-chrM 13805 C C 25 0 25 1 . I
-chrM 13806 C C 25 0 25 1 . I
-chrM 13807 A A 25 0 25 1 . I
-chrM 13808 A A 25 0 25 1 . I
-chrM 13809 C C 25 0 25 1 . I
-chrM 13810 A A 25 0 25 1 . ?
-chrM 13811 T T 25 0 25 1 . I
-chrM 13812 A A 25 0 25 1 . C
-chrM 13813 A A 25 0 25 1 . C
-chrM 13814 C C 25 0 25 1 . I
-chrM 13815 C C 25 0 25 1 . I
-chrM 13816 T T 25 0 25 1 . I
-chrM 13817 C C 25 0 25 1 . I
-chrM 13818 C C 25 0 25 1 .$ I
-chrM 13855 G G 25 0 25 1 ^:, I
-chrM 13856 T T 25 0 25 1 , I
-chrM 13857 A A 25 0 25 1 , I
-chrM 13858 T T 25 0 25 1 , I
-chrM 13859 T T 25 0 25 1 , I
-chrM 13860 A A 25 0 25 1 , I
-chrM 13861 G G 25 0 25 1 , I
-chrM 13862 A A 25 0 25 1 , I
-chrM 13863 C C 25 0 25 1 , I
-chrM 13864 A A 25 0 25 1 , I
-chrM 13865 C C 25 0 25 1 , I
-chrM 13866 C C 25 0 25 1 , I
-chrM 13867 C C 25 0 25 1 , I
-chrM 13868 A A 25 0 25 1 , I
-chrM 13869 T T 25 0 25 1 , I
-chrM 13870 A A 25 0 25 1 , I
-chrM 13871 C C 25 0 25 1 , I
-chrM 13872 C C 25 0 25 1 , I
-chrM 13873 T T 25 0 25 1 , I
-chrM 13874 C C 25 0 25 1 , I
-chrM 13875 A A 25 0 25 1 , I
-chrM 13876 G G 25 0 25 1 , I
-chrM 13877 G G 25 0 25 1 , I
-chrM 13878 A A 25 0 25 1 , I
-chrM 13879 T T 25 0 25 1 , I
-chrM 13880 A A 25 0 25 1 , I
-chrM 13881 C C 25 0 25 1 , I
-chrM 13882 T A 4 4 25 1 n "
-chrM 13883 G A 4 4 25 1 n "
-chrM 13884 C C 25 0 25 1 , I
-chrM 13885 T T 25 0 25 1 , I
-chrM 13886 C C 25 0 25 1 , I
-chrM 13887 A A 25 0 25 1 , I
-chrM 13888 G G 25 0 25 1 , I
-chrM 13889 T T 25 0 25 1 , I
-chrM 13890 A A 25 0 25 1 ,$ I
-chrM 14023 A A 25 0 25 1 ^:, I
-chrM 14024 A A 25 0 25 1 , I
-chrM 14025 A A 25 0 25 1 , I
-chrM 14026 C C 14 0 25 1 , /
-chrM 14027 C C 25 0 25 1 , :
-chrM 14028 C C 5 0 25 1 , &
-chrM 14029 C C 25 0 25 1 , G
-chrM 14030 C C 25 0 25 1 , I
-chrM 14031 A A 25 0 25 1 , I
-chrM 14032 T T 18 0 25 1 , 3
-chrM 14033 A A 25 0 25 1 , I
-chrM 14034 A A 25 0 25 1 , I
-chrM 14035 A A 33 0 25 2 ,^:, II
+chrM 10926 A A 33 0 25 2 ,$, EI
+chrM 10927 C C 30 0 25 1 , I
+chrM 10928 G G 30 0 25 1 , I
+chrM 10929 G N 0 0 0 1 n "
+chrM 10930 A N 0 0 0 1 n "
+chrM 10931 A A 30 0 25 1 , I
+chrM 10932 T T 30 0 25 1 , I
+chrM 10933 A A 30 0 25 1 , I
+chrM 10934 C C 30 0 25 1 , I
+chrM 10935 T T 30 0 25 1 , I
+chrM 10936 A A 30 0 25 1 , I
+chrM 10937 C C 30 0 25 1 ,$ 7
+chrM 10991 A A 30 0 25 1 ^:. E
+chrM 10992 T T 30 0 25 1 . I
+chrM 10993 A A 30 0 25 1 . I
+chrM 10994 C C 30 0 25 1 . I
+chrM 10995 T T 30 0 25 1 . I
+chrM 10996 A A 30 0 25 1 . I
+chrM 10997 T T 30 0 25 1 . I
+chrM 10998 C N 0 0 0 1 N "
+chrM 10999 C N 0 0 0 1 N "
+chrM 11000 C C 30 0 25 1 . I
+chrM 11001 T T 30 0 25 1 . I
+chrM 11002 G G 30 0 25 1 . I
+chrM 11003 T T 30 0 25 1 . I
+chrM 11004 G G 30 0 25 1 . I
+chrM 11005 A A 30 0 25 1 . 2
+chrM 11006 G G 30 0 25 1 . I
+chrM 11007 G G 30 0 25 1 . I
+chrM 11008 A A 30 0 25 1 . I
+chrM 11009 A A 30 0 25 1 . I
+chrM 11010 T T 30 0 25 1 . I
+chrM 11011 A A 30 0 25 1 . I
+chrM 11012 A A 30 0 25 1 . I
+chrM 11013 T T 30 0 25 1 . I
+chrM 11014 C C 30 0 25 1 . I
+chrM 11015 A A 30 0 25 1 . I
+chrM 11016 T T 30 0 25 1 . I
+chrM 11017 A A 30 0 25 1 . F
+chrM 11018 A A 30 0 25 1 . I
+chrM 11019 C C 30 0 25 1 . I
+chrM 11020 T T 30 0 25 1 . I
+chrM 11021 A A 30 0 25 1 . :
+chrM 11022 G G 30 0 25 1 . I
+chrM 11023 T T 30 0 25 1 . I
+chrM 11024 T T 30 0 25 1 . I
+chrM 11025 C C 30 0 25 1 . E
+chrM 11026 C C 30 0 25 1 .$ B
+chrM 11036 C C 30 0 25 1 ^:, E
+chrM 11037 G G 30 0 25 1 , I
+chrM 11038 A A 30 0 25 1 , I
+chrM 11039 C C 30 0 25 1 , I
+chrM 11040 A A 30 0 25 1 , I
+chrM 11041 A A 30 0 25 1 , I
+chrM 11042 A A 30 0 25 1 , I
+chrM 11043 C C 30 0 25 1 , I
+chrM 11044 C C 30 0 25 1 , I
+chrM 11045 G G 30 0 25 1 , I
+chrM 11046 A A 30 0 25 1 , I
+chrM 11047 T T 30 0 25 1 , I
+chrM 11048 C C 30 0 25 1 , I
+chrM 11049 T T 30 0 25 1 , I
+chrM 11050 A A 30 0 25 1 , I
+chrM 11051 A A 30 0 25 1 , I
+chrM 11052 A A 30 0 25 1 , I
+chrM 11053 A A 30 0 25 1 , I
+chrM 11054 T T 30 0 25 1 , I
+chrM 11055 C C 30 0 25 1 , I
+chrM 11056 A A 30 0 25 1 , I
+chrM 11057 C C 30 0 25 1 , I
+chrM 11058 T T 30 0 25 1 , I
+chrM 11059 T T 30 0 25 1 , I
+chrM 11060 A A 30 0 25 1 , I
+chrM 11061 T T 30 0 25 1 , I
+chrM 11062 T T 30 0 25 1 , I
+chrM 11063 G N 0 0 0 1 n "
+chrM 11064 C N 0 0 0 1 n "
+chrM 11065 A A 30 0 25 1 , I
+chrM 11066 T T 30 0 25 1 , I
+chrM 11067 A A 30 0 25 1 , I
+chrM 11068 C C 30 0 25 1 , I
+chrM 11069 T T 30 0 25 1 , I
+chrM 11070 C C 30 0 25 1 , E
+chrM 11071 C C 30 0 25 1 ,$ A
+chrM 11086 A A 30 0 25 1 ^:, E
+chrM 11087 G G 30 0 25 1 , 1
+chrM 11088 C N 0 0 0 1 , '
+chrM 11089 C C 30 0 25 1 , =
+chrM 11090 C C 30 0 25 1 , D
+chrM 11091 T T 30 0 25 1 , 0
+chrM 11092 A A 30 0 25 1 , I
+chrM 11093 G G 30 0 25 1 , @
+chrM 11094 T T 30 0 25 1 , 4
+chrM 11095 A A 30 0 25 1 , I
+chrM 11096 A A 30 0 25 1 , I
+chrM 11097 T T 30 0 25 1 , A
+chrM 11098 C C 30 0 25 1 , I
+chrM 11099 G G 30 0 25 1 , I
+chrM 11100 T T 30 0 25 1 , D
+chrM 11101 A A 30 0 25 1 , I
+chrM 11102 G G 30 0 25 1 , I
+chrM 11103 C C 30 0 25 1 , I
+chrM 11104 C C 30 0 25 1 , I
+chrM 11105 G G 30 0 25 1 , I
+chrM 11106 T T 30 0 25 1 , I
+chrM 11107 C C 30 0 25 1 , I
+chrM 11108 C C 30 0 25 1 , I
+chrM 11109 T T 30 0 25 1 , I
+chrM 11110 C C 30 0 25 1 , I
+chrM 11111 A A 30 0 25 1 , I
+chrM 11112 T T 30 0 25 1 , I
+chrM 11113 C N 0 0 0 1 n "
+chrM 11114 C N 0 0 0 1 n "
+chrM 11115 A A 30 0 25 1 , I
+chrM 11116 A A 30 0 25 1 , I
+chrM 11117 A A 30 0 25 1 , I
+chrM 11118 C C 30 0 25 1 , I
+chrM 11119 A A 30 0 25 1 , I
+chrM 11120 C C 30 0 25 1 , E
+chrM 11121 C C 30 0 25 1 ,$ B
+chrM 11375 A A 30 0 25 1 ^:. D
+chrM 11376 T T 30 0 25 1 . I
+chrM 11377 T T 30 0 25 1 . I
+chrM 11378 A A 30 0 25 1 . I
+chrM 11379 C C 30 0 25 1 . I
+chrM 11380 C C 30 0 25 1 . I
+chrM 11381 A A 30 0 25 1 . I
+chrM 11382 T N 0 0 0 1 N "
+chrM 11383 T N 0 0 0 1 N "
+chrM 11384 A A 30 0 25 1 . I
+chrM 11385 T T 30 0 25 1 . I
+chrM 11386 C C 30 0 25 1 . I
+chrM 11387 C C 30 0 25 1 . I
+chrM 11388 T T 30 0 25 1 . I
+chrM 11389 A A 30 0 25 1 . I
+chrM 11390 A A 30 0 25 1 . I
+chrM 11391 T T 30 0 25 1 . I
+chrM 11392 A A 30 0 25 1 . G
+chrM 11393 G G 30 0 25 1 . I
+chrM 11394 G G 30 0 25 1 . I
+chrM 11395 A A 30 0 25 1 . I
+chrM 11396 G G 30 0 25 1 . I
+chrM 11397 C C 30 0 25 1 . I
+chrM 11398 C C 30 0 25 1 . I
+chrM 11399 A A 30 0 25 1 . I
+chrM 11400 A A 30 0 25 1 . I
+chrM 11401 T T 30 0 25 1 . I
+chrM 11402 A A 30 0 25 1 . I
+chrM 11403 T T 30 0 25 1 . I
+chrM 11404 C C 30 0 25 1 . I
+chrM 11405 A A 30 0 25 1 . @
+chrM 11406 C C 30 0 25 1 . I
+chrM 11407 C C 30 0 25 1 . I
+chrM 11408 A A 30 0 25 1 . 4
+chrM 11409 T T 30 0 25 1 . I
+chrM 11410 C C 30 0 25 1 .$ C
+chrM 11457 A A 30 0 25 1 ^:. >
+chrM 11458 A A 30 0 25 1 . >
+chrM 11459 T T 30 0 25 1 . I
+chrM 11460 A A 30 0 25 1 . I
+chrM 11461 C C 30 0 25 1 . I
+chrM 11462 A A 30 0 25 1 . I
+chrM 11463 C C 30 0 25 1 . I
+chrM 11464 A N 0 0 0 1 N "
+chrM 11465 C N 0 0 0 1 N "
+chrM 11466 A A 30 0 25 1 . I
+chrM 11467 C C 30 0 25 1 . I
+chrM 11468 C C 30 0 25 1 . I
+chrM 11469 A A 30 0 25 1 . I
+chrM 11470 T T 30 0 25 1 . I
+chrM 11471 A A 30 0 25 1 . I
+chrM 11472 T T 30 0 25 1 . I
+chrM 11473 C C 30 0 25 1 . I
+chrM 11474 A A 30 0 25 1 . I
+chrM 11475 A A 30 0 25 1 . I
+chrM 11476 C C 30 0 25 1 . I
+chrM 11477 A A 30 0 25 1 . I
+chrM 11478 G G 30 0 25 1 . I
+chrM 11479 C C 30 0 25 1 . I
+chrM 11480 A A 30 0 25 1 . I
+chrM 11481 T T 30 0 25 1 . I
+chrM 11482 T T 30 0 25 1 . I
+chrM 11483 A A 30 0 25 1 . I
+chrM 11484 A A 30 0 25 1 . I
+chrM 11485 A A 30 0 25 1 . I
+chrM 11486 C C 30 0 25 1 . I
+chrM 11487 C C 30 0 25 1 . I
+chrM 11488 T T 30 0 25 1 . I
+chrM 11489 T T 30 0 25 1 . I
+chrM 11490 C C 30 0 25 1 . I
+chrM 11491 A A 30 0 25 1 . @
+chrM 11492 T T 30 0 25 1 .$ >
+chrM 11616 G G 30 0 25 1 ^:, E
+chrM 11617 A A 30 0 25 1 , I
+chrM 11618 T T 30 0 25 1 , 9
+chrM 11619 C C 30 0 25 1 , I
+chrM 11620 T T 30 0 25 1 , I
+chrM 11621 A A 30 0 25 1 , I
+chrM 11622 G G 30 0 25 1 , I
+chrM 11623 A A 30 0 25 1 , I
+chrM 11624 A A 30 0 25 1 , I
+chrM 11625 A A 30 0 25 1 , I
+chrM 11626 C C 30 0 25 1 , I
+chrM 11627 A A 30 0 25 1 , I
+chrM 11628 G G 30 0 25 1 , I
+chrM 11629 A A 30 0 25 1 , I
+chrM 11630 A A 30 0 25 1 , I
+chrM 11631 A A 30 0 25 1 , I
+chrM 11632 C C 30 0 25 1 , I
+chrM 11633 T T 30 0 25 1 , I
+chrM 11634 T T 30 0 25 1 , I
+chrM 11635 A A 30 0 25 1 , I
+chrM 11636 A A 30 0 25 1 , I
+chrM 11637 T T 30 0 25 1 , I
+chrM 11638 A A 30 0 25 1 , I
+chrM 11639 T T 30 0 25 1 , I
+chrM 11640 T T 30 0 25 1 , I
+chrM 11641 T T 30 0 25 1 , I
+chrM 11642 C C 30 0 25 1 , I
+chrM 11643 T N 0 0 0 1 n "
+chrM 11644 T N 0 0 0 1 n "
+chrM 11645 A A 30 0 25 1 , I
+chrM 11646 T T 30 0 25 1 , I
+chrM 11647 T T 30 0 25 1 , I
+chrM 11648 T T 30 0 25 1 , I
+chrM 11649 A A 30 0 25 1 , I
+chrM 11650 C C 30 0 25 1 , E
+chrM 11651 C C 30 0 25 1 ,$ B
+chrM 11721 A A 30 0 25 1 ^:. E
+chrM 11722 G G 30 0 25 1 . I
+chrM 11723 G G 30 0 25 1 . I
+chrM 11724 A A 30 0 25 1 . I
+chrM 11725 T T 30 0 25 1 . I
+chrM 11726 A A 30 0 25 1 . I
+chrM 11727 G G 30 0 25 1 . I
+chrM 11728 G N 0 0 0 1 N "
+chrM 11729 A N 0 0 0 1 N "
+chrM 11730 G G 30 0 25 1 . I
+chrM 11731 C C 30 0 25 1 . I
+chrM 11732 T T 30 0 25 1 . I
+chrM 11733 A A 30 0 25 1 . I
+chrM 11734 T T 30 0 25 1 . I
+chrM 11735 C C 30 0 25 1 . I
+chrM 11736 C C 30 0 25 1 . I
+chrM 11737 G G 30 0 25 1 . I
+chrM 11738 T T 30 0 25 1 . I
+chrM 11739 T T 30 0 25 1 . I
+chrM 11740 G G 30 0 25 1 . I
+chrM 11741 G G 30 0 25 1 . I
+chrM 11742 T T 30 0 25 1 . I
+chrM 11743 C C 30 0 25 1 . I
+chrM 11744 T T 30 0 25 1 . I
+chrM 11745 T T 30 0 25 1 . I
+chrM 11746 A A 30 0 25 1 . I
+chrM 11747 G G 30 0 25 1 . I
+chrM 11748 G G 30 0 25 1 . I
+chrM 11749 A A 30 0 25 1 . F
+chrM 11750 A A 30 0 25 1 . I
+chrM 11751 C C 30 0 25 1 . I
+chrM 11752 C C 30 0 25 1 . I
+chrM 11753 A A 30 0 25 1 . >
+chrM 11754 A A 30 0 25 1 . :
+chrM 11755 A A 30 0 25 1 . 6
+chrM 11756 A A 30 0 25 1 .$ 8
+chrM 12013 C C 30 0 25 1 ^:, >
+chrM 12014 C C 30 0 25 1 , >
+chrM 12015 T T 30 0 25 1 , I
+chrM 12016 A A 30 0 25 1 , I
+chrM 12017 A A 30 0 25 1 , I
+chrM 12018 G G 30 0 25 1 , I
+chrM 12019 C C 30 0 25 1 , I
+chrM 12020 T T 30 0 25 1 , I
+chrM 12021 T T 30 0 25 1 , F
+chrM 12022 C C 30 0 25 1 , I
+chrM 12023 A A 30 0 25 1 , I
+chrM 12024 A A 30 0 25 1 , I
+chrM 12025 A A 30 0 25 1 , I
+chrM 12026 C C 30 0 25 1 , I
+chrM 12027 T T 30 0 25 1 , I
+chrM 12028 A A 30 0 25 1 , I
+chrM 12029 G G 30 0 25 1 , I
+chrM 12030 A A 30 0 25 1 , I
+chrM 12031 T T 30 0 25 1 , I
+chrM 12032 T T 30 0 25 1 , I
+chrM 12033 A A 30 0 25 1 , I
+chrM 12034 C C 30 0 25 1 , I
+chrM 12035 T T 30 0 25 1 , I
+chrM 12036 T T 30 0 25 1 , I
+chrM 12037 C C 30 0 25 1 , I
+chrM 12038 T T 30 0 25 1 , I
+chrM 12039 C C 30 0 25 1 , I
+chrM 12040 A N 0 0 0 1 n "
+chrM 12041 A N 0 0 0 1 n "
+chrM 12042 T T 30 0 25 1 , I
+chrM 12043 A A 30 0 25 1 , I
+chrM 12044 A A 30 0 25 1 , I
+chrM 12045 T T 30 0 25 1 , E
+chrM 12046 T T 30 0 25 1 , B
+chrM 12047 T T 30 0 25 1 , A
+chrM 12048 T T 30 0 25 1 ,$ ?
+chrM 12295 A A 30 0 25 1 ^:. B
+chrM 12296 A A 30 0 25 1 . E
+chrM 12297 T T 30 0 25 1 . I
+chrM 12298 C C 30 0 25 1 . I
+chrM 12299 C C 30 0 25 1 . I
+chrM 12300 T T 30 0 25 1 . I
+chrM 12301 T T 30 0 25 1 . I
+chrM 12302 T N 0 0 0 1 N "
+chrM 12303 A N 0 0 0 1 N "
+chrM 12304 T T 30 0 25 1 . I
+chrM 12305 A A 30 0 25 1 . I
+chrM 12306 A A 30 0 25 1 . I
+chrM 12307 C C 30 0 25 1 . I
+chrM 12308 C C 30 0 25 1 . I
+chrM 12309 G G 30 0 25 1 . I
+chrM 12310 C C 30 0 25 1 . I
+chrM 12311 A A 30 0 25 1 . I
+chrM 12312 T T 30 0 25 1 . I
+chrM 12313 C C 30 0 25 1 . I
+chrM 12314 G G 30 0 25 1 . I
+chrM 12315 G G 30 0 25 1 . I
+chrM 12316 G G 30 0 25 1 . I
+chrM 12317 G G 30 0 25 1 . I
+chrM 12318 A A 30 0 25 1 . I
+chrM 12319 T T 30 0 25 1 . I
+chrM 12320 A A 30 0 25 1 . I
+chrM 12321 T T 30 0 25 1 . I
+chrM 12322 C C 30 0 25 1 . I
+chrM 12323 G G 30 0 25 1 . I
+chrM 12324 G G 30 0 25 1 . I
+chrM 12325 C C 30 0 25 1 . I
+chrM 12326 T T 30 0 25 1 . I
+chrM 12327 T T 30 0 25 1 . I
+chrM 12328 C C 30 0 25 1 . :
+chrM 12329 A N 0 0 0 1 . (
+chrM 12330 T T 30 0 25 1 .$ D
+chrM 12387 T T 30 0 25 1 ^:, E
+chrM 12388 C C 30 0 25 1 , I
+chrM 12389 A A 30 0 25 1 , I
+chrM 12390 T T 30 0 25 1 , H
+chrM 12391 A A 30 0 25 1 , I
+chrM 12392 C C 30 0 25 1 , I
+chrM 12393 T T 30 0 25 1 , ;
+chrM 12394 C C 30 0 25 1 , I
+chrM 12395 G G 30 0 25 1 , I
+chrM 12396 A A 30 0 25 1 , I
+chrM 12397 C C 30 0 25 1 , I
+chrM 12398 C C 30 0 25 1 , I
+chrM 12399 C C 30 0 25 1 , I
+chrM 12400 C C 30 0 25 1 , I
+chrM 12401 A A 30 0 25 1 , I
+chrM 12402 A A 30 0 25 1 , I
+chrM 12403 C C 30 0 25 1 , I
+chrM 12404 C C 30 0 25 1 , I
+chrM 12405 T T 30 0 25 1 , I
+chrM 12406 T T 30 0 25 1 , I
+chrM 12407 A A 30 0 25 1 , I
+chrM 12408 C C 30 0 25 1 , I
+chrM 12409 C C 30 0 25 1 , I
+chrM 12410 A A 30 0 25 1 , I
+chrM 12411 A A 30 0 25 1 , I
+chrM 12412 C C 30 0 25 1 , I
+chrM 12413 C C 30 0 25 1 , I
+chrM 12414 T N 0 0 0 1 n "
+chrM 12415 C N 0 0 0 1 n "
+chrM 12416 C C 30 0 25 1 , I
+chrM 12417 C C 30 0 25 1 , I
+chrM 12418 G G 30 0 25 1 , I
+chrM 12419 C C 30 0 25 1 , I
+chrM 12420 T T 30 0 25 1 , I
+chrM 12421 C C 30 0 25 1 , E
+chrM 12422 C C 30 0 25 1 ,$ B
+chrM 12584 G G 30 0 25 1 ^:. E
+chrM 12585 A A 30 0 25 1 . I
+chrM 12586 A A 30 0 25 1 . I
+chrM 12587 A A 30 0 25 1 . I
+chrM 12588 A A 30 0 25 1 . I
+chrM 12589 C C 30 0 25 1 . I
+chrM 12590 A A 30 0 25 1 . I
+chrM 12591 A N 0 0 0 1 N "
+chrM 12592 C N 0 0 0 1 N "
+chrM 12593 A A 30 0 25 1 . I
+chrM 12594 A A 30 0 25 1 . I
+chrM 12595 A A 30 0 25 1 . I
+chrM 12596 A A 30 0 25 1 . I
+chrM 12597 C C 30 0 25 1 . I
+chrM 12598 A A 30 0 25 1 . I
+chrM 12599 A A 30 0 25 1 . I
+chrM 12600 T T 30 0 25 1 . I
+chrM 12601 C C 30 0 25 1 . I
+chrM 12602 C C 30 0 25 1 . I
+chrM 12603 A A 30 0 25 1 . I
+chrM 12604 G G 30 0 25 1 . I
+chrM 12605 T T 30 0 25 1 . I
+chrM 12606 C C 30 0 25 1 . I
+chrM 12607 A A 30 0 25 1 . I
+chrM 12608 C C 30 0 25 1 . I
+chrM 12609 T T 30 0 25 1 . I
+chrM 12610 T T 30 0 25 1 . I
+chrM 12611 A A 30 0 25 1 . I
+chrM 12612 C C 30 0 25 1 . I
+chrM 12613 C C 30 0 25 1 . I
+chrM 12614 C C 30 0 25 1 . I
+chrM 12615 T T 30 0 25 1 . I
+chrM 12616 A A 30 0 25 1 . @
+chrM 12617 T T 30 0 25 1 . I
+chrM 12618 G G 30 0 25 1 . I
+chrM 12619 C C 30 0 25 1 .$ >
+chrM 12988 G G 30 0 25 1 ^:. E
+chrM 12989 T T 30 0 25 1 . I
+chrM 12990 A A 30 0 25 1 . I
+chrM 12991 C C 30 0 25 1 . I
+chrM 12992 A A 30 0 25 1 . I
+chrM 12993 C C 30 0 25 1 . I
+chrM 12994 C C 30 0 25 1 . I
+chrM 12995 A N 0 0 0 1 N "
+chrM 12996 A N 0 0 0 1 N "
+chrM 12997 C C 30 0 25 1 . I
+chrM 12998 G G 30 0 25 1 . I
+chrM 12999 C C 30 0 25 1 . I
+chrM 13000 C C 30 0 25 1 . I
+chrM 13001 T T 30 0 25 1 . I
+chrM 13002 G G 30 0 25 1 . I
+chrM 13003 A A 30 0 25 1 . 9
+chrM 13004 G G 30 0 25 1 . I
+chrM 13005 C C 30 0 25 1 . I
+chrM 13006 C C 30 0 25 1 . I
+chrM 13007 C C 30 0 25 1 . I
+chrM 13008 T T 30 0 25 1 . I
+chrM 13009 A A 30 0 25 1 . I
+chrM 13010 C C 30 0 25 1 . E
+chrM 13011 T T 30 0 25 1 . I
+chrM 13012 A N 0 0 0 1 . (
+chrM 13013 A A 30 0 25 1 . I
+chrM 13014 T T 30 0 25 1 . I
+chrM 13015 A A 30 0 25 1 . 9
+chrM 13016 A A 30 0 25 1 . .
+chrM 13017 C C 30 0 25 1 . I
+chrM 13018 T T 30 0 25 1 . 4
+chrM 13019 C C 30 0 25 1 . I
+chrM 13020 T T 30 0 25 1 . I
+chrM 13021 C C 30 0 25 1 . I
+chrM 13022 A N 0 0 0 1 . ,
+chrM 13023 T T 30 0 25 1 .$ >
+chrM 13560 T T 30 0 25 1 ^:, E
+chrM 13561 C C 30 0 25 1 , I
+chrM 13562 A A 30 0 25 1 , I
+chrM 13563 C C 30 0 25 1 , I
+chrM 13564 C C 30 0 25 1 , I
+chrM 13565 C C 30 0 25 1 , I
+chrM 13566 T T 30 0 25 1 , I
+chrM 13567 T T 30 0 25 1 , I
+chrM 13568 A A 30 0 25 1 , I
+chrM 13569 C C 30 0 25 1 , I
+chrM 13570 C C 30 0 25 1 , I
+chrM 13571 C C 30 0 25 1 , I
+chrM 13572 T T 30 0 25 1 , I
+chrM 13573 A A 30 0 25 1 , I
+chrM 13574 A A 30 0 25 1 , I
+chrM 13575 G G 30 0 25 1 , I
+chrM 13576 C C 30 0 25 1 , I
+chrM 13577 A A 30 0 25 1 , I
+chrM 13578 T T 30 0 25 1 , I
+chrM 13579 A A 30 0 25 1 , I
+chrM 13580 C C 30 0 25 1 , I
+chrM 13581 T T 30 0 25 1 , I
+chrM 13582 A A 30 0 25 1 , I
+chrM 13583 C C 30 0 25 1 , I
+chrM 13584 T T 30 0 25 1 , I
+chrM 13585 T T 30 0 25 1 , I
+chrM 13586 T T 30 0 25 1 , I
+chrM 13587 T N 0 0 0 1 n "
+chrM 13588 T N 0 0 0 1 n "
+chrM 13589 A A 30 0 25 1 , I
+chrM 13590 A A 30 0 25 1 , I
+chrM 13591 T T 30 0 25 1 , I
+chrM 13592 C C 30 0 25 1 , I
+chrM 13593 T T 30 0 25 1 , I
+chrM 13594 C C 30 0 25 1 , E
+chrM 13595 C C 30 0 25 1 ,$ A
+chrM 13783 T T 30 0 25 1 ^:. E
+chrM 13784 C C 30 0 25 1 . I
+chrM 13785 A A 30 0 25 1 . I
+chrM 13786 C C 30 0 25 1 . I
+chrM 13787 T T 30 0 25 1 . I
+chrM 13788 C C 30 0 25 1 . I
+chrM 13789 T T 30 0 25 1 . I
+chrM 13790 T N 0 0 0 1 N "
+chrM 13791 C N 0 0 0 1 N "
+chrM 13792 A A 30 0 25 1 . I
+chrM 13793 G G 30 0 25 1 . I
+chrM 13794 A A 30 0 25 1 . I
+chrM 13795 A A 30 0 25 1 . I
+chrM 13796 C C 30 0 25 1 . I
+chrM 13797 A A 30 0 25 1 . I
+chrM 13798 T T 30 0 25 1 . I
+chrM 13799 A A 30 0 25 1 . I
+chrM 13800 T T 30 0 25 1 . I
+chrM 13801 A A 30 0 25 1 . I
+chrM 13802 A A 30 0 25 1 . I
+chrM 13803 A A 30 0 25 1 . I
+chrM 13804 A A 30 0 25 1 . I
+chrM 13805 C C 30 0 25 1 . I
+chrM 13806 C C 30 0 25 1 . I
+chrM 13807 A A 30 0 25 1 . I
+chrM 13808 A A 30 0 25 1 . I
+chrM 13809 C C 30 0 25 1 . I
+chrM 13810 A A 30 0 25 1 . ?
+chrM 13811 T T 30 0 25 1 . I
+chrM 13812 A A 30 0 25 1 . C
+chrM 13813 A A 30 0 25 1 . C
+chrM 13814 C C 30 0 25 1 . I
+chrM 13815 C C 30 0 25 1 . I
+chrM 13816 T T 30 0 25 1 . I
+chrM 13817 C C 30 0 25 1 . E
+chrM 13818 C C 30 0 25 1 .$ B
+chrM 13855 G G 30 0 25 1 ^:, E
+chrM 13856 T T 30 0 25 1 , I
+chrM 13857 A A 30 0 25 1 , I
+chrM 13858 T T 30 0 25 1 , I
+chrM 13859 T T 30 0 25 1 , I
+chrM 13860 A A 30 0 25 1 , I
+chrM 13861 G G 30 0 25 1 , I
+chrM 13862 A A 30 0 25 1 , I
+chrM 13863 C C 30 0 25 1 , I
+chrM 13864 A A 30 0 25 1 , I
+chrM 13865 C C 30 0 25 1 , I
+chrM 13866 C C 30 0 25 1 , I
+chrM 13867 C C 30 0 25 1 , I
+chrM 13868 A A 30 0 25 1 , I
+chrM 13869 T T 30 0 25 1 , I
+chrM 13870 A A 30 0 25 1 , I
+chrM 13871 C C 30 0 25 1 , I
+chrM 13872 C C 30 0 25 1 , I
+chrM 13873 T T 30 0 25 1 , I
+chrM 13874 C C 30 0 25 1 , I
+chrM 13875 A A 30 0 25 1 , I
+chrM 13876 G G 30 0 25 1 , I
+chrM 13877 G G 30 0 25 1 , I
+chrM 13878 A A 30 0 25 1 , I
+chrM 13879 T T 30 0 25 1 , I
+chrM 13880 A A 30 0 25 1 , I
+chrM 13881 C C 30 0 25 1 , I
+chrM 13882 T N 0 0 0 1 n "
+chrM 13883 G N 0 0 0 1 n "
+chrM 13884 C C 30 0 25 1 , I
+chrM 13885 T T 30 0 25 1 , I
+chrM 13886 C C 30 0 25 1 , I
+chrM 13887 A A 30 0 25 1 , I
+chrM 13888 G G 30 0 25 1 , I
+chrM 13889 T T 30 0 25 1 , I
+chrM 13890 A A 30 0 25 1 ,$ E
+chrM 14023 A A 30 0 25 1 ^:, A
+chrM 14024 A A 30 0 25 1 , B
+chrM 14025 A A 30 0 25 1 , E
+chrM 14026 C C 30 0 25 1 , /
+chrM 14027 C C 30 0 25 1 , :
+chrM 14028 C N 0 0 0 1 , &
+chrM 14029 C C 30 0 25 1 , G
+chrM 14030 C C 30 0 25 1 , I
+chrM 14031 A A 30 0 25 1 , I
+chrM 14032 T T 30 0 25 1 , 3
+chrM 14033 A A 30 0 25 1 , I
+chrM 14034 A A 30 0 25 1 , I
+chrM 14035 A A 33 0 25 2 ,^:, IE
chrM 14036 T T 33 0 25 2 ,, ;;
chrM 14037 A A 33 0 25 2 ,, II
chrM 14038 G G 33 0 25 2 ,, II
@@ -2874,207 +2874,207 @@ chrM 14046 T T 33 0 25 2 ,, II
chrM 14047 T T 33 0 25 2 ,, II
chrM 14048 T T 33 0 25 2 ,, II
chrM 14049 T T 33 0 25 2 ,, II
-chrM 14050 G G 19 0 25 2 n, "I
-chrM 14051 A A 28 0 25 2 n, "I
+chrM 14050 G G 30 0 25 2 n, "I
+chrM 14051 A A 30 0 25 2 n, "I
chrM 14052 A A 33 0 25 2 ,, II
chrM 14053 G G 33 0 25 2 ,, II
chrM 14054 A A 33 0 25 2 ,, II
chrM 14055 A A 33 0 25 2 ,, II
chrM 14056 A A 33 0 25 2 ,, II
chrM 14057 A A 33 0 25 2 ,, II
-chrM 14058 C C 33 0 25 2 ,$, II
-chrM 14059 C C 25 0 25 1 , I
-chrM 14060 C C 25 0 25 1 , I
-chrM 14061 C C 25 0 25 1 , I
-chrM 14062 A A 28 0 25 2 n^:, "I
-chrM 14063 C C 4 0 25 2 n, "+
+chrM 14058 C C 33 0 25 2 ,$, >I
+chrM 14059 C C 30 0 25 1 , I
+chrM 14060 C C 30 0 25 1 , I
+chrM 14061 C C 30 0 25 1 , I
+chrM 14062 A A 30 0 25 2 n^:, "E
+chrM 14063 C N 0 0 0 2 n, "+
chrM 14064 A A 33 0 25 2 ,, II
chrM 14065 A A 33 0 25 2 ,, II
chrM 14066 A A 33 0 25 2 ,, II
chrM 14067 A A 33 0 25 2 ,, II
chrM 14068 C C 33 0 25 2 ,, I1
chrM 14069 T T 33 0 25 2 ,, II
-chrM 14070 A A 33 0 25 2 ,$, II
-chrM 14071 A A 25 0 25 1 , I
-chrM 14072 C C 25 0 25 1 , I
-chrM 14073 A A 25 0 25 1 , I
-chrM 14074 A A 25 0 25 1 , I
-chrM 14075 C C 25 0 25 1 , I
-chrM 14076 A A 25 0 25 1 , I
-chrM 14077 A A 25 0 25 1 , I
-chrM 14078 A A 25 0 25 1 , I
-chrM 14079 A A 25 0 25 1 , I
-chrM 14080 A A 25 0 25 1 , I
-chrM 14081 T T 25 0 25 1 , I
-chrM 14082 A A 25 0 25 1 , I
-chrM 14083 A A 25 0 25 1 , I
-chrM 14084 C C 25 0 25 1 , I
-chrM 14085 A A 25 0 25 1 , I
-chrM 14086 C C 25 0 25 1 , I
-chrM 14087 T T 25 0 25 1 , I
-chrM 14088 C C 25 0 25 1 , I
-chrM 14089 A A 4 0 25 1 n "
-chrM 14090 A A 4 0 25 1 n "
-chrM 14091 A A 25 0 25 1 , I
-chrM 14092 A A 25 0 25 1 , I
-chrM 14093 T T 25 0 25 1 , I
-chrM 14094 A A 25 0 25 1 , I
-chrM 14095 A A 25 0 25 1 , I
-chrM 14096 A A 25 0 25 1 , I
-chrM 14097 C C 25 0 25 1 ,$ I
-chrM 14239 T T 25 0 25 1 ^:, I
-chrM 14240 T T 25 0 25 1 , I
-chrM 14241 T T 25 0 25 1 , I
-chrM 14242 A A 25 0 25 1 , I
-chrM 14243 T T 25 0 25 1 , I
-chrM 14244 T T 25 0 25 1 , B
-chrM 14245 G G 25 0 25 1 , I
-chrM 14246 A A 25 0 25 1 , I
-chrM 14247 C C 25 0 25 1 , I
-chrM 14248 C C 25 0 25 1 , I
-chrM 14249 T T 25 0 25 1 , I
-chrM 14250 A A 25 0 25 1 , I
-chrM 14251 C C 25 0 25 1 , I
-chrM 14252 C C 25 0 25 1 , I
-chrM 14253 A A 25 0 25 1 , I
-chrM 14254 G G 25 0 25 1 , I
-chrM 14255 C C 25 0 25 1 , I
-chrM 14256 C C 25 0 25 1 , I
-chrM 14257 C C 25 0 25 1 , I
-chrM 14258 C C 25 0 25 1 , I
-chrM 14259 C C 25 0 25 1 , I
-chrM 14260 T T 25 0 25 1 , I
-chrM 14261 C C 25 0 25 1 , I
-chrM 14262 A A 25 0 25 1 , I
-chrM 14263 A A 25 0 25 1 , I
-chrM 14264 A A 25 0 25 1 , I
-chrM 14265 C C 25 0 25 1 , I
-chrM 14266 A A 4 0 25 1 n "
-chrM 14267 T A 4 4 25 1 n "
-chrM 14268 T T 25 0 25 1 , I
-chrM 14269 T T 25 0 25 1 , I
-chrM 14270 C C 25 0 25 1 , I
-chrM 14271 A A 25 0 25 1 , I
-chrM 14272 T T 25 0 25 1 , I
-chrM 14273 C C 25 0 25 1 , I
-chrM 14274 A A 25 0 25 1 ,$ I
-chrM 14463 C C 25 0 25 1 ^:, I
-chrM 14464 T T 25 0 25 1 , G
-chrM 14465 G G 25 0 25 1 , I
-chrM 14466 C C 25 0 25 1 , I
-chrM 14467 C C 25 0 25 1 , I
-chrM 14468 T T 25 0 25 1 , ;
-chrM 14469 C C 25 0 25 1 , I
-chrM 14470 T T 25 0 25 1 , I
-chrM 14471 T T 23 0 25 1 , 8
-chrM 14472 C C 25 0 25 1 , I
-chrM 14473 A A 25 0 25 1 , I
-chrM 14474 T T 25 0 25 1 , I
-chrM 14475 T T 25 0 25 1 , I
-chrM 14476 C C 25 0 25 1 , I
-chrM 14477 A A 25 0 25 1 , I
-chrM 14478 C C 25 0 25 1 , I
-chrM 14479 G G 25 0 25 1 , I
-chrM 14480 T T 25 0 25 1 , I
-chrM 14481 A A 25 0 25 1 , I
-chrM 14482 G G 25 0 25 1 , I
-chrM 14483 G G 25 0 25 1 , I
-chrM 14484 A A 25 0 25 1 , I
-chrM 14485 C C 25 0 25 1 , I
-chrM 14486 G G 25 0 25 1 , I
-chrM 14487 C C 25 0 25 1 , I
-chrM 14488 G G 25 0 25 1 , I
-chrM 14489 G G 25 0 25 1 , I
-chrM 14490 C A 4 4 25 1 n "
-chrM 14491 C A 4 4 25 1 n "
-chrM 14492 T T 25 0 25 1 , I
-chrM 14493 C C 25 0 25 1 , I
-chrM 14494 T T 25 0 25 1 , I
-chrM 14495 A A 25 0 25 1 , I
-chrM 14496 C C 25 0 25 1 , I
-chrM 14497 T T 25 0 25 1 , I
-chrM 14498 A A 25 0 25 1 ,$ I
-chrM 14866 A A 25 0 25 1 ^:, I
-chrM 14867 A A 21 0 25 1 , 6
-chrM 14868 A A 25 0 25 1 , I
-chrM 14869 G G 18 0 25 1 , 3
-chrM 14870 A A 11 0 25 1 , ,
-chrM 14871 C C 6 0 25 1 , '
-chrM 14872 A A 24 0 25 1 , 9
-chrM 14873 T T 19 0 25 1 , 4
-chrM 14874 C C 25 0 25 1 , I
-chrM 14875 C C 25 0 25 1 , I
-chrM 14876 T T 25 0 25 1 , A
-chrM 14877 A A 25 0 25 1 , I
-chrM 14878 G G 7 0 25 1 , (
-chrM 14879 G G 25 0 25 1 , I
-chrM 14880 A A 25 0 25 1 , A
-chrM 14881 C C 25 0 25 1 , I
-chrM 14882 T T 25 0 25 1 , G
-chrM 14883 C C 25 0 25 1 , I
-chrM 14884 C C 9 0 25 1 , *
-chrM 14885 T T 19 0 25 1 , 4
-chrM 14886 C C 25 0 25 1 , I
-chrM 14887 C C 25 0 25 1 , I
-chrM 14888 T T 25 0 25 1 , F
-chrM 14889 C C 25 0 25 1 , I
-chrM 14890 C C 25 0 25 1 , I
-chrM 14891 T T 25 0 25 1 , I
-chrM 14892 G G 25 0 25 1 , I
-chrM 14893 A A 4 0 25 1 n "
-chrM 14894 T A 4 4 25 1 n "
-chrM 14895 C C 25 0 25 1 , I
-chrM 14896 T T 25 0 25 1 , I
-chrM 14897 T T 25 0 25 1 , I
-chrM 14898 G G 25 0 25 1 , I
-chrM 14899 C C 25 0 25 1 , I
-chrM 14900 T T 25 0 25 1 , I
-chrM 14901 C C 25 0 25 1 ,$ I
-chrM 14956 A A 25 0 25 1 ^:. I
-chrM 14957 C C 25 0 25 1 . I
-chrM 14958 C C 25 0 25 1 . I
-chrM 14959 C C 25 0 25 1 . I
-chrM 14960 C C 25 0 25 1 . I
-chrM 14961 A A 25 0 25 1 . I
-chrM 14962 G G 25 0 25 1 . I
-chrM 14963 C A 4 4 25 1 N "
-chrM 14964 T A 4 4 25 1 N "
-chrM 14965 A A 25 0 25 1 . I
-chrM 14966 A A 25 0 25 1 . I
-chrM 14967 C C 25 0 25 1 . I
-chrM 14968 C C 25 0 25 1 . I
-chrM 14969 C C 25 0 25 1 . I
-chrM 14970 T T 25 0 25 1 . I
-chrM 14971 C C 25 0 25 1 . I
-chrM 14972 T T 25 0 25 1 . I
-chrM 14973 C C 25 0 25 1 . I
-chrM 14974 A A 25 0 25 1 . I
-chrM 14975 G G 25 0 25 1 . I
-chrM 14976 C C 25 0 25 1 . I
-chrM 14977 A A 21 0 25 1 . 6
-chrM 14978 C C 25 0 25 1 . I
-chrM 14979 T T 25 0 25 1 . I
-chrM 14980 C C 25 0 25 1 . I
-chrM 14981 C C 25 0 25 1 . I
-chrM 14982 C C 25 0 25 1 . I
-chrM 14983 C C 25 0 25 1 . I
-chrM 14984 C C 25 0 25 1 . I
-chrM 14985 T T 25 0 25 1 . I
-chrM 14986 C C 25 0 25 1 . I
-chrM 14987 A A 20 0 25 1 . 5
-chrM 14988 T T 25 0 25 1 . I
-chrM 14989 A A 12 0 25 1 . -
-chrM 14990 T T 25 0 25 1 . I
-chrM 14991 T T 25 0 25 1 .$ I
-chrM 15012 G G 25 0 25 1 ^:. I
-chrM 15013 T T 25 0 25 1 . I
-chrM 15014 T T 33 0 25 2 .^:, II
+chrM 14070 A A 33 0 25 2 ,$, >I
+chrM 14071 A A 30 0 25 1 , I
+chrM 14072 C C 30 0 25 1 , I
+chrM 14073 A A 30 0 25 1 , I
+chrM 14074 A A 30 0 25 1 , I
+chrM 14075 C C 30 0 25 1 , I
+chrM 14076 A A 30 0 25 1 , I
+chrM 14077 A A 30 0 25 1 , I
+chrM 14078 A A 30 0 25 1 , I
+chrM 14079 A A 30 0 25 1 , I
+chrM 14080 A A 30 0 25 1 , I
+chrM 14081 T T 30 0 25 1 , I
+chrM 14082 A A 30 0 25 1 , I
+chrM 14083 A A 30 0 25 1 , I
+chrM 14084 C C 30 0 25 1 , I
+chrM 14085 A A 30 0 25 1 , I
+chrM 14086 C C 30 0 25 1 , I
+chrM 14087 T T 30 0 25 1 , I
+chrM 14088 C C 30 0 25 1 , I
+chrM 14089 A N 0 0 0 1 n "
+chrM 14090 A N 0 0 0 1 n "
+chrM 14091 A A 30 0 25 1 , I
+chrM 14092 A A 30 0 25 1 , I
+chrM 14093 T T 30 0 25 1 , I
+chrM 14094 A A 30 0 25 1 , I
+chrM 14095 A A 30 0 25 1 , I
+chrM 14096 A A 30 0 25 1 , I
+chrM 14097 C C 30 0 25 1 ,$ C
+chrM 14239 T T 30 0 25 1 ^:, ;
+chrM 14240 T T 30 0 25 1 , ;
+chrM 14241 T T 30 0 25 1 , >
+chrM 14242 A A 30 0 25 1 , I
+chrM 14243 T T 30 0 25 1 , I
+chrM 14244 T T 30 0 25 1 , B
+chrM 14245 G G 30 0 25 1 , I
+chrM 14246 A A 30 0 25 1 , I
+chrM 14247 C C 30 0 25 1 , I
+chrM 14248 C C 30 0 25 1 , I
+chrM 14249 T T 30 0 25 1 , I
+chrM 14250 A A 30 0 25 1 , I
+chrM 14251 C C 30 0 25 1 , I
+chrM 14252 C C 30 0 25 1 , I
+chrM 14253 A A 30 0 25 1 , I
+chrM 14254 G G 30 0 25 1 , I
+chrM 14255 C C 30 0 25 1 , I
+chrM 14256 C C 30 0 25 1 , I
+chrM 14257 C C 30 0 25 1 , I
+chrM 14258 C C 30 0 25 1 , I
+chrM 14259 C C 30 0 25 1 , I
+chrM 14260 T T 30 0 25 1 , I
+chrM 14261 C C 30 0 25 1 , I
+chrM 14262 A A 30 0 25 1 , I
+chrM 14263 A A 30 0 25 1 , I
+chrM 14264 A A 30 0 25 1 , I
+chrM 14265 C C 30 0 25 1 , I
+chrM 14266 A N 0 0 0 1 n "
+chrM 14267 T N 0 0 0 1 n "
+chrM 14268 T T 30 0 25 1 , I
+chrM 14269 T T 30 0 25 1 , I
+chrM 14270 C C 30 0 25 1 , I
+chrM 14271 A A 30 0 25 1 , I
+chrM 14272 T T 30 0 25 1 , I
+chrM 14273 C C 30 0 25 1 , I
+chrM 14274 A A 30 0 25 1 ,$ E
+chrM 14463 C C 30 0 25 1 ^:, E
+chrM 14464 T T 30 0 25 1 , G
+chrM 14465 G G 30 0 25 1 , I
+chrM 14466 C C 30 0 25 1 , I
+chrM 14467 C C 30 0 25 1 , I
+chrM 14468 T T 30 0 25 1 , ;
+chrM 14469 C C 30 0 25 1 , I
+chrM 14470 T T 30 0 25 1 , I
+chrM 14471 T T 30 0 25 1 , 8
+chrM 14472 C C 30 0 25 1 , I
+chrM 14473 A A 30 0 25 1 , I
+chrM 14474 T T 30 0 25 1 , I
+chrM 14475 T T 30 0 25 1 , I
+chrM 14476 C C 30 0 25 1 , I
+chrM 14477 A A 30 0 25 1 , I
+chrM 14478 C C 30 0 25 1 , I
+chrM 14479 G G 30 0 25 1 , I
+chrM 14480 T T 30 0 25 1 , I
+chrM 14481 A A 30 0 25 1 , I
+chrM 14482 G G 30 0 25 1 , I
+chrM 14483 G G 30 0 25 1 , I
+chrM 14484 A A 30 0 25 1 , I
+chrM 14485 C C 30 0 25 1 , I
+chrM 14486 G G 30 0 25 1 , I
+chrM 14487 C C 30 0 25 1 , I
+chrM 14488 G G 30 0 25 1 , I
+chrM 14489 G G 30 0 25 1 , I
+chrM 14490 C N 0 0 0 1 n "
+chrM 14491 C N 0 0 0 1 n "
+chrM 14492 T T 30 0 25 1 , I
+chrM 14493 C C 30 0 25 1 , I
+chrM 14494 T T 30 0 25 1 , I
+chrM 14495 A A 30 0 25 1 , I
+chrM 14496 C C 30 0 25 1 , I
+chrM 14497 T T 30 0 25 1 , I
+chrM 14498 A A 30 0 25 1 ,$ E
+chrM 14866 A A 30 0 25 1 ^:, A
+chrM 14867 A A 30 0 25 1 , 6
+chrM 14868 A A 30 0 25 1 , E
+chrM 14869 G G 30 0 25 1 , 3
+chrM 14870 A N 0 0 0 1 , ,
+chrM 14871 C N 0 0 0 1 , '
+chrM 14872 A A 30 0 25 1 , 9
+chrM 14873 T T 30 0 25 1 , 4
+chrM 14874 C C 30 0 25 1 , I
+chrM 14875 C C 30 0 25 1 , I
+chrM 14876 T T 30 0 25 1 , A
+chrM 14877 A A 30 0 25 1 , I
+chrM 14878 G N 0 0 0 1 , (
+chrM 14879 G G 30 0 25 1 , I
+chrM 14880 A A 30 0 25 1 , A
+chrM 14881 C C 30 0 25 1 , I
+chrM 14882 T T 30 0 25 1 , G
+chrM 14883 C C 30 0 25 1 , I
+chrM 14884 C N 0 0 0 1 , *
+chrM 14885 T T 30 0 25 1 , 4
+chrM 14886 C C 30 0 25 1 , I
+chrM 14887 C C 30 0 25 1 , I
+chrM 14888 T T 30 0 25 1 , F
+chrM 14889 C C 30 0 25 1 , I
+chrM 14890 C C 30 0 25 1 , I
+chrM 14891 T T 30 0 25 1 , I
+chrM 14892 G G 30 0 25 1 , I
+chrM 14893 A N 0 0 0 1 n "
+chrM 14894 T N 0 0 0 1 n "
+chrM 14895 C C 30 0 25 1 , I
+chrM 14896 T T 30 0 25 1 , I
+chrM 14897 T T 30 0 25 1 , I
+chrM 14898 G G 30 0 25 1 , I
+chrM 14899 C C 30 0 25 1 , I
+chrM 14900 T T 30 0 25 1 , I
+chrM 14901 C C 30 0 25 1 ,$ >
+chrM 14956 A A 30 0 25 1 ^:. D
+chrM 14957 C C 30 0 25 1 . I
+chrM 14958 C C 30 0 25 1 . I
+chrM 14959 C C 30 0 25 1 . I
+chrM 14960 C C 30 0 25 1 . I
+chrM 14961 A A 30 0 25 1 . I
+chrM 14962 G G 30 0 25 1 . I
+chrM 14963 C N 0 0 0 1 N "
+chrM 14964 T N 0 0 0 1 N "
+chrM 14965 A A 30 0 25 1 . I
+chrM 14966 A A 30 0 25 1 . I
+chrM 14967 C C 30 0 25 1 . I
+chrM 14968 C C 30 0 25 1 . I
+chrM 14969 C C 30 0 25 1 . I
+chrM 14970 T T 30 0 25 1 . I
+chrM 14971 C C 30 0 25 1 . I
+chrM 14972 T T 30 0 25 1 . I
+chrM 14973 C C 30 0 25 1 . I
+chrM 14974 A A 30 0 25 1 . I
+chrM 14975 G G 30 0 25 1 . I
+chrM 14976 C C 30 0 25 1 . I
+chrM 14977 A A 30 0 25 1 . 6
+chrM 14978 C C 30 0 25 1 . I
+chrM 14979 T T 30 0 25 1 . I
+chrM 14980 C C 30 0 25 1 . I
+chrM 14981 C C 30 0 25 1 . I
+chrM 14982 C C 30 0 25 1 . I
+chrM 14983 C C 30 0 25 1 . I
+chrM 14984 C C 30 0 25 1 . I
+chrM 14985 T T 30 0 25 1 . I
+chrM 14986 C C 30 0 25 1 . I
+chrM 14987 A A 30 0 25 1 . 5
+chrM 14988 T T 30 0 25 1 . I
+chrM 14989 A N 0 0 0 1 . -
+chrM 14990 T T 30 0 25 1 . E
+chrM 14991 T T 30 0 25 1 .$ B
+chrM 15012 G G 30 0 25 1 ^:. E
+chrM 15013 T T 30 0 25 1 . I
+chrM 15014 T T 33 0 25 2 .^:, I>
chrM 15015 T T 33 0 25 2 ., I8
chrM 15016 G G 33 0 25 2 ., IA
chrM 15017 C C 33 0 25 2 ., II
chrM 15018 C C 33 0 25 2 ., II
-chrM 15019 T T 19 0 25 2 N, ":
-chrM 15020 A A 29 0 25 2 N, "I
+chrM 15019 T T 30 0 25 2 N, ":
+chrM 15020 A A 30 0 25 2 N, "I
chrM 15021 C C 33 0 25 2 ., II
chrM 15022 G G 33 0 25 2 ., II
chrM 15023 C C 33 0 25 2 ., II
@@ -3095,192 +3095,192 @@ chrM 15037 A A 33 0 25 2 ., 6I
chrM 15038 T T 33 0 25 2 ., II
chrM 15039 T T 33 0 25 2 ., II
chrM 15040 C C 33 0 25 2 ., II
-chrM 15041 C C 19 0 25 2 .n I"
-chrM 15042 C C 19 0 25 2 .n I"
+chrM 15041 C C 30 0 25 2 .n I"
+chrM 15042 C C 30 0 25 2 .n I"
chrM 15043 A A 33 0 25 2 ., 1I
chrM 15044 A A 33 0 25 2 ., CI
chrM 15045 C C 33 0 25 2 ., II
chrM 15046 A A 33 0 25 2 ., =I
chrM 15047 A A 33 0 25 2 .$, 3I
-chrM 15048 A A 25 0 25 1 , I
-chrM 15049 C C 25 0 25 1 ,$ I
-chrM 15080 T T 25 0 25 1 ^:, H
-chrM 15081 C C 25 0 25 1 , I
-chrM 15082 C C 25 0 25 1 , I
-chrM 15083 T T 25 0 25 1 , I
-chrM 15084 G G 25 0 25 1 , I
-chrM 15085 A A 25 0 25 1 , I
-chrM 15086 T T 25 0 25 1 , F
-chrM 15087 C C 25 0 25 1 , I
-chrM 15088 C C 25 0 25 1 , I
-chrM 15089 T T 25 0 25 1 , A
-chrM 15090 A A 25 0 25 1 , I
-chrM 15091 G G 25 0 25 1 , H
-chrM 15092 C C 25 0 25 1 , I
-chrM 15093 A A 25 0 25 1 , I
-chrM 15094 C C 25 0 25 1 , I
-chrM 15095 T T 25 0 25 1 , I
-chrM 15096 C C 25 0 25 1 , I
-chrM 15097 A A 25 0 25 1 , I
-chrM 15098 T T 25 0 25 1 , I
-chrM 15099 C C 25 0 25 1 , I
-chrM 15100 C C 25 0 25 1 , I
-chrM 15101 C C 25 0 25 1 , I
-chrM 15102 C C 25 0 25 1 , I
-chrM 15103 A A 25 0 25 1 , I
-chrM 15104 C C 25 0 25 1 , I
-chrM 15105 C C 25 0 25 1 , I
-chrM 15106 C C 25 0 25 1 , I
-chrM 15107 T A 4 4 25 1 n "
-chrM 15108 C A 4 4 25 1 n "
-chrM 15109 C C 25 0 25 1 , I
-chrM 15110 A A 25 0 25 1 , I
-chrM 15111 C C 25 0 25 1 , I
-chrM 15112 A A 25 0 25 1 , I
-chrM 15113 T T 25 0 25 1 , I
-chrM 15114 A A 25 0 25 1 , I
-chrM 15115 T T 25 0 25 1 ,$ I
-chrM 15275 T T 25 0 25 1 ^:. I
-chrM 15276 C C 25 0 25 1 . I
-chrM 15277 A A 25 0 25 1 . I
-chrM 15278 T T 25 0 25 1 . I
-chrM 15279 T T 25 0 25 1 . I
-chrM 15280 T T 25 0 25 1 . I
-chrM 15281 T T 25 0 25 1 . I
-chrM 15282 T A 4 4 25 1 N "
-chrM 15283 A A 4 0 25 1 N "
-chrM 15284 T T 25 0 25 1 . I
-chrM 15285 A A 25 0 25 1 . I
-chrM 15286 C C 25 0 25 1 . I
-chrM 15287 C C 25 0 25 1 . I
-chrM 15288 A A 25 0 25 1 . I
-chrM 15289 C C 25 0 25 1 . I
-chrM 15290 T T 25 0 25 1 . I
-chrM 15291 C C 25 0 25 1 . I
-chrM 15292 G G 25 0 25 1 . I
-chrM 15293 C C 25 0 25 1 . I
-chrM 15294 A A 25 0 25 1 . I
-chrM 15295 A A 25 0 25 1 . I
-chrM 15296 G G 25 0 25 1 . I
-chrM 15297 C C 25 0 25 1 . I
-chrM 15298 A A 25 0 25 1 . I
-chrM 15299 C C 25 0 25 1 . I
-chrM 15300 C C 25 0 25 1 . I
-chrM 15301 A A 25 0 25 1 . @
-chrM 15302 T T 25 0 25 1 . I
-chrM 15303 C C 25 0 25 1 . =
-chrM 15304 G G 25 0 25 1 . I
-chrM 15305 A A 22 0 25 1 . 7
-chrM 15306 A A 24 0 25 1 . 9
-chrM 15307 A A 25 0 25 1 . I
-chrM 15308 A A 21 0 25 1 . 6
-chrM 15309 C C 25 0 25 1 . I
-chrM 15310 A A 25 0 25 1 .$ I
-chrM 15338 T T 25 0 25 1 ^:, E
-chrM 15339 A A 25 0 25 1 , I
-chrM 15340 T T 25 0 25 1 , I
-chrM 15341 A A 25 0 25 1 , I
-chrM 15342 T T 25 0 25 1 , ?
-chrM 15343 C C 12 0 25 1 , -
-chrM 15344 G G 25 0 25 1 , I
-chrM 15345 C C 25 0 25 1 , I
-chrM 15346 A A 25 0 25 1 , I
-chrM 15347 C C 25 0 25 1 , I
-chrM 15348 A A 25 0 25 1 , I
-chrM 15349 T T 25 0 25 1 , A
-chrM 15350 T T 25 0 25 1 , I
-chrM 15351 A A 25 0 25 1 , I
-chrM 15352 C C 25 0 25 1 , I
-chrM 15353 C C 25 0 25 1 , I
-chrM 15354 C C 25 0 25 1 , I
-chrM 15355 T T 25 0 25 1 , I
-chrM 15356 G G 25 0 25 1 , I
-chrM 15357 G G 25 0 25 1 , I
-chrM 15358 T T 25 0 25 1 , I
-chrM 15359 C C 25 0 25 1 , I
-chrM 15360 T T 25 0 25 1 , I
-chrM 15361 T T 25 0 25 1 , I
-chrM 15362 G G 25 0 25 1 , I
-chrM 15363 T T 25 0 25 1 , I
-chrM 15364 A A 25 0 25 1 , I
-chrM 15365 A A 4 0 25 1 n "
-chrM 15366 A A 4 0 25 1 n "
-chrM 15367 C C 25 0 25 1 , I
-chrM 15368 C C 25 0 25 1 , I
-chrM 15369 A A 25 0 25 1 , I
-chrM 15370 G G 25 0 25 1 , I
-chrM 15371 A A 25 0 25 1 , I
-chrM 15372 A A 25 0 25 1 , I
-chrM 15373 A A 25 0 25 1 ,$ I
-chrM 15787 A A 25 0 25 1 ^:, I
-chrM 15788 T T 25 0 25 1 , =
-chrM 15789 C C 25 0 25 1 , I
-chrM 15790 C C 25 0 25 1 , I
-chrM 15791 T T 12 0 25 1 , -
-chrM 15792 C C 25 0 25 1 , I
-chrM 15793 G G 25 0 25 1 , I
-chrM 15794 C C 25 0 25 1 , H
-chrM 15795 T T 24 0 25 1 , 9
-chrM 15796 C C 25 0 25 1 , I
-chrM 15797 C C 25 0 25 1 , I
-chrM 15798 G G 25 0 25 1 , I
-chrM 15799 G G 25 0 25 1 , I
-chrM 15800 G G 25 0 25 1 , I
-chrM 15801 C C 25 0 25 1 , I
-chrM 15802 C C 25 0 25 1 , I
-chrM 15803 C C 25 0 25 1 , I
-chrM 15804 A A 25 0 25 1 , I
-chrM 15805 T T 25 0 25 1 , D
-chrM 15806 C C 25 0 25 1 , I
-chrM 15807 C C 25 0 25 1 , I
-chrM 15808 A A 25 0 25 1 , I
-chrM 15809 A A 25 0 25 1 , I
-chrM 15810 A A 25 0 25 1 , I
-chrM 15811 C C 25 0 25 1 , I
-chrM 15812 G G 25 0 25 1 , I
-chrM 15813 T T 25 0 25 1 , I
-chrM 15814 G A 4 4 25 1 n "
-chrM 15815 G A 4 4 25 1 n "
-chrM 15816 G G 25 0 25 1 , I
-chrM 15817 G G 25 0 25 1 , I
-chrM 15818 G G 25 0 25 1 , I
-chrM 15819 T T 25 0 25 1 , I
-chrM 15820 T T 25 0 25 1 , I
-chrM 15821 T T 25 0 25 1 , I
-chrM 15822 C C 25 0 25 1 ,$ I
-chrM 16613 G G 25 0 25 1 ^:. I
-chrM 16614 C C 25 0 25 1 . I
-chrM 16615 A A 25 0 25 1 . I
-chrM 16616 T T 25 0 25 1 . I
-chrM 16617 C C 25 0 25 1 . I
-chrM 16618 C C 25 0 25 1 . I
-chrM 16619 C C 25 0 25 1 . I
-chrM 16620 C A 4 4 25 1 N "
-chrM 16621 C A 4 4 25 1 N "
-chrM 16622 T T 25 0 25 1 . I
-chrM 16623 A A 25 0 25 1 . I
-chrM 16624 G G 25 0 25 1 . I
-chrM 16625 A A 25 0 25 1 . @
-chrM 16626 T T 25 0 25 1 . I
-chrM 16627 C C 25 0 25 1 . I
-chrM 16628 T T 25 0 25 1 . I
-chrM 16629 A A 25 0 25 1 . I
-chrM 16630 A A 10 0 25 1 . +
-chrM 16631 T T 25 0 25 1 . I
-chrM 16632 T T 25 0 25 1 . I
-chrM 16633 T T 25 0 25 1 . I
-chrM 16634 T T 25 0 25 1 . I
-chrM 16635 C C 25 0 25 1 . I
-chrM 16636 T T 25 0 25 1 . I
-chrM 16637 A A 23 0 25 1 . 8
-chrM 16638 A A 25 0 25 1 . H
-chrM 16639 A A 23 0 25 1 . 8
-chrM 16640 T T 25 0 25 1 . I
-chrM 16641 C C 25 0 25 1 . I
-chrM 16642 T T 25 0 25 1 . I
-chrM 16643 G G 25 0 25 1 . I
-chrM 16644 T T 25 0 25 1 . I
-chrM 16645 C C 25 0 25 1 . I
-chrM 16646 A A 25 0 25 1 . I
-chrM 16647 A A 25 0 25 1 . C
-chrM 16648 C C 25 0 25 1 .$ I
+chrM 15048 A A 30 0 25 1 , I
+chrM 15049 C C 30 0 25 1 ,$ E
+chrM 15080 T T 30 0 25 1 ^:, E
+chrM 15081 C C 30 0 25 1 , I
+chrM 15082 C C 30 0 25 1 , I
+chrM 15083 T T 30 0 25 1 , I
+chrM 15084 G G 30 0 25 1 , I
+chrM 15085 A A 30 0 25 1 , I
+chrM 15086 T T 30 0 25 1 , F
+chrM 15087 C C 30 0 25 1 , I
+chrM 15088 C C 30 0 25 1 , I
+chrM 15089 T T 30 0 25 1 , A
+chrM 15090 A A 30 0 25 1 , I
+chrM 15091 G G 30 0 25 1 , H
+chrM 15092 C C 30 0 25 1 , I
+chrM 15093 A A 30 0 25 1 , I
+chrM 15094 C C 30 0 25 1 , I
+chrM 15095 T T 30 0 25 1 , I
+chrM 15096 C C 30 0 25 1 , I
+chrM 15097 A A 30 0 25 1 , I
+chrM 15098 T T 30 0 25 1 , I
+chrM 15099 C C 30 0 25 1 , I
+chrM 15100 C C 30 0 25 1 , I
+chrM 15101 C C 30 0 25 1 , I
+chrM 15102 C C 30 0 25 1 , I
+chrM 15103 A A 30 0 25 1 , I
+chrM 15104 C C 30 0 25 1 , I
+chrM 15105 C C 30 0 25 1 , I
+chrM 15106 C C 30 0 25 1 , I
+chrM 15107 T N 0 0 0 1 n "
+chrM 15108 C N 0 0 0 1 n "
+chrM 15109 C C 30 0 25 1 , I
+chrM 15110 A A 30 0 25 1 , I
+chrM 15111 C C 30 0 25 1 , I
+chrM 15112 A A 30 0 25 1 , I
+chrM 15113 T T 30 0 25 1 , I
+chrM 15114 A A 30 0 25 1 , I
+chrM 15115 T T 30 0 25 1 ,$ E
+chrM 15275 T T 30 0 25 1 ^:. D
+chrM 15276 C C 30 0 25 1 . I
+chrM 15277 A A 30 0 25 1 . I
+chrM 15278 T T 30 0 25 1 . I
+chrM 15279 T T 30 0 25 1 . I
+chrM 15280 T T 30 0 25 1 . I
+chrM 15281 T T 30 0 25 1 . I
+chrM 15282 T N 0 0 0 1 N "
+chrM 15283 A N 0 0 0 1 N "
+chrM 15284 T T 30 0 25 1 . I
+chrM 15285 A A 30 0 25 1 . I
+chrM 15286 C C 30 0 25 1 . I
+chrM 15287 C C 30 0 25 1 . I
+chrM 15288 A A 30 0 25 1 . I
+chrM 15289 C C 30 0 25 1 . I
+chrM 15290 T T 30 0 25 1 . I
+chrM 15291 C C 30 0 25 1 . I
+chrM 15292 G G 30 0 25 1 . I
+chrM 15293 C C 30 0 25 1 . I
+chrM 15294 A A 30 0 25 1 . I
+chrM 15295 A A 30 0 25 1 . I
+chrM 15296 G G 30 0 25 1 . I
+chrM 15297 C C 30 0 25 1 . I
+chrM 15298 A A 30 0 25 1 . I
+chrM 15299 C C 30 0 25 1 . I
+chrM 15300 C C 30 0 25 1 . I
+chrM 15301 A A 30 0 25 1 . @
+chrM 15302 T T 30 0 25 1 . I
+chrM 15303 C C 30 0 25 1 . =
+chrM 15304 G G 30 0 25 1 . I
+chrM 15305 A A 30 0 25 1 . 7
+chrM 15306 A A 30 0 25 1 . 9
+chrM 15307 A A 30 0 25 1 . I
+chrM 15308 A A 30 0 25 1 . 6
+chrM 15309 C C 30 0 25 1 . I
+chrM 15310 A A 30 0 25 1 .$ >
+chrM 15338 T T 30 0 25 1 ^:, E
+chrM 15339 A A 30 0 25 1 , I
+chrM 15340 T T 30 0 25 1 , I
+chrM 15341 A A 30 0 25 1 , I
+chrM 15342 T T 30 0 25 1 , ?
+chrM 15343 C N 0 0 0 1 , -
+chrM 15344 G G 30 0 25 1 , I
+chrM 15345 C C 30 0 25 1 , I
+chrM 15346 A A 30 0 25 1 , I
+chrM 15347 C C 30 0 25 1 , I
+chrM 15348 A A 30 0 25 1 , I
+chrM 15349 T T 30 0 25 1 , A
+chrM 15350 T T 30 0 25 1 , I
+chrM 15351 A A 30 0 25 1 , I
+chrM 15352 C C 30 0 25 1 , I
+chrM 15353 C C 30 0 25 1 , I
+chrM 15354 C C 30 0 25 1 , I
+chrM 15355 T T 30 0 25 1 , I
+chrM 15356 G G 30 0 25 1 , I
+chrM 15357 G G 30 0 25 1 , I
+chrM 15358 T T 30 0 25 1 , I
+chrM 15359 C C 30 0 25 1 , I
+chrM 15360 T T 30 0 25 1 , I
+chrM 15361 T T 30 0 25 1 , I
+chrM 15362 G G 30 0 25 1 , I
+chrM 15363 T T 30 0 25 1 , I
+chrM 15364 A A 30 0 25 1 , I
+chrM 15365 A N 0 0 0 1 n "
+chrM 15366 A N 0 0 0 1 n "
+chrM 15367 C C 30 0 25 1 , I
+chrM 15368 C C 30 0 25 1 , I
+chrM 15369 A A 30 0 25 1 , I
+chrM 15370 G G 30 0 25 1 , I
+chrM 15371 A A 30 0 25 1 , >
+chrM 15372 A A 30 0 25 1 , ;
+chrM 15373 A A 30 0 25 1 ,$ :
+chrM 15787 A A 30 0 25 1 ^:, E
+chrM 15788 T T 30 0 25 1 , =
+chrM 15789 C C 30 0 25 1 , I
+chrM 15790 C C 30 0 25 1 , I
+chrM 15791 T N 0 0 0 1 , -
+chrM 15792 C C 30 0 25 1 , I
+chrM 15793 G G 30 0 25 1 , I
+chrM 15794 C C 30 0 25 1 , H
+chrM 15795 T T 30 0 25 1 , 9
+chrM 15796 C C 30 0 25 1 , I
+chrM 15797 C C 30 0 25 1 , I
+chrM 15798 G G 30 0 25 1 , I
+chrM 15799 G G 30 0 25 1 , I
+chrM 15800 G G 30 0 25 1 , I
+chrM 15801 C C 30 0 25 1 , I
+chrM 15802 C C 30 0 25 1 , I
+chrM 15803 C C 30 0 25 1 , I
+chrM 15804 A A 30 0 25 1 , I
+chrM 15805 T T 30 0 25 1 , D
+chrM 15806 C C 30 0 25 1 , I
+chrM 15807 C C 30 0 25 1 , I
+chrM 15808 A A 30 0 25 1 , I
+chrM 15809 A A 30 0 25 1 , I
+chrM 15810 A A 30 0 25 1 , I
+chrM 15811 C C 30 0 25 1 , I
+chrM 15812 G G 30 0 25 1 , I
+chrM 15813 T T 30 0 25 1 , I
+chrM 15814 G N 0 0 0 1 n "
+chrM 15815 G N 0 0 0 1 n "
+chrM 15816 G G 30 0 25 1 , I
+chrM 15817 G G 30 0 25 1 , I
+chrM 15818 G G 30 0 25 1 , I
+chrM 15819 T T 30 0 25 1 , I
+chrM 15820 T T 30 0 25 1 , I
+chrM 15821 T T 30 0 25 1 , I
+chrM 15822 C C 30 0 25 1 ,$ E
+chrM 16613 G G 30 0 25 1 ^:. E
+chrM 16614 C C 30 0 25 1 . I
+chrM 16615 A A 30 0 25 1 . I
+chrM 16616 T T 30 0 25 1 . I
+chrM 16617 C C 30 0 25 1 . I
+chrM 16618 C C 30 0 25 1 . I
+chrM 16619 C C 30 0 25 1 . I
+chrM 16620 C N 0 0 0 1 N "
+chrM 16621 C N 0 0 0 1 N "
+chrM 16622 T T 30 0 25 1 . I
+chrM 16623 A A 30 0 25 1 . I
+chrM 16624 G G 30 0 25 1 . I
+chrM 16625 A A 30 0 25 1 . @
+chrM 16626 T T 30 0 25 1 . I
+chrM 16627 C C 30 0 25 1 . I
+chrM 16628 T T 30 0 25 1 . I
+chrM 16629 A A 30 0 25 1 . I
+chrM 16630 A N 0 0 0 1 . +
+chrM 16631 T T 30 0 25 1 . I
+chrM 16632 T T 30 0 25 1 . I
+chrM 16633 T T 30 0 25 1 . I
+chrM 16634 T T 30 0 25 1 . I
+chrM 16635 C C 30 0 25 1 . I
+chrM 16636 T T 30 0 25 1 . I
+chrM 16637 A A 30 0 25 1 . 8
+chrM 16638 A A 30 0 25 1 . H
+chrM 16639 A A 30 0 25 1 . 8
+chrM 16640 T T 30 0 25 1 . I
+chrM 16641 C C 30 0 25 1 . I
+chrM 16642 T T 30 0 25 1 . I
+chrM 16643 G G 30 0 25 1 . I
+chrM 16644 T T 30 0 25 1 . I
+chrM 16645 C C 30 0 25 1 . I
+chrM 16646 A A 30 0 25 1 . I
+chrM 16647 A A 30 0 25 1 . C
+chrM 16648 C C 30 0 25 1 .$ >
--- a/test-data/bam_to_sam_out2.sam
+++ b/test-data/bam_to_sam_out2.sam
@@ -1,10 +1,10 @@
HWI-EAS91_1_30788AAXX:1:1:1095:605 0 chrM 23 25 36M * 0 0 AAGCAAGNNACTGAAAATGCCTAGATGAGTATTCTT IIIIIII""IIIIIIIIIIIIIIIEIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:606:460 0 chrM 4552 25 36M * 0 0 TTAATTTNNATTATAATAACACTCACAATATTCATA IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:1082:719 16 chrM 7191 25 36M * 0 0 TAAATTAACCCATACCAGCACCATAGANNCTCAAGA <III0EII3+3I29I>III8AIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:1059:362 16 chrM 7348 25 36M * 0 0 GGCCACCAATGATACTGAAGCTACGAGNNTACCGAT II/<)2IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:799:192 16 chrM 8421 25 36M * 0 0 CCTGTAGCCCTAGCCGTGCGGCTAACCNNTAACATT II%::I<IIIIIEIII8IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:1746:1180 16 chrM 12013 25 36M * 0 0 CCTAAGCTTCAAACTAGATTACTTCTCNNTAATTTT IIIIIIIIFIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
+HWI-EAS91_1_30788AAXX:1:1:1273:600 16 chrM 13855 25 36M * 0 0 GTATTAGACACCCATACCTCAGGATACNNCTCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
HWI-EAS91_1_30788AAXX:1:1:1650:1185 0 chrM 14956 25 36M * 0 0 ACCCCAGNNAACCCTCTCAGCACTCCCCCTCATATT IIIIIII""IIIIIIIIIIII6IIIIIIIII5I-II NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:799:192 16 chrM 8421 25 36M * 0 0 CCTGTAGCCCTAGCCGTGCGGCTAACCNNTAACATT II%::I<IIIIIEIII8IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:1082:719 16 chrM 7191 25 36M * 0 0 TAAATTAACCCATACCAGCACCATAGANNCTCAAGA <III0EII3+3I29I>III8AIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:1746:1180 16 chrM 12013 25 36M * 0 0 CCTAAGCTTCAAACTAGATTACTTCTCNNTAATTTT IIIIIIIIFIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:606:460 0 chrM 4552 25 36M * 0 0 TTAATTTNNATTATAATAACACTCACAATATTCATA IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:1059:362 16 chrM 7348 25 36M * 0 0 GGCCACCAATGATACTGAAGCTACGAGNNTACCGAT II/<)2IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
HWI-EAS91_1_30788AAXX:1:1:1483:1161 16 chrM 15080 25 36M * 0 0 TCCTGATCCTAGCACTCATCCCCACCCNNCACATAT HIIIIIFIIAIHIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
-HWI-EAS91_1_30788AAXX:1:1:1273:600 16 chrM 13855 25 36M * 0 0 GTATTAGACACCCATACCTCAGGATACNNCTCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
HWI-EAS91_1_30788AAXX:1:1:1190:1283 16 chrM 15338 25 36M * 0 0 TATATCGCACATTACCCTGGTCTTGTANNCCAGAAA EIII?-IIIIIAIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
Binary file test-data/sam_merge_out2.bam has changed
--- a/tools/samtools/bam_to_sam.py
+++ b/tools/samtools/bam_to_sam.py
@@ -24,12 +24,51 @@ def __main__():
( options, args ) = parser.parse_args()
tmp_dir = tempfile.mkdtemp()
+
try:
# exit if input file empty
if os.path.getsize( options.input1 ) == 0:
raise Exception, 'Initial BAM file empty'
+ # Sort alignments by leftmost coordinates. File <out.prefix>.bam will be created. This command
+ # may also create temporary files <out.prefix>.%d.bam when the whole alignment cannot be fitted
+ # into memory ( controlled by option -m ).
+ tmp_sorted_aligns_file = tempfile.NamedTemporaryFile( dir=tmp_dir )
+ tmp_sorted_aligns_file_base = tmp_sorted_aligns_file.name
+ tmp_sorted_aligns_file_name = '%s.bam' % tmp_sorted_aligns_file.name
+ tmp_sorted_aligns_file.close()
+ command = 'samtools sort %s %s' % ( options.input1, tmp_sorted_aligns_file_base )
+ tmp = tempfile.NamedTemporaryFile( dir=tmp_dir ).name
+ tmp_stderr = open( tmp, 'wb' )
+ proc = subprocess.Popen( args=command, shell=True, cwd=tmp_dir, stderr=tmp_stderr.fileno() )
+ returncode = proc.wait()
+ tmp_stderr.close()
+ # get stderr, allowing for case where it's very large
+ tmp_stderr = open( tmp, 'rb' )
+ stderr = ''
+ buffsize = 1048576
+ try:
+ while True:
+ stderr += tmp_stderr.read( buffsize )
+ if not stderr or len( stderr ) % buffsize != 0:
+ break
+ except OverflowError:
+ pass
+ tmp_stderr.close()
+ if returncode != 0:
+ raise Exception, stderr
+ # exit if sorted BAM file empty
+ if os.path.getsize( tmp_sorted_aligns_file_name) == 0:
+ raise Exception, 'Intermediate sorted BAM file empty'
+ except Exception, e:
+ #clean up temp files
+ if os.path.exists( tmp_dir ):
+ shutil.rmtree( tmp_dir )
+ stop_err( 'Error sorting alignments from (%s), %s' % ( options.input1, str( e ) ) )
+
+
+ try:
# Extract all alignments from the input BAM file to SAM format ( since no region is specified, all the alignments will be extracted ).
- command = 'samtools view -o %s %s' % ( options.output1, options.input1 )
+ command = 'samtools view -o %s %s' % ( options.output1, tmp_sorted_aligns_file_name )
tmp = tempfile.NamedTemporaryFile( dir=tmp_dir ).name
tmp_stderr = open( tmp, 'wb' )
proc = subprocess.Popen( args=command, shell=True, cwd=tmp_dir, stderr=tmp_stderr.fileno() )
--- a/tools/samtools/bam_to_sam.xml
+++ b/tools/samtools/bam_to_sam.xml
@@ -3,7 +3,11 @@
<requirement type="package">samtools</requirement></requirements><description>converts BAM format to SAM format</description>
- <command interpreter="python">bam_to_sam.py --input1=$input1 --output1=$output1</command>
+ <command interpreter="python">
+ bam_to_sam.py
+ --input1=$input1
+ --output1=$output1
+ </command><inputs><param name="input1" type="data" format="bam" label="BAM File to Convert" /></inputs>
@@ -14,18 +18,18 @@
<test><!--
Bam-to-Sam command:
- samtools view -o test-data/3.bam bam_to_sam_out1.sam
+ samtools view -o bam_to_sam_out1.sam test-data/3.bam
--><param name="input1" value="1.bam" ftype="bam" />
- <output name="output1" file="bam_to_sam_out1.sam" />
+ <output name="output1" file="bam_to_sam_out1.sam" sorted="True" /></test><test><!--
Bam-to-Sam command:
- samtools view -o test-data/1.sam bam_to_sam_out2.sam
+ samtools view -o bam_to_sam_out2.sam test-data/1.bam
--><param name="input1" value="3.bam" ftype="bam" />
- <param name="output1" file="bam_to_sam_out2.sam" />
+ <param name="output1" file="bam_to_sam_out2.sam" sorted="True" /></test></tests><help>
--- a/tools/samtools/sam_pileup.xml
+++ b/tools/samtools/sam_pileup.xml
@@ -5,32 +5,32 @@
</requirements><command interpreter="python">
sam_pileup.py
- --input1=$input1
- --output=$output1
- --ref=$refOrHistory.reference
- #if $refOrHistory.reference == "history":
- --ownFile=$refOrHistory.ownFile
- #else:
- --ownFile="None"
- #end if
- --dbkey=${input1.metadata.dbkey}
- --indexDir=${GALAXY_DATA_INDEX_DIR}
- --bamIndex=${input1.metadata.bam_index}
- --lastCol=$lastCol
- --indels=$indels
- --mapCap=$mapCap
- --consensus=$c.consensus
- #if $c.consensus == "yes":
- --theta=$c.theta
- --hapNum=$c.hapNum
- --fraction=$c.fraction
- --phredProb=$c.phredProb
- #else:
- --theta="None"
- --hapNum="None"
- --fraction="None"
- --phredProb="None"
- #end if
+ --input1=$input1
+ --output=$output1
+ --ref=$refOrHistory.reference
+ #if $refOrHistory.reference == "history":
+ --ownFile=$refOrHistory.ownFile
+ #else:
+ --ownFile="None"
+ #end if
+ --dbkey=${input1.metadata.dbkey}
+ --indexDir=${GALAXY_DATA_INDEX_DIR}
+ --bamIndex=${input1.metadata.bam_index}
+ --lastCol=$lastCol
+ --indels=$indels
+ --mapCap=$mapCap
+ --consensus=$c.consensus
+ #if $c.consensus == "yes":
+ --theta=$c.theta
+ --hapNum=$c.hapNum
+ --fraction=$c.fraction
+ --phredProb=$c.phredProb
+ #else:
+ --theta="None"
+ --hapNum="None"
+ --fraction="None"
+ --phredProb="None"
+ #end if
</command><inputs><conditional name="refOrHistory">
@@ -80,7 +80,7 @@
<!--
Bam to pileup command:
samtools faidx chr_m.fasta
- samtools pileup -M 60 -f chr_m.fasta test-data/sam_pileup_in1.bam > test-data/sam_pileup_out1.pileup
+ samtools pileup -M 60 -f chr_m.fasta test-data/sam_pileup_in1.bam > sam_pileup_out1.pileup
chr_m.fasta is the prefix of the index
--><param name="reference" value="history" />
@@ -95,7 +95,7 @@
<test><!--
Bam to pileup command:
- samtools pileup -M 60 -c -T 0.85 -N 2 -r 0.001 -I 40 -f chr_m.fasta test-data/sam_pileup_in1.bam > test-data/sam_pileup_out2.pileup
+ samtools pileup -M 60 -c -T 0.85 -N 2 -r 0.001 -I 40 -f chr_m.fasta test-data/sam_pileup_in1.bam > sam_pileup_out2.pileup
chr_m.fasta is the prefix of the index
--><param name="reference" value="indexed" />
Binary file test-data/sam_to_bam_out1.bam has changed
1
0
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kelly Vincent <kpvincent(a)bx.psu.edu>
# Date 1289249827 18000
# Node ID 2875445df9906828bc804e9b0923160f902b3fac
# Parent 43c1f36a8e4e3f9aa62dc9bc144e54b8312364bf
# Parent 2c2baca255289cd48ecb806cfb0ea6468d489bde
merge
1
0
galaxy-dist commit 2c2baca25528: rgHaploView.py reorganized to make a little less ugly and easier to maintain
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Ross Lazarus <ross.lazarus(a)gmail.com>
# Date 1289249136 18000
# Node ID 2c2baca255289cd48ecb806cfb0ea6468d489bde
# Parent eee0e1d344d21de7fb079fcccc3df8e251d1e025
rgHaploView.py reorganized to make a little less ugly and easier to maintain
--- a/tools/rgenetics/rgHaploView.py
+++ b/tools/rgenetics/rgHaploView.py
@@ -33,11 +33,466 @@ javabin = 'java'
atrandic = {'A':'1','C':'2','G':'3','T':'4','N':'0','-':'0','1':'1','2':'2','3':'3','4':'4','0':'0'}
class NullDevice:
- """ """
+ """ a dev/null for ignoring output
+ """
def write(self, s):
pass
-def ld():
+class ldPlot:
+
+ def __init__(self, argv=[]):
+ """
+ setup
+ """
+ self.args=argv
+ self.parseArgs(argv=self.args)
+ self.setupRegions()
+
+ def parseArgs(self,argv=[]):
+ """
+ """
+ ts = '%s%s' % (string.punctuation,string.whitespace)
+ ptran = string.maketrans(ts,'_'*len(ts))
+ ### Figure out what genomic region we are interested in
+ self.region = argv[1]
+ self.orslist = argv[2].replace('X',' ').lower() # galaxy replaces newlines with XX - go figure
+ self.title = argv[3].translate(ptran)
+ # for outputs
+ self.outfile = argv[4]
+ self.logfn = 'Log_%s.txt' % (self.title)
+ self.histextra = argv[5]
+ self.base_name = argv[6]
+ self.pedFileBase = os.path.join(self.histextra,self.base_name)
+ print 'pedfilebase=%s' % self.pedFileBase
+ self.minMaf=argv[7]
+ if self.minMaf:
+ try:
+ self.minMaf = float(self.minMaf)
+ except:
+ self.minMaf = 0.0
+ self.maxDist=argv[8] or None
+ self.ldType=argv[9] or 'RSQ'
+ self.hiRes = (argv[10].lower() == 'hi')
+ self.memSize= argv[11] or '1000'
+ self.memSize = int(self.memSize)
+ self.outfpath = argv[12]
+ self.infotrack = False # note that otherwise this breaks haploview in headless mode
+ #infotrack = argv[13] == 'info'
+ # this fails in headless mode as at april 2010 with haploview 4.2
+ self.tagr2 = argv[14] or '0.8'
+ hmpanels = argv[15] # eg "['CEU','YRI']"
+ if hmpanels:
+ hmpanels = hmpanels.replace('[','')
+ hmpanels = hmpanels.replace(']','')
+ hmpanels = hmpanels.replace("'",'')
+ hmpanels = hmpanels.split(',')
+ self.hmpanels = hmpanels
+ self.hvbin = argv[16] # added rml june 2008
+ self.bindir = os.path.split(self.hvbin)[0]
+ # jan 2010 - always assume utes are on path to avoid platform problems
+ self.pdfjoin = 'pdfjoin' # os.path.join(bindir,'pdfjoin')
+ self.pdfnup = 'pdfnup' # os.path.join(bindir,'pdfnup')
+ self.mogrify = 'mogrify' # os.path.join(bindir,'mogrify')
+ self.convert = 'convert' # os.path.join(bindir,'convert')
+ self.log_file = os.path.join(self.outfpath,self.logfn)
+ self.MAP_FILE = '%s.map' % self.pedFileBase
+ self.DATA_FILE = '%s.ped' % self.pedFileBase
+ try:
+ os.makedirs(self.outfpath)
+ s = '## made new path %s\n' % self.outfpath
+ except:
+ pass
+ self.lf = file(self.log_file,'w')
+ s = 'PATH=%s\n' % os.environ.get('PATH','?')
+ self.lf.write(s)
+
+ def setupRegions(self):
+ """
+ """
+ chromosome = ''
+ spos = epos = -9
+ rslist = []
+ rsdict = {}
+
+ if self.region > '':
+ useRs = []
+ useRsdict={}
+ try: # TODO make a regexp?
+ c,rest = self.region.split(':')
+ chromosome = c.replace('chr','')
+ rest = rest.replace(',','') # remove commas
+ spos,epos = rest.split('-')
+ spos = int(spos)
+ epos = int(epos)
+ s = '## %s parsing chrom %s from %d to %d\n' % (progname,chromosome,spos,epos)
+ self.lf.write(s)
+ self.lf.write('\n')
+ print >> sys.stdout, s
+ except:
+ s = '##! %s unable to parse region %s - MUST look like "chr8:10,000-100,000\n' % (progname,self.region)
+ print >> sys.stdout, s
+ self.lf.write(s)
+ self.lf.write('\n')
+ self.lf.close()
+ sys.exit(1)
+ else:
+ useRs = self.orslist.split() # galaxy replaces newlines with XX - go figure
+ useRsdict = dict(zip(useRs,useRs))
+ self.useTemp = False
+ try:
+ dfile = open(self.DATA_FILE, 'r')
+ except: # bad input file name?
+ s = '##! RGeno unable to open file %s\n' % (self.DATA_FILE)
+ self.lf.write(s)
+ self.lf.write('\n')
+ self.lf.close()
+ print >> sys.stdout, s
+ raise
+ sys.exit(1)
+ try:
+ mfile = open(self.MAP_FILE, 'r')
+ except: # bad input file name?
+ s = '##! RGeno unable to open file %s' % (self.MAP_FILE)
+ lf.write(s)
+ lf.write('\n')
+ lf.close()
+ print >> sys.stdout, s
+ raise
+ sys.exit(1)
+ if len(useRs) > 0 or spos <> -9 : # subset region
+ self.useTemp = True
+ ### Figure out which markers are in this region
+ markers = []
+ snpcols = {}
+ chroms = {}
+ minpos = 2**32
+ maxpos = 0
+ for lnum,row in enumerate(mfile):
+ line = row.strip()
+ if not line: continue
+ chrom, snp, genpos, abspos = line.split()
+ try:
+ ic = int(chrom)
+ except:
+ ic = None
+ if ic and ic <= 23:
+ try:
+ abspos = int(abspos)
+ if abspos > maxpos:
+ maxpos = abspos
+ if abspos < minpos:
+ minpos = abspos
+ except:
+ abspos = epos + 999999999 # so next test fails
+ if useRsdict.get(snp,None) or (spos <> -9 and chrom == chromosome and (spos <= abspos <= epos)):
+ if chromosome == '':
+ chromosome = chrom
+ chroms.setdefault(chrom,chrom)
+ markers.append((chrom,abspos,snp)) # decorate for sort into genomic
+ snpcols[snp] = lnum # so we know which col to find genos for this marker
+ markers.sort()
+ rslist = [x[2] for x in markers] # drop decoration
+ rsdict = dict(zip(rslist,rslist))
+ if len(rslist) == 0:
+ s = '##! %s found no rs numbers in %s' % (progname,argv[1:3])
+ self.lf.write(s)
+ self.lf.write('\n')
+ self.lf.close()
+ print >> sys.stdout, s
+ sys.exit(1)
+ if spos == -9:
+ spos = minpos
+ epos = maxpos
+ s = '## %s looking for %d rs (%s)' % (progname,len(rslist),rslist[:5])
+ self.lf.write(s)
+ print >> sys.stdout, s
+ wewant = [(6+(2*snpcols[x])) for x in rslist] #
+ # column indices of first geno of each marker pair to get the markers into genomic
+ ### ... and then parse the rest of the ped file to pull out
+ ### the genotypes for all subjects for those markers
+ # /usr/local/galaxy/data/rg/1/lped/
+ self.tempMapName = os.path.join(self.outfpath,'%s.info' % self.title)
+ self.tempMap = file(self.tempMapName,'w')
+ self.tempPedName = os.path.join(self.outfpath,'%s.ped' % self.title)
+ self.tempPed = file(self.tempPedName,'w')
+ self.pngpath = '%s.LD.PNG' % self.tempPedName
+ map = ['%s\t%s' % (x[2],x[1]) for x in markers] # snp,abspos in genomic order for haploview
+ self.tempMap.write('%s\n' % '\n'.join(map))
+ self.tempMap.close()
+ nrows = 0
+ for line in dfile:
+ line = line.strip()
+ if not line:
+ continue
+ fields = line.split()
+ preamble = fields[:6]
+ g = ['%s %s' % (fields[snpcol], fields[snpcol+1]) for snpcol in wewant]
+ g = ' '.join(g)
+ g = g.split() # we'll get there
+ g = [atrandic.get(x,'0') for x in g] # numeric alleles...
+ self.tempPed.write('%s %s\n' % (' '.join(preamble), ' '.join(g)))
+ nrows += 1
+ self.tempPed.close()
+ s = '## %s: wrote %d markers, %d subjects for region %s\n' % (progname,len(rslist),nrows,self.region)
+ self.lf.write(s)
+ self.lf.write('\n')
+ print >> sys.stdout,s
+ else: # even if using all, must set up haploview info file instead of map
+ markers = []
+ chroms = {}
+ spos = sys.maxint
+ epos = -spos
+ for lnum,row in enumerate(mfile):
+ line = row.strip()
+ if not line: continue
+ chrom, snp, genpos, abspos = line.split()
+ try:
+ ic = int(chrom)
+ except:
+ ic = None
+ if ic and ic <= 23:
+ if chromosome == '':
+ chromosome = chrom
+ chroms.setdefault(chrom,chrom)
+ try:
+ p = int(abspos)
+ if p < spos and p <> 0:
+ spos = p
+ if p > epos and p <> 0:
+ epos = p
+ except:
+ pass
+ markers.append('%s %s' % (snp,abspos)) # no sort - pass
+ # now have spos and epos for hapmap if hmpanels
+ self.tempMapName = os.path.join(self.outfpath,'%s.info' % self.title)
+ self.tempMap = file(self.tempMapName,'w')
+ self.tempMap.write('\n'.join(markers))
+ self.tempMap.close()
+ self.tempPedName = os.path.join(self.outfpath,'%s.ped' % self.title)
+ try: # will fail on winblows!
+ os.symlink(self.DATA_FILE,self.tempPedName)
+ except:
+ shutil.copy(self.DATA_FILE,self.tempPedName) # wasteful but..
+ self.nchroms = len(chroms) # if > 1 can't really do this safely
+ dfile.close()
+ mfile.close()
+ self.spos = spos
+ self.epos = epos
+ self.chromosome = chromosome
+ if self.nchroms > 1:
+ s = '## warning - multiple chromosomes found in your map file - %s\n' % ','.join(chroms.keys())
+ self.lf.write(s)
+ print >> sys.stdout,s
+ sys.exit(1)
+
+ def doPlots(self):
+ """
+ """
+ DATA_FILE = self.tempPedName # for haploview
+ INFO_FILE = self.tempMapName
+ fblog,blog = tempfile.mkstemp()
+ ste = open(blog,'w') # to catch the blather
+ # if no need to rewrite - set up names for haploview call
+ vcl = [javabin,'-jar',self.hvbin,'-n','-memory','%d' % self.memSize,'-pairwiseTagging',
+ '-pedfile',DATA_FILE,'-info',INFO_FILE,'-tagrsqcounts',
+ '-tagrsqcutoff',self.tagr2, '-ldcolorscheme',self.ldType]
+ if self.minMaf:
+ vcl += ['-minMaf','%f' % self.minMaf]
+ if self.maxDist:
+ vcl += ['-maxDistance',self.maxDist]
+ if self.hiRes:
+ vcl.append('-png')
+ else:
+ vcl.append('-compressedpng')
+ if self.nchroms == 1:
+ vcl += ['-chromosome',self.chromosome]
+ if self.infotrack:
+ vcl.append('-infoTrack')
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=ste,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ vcl = [self.mogrify, '-resize 800x400!', '*.PNG']
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ inpng = '%s.LD.PNG' % DATA_FILE # stupid but necessary - can't control haploview name mangle
+ inpng = inpng.replace(' ','')
+ inpng = os.path.split(inpng)[-1]
+ tmppng = '%s.tmp.png' % self.title
+ tmppng = tmppng.replace(' ','')
+ outpng = '1_%s.png' % self.title
+ outpng = outpng.replace(' ','')
+ outpng = os.path.split(outpng)[-1]
+ vcl = [self.convert, '-resize 800x400!', inpng, tmppng]
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ s = "text 10,300 '%s'" % self.title[:40]
+ vcl = [self.convert, '-pointsize 25','-fill maroon',
+ '-draw "%s"' % s, tmppng, outpng]
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ try:
+ os.remove(os.path.join(self.outfpath,tmppng))
+ except:
+ pass # label all the plots then delete all the .PNG files before munging
+ fnum=1
+ if self.hmpanels:
+ sp = '%d' % (self.spos/1000.) # hapmap wants kb
+ ep = '%d' % (self.epos/1000.)
+ for panel in self.hmpanels:
+ if panel > '' and panel.lower() <> 'none': # in case someone checks that option too :)
+ ptran = panel.strip()
+ ptran = ptran.replace('+','_')
+ fnum += 1 # preserve an order or else we get sorted
+ vcl = [javabin,'-jar',self.hvbin,'-n','-memory','%d' % self.memSize,
+ '-chromosome',self.chromosome, '-panel',panel.strip(),
+ '-hapmapDownload','-startpos',sp,'-endpos',ep,
+ '-ldcolorscheme',self.ldType]
+ if self.minMaf:
+ vcl += ['-minMaf','%f' % self.minMaf]
+ if self.maxDist:
+ vcl += ['-maxDistance',self.maxDist]
+ if self.hiRes:
+ vcl.append('-png')
+ else:
+ vcl.append('-compressedpng')
+ if self.infotrack:
+ vcl.append('-infoTrack')
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=ste,stdout=self.lf)
+ retval = p.wait()
+ inpng = 'Chromosome%s%s.LD.PNG' % (self.chromosome,panel)
+ inpng = inpng.replace(' ','') # mysterious spaces!
+ outpng = '%d_HapMap_%s_%s.png' % (fnum,ptran,self.chromosome)
+ # hack for stupid chb+jpt
+ outpng = outpng.replace(' ','')
+ tmppng = '%s.tmp.png' % self.title
+ tmppng = tmppng.replace(' ','')
+ outpng = os.path.split(outpng)[-1]
+ vcl = [self.convert, '-resize 800x400!', inpng, tmppng]
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ s = "text 10,300 'HapMap %s'" % ptran.strip()
+ vcl = [self.convert, '-pointsize 25','-fill maroon',
+ '-draw "%s"' % s, tmppng, outpng]
+ p=subprocess.Popen(' '.join(vcl),shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
+ self.lf.write(s)
+ try:
+ os.remove(os.path.join(self.outfpath,tmppng))
+ except:
+ pass
+ nimages = len(glob.glob(os.path.join(self.outfpath,'*.png'))) # rely on HaploView shouting - PNG @!
+ self.lf.write('### nimages=%d\n' % nimages)
+ if nimages > 0: # haploview may fail?
+ vcl = '%s -format pdf -resize 800x400! *.png' % self.mogrify
+ p=subprocess.Popen(vcl,shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ self.lf.write('## executing %s returned %d\n' % (vcl,retval))
+ vcl = '%s *.pdf --fitpaper true --outfile alljoin.pdf' % self.pdfjoin
+ p=subprocess.Popen(vcl,shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ self.lf.write('## executing %s returned %d\n' % (vcl,retval))
+ vcl = '%s alljoin.pdf --nup 1x%d --outfile allnup.pdf' % (self.pdfnup,nimages)
+ p=subprocess.Popen(vcl,shell=True,cwd=self.outfpath,stderr=self.lf,stdout=self.lf)
+ retval = p.wait()
+ self.lf.write('## executing %s returned %d\n' % (vcl,retval))
+ #vcl = ['convert', 'allnup.pdf', 'allnup.png'] # this fails - bad pdf?
+ #p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath)
+ #retval = p.wait()
+ #lf.write('## executing %s returned %d\n' % (vcl,retval))
+ ste.close() # temp file used to catch haploview blather
+ hblather = open(blog,'r').readlines() # to catch the blather
+ os.unlink(blog)
+ if len(hblather) > 0:
+ self.lf.write('## In addition, Haploview complained:')
+ self.lf.write(''.join(hblather))
+ self.lf.write('\n')
+ self.lf.close()
+ flist = glob.glob(os.path.join(self.outfpath, '*'))
+ flist.sort()
+ ts = '!"#$%&\'()*+,-/:;<=>?@[\\]^_`{|}~' + string.whitespace
+ ftran = string.maketrans(ts,'_'*len(ts))
+ outf = file(self.outfile,'w')
+ outf.write(galhtmlprefix % progname)
+ s = '<h4>rgenetics for Galaxy %s, wrapping HaploView</h4>' % (progname)
+ outf.write(s)
+ """
+ as at ashg 2009, convert fails on allnup.pdf - probably too complex...
+ mainthumb = 'allnup.png'
+ mainpdf = 'allnup.pdf'
+ if os.path.exists(mainpdf):
+ if not os.path.exists(mainthumb):
+ outf.write('<table><tr><td colspan="3"><a href="%s">Main combined LD plot</a></td></tr></table>\n' % (mainpdf))
+ else:
+ outf.write('<table><tr><td><a href="%s"><img src="%s" alt="Main combined LD image" hspace="10" align="middle">')
+ outf.write('</td><td>Click this thumbnail to display the main combined LD image</td></tr></table>\n' % (mainpdf,mainthumb))
+ else:
+ outf.write('(No main image was generated - this usually means a Haploview error connecting to Hapmap site - please try later)<br/>\n')
+ outf.write('## Called as %s' % sys.argv)
+ """
+ outf.write('<br><div><hr><ul>\n')
+ for i, data in enumerate( flist ):
+ dn = os.path.split(data)[-1]
+ if dn[:3] <> 'all':
+ continue
+ newdn = dn.translate(ftran)
+ if dn <> newdn:
+ os.rename(os.path.join(self.outfpath,dn),os.path.join(self.outfpath,newdn))
+ dn = newdn
+ dnlabel = dn
+ ext = dn.split('.')[-1]
+ if dn == 'allnup.pdf':
+ dnlabel = 'All pdf plots on a single page'
+ elif dn == 'alljoin.pdf':
+ dnlabel = 'All pdf plots, each on a separate page'
+ outf.write('<li><a href="%s">%s - %s</a></li>\n' % (dn,dn,dnlabel))
+ for i, data in enumerate( flist ):
+ dn = os.path.split(data)[-1]
+ if dn[:3] == 'all':
+ continue
+ newdn = dn.translate(ftran)
+ if dn <> newdn:
+ os.rename(os.path.join(self.outfpath,dn),os.path.join(self.outfpath,newdn))
+ dn = newdn
+ dnlabel = dn
+ ext = dn.split('.')[-1]
+ if dn == 'allnup.pdf':
+ dnlabel = 'All pdf plots on a single page'
+ elif dn == 'alljoin.pdf':
+ dnlabel = 'All pdf plots, each on a separate page'
+ elif ext == 'info':
+ dnlabel = '%s map data for Haploview input' % self.title
+ elif ext == 'ped':
+ dnlabel = '%s genotype data for Haploview input' % self.title
+ elif dn.find('CEU') <> -1 or dn.find('YRI') <> -1 or dn.find('CHB_JPT') <> -1: # is hapmap
+ dnlabel = 'Hapmap data'
+ if ext == 'TAGS' or ext == 'TESTS' or ext == 'CHAPS':
+ dnlabel = dnlabel + ' Tagger output'
+ outf.write('<li><a href="%s">%s - %s</a></li>\n' % (dn,dn,dnlabel))
+ outf.write('</ol><br>')
+ outf.write("</div><div><hr>Job Log follows below (see %s)<pre>" % self.logfn)
+ s = file(self.log_file,'r').readlines()
+ s = '\n'.join(s)
+ outf.write('%s</pre><hr></div>' % s)
+ outf.write('</body></html>')
+ outf.close()
+ if self.useTemp:
+ try:
+ os.unlink(self.tempMapName)
+ os.unlink(self.tempPedName)
+ except:
+ pass
+
+if __name__ == "__main__":
""" ### Sanity check the arguments
<command interpreter="python">
@@ -52,444 +507,11 @@ def ld():
skipcheck?
"""
progname = os.path.split(sys.argv[0])[-1]
- ts = '%s%s' % (string.punctuation,string.whitespace)
- ptran = string.maketrans(ts,'_'*len(ts))
if len(sys.argv) < 16:
s = '##!%s: Expected 16 params in sys.argv, got %d (%s)' % (progname,len(sys.argv), sys.argv)
print s
sys.exit(1)
+ ld = ldPlot(argv = sys.argv)
+ ld.doPlots()
- ### Figure out what genomic region we are interested in
- region = sys.argv[1]
- orslist = sys.argv[2].replace('X',' ').lower() # galaxy replaces newlines with XX - go figure
- title = sys.argv[3].translate(ptran)
- # for outputs
- outfile = sys.argv[4]
- logfn = 'Log_%s.txt' % (title)
- histextra = sys.argv[5]
- base_name = sys.argv[6]
- pedFileBase = os.path.join(histextra,base_name)
- print 'pedfilebase=%s' % pedFileBase
- minMaf=sys.argv[7]
- if minMaf:
- try:
- minMaf = float(minMaf)
- except:
- minMaf = 0.0
- maxDist=sys.argv[8] or None
- ldType=sys.argv[9] or 'RSQ'
- hiRes = (sys.argv[10].lower() == 'hi')
- memSize= sys.argv[11] or '1000'
- memSize = int(memSize)
- outfpath = sys.argv[12]
- infotrack = False # note that otherwise this breaks haploview in headless mode
- #infotrack = sys.argv[13] == 'info'
- # this fails in headless mode as at april 2010 with haploview 4.2
- tagr2 = sys.argv[14] or '0.8'
- hmpanels = sys.argv[15] # eg "['CEU','YRI']"
- if hmpanels:
- hmpanels = hmpanels.replace('[','')
- hmpanels = hmpanels.replace(']','')
- hmpanels = hmpanels.replace("'",'')
- hmpanels = hmpanels.split(',')
- hvbin = sys.argv[16] # added rml june 2008
- bindir = os.path.split(hvbin)[0]
- # jan 2010 - always assume utes are on path to avoid platform problems
- pdfjoin = 'pdfjoin' # os.path.join(bindir,'pdfjoin')
- pdfnup = 'pdfnup' # os.path.join(bindir,'pdfnup')
- mogrify = 'mogrify' # os.path.join(bindir,'mogrify')
- convert = 'convert' # os.path.join(bindir,'convert')
- log_file = os.path.join(outfpath,logfn)
- MAP_FILE = '%s.map' % pedFileBase
- DATA_FILE = '%s.ped' % pedFileBase
- try:
- os.makedirs(outfpath)
- s = '## made new path %s\n' % outfpath
- except:
- pass
- lf = file(log_file,'w')
- s = 'PATH=%s\n' % os.environ.get('PATH','?')
- lf.write(s)
- hlogf = os.path.join(outfpath,'%s.log' % pedFileBase)
- chromosome = ''
- spos = epos = -9
- rslist = []
- rsdict = {}
- hlog = []
- if region > '':
- useRs = []
- useRsdict={}
- try: # TODO make a regexp?
- c,rest = region.split(':')
- chromosome = c.replace('chr','')
- rest = rest.replace(',','') # remove commas
- spos,epos = rest.split('-')
- spos = int(spos)
- epos = int(epos)
- s = '## %s parsing chrom %s from %d to %d\n' % (progname,chromosome,spos,epos)
- lf.write(s)
- lf.write('\n')
- print >> sys.stdout, s
- except:
- s = '##! %s unable to parse region %s - MUST look like "chr8:10,000-100,000\n' % (progname,region)
- print >> sys.stdout, s
- lf.write(s)
- lf.write('\n')
- lf.close()
- sys.exit(1)
- else:
- useRs = orslist.split() # galaxy replaces newlines with XX - go figure
- useRsdict = dict(zip(useRs,useRs))
- useTemp = False
- try:
- dfile = open(DATA_FILE, 'r')
- except: # bad input file name?
- s = '##! RGeno unable to open file %s\n' % (DATA_FILE)
- lf.write(s)
- lf.write('\n')
- lf.close()
- print >> sys.stdout, s
- raise
- sys.exit(1)
- try:
- mfile = open(MAP_FILE, 'r')
- except: # bad input file name?
- s = '##! RGeno unable to open file %s' % (MAP_FILE)
- lf.write(s)
- lf.write('\n')
- lf.close()
- print >> sys.stdout, s
- raise
- sys.exit(1)
- if len(useRs) > 0 or spos <> -9 : # subset region
- useTemp = True
- ### Figure out which markers are in this region
- markers = []
- snpcols = {}
- chroms = {}
- minpos = 2**32
- maxpos = 0
- for lnum,row in enumerate(mfile):
- line = row.strip()
- if not line: continue
- chrom, snp, genpos, abspos = line.split()
- try:
- ic = int(chrom)
- except:
- ic = None
- if ic and ic <= 23:
- try:
- abspos = int(abspos)
- if abspos > maxpos:
- maxpos = abspos
- if abspos < minpos:
- minpos = abspos
- except:
- abspos = epos + 999999999 # so next test fails
- if useRsdict.get(snp,None) or (spos <> -9 and chrom == chromosome and (spos <= abspos <= epos)):
- if chromosome == '':
- chromosome = chrom
- chroms.setdefault(chrom,chrom)
- markers.append((chrom,abspos,snp)) # decorate for sort into genomic
- snpcols[snp] = lnum # so we know which col to find genos for this marker
- markers.sort()
- rslist = [x[2] for x in markers] # drop decoration
- rsdict = dict(zip(rslist,rslist))
- if len(rslist) == 0:
- s = '##! %s found no rs numbers in %s' % (progname,sys.argv[1:3])
- lf.write(s)
- lf.write('\n')
- lf.close()
- print >> sys.stdout, s
- sys.exit(1)
- if spos == -9:
- spos = minpos
- epos = maxpos
- s = '## %s looking for %d rs (%s)' % (progname,len(rslist),rslist[:5])
- lf.write(s)
- print >> sys.stdout, s
- wewant = [(6+(2*snpcols[x])) for x in rslist] #
- # column indices of first geno of each marker pair to get the markers into genomic
- ### ... and then parse the rest of the ped file to pull out
- ### the genotypes for all subjects for those markers
- # /usr/local/galaxy/data/rg/1/lped/
- tempMapName = os.path.join(outfpath,'%s.info' % title)
- tempMap = file(tempMapName,'w')
- tempPedName = os.path.join(outfpath,'%s.ped' % title)
- tempPed = file(tempPedName,'w')
- pngpath = '%s.LD.PNG' % tempPedName
- map = ['%s\t%s' % (x[2],x[1]) for x in markers] # snp,abspos in genomic order for haploview
- tempMap.write('%s\n' % '\n'.join(map))
- tempMap.close()
- nrows = 0
- for line in dfile:
- line = line.strip()
- if not line:
- continue
- fields = line.split()
- preamble = fields[:6]
- g = ['%s %s' % (fields[snpcol], fields[snpcol+1]) for snpcol in wewant]
- g = ' '.join(g)
- g = g.split() # we'll get there
- g = [atrandic.get(x,'0') for x in g] # numeric alleles...
- tempPed.write('%s %s\n' % (' '.join(preamble), ' '.join(g)))
- nrows += 1
- tempPed.close()
- s = '## %s: wrote %d markers, %d subjects for region %s\n' % (progname,len(rslist),nrows,region)
- lf.write(s)
- lf.write('\n')
- print >> sys.stdout,s
- else: # even if using all, must set up haploview info file instead of map
- markers = []
- chroms = {}
- spos = sys.maxint
- epos = -spos
- for lnum,row in enumerate(mfile):
- line = row.strip()
- if not line: continue
- chrom, snp, genpos, abspos = line.split()
- try:
- ic = int(chrom)
- except:
- ic = None
- if ic and ic <= 23:
- if chromosome == '':
- chromosome = chrom
- chroms.setdefault(chrom,chrom)
- try:
- p = int(abspos)
- if p < spos and p <> 0:
- spos = p
- if p > epos and p <> 0:
- epos = p
- except:
- pass
- markers.append('%s %s' % (snp,abspos)) # no sort - pass
- # now have spos and epos for hapmap if hmpanels
- tempMapName = os.path.join(outfpath,'%s.info' % title)
- tempMap = file(tempMapName,'w')
- tempMap.write('\n'.join(markers))
- tempMap.close()
- tempPedName = os.path.join(outfpath,'%s.ped' % title)
- try: # will fail on winblows!
- os.symlink(DATA_FILE,tempPedName)
- except:
- shutil.copy(DATA_FILE,tempPedName) # wasteful but..
- nchroms = len(chroms) # if > 1 can't really do this safely
- if nchroms > 1:
- s = '## warning - multiple chromosomes found in your map file - %s\n' % ','.join(chroms.keys())
- lf.write(s)
- print >> sys.stdout,s
- sys.exit(1)
- DATA_FILE = tempPedName # for haploview
- INFO_FILE = tempMapName
- dfile.close()
- mfile.close()
- fblog,blog = tempfile.mkstemp()
- ste = open(blog,'w') # to catch the blather
- # if no need to rewrite - set up names for haploview call
- vcl = [javabin,'-jar',hvbin,'-n','-memory','%d' % memSize,'-pairwiseTagging',
- '-pedfile',DATA_FILE,'-info',INFO_FILE,'-tagrsqcounts',
- '-tagrsqcutoff',tagr2,
- '-ldcolorscheme',ldType]
- if minMaf:
- vcl += ['-minMaf','%f' % minMaf]
- if maxDist:
- vcl += ['-maxDistance',maxDist]
- if hiRes:
- vcl.append('-png')
- else:
- vcl.append('-compressedpng')
- if nchroms == 1:
- vcl += ['-chromosome',chromosome]
- if infotrack:
- vcl.append('-infoTrack')
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=ste,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- vcl = [mogrify, '-resize 800x400!', '*.PNG']
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- inpng = '%s.LD.PNG' % DATA_FILE # stupid but necessary - can't control haploview name mangle
- inpng = inpng.replace(' ','')
- inpng = os.path.split(inpng)[-1]
- tmppng = '%s.tmp.png' % title
- tmppng = tmppng.replace(' ','')
- outpng = '1_%s.png' % title
- outpng = outpng.replace(' ','')
- outpng = os.path.split(outpng)[-1]
- vcl = [convert, '-resize 800x400!', inpng, tmppng]
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- s = "text 10,300 '%s'" % title[:40]
- vcl = ['convert', '-pointsize 25','-fill maroon',
- '-draw "%s"' % s, tmppng, outpng]
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- try:
- os.remove(os.path.join(outfpath,tmppng))
- except:
- pass # label all the plots then delete all the .PNG files before munging
- fnum=1
- if hmpanels:
- sp = '%d' % (spos/1000.) # hapmap wants kb
- ep = '%d' % (epos/1000.)
- for panel in hmpanels:
- if panel > '' and panel.lower() <> 'none': # in case someone checks that option too :)
- ptran = panel.strip()
- ptran = ptran.replace('+','_')
- fnum += 1 # preserve an order or else we get sorted
- vcl = [javabin,'-jar',hvbin,'-n','-memory','%d' % memSize,
- '-chromosome',chromosome, '-panel',panel.strip(),
- '-hapmapDownload','-startpos',sp,'-endpos',ep,
- '-ldcolorscheme',ldType]
- if minMaf:
- vcl += ['-minMaf','%f' % minMaf]
- if maxDist:
- vcl += ['-maxDistance',maxDist]
- if hiRes:
- vcl.append('-png')
- else:
- vcl.append('-compressedpng')
- if infotrack:
- vcl.append('-infoTrack')
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=ste,stdout=lf)
- retval = p.wait()
- inpng = 'Chromosome%s%s.LD.PNG' % (chromosome,panel)
- inpng = inpng.replace(' ','') # mysterious spaces!
- outpng = '%d_HapMap_%s_%s.png' % (fnum,ptran,chromosome,)
- # hack for stupid chb+jpt
- outpng = outpng.replace(' ','')
- tmppng = '%s.tmp.png' % title
- tmppng = tmppng.replace(' ','')
- outpng = os.path.split(outpng)[-1]
- vcl = [convert, '-resize 800x400!', inpng, tmppng]
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- s = "text 10,300 'HapMap %s'" % ptran.strip()
- vcl = [convert, '-pointsize 25','-fill maroon',
- '-draw "%s"' % s, tmppng, outpng]
- p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- s = '## executing %s returned %d\n' % (' '.join(vcl),retval)
- lf.write(s)
- try:
- os.remove(os.path.join(outfpath,tmppng))
- except:
- pass
- nimages = len(glob.glob(os.path.join(outfpath,'*.png'))) # rely on HaploView shouting - PNG @!
- lf.write('### nimages=%d\n' % nimages)
- if nimages > 0: # haploview may fail?
- vcl = '%s -format pdf -resize 800x400! *.png' % mogrify
- p=subprocess.Popen(vcl,shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- lf.write('## executing %s returned %d\n' % (vcl,retval))
- vcl = '%s *.pdf --fitpaper true --outfile alljoin.pdf' % pdfjoin
- p=subprocess.Popen(vcl,shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- lf.write('## executing %s returned %d\n' % (vcl,retval))
- vcl = '%s alljoin.pdf --nup 1x%d --outfile allnup.pdf' % (pdfnup,nimages)
- p=subprocess.Popen(vcl,shell=True,cwd=outfpath,stderr=lf,stdout=lf)
- retval = p.wait()
- lf.write('## executing %s returned %d\n' % (vcl,retval))
- #vcl = ['convert', 'allnup.pdf', 'allnup.png'] # this fails - bad pdf?
- #p=subprocess.Popen(' '.join(vcl),shell=True,cwd=outfpath)
- #retval = p.wait()
- #lf.write('## executing %s returned %d\n' % (vcl,retval))
- lf.write('\n'.join(hlog))
- ste.close() # temp file used to catch haploview blather
- hblather = open(blog,'r').readlines() # to catch the blather
- os.unlink(blog)
- if len(hblather) > 0:
- lf.write('## In addition, Haploview complained:')
- lf.write(''.join(hblather))
- lf.write('\n')
- lf.close()
- flist = glob.glob(os.path.join(outfpath, '*'))
- flist.sort()
- ts = '!"#$%&\'()*+,-/:;<=>?@[\\]^_`{|}~' + string.whitespace
- ftran = string.maketrans(ts,'_'*len(ts))
- outf = file(outfile,'w')
- outf.write(galhtmlprefix % progname)
- s = '<h4>rgenetics for Galaxy %s, wrapping HaploView</h4>' % (progname)
- outf.write(s)
- """
- as at ashg 2009, convert fails on allnup.pdf - probably too complex...
- mainthumb = 'allnup.png'
- mainpdf = 'allnup.pdf'
- if os.path.exists(mainpdf):
- if not os.path.exists(mainthumb):
- outf.write('<table><tr><td colspan="3"><a href="%s">Main combined LD plot</a></td></tr></table>\n' % (mainpdf))
- else:
- outf.write('<table><tr><td><a href="%s"><img src="%s" alt="Main combined LD image" hspace="10" align="middle">')
- outf.write('</td><td>Click this thumbnail to display the main combined LD image</td></tr></table>\n' % (mainpdf,mainthumb))
- else:
- outf.write('(No main image was generated - this usually means a Haploview error connecting to Hapmap site - please try later)<br/>\n')
- outf.write('## Called as %s' % sys.argv)
- """
- outf.write('<br><div><hr><ul>\n')
- for i, data in enumerate( flist ):
- dn = os.path.split(data)[-1]
- if dn[:3] <> 'all':
- continue
- newdn = dn.translate(ftran)
- if dn <> newdn:
- os.rename(os.path.join(outfpath,dn),os.path.join(outfpath,newdn))
- dn = newdn
- dnlabel = dn
- ext = dn.split('.')[-1]
- if dn == 'allnup.pdf':
- dnlabel = 'All pdf plots on a single page'
- elif dn == 'alljoin.pdf':
- dnlabel = 'All pdf plots, each on a separate page'
- outf.write('<li><a href="%s">%s - %s</a></li>\n' % (dn,dn,dnlabel))
- for i, data in enumerate( flist ):
- dn = os.path.split(data)[-1]
- if dn[:3] == 'all':
- continue
- newdn = dn.translate(ftran)
- if dn <> newdn:
- os.rename(os.path.join(outfpath,dn),os.path.join(outfpath,newdn))
- dn = newdn
- dnlabel = dn
- ext = dn.split('.')[-1]
- if dn == 'allnup.pdf':
- dnlabel = 'All pdf plots on a single page'
- elif dn == 'alljoin.pdf':
- dnlabel = 'All pdf plots, each on a separate page'
- elif ext == 'info':
- dnlabel = '%s map data for Haploview input' % title
- elif ext == 'ped':
- dnlabel = '%s genotype data for Haploview input' % title
- elif dn.find('CEU') <> -1 or dn.find('YRI') <> -1 or dn.find('CHB_JPT') <> -1: # is hapmap
- dnlabel = 'Hapmap data'
- if ext == 'TAGS' or ext == 'TESTS' or ext == 'CHAPS':
- dnlabel = dnlabel + ' Tagger output'
- outf.write('<li><a href="%s">%s - %s</a></li>\n' % (dn,dn,dnlabel))
- outf.write('</ol><br>')
- outf.write("</div><div><hr>Job Log follows below (see %s)<pre>" % logfn)
- s = file(log_file,'r').readlines()
- s = '\n'.join(s)
- outf.write('%s</pre><hr></div>' % s)
- outf.write('</body></html>')
- outf.close()
- if useTemp:
- try:
- os.unlink(tempMapName)
- os.unlink(tempPedName)
- except:
- pass
-
-if __name__ == "__main__":
- ld()
-
1
0
galaxy-dist commit eee0e1d344d2: Update Tophat and Cufflinks tool wrappers and functional tests to support Tophat version 1.1.* This breaks support for Tophat versions 1.0.* and earlier.
by commits-noreply@bitbucket.org 20 Nov '10
by commits-noreply@bitbucket.org 20 Nov '10
20 Nov '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User jeremy goecks <jeremy.goecks(a)emory.edu>
# Date 1289247694 18000
# Node ID eee0e1d344d21de7fb079fcccc3df8e251d1e025
# Parent 1ebd342fb4eb29c095b19a960503402f75cbe944
Update Tophat and Cufflinks tool wrappers and functional tests to support Tophat version 1.1.* This breaks support for Tophat versions 1.0.* and earlier.
--- a/test-data/tophat_out2.wig
+++ /dev/null
@@ -1,175 +0,0 @@
-track type=bedGraph name="TopHat - read coverage"
-test_chromosome 0 52 0
-test_chromosome 52 53 1
-test_chromosome 53 54 2
-test_chromosome 54 55 3
-test_chromosome 55 57 4
-test_chromosome 57 58 6
-test_chromosome 58 60 7
-test_chromosome 60 65 8
-test_chromosome 65 70 9
-test_chromosome 70 71 10
-test_chromosome 71 72 11
-test_chromosome 72 75 12
-test_chromosome 75 77 13
-test_chromosome 77 79 15
-test_chromosome 79 82 16
-test_chromosome 82 85 17
-test_chromosome 85 87 19
-test_chromosome 87 88 20
-test_chromosome 88 90 21
-test_chromosome 90 91 22
-test_chromosome 91 93 23
-test_chromosome 93 95 26
-test_chromosome 95 97 28
-test_chromosome 97 99 30
-test_chromosome 99 100 31
-test_chromosome 100 101 35
-test_chromosome 101 102 36
-test_chromosome 102 105 38
-test_chromosome 105 106 39
-test_chromosome 106 107 40
-test_chromosome 107 112 43
-test_chromosome 112 114 44
-test_chromosome 114 118 45
-test_chromosome 118 121 46
-test_chromosome 121 122 48
-test_chromosome 122 124 50
-test_chromosome 124 126 53
-test_chromosome 126 129 54
-test_chromosome 129 130 53
-test_chromosome 130 131 55
-test_chromosome 131 132 57
-test_chromosome 132 133 55
-test_chromosome 133 134 54
-test_chromosome 134 135 55
-test_chromosome 135 136 54
-test_chromosome 136 137 56
-test_chromosome 137 138 57
-test_chromosome 138 141 60
-test_chromosome 141 147 62
-test_chromosome 147 148 61
-test_chromosome 148 150 62
-test_chromosome 150 152 61
-test_chromosome 152 153 60
-test_chromosome 153 154 61
-test_chromosome 154 155 63
-test_chromosome 155 156 64
-test_chromosome 156 158 65
-test_chromosome 158 159 66
-test_chromosome 159 160 68
-test_chromosome 160 161 67
-test_chromosome 161 163 68
-test_chromosome 163 164 69
-test_chromosome 164 165 71
-test_chromosome 165 167 73
-test_chromosome 167 168 74
-test_chromosome 168 169 72
-test_chromosome 169 170 75
-test_chromosome 170 171 73
-test_chromosome 171 172 74
-test_chromosome 172 174 75
-test_chromosome 174 175 77
-test_chromosome 175 176 74
-test_chromosome 176 177 73
-test_chromosome 177 181 71
-test_chromosome 181 182 70
-test_chromosome 182 183 67
-test_chromosome 183 184 68
-test_chromosome 184 189 69
-test_chromosome 189 193 68
-test_chromosome 193 194 69
-test_chromosome 194 195 71
-test_chromosome 195 196 72
-test_chromosome 196 197 70
-test_chromosome 197 199 68
-test_chromosome 199 200 66
-test_chromosome 200 201 67
-test_chromosome 201 202 66
-test_chromosome 202 204 65
-test_chromosome 204 205 67
-test_chromosome 205 207 65
-test_chromosome 207 211 66
-test_chromosome 211 213 65
-test_chromosome 213 216 64
-test_chromosome 216 220 62
-test_chromosome 220 224 63
-test_chromosome 224 225 64
-test_chromosome 225 228 66
-test_chromosome 228 229 65
-test_chromosome 229 230 62
-test_chromosome 230 231 61
-test_chromosome 231 232 60
-test_chromosome 232 234 59
-test_chromosome 234 237 58
-test_chromosome 237 238 57
-test_chromosome 238 239 55
-test_chromosome 239 240 53
-test_chromosome 240 241 50
-test_chromosome 241 242 51
-test_chromosome 242 243 52
-test_chromosome 243 244 53
-test_chromosome 244 246 50
-test_chromosome 246 247 52
-test_chromosome 247 249 50
-test_chromosome 249 250 47
-test_chromosome 250 349 0
-test_chromosome 349 350 1
-test_chromosome 350 351 49
-test_chromosome 351 352 51
-test_chromosome 352 353 53
-test_chromosome 353 354 54
-test_chromosome 354 357 55
-test_chromosome 357 358 56
-test_chromosome 358 361 55
-test_chromosome 361 362 57
-test_chromosome 362 365 56
-test_chromosome 365 366 57
-test_chromosome 366 368 58
-test_chromosome 368 369 57
-test_chromosome 369 372 56
-test_chromosome 372 375 59
-test_chromosome 375 378 60
-test_chromosome 378 379 59
-test_chromosome 379 380 57
-test_chromosome 380 381 56
-test_chromosome 381 382 54
-test_chromosome 382 384 53
-test_chromosome 384 386 52
-test_chromosome 386 387 51
-test_chromosome 387 388 50
-test_chromosome 388 390 48
-test_chromosome 390 395 47
-test_chromosome 395 396 45
-test_chromosome 396 398 44
-test_chromosome 398 399 43
-test_chromosome 399 400 42
-test_chromosome 400 402 1
-test_chromosome 402 500 0
-test_chromosome 500 508 39
-test_chromosome 508 509 38
-test_chromosome 509 510 37
-test_chromosome 510 511 36
-test_chromosome 511 516 35
-test_chromosome 516 517 33
-test_chromosome 517 518 31
-test_chromosome 518 521 29
-test_chromosome 521 522 26
-test_chromosome 522 524 25
-test_chromosome 524 525 24
-test_chromosome 525 526 22
-test_chromosome 526 527 20
-test_chromosome 527 528 18
-test_chromosome 528 529 17
-test_chromosome 529 530 16
-test_chromosome 530 532 15
-test_chromosome 532 534 14
-test_chromosome 534 536 13
-test_chromosome 536 540 11
-test_chromosome 540 541 10
-test_chromosome 541 543 9
-test_chromosome 543 544 8
-test_chromosome 544 545 7
-test_chromosome 545 547 6
-test_chromosome 547 549 3
-test_chromosome 549 549 2
--- a/tools/ngs_rna/tophat_wrapper.py
+++ b/tools/ngs_rna/tophat_wrapper.py
@@ -10,9 +10,8 @@ def __main__():
#Parse Command Line
parser = optparse.OptionParser()
parser.add_option( '-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.' )
- parser.add_option( '-C', '--coverage-output', dest='coverage_output_file', help='Coverage output file; formate is WIG.' )
parser.add_option( '-J', '--junctions-output', dest='junctions_output_file', help='Junctions output file; formate is BED.' )
- parser.add_option( '-H', '--hits-output', dest='accepted_hits_output_file', help='Accepted hits output file; formate is SAM.' )
+ parser.add_option( '-H', '--hits-output', dest='accepted_hits_output_file', help='Accepted hits output file; formate is BAM.' )
parser.add_option( '', '--own-file', dest='own_file', help='' )
parser.add_option( '-D', '--indexes-path', dest='index_path', help='Indexes directory; location of .ebwt and .fa files.' )
parser.add_option( '-r', '--mate-inner-dist', dest='mate_inner_dist', help='This is the expected (mean) inner distance between mate pairs. \
@@ -186,33 +185,14 @@ def __main__():
tmp_stderr.close()
if returncode != 0:
raise Exception, stderr
+
+ # TODO: look for errors in program output.
+
+ # Copy output files from tmp directory to specified files.
+ shutil.copyfile( os.path.join( tmp_output_dir, "junctions.bed" ), options.junctions_output_file )
+ shutil.copyfile( os.path.join( tmp_output_dir, "accepted_hits.bam" ), options.accepted_hits_output_file )
except Exception, e:
- # Clean up temp dirs
- if os.path.exists( tmp_output_dir ):
- shutil.rmtree( tmp_output_dir )
- stop_err( 'Error in tophat:\n' + str( e ) )
-
- # TODO: look for errors in program output.
-
- # Postprocessing: copy output files from tmp directory to specified files. Also need to remove header lines from SAM file.
- try:
- try:
- shutil.copyfile( os.path.join( tmp_output_dir, "coverage.wig" ), options.coverage_output_file )
- shutil.copyfile( os.path.join( tmp_output_dir, "junctions.bed" ), options.junctions_output_file )
-
- # Remove headers from SAM file in place.
- in_header = True # Headers always at start of file.
- for line in fileinput.input( os.path.join( tmp_output_dir, "accepted_hits.sam" ), inplace=1 ):
- if in_header and line.startswith("@"):
- continue
- else:
- in_header = False
- sys.stdout.write( line )
-
- # Copy SAM File.
- shutil.copyfile( os.path.join( tmp_output_dir, "accepted_hits.sam" ), options.accepted_hits_output_file )
- except Exception, e:
- stop_err( 'Error in tophat:\n' + str( e ) )
+ stop_err( 'Error in tophat:\n' + str( e ) )
finally:
# Clean up temp dirs
if os.path.exists( tmp_index_dir ):
--- a/test-data/tophat_out3.bed
+++ /dev/null
@@ -1,3 +0,0 @@
-track name=junctions description="TopHat junctions"
-test_chromosome 180 402 JUNC00000001 46 + 180 402 255,0,0 2 70,52 0,170
-test_chromosome 349 550 JUNC00000002 38 + 349 550 255,0,0 2 51,50 0,151
--- a/tools/ngs_rna/cuffdiff_wrapper.xml
+++ b/tools/ngs_rna/cuffdiff_wrapper.xml
@@ -33,8 +33,8 @@
</command><inputs><param format="gtf" name="gtf_input" type="data" label="Transcripts" help="A transcript GTF file produced by cufflinks, cuffcompare, or other source."/>
- <param format="sam" name="aligned_reads1" type="data" label="SAM file of aligned RNA-Seq reads" help=""/>
- <param format="sam" name="aligned_reads2" type="data" label="SAM file of aligned RNA-Seq reads" help=""/>
+ <param format="sam,bam" name="aligned_reads1" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/>
+ <param format="sam,bam" name="aligned_reads2" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/><param name="fdr" type="float" value="0.05" label="False Discovery Rate" help="The allowed false discovery rate."/><param name="min_mapqual" type="integer" value="0" label="Min SAM Mapping Quality" help="Instructs Cufflinks to ignore alignments with a SAM mapping quality lower than this number."/><param name="min_alignment_count" type="integer" value="0" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/>
--- /dev/null
+++ b/test-data/tophat_out1.bed
@@ -0,0 +1,3 @@
+track name=junctions description="TopHat junctions"
+test_chromosome 180 402 JUNC00000001 46 + 180 402 255,0,0 2 70,52 0,170
+test_chromosome 349 550 JUNC00000002 38 + 349 550 255,0,0 2 51,50 0,151
--- a/tools/ngs_rna/cufflinks_wrapper.xml
+++ b/tools/ngs_rna/cufflinks_wrapper.xml
@@ -23,7 +23,7 @@
#end if
</command><inputs>
- <param format="sam" name="input" type="data" label="SAM file of aligned RNA-Seq reads" help=""/>
+ <param format="sam,bam" name="input" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/><param name="max_intron_len" type="integer" value="300000" label="Max Intron Length" help=""/><param name="min_isoform_fraction" type="float" value="0.05" label="Min Isoform Fraction" help=""/><param name="pre_mrna_fraction" type="float" value="0.05" label="Pre MRNA Fraction" help=""/>
--- a/tools/ngs_rna/tophat_wrapper.xml
+++ b/tools/ngs_rna/tophat_wrapper.xml
@@ -1,15 +1,14 @@
-<tool id="tophat" name="Tophat" version="1.1.1">
+<tool id="tophat" name="Tophat" version="1.1.2"><description>Find splice junctions using RNA-seq data</description><requirements><requirement type="package">tophat</requirement></requirements><command interpreter="python">
tophat_wrapper.py
- ## Change this to accomodate the number of threads you have available.
+ ## Change this to accommodate the number of threads you have available.
--num-threads="4"
## Provide outputs.
- --coverage-output=$coverage
--junctions-output=$junctions
--hits-output=$accepted_hits
@@ -338,9 +337,8 @@
</inputs><outputs>
- <data format="sam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"/>
- <data format="bedgraph" name="coverage" label="${tool.name} on ${on_string}: coverage"/><data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"/>
+ <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"/></outputs><tests>
@@ -367,9 +365,9 @@
<param name="input2" ftype="fastqsanger" value="tophat_in2.fq"/><param name="mate_inner_distance" value="20"/><param name="pSettingsType" value="preSet"/>
- <output name="accepted_hits" file="tophat_out1.sam" sort="True"/>
- <output name="coverage" file="tophat_out2.wig"/>
- <output name="junctions" file="tophat_out3.bed"/>
+ <output name="junctions" file="tophat_out1.bed"/>
+ <!-- Bam files always differ (due to magic number?), so can't test this right now. -->
+ <output name="accepted_hits" file="tophat_out2.bam" lines_diff="100000"/></test><!-- <test><param name="genomeSource" value="history"/>
@@ -451,15 +449,13 @@ Tophat accepts files in Sanger FASTQ for
**Outputs**
-Tophat produces three output files:
+Tophat produces two output files:
-- coverage.wig -- A UCSC BedGraph_ wigglegram track, showing the depth of coverage at each position, including the spliced read alignments.
-- accepted_hits.sam -- A list of read alignments in SAM_ format.
-- junctions.bed -- A UCSC BED_ track of junctions reported by TopHat. Each junction consists of two connected BED blocks, where each block is as long as the maximal overhang of any read spanning the junction. The score is the number of alignments spanning the junction.
-
-.. _BedGraph: http://genome.ucsc.edu/goldenPath/help/bedgraph.html
-.. _SAM: http://samtools.sourceforge.net/
+- junctions -- A UCSC BED_ track of junctions reported by TopHat. Each junction consists of two connected BED blocks, where each block is as long as the maximal overhang of any read spanning the junction. The score is the number of alignments spanning the junction.
+- accepted_hits -- A list of read alignments in BAM_ format.
+
.. _BED: http://genome.ucsc.edu/FAQ/FAQformat.html#format1
+.. _BAM: http://samtools.sourceforge.net/
-------
--- a/test-data/tophat_out1.sam
+++ /dev/null
@@ -1,179 +0,0 @@
-test_mRNA_103_284_2a 161 test_chromosome 153 255 75M = 360 0 CGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_103_284_2a 81 test_chromosome 360 255 41M100N34M = 153 0 TTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_104_274_1c 73 test_chromosome 350 255 51M100N24M * 0 0 CACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_104_278_3e 161 test_chromosome 154 255 75M = 354 0 GACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTTTTTGGCGCGCGGCCCTACGGCTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_104_278_3e 81 test_chromosome 354 255 47M100N28M = 154 0 ATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGAATCGAGGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_105_266_13 163 test_chromosome 155 255 75M = 242 0 ACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_105_266_13 83 test_chromosome 242 255 9M100N50M100N16M = 155 0 CGATCCGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_105_276_c 161 test_chromosome 155 255 75M = 352 0 ACTGGACTATTTAGGACGATCGGACTGAGGAAGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_105_276_c 81 test_chromosome 352 255 49M100N26M = 155 0 CTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGGCTTTTTCTACTTGAGACTGGGATCGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_106_253_45 137 test_chromosome 156 255 75M * 0 0 CTGGACTATTTAGGTCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_107_286_5 161 test_chromosome 157 255 75M = 362 0 TGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_107_286_5 81 test_chromosome 362 255 39M100N36M = 157 0 ATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_110_267_22 163 test_chromosome 160 255 75M = 243 0 ACTAGTTAGGGCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAGTTGGCGCGCGGCCCTACGACTGAGCGTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:5 NH:i:1
-test_mRNA_110_267_22 83 test_chromosome 243 255 8M100N50M100N17M = 160 0 GATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_110_271_28 147 test_chromosome 247 255 4M100N50M100N21M = 160 0 CGCCACTATTACTTTATTATCTTACTCGGACGAAGACGGATCGGCAACGGGGCTTTTTCTACTTGAGACTGGGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_110_271_28 99 test_chromosome 160 255 75M = 247 0 ACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_111_268_d 73 test_chromosome 244 255 7M100N50M100N18M * 0 0 ATACGCCACTATTATTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_111_297_61 161 test_chromosome 161 255 75M = 373 0 CTATTTAGGACGATCGGACTGGGGAGGGCAGTAGGACGCTACGGATTTGGCGCGCGGCCCTACGGCTGAGCGTCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_111_297_61 81 test_chromosome 373 255 28M100N47M = 161 0 CGGACGTAGACGGATCCGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_114_277_5b 161 test_chromosome 164 255 75M = 353 0 TTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGCCTGAGCGTCGAGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_114_277_5b 81 test_chromosome 353 255 48M100N27M = 164 0 TATTACTTTATTATCTTACTCGGAGGTAGACGGAACGGCAACGGGACTTTTTCTGCTTGAGACTGGGATCGAGGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_116_271_2b 163 test_chromosome 166 255 75M = 247 0 TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_116_271_2b 83 test_chromosome 247 255 4M100N50M100N21M = 166 0 CGCCACTATTACTTTATTATCTTACTCGGACGTAGACAGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_116_295_63 161 test_chromosome 166 255 75M = 371 0 TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_116_295_63 81 test_chromosome 371 255 30M100N45M = 166 0 CTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_118_297_f 161 test_chromosome 168 255 75M = 373 0 GGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_118_297_f 81 test_chromosome 373 255 28M100N47M = 168 0 CGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_11_190_1a 147 test_chromosome 166 255 75M = 61 0 TAGGTCGATGGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGTGGCCCTACGGCTGAGCGTCGAGCTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_11_190_1a 99 test_chromosome 61 255 75M = 166 0 GACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_122_299_6 161 test_chromosome 172 255 75M = 375 0 GATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_122_299_6 81 test_chromosome 375 255 26M100N49M = 172 0 GACGTAGACGGAGCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_125_280_48 145 test_chromosome 356 255 45M100N30M = 175 0 TACTTTATTATCTTACTCTGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGAGCGAGGCGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_125_280_48 97 test_chromosome 175 255 75M = 356 0 CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGAAACGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_125_293_60 161 test_chromosome 175 255 75M = 369 0 CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCTTCGAGGTTGCGATACGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_125_293_60 81 test_chromosome 369 255 32M100N43M = 175 0 TACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_126_282_18 161 test_chromosome 176 255 75M = 358 0 GGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_126_282_18 81 test_chromosome 358 255 43M100N32M = 176 0 CTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_128_252_36 137 test_chromosome 228 255 23M100N52M * 0 0 GAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGGAACGGGACTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_131_260_33 147 test_chromosome 236 255 15M100N50M100N10M = 181 0 AGCTTGTGATACGCCACTATTACTTTATTATCTTACTCGGACGTAAACGGATCGGCCACGGGACTTTTTTTACTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_131_260_33 99 test_chromosome 181 255 70M100N5M = 236 0 GAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_145_300_37 163 test_chromosome 195 255 56M100N19M = 376 0 GACGCTACGTATTTGGCGCGGGGCCCTATGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTAGTATATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:5 XS:A:+ NH:i:1
-test_mRNA_145_300_37 83 test_chromosome 376 255 25M100N50M = 195 0 ACGTAGACGGATCGGAAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_150_290_0 73 test_chromosome 366 255 35M100N40M * 0 0 TCTTACTCGGACGTAGACGGATCGCCAACGGGACTTTTTCTACTTGAGACTGAGACCGAGGCGGACTTTTTAGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_151_286_e 137 test_chromosome 362 255 39M100N36M * 0 0 ATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTATCTACTTGAGACTGGGATCGAGGCGGACTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_151_297_1d 137 test_chromosome 373 255 28M100N47M * 0 0 CGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACATTTTAGGACGGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_16_194_10 163 test_chromosome 66 255 75M = 170 0 GACTGGATGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACGGACGGACTTAAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_16_194_10 83 test_chromosome 170 255 75M = 66 0 ACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_172_294_4f 147 test_chromosome 370 255 31M100N44M = 222 0 ACTCGGACGTAGACGGGTCGGCAGCGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGGACGTTTTAGGACGGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_172_294_4f 99 test_chromosome 222 255 29M100N46M = 370 0 ACGGATGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTCCTCGGACGTAGACGGATCGCCAACGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_21_208_24 163 test_chromosome 71 255 75M = 184 0 GAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_21_208_24 83 test_chromosome 184 255 67M100N8M = 71 0 GAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGCCTGAGCGTCGAGCTTGCGATACGCCACTATTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_22_173_62 147 test_chromosome 149 255 75M = 72 0 GCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_22_173_62 99 test_chromosome 72 255 75M = 149 0 AGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_23_186_42 163 test_chromosome 73 255 75M = 162 0 GGCGCTTGTGACTGAGCTAGGACGTGCCACTACGGGGATGAAGACTAGGACTACGGACGGACTTAGAGCGTCAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_23_186_42 83 test_chromosome 162 255 75M = 73 0 TATTTAGGACGATCGGACGGAGGAGGGCAGAAGGACGCTACGTATTTGGCGCGCGGCCCTACGACTGAGCGTCGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_26_189_30 163 test_chromosome 76 255 75M = 165 0 GCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_26_189_30 83 test_chromosome 165 255 75M = 76 0 TTAGGACGATCGGACTGAGGAGGGCAGTAGGACGGTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_28_188_11 147 test_chromosome 164 255 75M = 78 0 TTTAGGACGATCGGACTGAGGAAGGCAGTAGGACGCTTCGTATTTGGCGCGAGGCCCTACGGCTGAGCGTCGAGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_28_188_11 99 test_chromosome 78 255 75M = 164 0 TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGAACGGACTTAGAGCGTCAGATGCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_28_206_1f 73 test_chromosome 78 255 75M * 0 0 TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGACGCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_30_231_3c 161 test_chromosome 80 255 75M = 207 0 GCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_30_231_3c 81 test_chromosome 207 255 44M100N31M = 80 0 TTGGCGCGCGGCCCTACGGCTAAGCGTCGAGCTTGCGATACGCCACTATTACTTTAATATCTTACTCGCACGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_33_189_4a 73 test_chromosome 165 255 75M * 0 0 TTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACCTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGGGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_33_223_4e 73 test_chromosome 83 255 75M * 0 0 ACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_36_146_27 163 test_chromosome 86 255 75M = 122 0 GCGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACAGACGGACTTAGAGCGTCAGATGCAGCGACTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_36_146_27 83 test_chromosome 122 255 75M = 86 0 ACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGTGCAGTAGGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_36_218_12 147 test_chromosome 194 255 57M100N18M = 86 0 GGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_36_218_12 99 test_chromosome 86 255 75M = 194 0 GAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGCCTTAGAGCGTCAGATGCAGCGACTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_38_199_29 147 test_chromosome 175 255 75M = 88 0 CGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_38_199_29 99 test_chromosome 88 255 75M = 175 0 GCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_39_219_5c 147 test_chromosome 195 255 56M100N19M = 89 0 GACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCCAGCTTGCGATACGCCACTATTACTTTATTATCTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_39_219_5c 99 test_chromosome 89 255 75M = 195 0 CTAGGACGTCCCACTATGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGGCTGGACTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_3_187_51 147 test_chromosome 163 255 75M = 53 0 ATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_3_187_51 99 test_chromosome 53 255 75M = 163 0 TACTATTTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_41_236_55 145 test_chromosome 212 255 39M100N36M = 91 0 GCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_41_236_55 97 test_chromosome 91 255 75M = 212 0 AGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_42_209_25 147 test_chromosome 185 255 66M100N9M = 92 0 AGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_42_209_25 99 test_chromosome 92 255 75M = 185 0 GGACGTGCCACTACGTGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_44_193_3f 147 test_chromosome 169 255 75M = 94 0 GACGATCGGACTGGGGAGAGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_44_193_3f 99 test_chromosome 94 255 75M = 169 0 ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGTCTATTTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_44_197_35 147 test_chromosome 173 255 75M = 94 0 ATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGATCGTCGAGCTTGCGATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_44_197_35 99 test_chromosome 94 255 75M = 173 0 ACGTGCAACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_44_225_1e 163 test_chromosome 94 255 75M = 201 0 ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCGGGTGCAGCGACTGGACTATTTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_44_225_1e 83 test_chromosome 201 255 50M100N25M = 94 0 ACGTATATGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_46_195_17 137 test_chromosome 96 255 75M * 0 0 GTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_46_232_2f 147 test_chromosome 208 255 43M100N32M = 96 0 TGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_46_232_2f 99 test_chromosome 96 255 75M = 208 0 GTGCCACTACGGGGATGACGACTAGGACTACGGCCGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_48_207_39 73 test_chromosome 98 255 75M * 0 0 GCCCCTACGGGGATGACGACTAGGACTACGGACGGATTTAGACCGTCAGATGCAGCGACTGGACTATTTAGGACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_48_249_20 161 test_chromosome 98 255 75M = 225 0 GCCACTACGGGGATGACGACTAGGACGACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_48_249_20 81 test_chromosome 225 255 26M100N49M = 98 0 GCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTACTATCTTACTCGGACGGAGACGGATCGGCAACGGGAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_4_191_5d 163 test_chromosome 54 255 75M = 167 0 ACTATCTGACGAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTACCATTACGCGGATGACGACTAGGACTACGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_4_191_5d 83 test_chromosome 167 255 75M = 54 0 AGGACGATCGGACTGAGTAGGGCAGTAGGACACTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_50_224_2d 163 test_chromosome 100 255 75M = 200 0 CACTACGAGGATGACGTCTAGGACTACGGACGGACTTAGAGCGTCAGACGCAGCGACTGGACTATTTAGGACGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_50_224_2d 83 test_chromosome 200 255 51M100N24M = 100 0 TACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_51_194_47 163 test_chromosome 101 255 75M = 170 0 ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_51_194_47 83 test_chromosome 170 255 75M = 101 0 ACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_51_194_49 147 test_chromosome 170 255 75M = 101 0 ACGTTCGGACTGAGGAGGGCAGTAGGACGCCACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_51_194_49 99 test_chromosome 101 255 75M = 170 0 ACTACGGGGATGACGACTAGGCCTACGGATGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_51_237_a 147 test_chromosome 213 255 38M100N37M = 101 0 CGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_51_237_a 99 test_chromosome 101 255 75M = 213 0 ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_51_248_14 145 test_chromosome 224 255 27M100N48M = 101 0 GGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGAACGGCAACGGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_51_248_14 97 test_chromosome 101 255 75M = 224 0 ACTACGGGGATGACGACGAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGAACTTTTTAGGACGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_52_261_1b 145 test_chromosome 237 255 14M100N50M100N11M = 102 0 GCTTGCGATACGCCACTATTACTTAATTATCTTACTCGGACGTAGAAGGATCGGCAACGGGACTTTTTCTACTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_52_261_1b 97 test_chromosome 102 255 75M = 237 0 CTACGGGAATGACGACTAGGGCTACGGAGGGACTTACAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 NH:i:1
-test_mRNA_53_212_19 147 test_chromosome 188 255 63M100N12M = 103 0 GCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTTCTTTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_53_212_19 99 test_chromosome 103 255 75M = 188 0 TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATTTAGGACGATCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_53_272_5a 161 test_chromosome 103 255 75M = 248 0 TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_53_272_5a 81 test_chromosome 248 255 3M100N50M100N22M = 103 0 GCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGACACTGGGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_56_183_56 147 test_chromosome 159 255 75M = 106 0 GACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_56_183_56 99 test_chromosome 106 255 75M = 159 0 GGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTGGGACGATCGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_57_231_8 147 test_chromosome 207 255 44M100N31M = 107 0 TTGGCGCGCGGCCCTAGGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_57_231_8 99 test_chromosome 107 255 75M = 207 0 GGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCACCGACTGGACTATTTAGGACGATCGGACTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_58_218_16 163 test_chromosome 108 255 75M = 194 0 GGATGACGACTAGGACTACGGACGGACTTAGAACGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_58_218_16 83 test_chromosome 194 255 57M100N18M = 108 0 GGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_58_220_3d 163 test_chromosome 108 255 75M = 196 0 GGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_58_220_3d 83 test_chromosome 196 255 55M100N20M = 108 0 ACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGGTTGCGATACGCCACTATTACTTTATTATCTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_58_234_7 163 test_chromosome 108 255 75M = 210 0 GGATGACGCCTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_58_234_7 83 test_chromosome 210 255 41M100N34M = 108 0 GCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTAGTTTATTATCTGACTCGGACGTAGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_5_197_46 145 test_chromosome 173 255 75M = 55 0 ATCGGACGGAGGAGGGCAGTAGGACGCTACGTATTTGGCGGGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_5_197_46 97 test_chromosome 55 255 75M = 173 0 CTATCTGACTAGACTCGAGGCGCTTGCGTCTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_63_229_4c 163 test_chromosome 113 255 75M = 205 0 ACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGGGACTGGACTATTTAGGACGATCGGACTGAGGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_63_229_4c 83 test_chromosome 205 255 46M100N29M = 113 0 ATTTGGCGCGCGGCCCTACGGCTGAGTGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_65_238_2e 147 test_chromosome 214 255 37M100N38M = 115 0 GCGGCCCTACGGCTGCGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_65_238_2e 99 test_chromosome 115 255 75M = 214 0 GACTAGGACTACGGACGGACTTAGAGCGTCAGAAGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_69_229_23 163 test_chromosome 119 255 75M = 205 0 AGGACTACGGACGGACTTATAGGGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_69_229_23 83 test_chromosome 205 255 46M100N29M = 119 0 CTTTGGCGCGCGGCCCTACGGCTGAGCGTCTAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_6_182_59 147 test_chromosome 158 255 75M = 56 0 GGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_6_182_59 99 test_chromosome 56 255 75M = 158 0 TATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCAGTACGGGGATGACGACTAGGACTACGGAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_72_258_4 163 test_chromosome 122 255 75M = 234 0 ACTACGGACGGACTTAGAGCGTCAGATGCAGCAACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_72_258_4 83 test_chromosome 234 255 17M100N50M100N8M = 122 0 CGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATGGGCAACGGGACTTTTTCTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_73_240_34 147 test_chromosome 216 255 35M100N40M = 123 0 GGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTTCTCGGACGTAGACGGATCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_73_240_34 99 test_chromosome 123 255 75M = 216 0 CTACGGACGGACTTAGAGCGTCAGATGCAGCGAATGGACTATTTAGGACGCTCGGACTGAGGAGGGCAGTAGGAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_73_259_5e 147 test_chromosome 235 255 16M100N50M100N9M = 123 0 GAGCTTGCGATACGCCACTATTACTGTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_73_259_5e 99 test_chromosome 123 255 75M = 235 0 CTACGGACGGACTTAGAGCGTCAGATGCTGCGACTGGACTATTTGGGACGATCGGACTGAGGAGGGCAGTAGGAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_75_204_54 73 test_chromosome 125 255 75M * 0 0 ACGGACGGACTTCGAGCCTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_75_235_21 73 test_chromosome 125 255 75M * 0 0 ACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGCACGATCGGACTGAGGAGGGCAGTAGAACGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_75_277_3b 145 test_chromosome 353 255 48M100N27M = 125 0 TATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACCTGAGACTGGGATCGAGGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_75_277_3b 97 test_chromosome 125 255 75M = 353 0 ACGGACGGACTTAAAGCTTCAGATGCAGCGACAGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_77_256_2c 73 test_chromosome 127 255 75M * 0 0 GGACGGACTTAGAGCATCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_78_276_4b 145 test_chromosome 352 255 49M100N26M = 128 0 CTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTAGGATCGAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_78_276_4b 97 test_chromosome 128 255 75M = 352 0 GACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGGCGCTAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_79_256_31 137 test_chromosome 129 255 75M * 0 0 ACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_81_228_3a 163 test_chromosome 131 255 75M = 204 0 GGACTGAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGTAGTAGGACGCTACGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_81_228_3a 83 test_chromosome 204 255 47M100N28M = 131 0 TATTTGGCGCGCGGCCCTATGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGTAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_81_245_4d 163 test_chromosome 131 255 75M = 221 0 GGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGATGAGGGCAGTAGGACGCTACGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_81_245_4d 83 test_chromosome 221 255 30M100N45M = 131 0 TACGGCTGAGCGTCGAGGTTGCGATACGCCACTATTACTTTATAATCTTACTCGGACGTAGACGGATCGGCAACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_82_255_2 137 test_chromosome 132 255 75M * 0 0 GACTTAGAGCGTCAGATGCAGCGACTGGACTTTTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_82_271_58 147 test_chromosome 247 255 4M100N50M100N21M = 132 0 CGCCACTATTACTTTATTATCTTACTCGGACGTAGACGCATCGGCAACGGGACTTTTTCTACTTGAGACTGGGAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_82_271_58 99 test_chromosome 132 255 75M = 247 0 GACTTAGAGCGTCAGTTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_85_268_53 147 test_chromosome 244 255 7M100N50M100N18M = 135 0 ATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGTCAACGGGACTTTTTCTACTTGAGACTGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_85_268_53 99 test_chromosome 135 255 75M = 244 0 TTAGTGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_85_275_38 137 test_chromosome 351 255 50M100N25M * 0 0 ACTCTTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTACTACTTGAGACTGGGATCGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_87_250_57 163 test_chromosome 137 255 75M = 226 0 AGAGCGTCAGATGCAGAGACTGGACTATTTAGGACGATCGGACTGAGGAGTGCAGTAGGACGCTACGTATTTGGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_87_250_57 83 test_chromosome 226 255 25M100N50M = 137 0 ATGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NH:i:1
-test_mRNA_87_279_5f 161 test_chromosome 137 255 75M = 355 0 AGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACCGAGGAGGGCAGTAGGACGCTACGTATTTGGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_87_279_5f 81 test_chromosome 355 255 46M100N29M = 137 0 TTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTGGGATCGAGGCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:+ NH:i:1
-test_mRNA_88_257_50 137 test_chromosome 138 255 75M * 0 0 GAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_89_230_b 163 test_chromosome 139 255 75M = 206 0 AGCGTCAGGTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_89_230_b 83 test_chromosome 206 255 45M100N30M = 139 0 TCTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTAACTCACTCGGACGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_89_245_15 147 test_chromosome 221 255 30M100N45M = 139 0 TACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTTCTCTATTATCTTACTCGGACGTAGACGGATCGGCAACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_89_245_15 99 test_chromosome 139 255 75M = 221 0 AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_89_267_32 163 test_chromosome 139 255 75M = 243 0 AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGAGTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_89_267_32 83 test_chromosome 243 255 8M100N50M100N17M = 139 0 GATACGGCACTATTACTTTATTATCTTTCTCGGACGTAGACGGATCGGCAACGGGACTTTTTCTACTTGAGACTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_8_155_9 163 test_chromosome 58 255 75M = 131 0 TGTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_8_155_9 83 test_chromosome 131 255 75M = 58 0 GGACTTCGAGCGTCAGATGCAGCGACTGTACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_8_197_1 147 test_chromosome 173 255 75M = 58 0 ATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_8_197_1 99 test_chromosome 58 255 75M = 173 0 TCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGACACTACGGGGATGGCGACTAGGACTACGGACGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
-test_mRNA_91_256_41 73 test_chromosome 141 255 75M * 0 0 CGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_92_250_44 147 test_chromosome 226 255 25M100N50M = 142 0 CTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGGTACGGGACT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NH:i:1
-test_mRNA_92_250_44 99 test_chromosome 142 255 75M = 226 0 GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 NH:i:1
-test_mRNA_92_266_43 147 test_chromosome 242 255 9M100N50M100N16M = 142 0 CGATACGCCACTATTACTTTCTTATCTTACTCGGACGTAGACGGAGCGGCAACGGGACTTTTTCTACTTGAGACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_92_266_43 99 test_chromosome 142 255 75M = 242 0 GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTCAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_94_291_40 137 test_chromosome 367 255 34M100N41M * 0 0 CTTCCTGGGACGTAGACGGATCGGCAACGCGACATTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTGGGAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:5 XS:A:+ NH:i:1
-test_mRNA_96_238_3 163 test_chromosome 146 255 75M = 214 0 GATGCAGCGACTGGACTATTTAGGACGATCGGACGGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 NH:i:1
-test_mRNA_96_238_3 83 test_chromosome 214 255 37M100N38M = 146 0 GCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCTACTAGTACTTTATTATCTTACGCGGACGTAGACGGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XS:A:+ NH:i:1
-test_mRNA_97_275_26 145 test_chromosome 351 255 50M100N25M = 147 0 ACTATTACTTTATTATCTTAGTCGGACGTAGACGGATCGGAAACGGGACTCTTTCTACTTGAGACTGGGATCGAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:3 XS:A:+ NH:i:1
-test_mRNA_97_275_26 97 test_chromosome 147 255 75M = 351 0 ATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_9_179_52 163 test_chromosome 59 255 75M = 155 0 CTGACTAGACTGGAGGCGCTCGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 NH:i:1
-test_mRNA_9_179_52 83 test_chromosome 155 255 75M = 59 0 ACTGGACCATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 NH:i:1
Binary file test-data/tophat_out2.bam has changed
1
0