galaxy-commits November 2010

galaxy-commits@lists.galaxyproject.org

1 participants
286 discussions

galaxy-dist commit 7e9ae4605105: Add a new "Files uploaded via FTP" grid to the upload form and related parameter types, form fields, etc.
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Nate Coraor <nate(a)bx.psu.edu> # Date 1288969490 14400 # Node ID 7e9ae46051057d822aff82a9b1f3aec0200086f2 # Parent cdd6ce1f38b0e22802ed63e3e0cb4f6a58cb93b2 Add a new "Files uploaded via FTP" grid to the upload form and related parameter types, form fields, etc. --- a/tools/data_source/upload.xml +++ b/tools/data_source/upload.xml @@ -1,6 +1,6 @@ <?xml version="1.0"?> -<tool name="Upload File" id="upload1" version="1.1.1"> +<tool name="Upload File" id="upload1" version="1.1.2"><description> from your computer </description> @@ -29,6 +29,7 @@ <validator type="expression" message="You will need to reselect the file you specified (%s)." substitute_value_in_message="True">not ( ( isinstance( value, unicode ) or isinstance( value, str ) ) and value != "" )</validator></param><param name="url_paste" type="text" area="true" size="5x35" label="URL/Text" help="Here you may specify a list of URLs (one per line) or paste the contents of a file."/> + <param name="ftp_files" type="ftpfile" label="Files uploaded via FTP"/><param name="space_to_tab" type="select" display="checkboxes" multiple="True" label="Convert spaces to tabs" help="Use this option if you are entering intervals by hand."><option value="Yes">Yes</option></param> --- a/lib/galaxy/web/form_builder.py +++ b/lib/galaxy/web/form_builder.py @@ -2,9 +2,10 @@ Classes for generating HTML forms """ -import logging,sys +import logging, sys, os, time from cgi import escape -from galaxy.util import restore_text +from galaxy.util import restore_text, relpath, nice_size +from galaxy.web import url_for log = logging.getLogger(__name__) @@ -145,6 +146,68 @@ class FileField(BaseField): ajax_text = ' galaxy-ajax-upload="true"' return '<input type="file" name="%s%s"%s%s>' % ( prefix, self.name, ajax_text, value_text ) +class FTPFileField(BaseField): + """ + An FTP file upload input. + """ + thead = ''' + <table id="grid-table" class="grid"> + <thead id="grid-table-header"> + <tr> + <th id="select-header"></th> + <th id="name-header"> + File + </th> + <th id="size-header"> + Size + </th> + <th id="date-header"> + Date + </th> + </tr> + </thead> + <tbody id="grid-table-body"> + ''' + trow = ''' + <tr> + <td><input type="checkbox" name="%s%s" value="%s"/></td> + <td>%s</td> + <td>%s</td> + <td>%s</td> + </tr> + ''' + tfoot = ''' + </tbody> + </table> + ''' + def __init__( self, name, dir, ftp_site, value = None ): + self.name = name + self.dir = dir + self.ftp_site = ftp_site + self.value = value + def get_html( self, prefix="" ): + rval = FTPFileField.thead + if self.dir is None: + rval += '<tr><td colspan="3"><em>Please <a href="%s">create</a> or <a href="%s">log in to</a> a Galaxy account to view files uploaded via FTP.</em></td></tr>' % ( url_for( controller='user', action='create', referer=url_for( controller='root' ) ), url_for( controller='user', action='login', referer=url_for( controller='root' ) ) ) + elif not os.path.exists( self.dir ): + rval += '<tr><td colspan="3"><em>Your FTP upload directory contains no files.</em></td></tr>' + else: + uploads = [] + for ( dirpath, dirnames, filenames ) in os.walk( self.dir ): + for filename in filenames: + path = relpath( os.path.join( dirpath, filename ), self.dir ) + statinfo = os.lstat( os.path.join( dirpath, filename ) ) + uploads.append( dict( path=path, + size=nice_size( statinfo.st_size ), + ctime=time.strftime( "%m/%d/%Y %I:%M:%S %p", time.localtime( statinfo.st_ctime ) ) ) ) + if not uploads: + rval += '<tr><td colspan="3"><em>Your FTP upload directory contains no files.</em></td></tr>' + for upload in uploads: + rval += FTPFileField.trow % ( prefix, self.name, upload['path'], upload['path'], upload['size'], upload['ctime'] ) + rval += FTPFileField.tfoot + rval += '<div class="toolParamHelp">This Galaxy server allows you to upload files via FTP. To upload some files, log in to the FTP server at <strong>%s</strong> using your Galaxy credentials (email address and password).</div>' % self.ftp_site + return rval + class HiddenField(BaseField): """ A hidden field. --- a/lib/galaxy/tools/parameters/basic.py +++ b/lib/galaxy/tools/parameters/basic.py @@ -40,6 +40,11 @@ class ToolParameter( object ): for elem in param.findall("validator"): self.validators.append( validation.Validator.from_element( self, elem ) ) + @property + def visible( self ): + """Return true if the parameter should be rendered on the form""" + return True + def get_label( self ): """Return user friendly name for the parameter""" if self.label: return self.label @@ -362,6 +367,41 @@ class FileToolParameter( ToolParameter ) def get_initial_value( self, trans, context ): return None +class FTPFileToolParameter( ToolParameter ): + """ + Parameter that takes a file uploaded via FTP as a value. + """ + def __init__( self, tool, elem ): + """ + Example: C{<param name="bins" type="file" />} + """ + ToolParameter.__init__( self, tool, elem ) + @property + def visible( self ): + if self.tool.app.config.ftp_upload_dir is None or self.tool.app.config.ftp_upload_site is None: + return False + return True + def get_html_field( self, trans=None, value=None, other_values={} ): + if trans is None or trans.user is None: + user_ftp_dir = None + else: + user_ftp_dir = os.path.join( trans.app.config.ftp_upload_dir, trans.user.email ) + return form_builder.FTPFileField( self.name, user_ftp_dir, trans.app.config.ftp_upload_site, value = value ) + def from_html( self, value, trans=None, other_values={} ): + return util.listify( value ) + def to_string( self, value, app ): + if value in [ None, '' ]: + return None + elif isinstance( value, unicode ) or isinstance( value, str ) or isinstance( value, list ): + return value + def to_python( self, value, app ): + if value is None: + return None + elif isinstance( value, unicode ) or isinstance( value, str ) or isinstance( value, list ): + return value + def get_initial_value( self, trans, context ): + return None + class HiddenToolParameter( ToolParameter ): """ Parameter that takes one of two values. @@ -1427,6 +1467,7 @@ parameter_types = dict( text = Te hidden = HiddenToolParameter, baseurl = BaseURLToolParameter, file = FileToolParameter, + ftpfile = FTPFileToolParameter, data = DataToolParameter, drill_down = DrillDownSelectToolParameter ) --- a/lib/galaxy/util/__init__.py +++ b/lib/galaxy/util/__init__.py @@ -480,6 +480,32 @@ def umask_fix_perms( path, umask, unmask current_group, e ) ) +def nice_size(size): + """ + Returns a readably formatted string with the size + + >>> nice_size(100) + '100.0 bytes' + >>> nice_size(10000) + '9.8 Kb' + >>> nice_size(1000000) + '976.6 Kb' + >>> nice_size(100000000) + '95.4 Mb' + """ + words = [ 'bytes', 'Kb', 'Mb', 'Gb' ] + try: + size = float( size ) + except: + return '??? bytes' + for ind, word in enumerate(words): + step = 1024 ** (ind + 1) + if step > size: + size = size / float(1024 ** ind) + out = "%.1f %s" % (size, word) + return out + return '??? bytes' + galaxy_root_path = os.path.join(__path__[0], "..","..","..") # The dbnames list is used in edit attributes and the upload tool dbnames = read_dbnames( os.path.join( galaxy_root_path, "tool-data", "shared", "ucsc", "builds.txt" ) ) --- a/universe_wsgi.ini.sample +++ b/universe_wsgi.ini.sample @@ -324,6 +324,18 @@ use_interactive = True # Enable the (experimental! beta!) Web API. Documentation forthcoming. #enable_api = False +# Enable Galaxy's "Upload via FTP" interface. You'll need to install and +# configure an FTP server (we've used ProFTPd since it can use Galaxy's +# database for authentication) and set the following two options. + +# This should point to a directory containing subdirectories matching users' +# email addresses, where Galaxy will look for files. +#ftp_upload_dir = None + +# This should be the hostname of your FTP server, which will be provided to +# users in the help text. +#ftp_upload_site = None + # -- Job Execution # If running multiple Galaxy processes, one can be designated as the job --- a/templates/tool_form.mako +++ b/templates/tool_form.mako @@ -51,7 +51,9 @@ function checkUncheckAll( name, check ) <%def name="do_inputs( inputs, tool_state, errors, prefix, other_values=None )"><% other_values = ExpressionContext( tool_state, other_values ) %> %for input_index, input in enumerate( inputs.itervalues() ): - %if input.type == "repeat": + %if not input.visible: + <% pass %> + %elif input.type == "repeat": <div class="repeat-group"><div class="form-title-row"><b>${input.title_plural}</b></div><% repeat_state = tool_state[input.name] %> --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -929,7 +929,11 @@ class Tool: assert isinstance( out_data, odict ) return 'tool_executed.mako', dict( out_data=out_data ) except: - return 'message.mako', dict( status='error', message='odict not returned from tool execution', refresh_frames=[] ) + if isinstance( out_data, str ): + message = out_data + else: + message = 'Failure executing tool (odict not returned from tool execution)' + return 'message.mako', dict( status='error', message=message, refresh_frames=[] ) # Otherwise move on to the next page else: state.page += 1 --- a/lib/galaxy/tools/parameters/grouping.py +++ b/lib/galaxy/tools/parameters/grouping.py @@ -12,11 +12,14 @@ import StringIO, os, urllib from galaxy.datatypes import sniff from galaxy.util.bunch import Bunch from galaxy.util.odict import odict -from galaxy.util import json +from galaxy.util import json, relpath class Group( object ): def __init__( self ): self.name = None + @property + def visible( self ): + return True def value_to_basic( self, value, app ): """ Convert value to a (possibly nested) representation using only basic @@ -267,6 +270,7 @@ class UploadDataset( Group ): rval = [] data_file = context['file_data'] url_paste = context['url_paste'] + ftp_files = context['ftp_files'] name = context.get( 'NAME', None ) info = context.get( 'INFO', None ) space_to_tab = False @@ -281,6 +285,31 @@ class UploadDataset( Group ): if file_bunch.path: file_bunch.space_to_tab = space_to_tab rval.append( file_bunch ) + # look for files uploaded via FTP + valid_files = [] + if ftp_files: + if trans.user is None: + log.warning( 'Anonymous user passed values in ftp_files: %s' % ftp_files ) + ftp_files = [] + # TODO: warning to the user (could happen if session has become invalid) + else: + user_ftp_dir = os.path.join( trans.app.config.ftp_upload_dir, trans.user.email ) + for ( dirpath, dirnames, filenames ) in os.walk( user_ftp_dir ): + for filename in filenames: + path = relpath( os.path.join( dirpath, filename ), user_ftp_dir ) + if not os.path.islink( os.path.join( dirpath, filename ) ): + valid_files.append( path ) + for ftp_file in ftp_files: + if ftp_file not in valid_files: + log.warning( 'User passed an invalid file path in ftp_files: %s' % ftp_file ) + continue + # TODO: warning to the user (could happen if file is already imported) + ftp_data_file = { 'local_filename' : os.path.abspath( os.path.join( user_ftp_dir, ftp_file ) ), + 'filename' : os.path.basename( ftp_file ) } + file_bunch = get_data_file_filename( ftp_data_file, override_name = name, override_info = info ) + if file_bunch.path: + file_bunch.space_to_tab = space_to_tab + rval.append( file_bunch ) return rval file_type = self.get_file_type( context ) d_type = self.get_datatype( trans, context ) --- a/static/june_2007_style/blue/base.css +++ b/static/june_2007_style/blue/base.css @@ -39,8 +39,7 @@ div.form-title-row{padding:5px 10px;} div.repeat-group-item{border-left:solid #d8b365 5px;margin-left:10px;margin-bottom:10px;} div.form-row-error{background:#FFCCCC;} div.form-row label{font-weight:bold;display:block;margin-bottom:.2em;} -div.form-row-input{float:left;width:300px;} -div.form-row-input > input{max-width:300px;} +div.form-row-input{float:left;} div.form-row-input label{font-weight:normal;display:inline;} div.form-row-error-message{width:300px;float:left;color:red;font-weight:bold;padding:3px 0 0 1em;} select,input,textarea{font:inherit;font-size:115%;} --- a/lib/galaxy/datatypes/data.py +++ b/lib/galaxy/datatypes/data.py @@ -419,36 +419,16 @@ class Newick( Text ): # ------------- Utility methods -------------- +# nice_size used to be here, but to resolve cyclical dependencies it's been +# moved to galaxy.util. It belongs there anyway since it's used outside +# datatypes. +nice_size = util.nice_size + def get_test_fname( fname ): """Returns test data filename""" path, name = os.path.split(__file__) full_path = os.path.join( path, 'test', fname ) return full_path -def nice_size(size): - """ - Returns a readably formatted string with the size - - >>> nice_size(100) - '100.0 bytes' - >>> nice_size(10000) - '9.8 Kb' - >>> nice_size(1000000) - '976.6 Kb' - >>> nice_size(100000000) - '95.4 Mb' - """ - words = [ 'bytes', 'Kb', 'Mb', 'Gb' ] - try: - size = float( size ) - except: - return '??? bytes' - for ind, word in enumerate(words): - step = 1024 ** (ind + 1) - if step > size: - size = size / float(1024 ** ind) - out = "%.1f %s" % (size, word) - return out - return '??? bytes' def get_file_peek( file_name, is_multi_byte=False, WIDTH=256, LINE_COUNT=5 ): """ Returns the first LINE_COUNT lines wrapped to WIDTH --- a/lib/galaxy/tools/actions/upload.py +++ b/lib/galaxy/tools/actions/upload.py @@ -21,7 +21,7 @@ class UploadToolAction( ToolAction ): upload_common.cleanup_unused_precreated_datasets( precreated_datasets ) if not uploaded_datasets: - return 'No data was entered in the upload form, please go back and choose data to upload.' + return None, 'No data was entered in the upload form, please go back and choose data to upload.' json_file_path = upload_common.create_paramfile( trans, uploaded_datasets ) data_list = [ ud.data for ud in uploaded_datasets ] --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -99,6 +99,10 @@ class Configuration( object ): self.user_library_import_dir = kwargs.get( 'user_library_import_dir', None ) if self.user_library_import_dir is not None and not os.path.exists( self.user_library_import_dir ): raise ConfigurationError( "user_library_import_dir specified in config (%s) does not exist" % self.user_library_import_dir ) + self.ftp_upload_dir = kwargs.get( 'ftp_upload_dir', None ) + if self.ftp_upload_dir is not None and not os.path.exists( self.ftp_upload_dir ): + os.makedirs( self.ftp_upload_dir ) + self.ftp_upload_site = kwargs.get( 'ftp_upload_site', None ) self.allow_library_path_paste = kwargs.get( 'allow_library_path_paste', False ) self.disable_library_comptypes = kwargs.get( 'disable_library_comptypes', '' ).lower().split( ',' ) # Location for dependencies --- a/static/june_2007_style/base.css.tmpl +++ b/static/june_2007_style/base.css.tmpl @@ -212,11 +212,6 @@ div.form-row label { div.form-row-input { float: left; - width: 300px; -} - -div.form-row-input > input { - max-width: 300px; } div.form-row-input label {

1 0

galaxy-dist commit 11abfc8eed60: Update cufflinks and cuffdiff wrappers to indicate that, as of version 0.9, setting parameters for paired-end reads is not recommended.
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User jeremy goecks <jeremy.goecks(a)emory.edu> # Date 1288979059 14400 # Node ID 11abfc8eed60c0bdd231d06992f72001a2c785fa # Parent 9545e8675a5d43408d75c66fcf3115cbdaf4af8a Update cufflinks and cuffdiff wrappers to indicate that, as of version 0.9, setting parameters for paired-end reads is not recommended. --- a/tools/ngs_rna/cuffdiff_wrapper.xml +++ b/tools/ngs_rna/cuffdiff_wrapper.xml @@ -25,6 +25,11 @@ --inputA=$gtf_input --input1=$aligned_reads1 --input2=$aligned_reads2 + + #if $singlePaired.sPaired == "Yes": + -m $singlePaired.mean_inner_distance + -s $singlePaired.inner_distance_std_dev + #end if </command><inputs><param format="gtf" name="gtf_input" type="data" label="Transcripts" help="A transcript GTF file produced by cufflinks, cuffcompare, or other source."/> @@ -34,12 +39,12 @@ <param name="min_mapqual" type="integer" value="0" label="Min SAM Mapping Quality" help="Instructs Cufflinks to ignore alignments with a SAM mapping quality lower than this number."/><param name="min_alignment_count" type="integer" value="0" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/><conditional name="singlePaired"> - <param name="sPaired" type="select" label="Is this library mate-paired?"> - <option value="single">Single-end</option> - <option value="paired">Paired-end</option> + <param name="sPaired" type="select" label="Set Parameters for Paired-end Reads? (not recommended)"> + <option value="No">No</option> + <option value="Yes">Yes</option></param> - <when value="single"></when> - <when value="paired"> + <when value="No"></when> + <when value="Yes"><param name="mean_inner_distance" type="integer" value="20" label="Mean Inner Distance between Mate Pairs"/><param name="inner_distance_std_dev" type="integer" value="20" label="Standard Deviation for Inner Distance between Mate Pairs"/></when> --- a/tools/ngs_rna/cufflinks_wrapper.xml +++ b/tools/ngs_rna/cufflinks_wrapper.xml @@ -17,7 +17,7 @@ #if $reference_annotation.use_ref == "Yes": -G $reference_annotation.reference_annotation_file #end if - #if $singlePaired.sPaired == "paired": + #if $singlePaired.sPaired == "Yes": -m $singlePaired.mean_inner_distance -s $singlePaired.inner_distance_std_dev #end if @@ -39,12 +39,12 @@ </when></conditional><conditional name="singlePaired"> - <param name="sPaired" type="select" label="Is this library mate-paired?"> - <option value="single">Single-end</option> - <option value="paired">Paired-end</option> + <param name="sPaired" type="select" label="Set Parameters for Paired-end Reads? (not recommended)"> + <option value="No">No</option> + <option value="Yes">Yes</option></param> - <when value="single"></when> - <when value="paired"> + <when value="No"></when> + <when value="Yes"><param name="mean_inner_distance" type="integer" value="20" label="Mean Inner Distance between Mate Pairs"/><param name="inner_distance_std_dev" type="integer" value="20" label="Standard Deviation for Inner Distance between Mate Pairs"/></when>

1 0

galaxy-dist commit 1e8d7c6ad88b: Add support for tool dependency injection to all cluster runners
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User James Taylor <james(a)jamestaylor.org> # Date 1288983797 14400 # Node ID 1e8d7c6ad88b074b33b2029f3baa15c2eb929e70 # Parent 32e5efb7a7d5606a4dc1c8808fe4888ade2892e8 Add support for tool dependency injection to all cluster runners --- a/lib/galaxy/tools/deps/__init__.py +++ b/lib/galaxy/tools/deps/__init__.py @@ -51,7 +51,7 @@ class DependencyManager( object ): if os.path.exists( script ): return script, path, version else: - return None, None + return None, None, None def _find_dep_default( self, name ): version = None @@ -64,6 +64,6 @@ class DependencyManager( object ): if os.path.exists( script ): return script, real_path, real_version else: - return None, None + return None, None, None --- a/lib/galaxy/jobs/runners/__init__.py +++ b/lib/galaxy/jobs/runners/__init__.py @@ -0,0 +1,32 @@ +import os, os.path + +class BaseJobRunner( object ): + + def build_command_line( self, job_wrapper, include_metadata=False ): + """ + Compose the sequence of commands neccesary to execute a job. This will + currently include: + - environment settings corresponding to any requirement tags + - command line taken from job wrapper + - commands to set metadata (if include_metadata is True) + """ + commands = job_wrapper.get_command_line() + # All job runners currently handle this case which should never + # occur + if not commands: + return None + # Prepend dependency injection + if job_wrapper.dependency_shell_commands: + commands = "; ".join( job_wrapper.dependency_shell_commands + [ commands ] ) + # Append metadata setting commands, we don't want to overwrite metadata + # that was copied over in init_meta(), as per established behavior + if include_metadata and self.app.config.set_metadata_externally: + commands += "; cd %s; " % os.path.abspath( os.getcwd() ) + commands += job_wrapper.setup_external_metadata( + exec_dir = os.path.abspath( os.getcwd() ), + tmp_dir = self.app.config.new_file_path, + dataset_files_path = self.app.model.Dataset.file_path, + output_fnames = output_fnames, + set_extension = False, + kwds = { 'overwrite' : False } ) + return commands --- a/lib/galaxy/jobs/runners/local.py +++ b/lib/galaxy/jobs/runners/local.py @@ -5,13 +5,14 @@ import threading from galaxy import model from galaxy.datatypes.data import nice_size +from galaxy.jobs.runners import BaseJobRunner import os, errno from time import sleep log = logging.getLogger( __name__ ) -class LocalJobRunner( object ): +class LocalJobRunner( BaseJobRunner ): """ Job runner backed by a finite pool of worker threads. FIFO scheduling """ @@ -53,9 +54,7 @@ class LocalJobRunner( object ): # Prepare the job to run try: job_wrapper.prepare() - command_line = job_wrapper.get_command_line() - if job_wrapper.dependency_shell_commands: - command_line = "; ".join( job_wrapper.dependency_shell_commands + [ command_line ] ) + command_line = self.build_command_line( job_wrapper ) except: job_wrapper.fail( "failure preparing job", exception=True ) log.exception("failure running job %d" % job_wrapper.job_id) --- a/lib/galaxy/jobs/runners/sge.py +++ b/lib/galaxy/jobs/runners/sge.py @@ -2,6 +2,8 @@ import os, logging, threading, time from Queue import Queue, Empty from galaxy import model +from galaxy.jobs.runners import BaseJobRunner + from paste.deploy.converters import asbool import pkg_resources @@ -58,7 +60,7 @@ class SGEJobState( object ): self.efile = None self.runner_url = None -class SGEJobRunner( object ): +class SGEJobRunner( BaseJobRunner ): """ Job runner backed by a finite pool of worker threads. FIFO scheduling """ @@ -144,7 +146,7 @@ class SGEJobRunner( object ): try: job_wrapper.prepare() - command_line = job_wrapper.get_command_line() + command_line = self.build_command_line( job_wrapper, include_metadata = True ) except: job_wrapper.fail( "failure preparing job", exception=True ) log.exception("failure running job %d" % job_wrapper.job_id) @@ -191,14 +193,7 @@ class SGEJobRunner( object ): jt.nativeSpecification = ' '.join(nativeSpec) script = sge_template % (job_wrapper.galaxy_lib_dir, os.path.abspath( job_wrapper.working_directory ), command_line) - if self.app.config.set_metadata_externally: - script += "cd %s\n" % os.path.abspath( os.getcwd() ) - script += "%s\n" % job_wrapper.setup_external_metadata( exec_dir = os.path.abspath( os.getcwd() ), - tmp_dir = self.app.config.new_file_path, - dataset_files_path = self.app.model.Dataset.file_path, - output_fnames = job_wrapper.get_output_fnames(), - set_extension = False, - kwds = { 'overwrite' : False } ) #we don't want to overwrite metadata that was copied over in init_meta(), as per established behavior + fh = file( jt.remoteCommand, "w" ) fh.write( script ) fh.close() --- a/lib/galaxy/jobs/runners/drmaa.py +++ b/lib/galaxy/jobs/runners/drmaa.py @@ -2,6 +2,8 @@ import os, logging, threading, time from Queue import Queue, Empty from galaxy import model +from galaxy.jobs.runners import BaseJobRunner + from paste.deploy.converters import asbool import pkg_resources @@ -58,7 +60,7 @@ class DRMAAJobState( object ): self.efile = None self.runner_url = None -class DRMAAJobRunner( object ): +class DRMAAJobRunner( BaseJobRunner ): """ Job runner backed by a finite pool of worker threads. FIFO scheduling """ @@ -120,7 +122,7 @@ class DRMAAJobRunner( object ): try: job_wrapper.prepare() - command_line = job_wrapper.get_command_line() + command_line = self.build_command_line( job_wrapper, include_metadata=True ) except: job_wrapper.fail( "failure preparing job", exception=True ) log.exception("failure running job %d" % job_wrapper.job_id) @@ -154,14 +156,6 @@ class DRMAAJobRunner( object ): jt.nativeSpecification = native_spec script = drm_template % (job_wrapper.galaxy_lib_dir, os.path.abspath( job_wrapper.working_directory ), command_line) - if self.app.config.set_metadata_externally: - script += "cd %s\n" % os.path.abspath( os.getcwd() ) - script += "%s\n" % job_wrapper.setup_external_metadata( exec_dir = os.path.abspath( os.getcwd() ), - tmp_dir = self.app.config.new_file_path, - dataset_files_path = self.app.model.Dataset.file_path, - output_fnames = job_wrapper.get_output_fnames(), - set_extension = False, - kwds = { 'overwrite' : False } ) #we don't want to overwrite metadata that was copied over in init_meta(), as per established behavior fh = file( jt.remoteCommand, "w" ) fh.write( script ) fh.close() --- a/lib/galaxy/jobs/runners/pbs.py +++ b/lib/galaxy/jobs/runners/pbs.py @@ -5,6 +5,7 @@ from Queue import Queue, Empty from galaxy import model from galaxy.datatypes.data import nice_size from galaxy.util.bunch import Bunch +from galaxy.jobs.runners import BaseJobRunner from paste.deploy.converters import asbool @@ -80,7 +81,7 @@ class PBSJobState( object ): self.check_count = 0 self.stop_job = False -class PBSJobRunner( object ): +class PBSJobRunner( BaseJobRunner ): """ Job runner backed by a finite pool of worker threads. FIFO scheduling """ @@ -183,7 +184,7 @@ class PBSJobRunner( object ): try: job_wrapper.prepare() - command_line = job_wrapper.get_command_line() + command_line = self.build_command_line( job_wrapper, include_metadata=not( self.app.config.pbs_stage_path ) ) except: job_wrapper.fail( "failure preparing job", exception=True ) log.exception("failure running job %d" % job_wrapper.job_id) @@ -253,14 +254,6 @@ class PBSJobRunner( object ): script = pbs_symlink_template % (job_wrapper.galaxy_lib_dir, " ".join(job_wrapper.get_input_fnames() + output_files), self.app.config.pbs_stage_path, exec_dir, command_line) else: script = pbs_template % ( job_wrapper.galaxy_lib_dir, exec_dir, command_line ) - if self.app.config.set_metadata_externally: - script += "cd %s\n" % os.path.abspath( os.getcwd() ) - script += "%s\n" % job_wrapper.setup_external_metadata( exec_dir = os.path.abspath( os.getcwd() ), - tmp_dir = self.app.config.new_file_path, - dataset_files_path = self.app.model.Dataset.file_path, - output_fnames = output_fnames, - set_extension = False, - kwds = { 'overwrite' : False } ) #we don't want to overwrite metadata that was copied over in init_meta(), as per established behavior job_file = "%s/%s.sh" % (self.app.config.cluster_files_directory, job_wrapper.job_id) fh = file(job_file, "w") fh.write(script)

1 0

galaxy-dist commit 702f4717a8f3: Bugfix for the abstracted job runner
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Nate Coraor <nate(a)bx.psu.edu> # Date 1288986871 14400 # Node ID 702f4717a8f3fe38758c54136f81935f7679c937 # Parent 6d94416b2ccf9205283ec197154d99522615cbf8 Bugfix for the abstracted job runner --- a/lib/galaxy/jobs/runners/__init__.py +++ b/lib/galaxy/jobs/runners/__init__.py @@ -26,7 +26,7 @@ class BaseJobRunner( object ): exec_dir = os.path.abspath( os.getcwd() ), tmp_dir = self.app.config.new_file_path, dataset_files_path = self.app.model.Dataset.file_path, - output_fnames = output_fnames, + output_fnames = job_wrapper.get_output_fnames(), set_extension = False, kwds = { 'overwrite' : False } ) return commands

1 0

galaxy-dist commit 16bd91a54888: Must be logged in to use api keys. Fix small typo in error messages
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Kanwei Li <kanwei(a)gmail.com> # Date 1288813870 14400 # Node ID 16bd91a548887fb0be24b981c2d66fb7ef7b1922 # Parent cf8bef68e8befb8b6631578b71ff69f701fc0d4d Must be logged in to use api keys. Fix small typo in error messages --- a/lib/galaxy/web/controllers/user.py +++ b/lib/galaxy/web/controllers/user.py @@ -984,6 +984,7 @@ class User( BaseController, UsesFormDefi message=message, lines_skipped=lines_skipped ) @web.expose + @web.require_login() def api_keys( self, trans, **kwd ): params = util.Params( kwd ) message = util.restore_text( params.get( 'message', '' ) ) --- a/lib/galaxy/web/framework/__init__.py +++ b/lib/galaxy/web/framework/__init__.py @@ -84,7 +84,7 @@ def require_login( verb="perform this ac return func( self, trans, *args, **kwargs ) else: return trans.show_error_message( - 'You must be <a target="_top" href="%s">logged in</a> to %s</div>.' + 'You must be <a target="_top" href="%s">logged in</a> to %s.' % ( url_for( controller='user', action='login', webapp=webapp ), verb ), use_panels=use_panels ) return decorator return argcatcher

1 0

galaxy-dist commit 6838e10e5912: Fix for TextToolParameter.get_html_field when provided value is an empty string but default value specified in tool is non-empty string. Fixes issue with rerun button where if a user had input an empty string, the form displayed when rerun would have the default value from the tool and not the actual previously specified value.
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Daniel Blankenberg <dan(a)bx.psu.edu> # Date 1288818754 14400 # Node ID 6838e10e5912cec46060bda189841edba305ac1d # Parent 16bd91a548887fb0be24b981c2d66fb7ef7b1922 Fix for TextToolParameter.get_html_field when provided value is an empty string but default value specified in tool is non-empty string. Fixes issue with rerun button where if a user had input an empty string, the form displayed when rerun would have the default value from the tool and not the actual previously specified value. --- a/lib/galaxy/tools/parameters/basic.py +++ b/lib/galaxy/tools/parameters/basic.py @@ -165,10 +165,11 @@ class TextToolParameter( ToolParameter ) self.value = elem.get( 'value' ) self.area = string_as_bool( elem.get( 'area', False ) ) def get_html_field( self, trans=None, value=None, other_values={} ): + if value is None: value = self.value if self.area: - return form_builder.TextArea( self.name, self.size, value or self.value ) + return form_builder.TextArea( self.name, self.size, value ) else: - return form_builder.TextField( self.name, self.size, value or self.value ) + return form_builder.TextField( self.name, self.size, value ) def get_initial_value( self, trans, context ): return self.value

1 0

galaxy-dist commit f372ea5a6014: Fix interpreter for the FASTX Barcode Splitter.
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Nate Coraor <nate(a)bx.psu.edu> # Date 1288902351 14400 # Node ID f372ea5a601443a9b9cd1d3f7e04ddc24db5b57a # Parent cdf8d61425cce011f98b1f24bd9fe19dc59b10ab Fix interpreter for the FASTX Barcode Splitter. --- a/tools/fastx_toolkit/fastx_barcode_splitter.xml +++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml @@ -1,7 +1,7 @@ <tool id="cshl_fastx_barcode_splitter" name="Barcode Splitter"><description></description><requirements><requirement type="package">fastx_toolkit</requirement></requirements> - <command interpreter="sh">fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" "$output.files_path" --mismatches $mismatches --partial $partial $EOL > $output </command> + <command interpreter="bash">fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" "$output.files_path" --mismatches $mismatches --partial $partial $EOL > $output </command><inputs><param format="txt" name="BARCODE" type="data" label="Barcodes to use" />

1 0

galaxy-dist commit 9d68027b0109: Add options to Tophat wrapper for specifying own splice junctions.
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User jeremy goecks <jeremy.goecks(a)emory.edu> # Date 1288805582 14400 # Node ID 9d68027b01096e2b32101234878d11946c03d08c # Parent 49f0e8441a4da6b1ec03250448ab84854f07aa77 Add options to Tophat wrapper for specifying own splice junctions. --- a/tools/ngs_rna/tophat_wrapper.py +++ b/tools/ngs_rna/tophat_wrapper.py @@ -29,6 +29,24 @@ def __main__(): help='The maximum intron length. When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read.' ) parser.add_option( '-F', '--junction_filter', dest='junction_filter', help='Filter out junctions supported by too few alignments (number of reads divided by average depth of coverage)' ) parser.add_option( '-g', '--max_multihits', dest='max_multihits', help='Maximum number of alignments to be allowed' ) + parser.add_option( '', '--seg-mismatches', dest='seg_mismatches', help='Number of mismatches allowed in each segment alignment for reads mapped independently' ) + parser.add_option( '', '--seg-length', dest='seg_length', help='Minimum length of read segments' ) + + # Options for supplying own junctions + parser.add_option( '-G', '--GTF', dest='gene_model_annotations', help='Supply TopHat with a list of gene model annotations. \ + TopHat will use the exon records in this file to build \ + a set of known splice junctions for each gene, and will \ + attempt to align reads to these junctions even if they \ + would not normally be covered by the initial mapping.') + parser.add_option( '-j', '--raw-juncs', dest='raw_juncs', help='Supply TopHat with a list of raw junctions. Junctions are \ + specified one per line, in a tab-delimited format. Records \ + look like: <chrom><left><right><+/-> left and right are \ + zero-based coordinates, and specify the last character of the \ + left sequenced to be spliced to the first character of the right \ + sequence, inclusive.') + parser.add_option( '', '--no-novel-juncs', action="store_true", dest='no_novel_juncs', help="Only look for junctions indicated in the \ + supplied GFF file. (ignored without -G)") + # Types of search. parser.add_option( '', '--microexon-search', action="store_true", dest='microexon_search', help='With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer.') parser.add_option( '', '--closure-search', action="store_true", dest='closure_search', help='Enables the mate pair closure-based search for junctions. Closure-based search should only be used when the expected inner distance between mates is small (<= 50bp)') parser.add_option( '', '--no-closure-search', action="store_false", dest='closure_search' ) @@ -41,8 +59,6 @@ def __main__(): parser.add_option( '', '--max-closure-intron', dest='max_closure_intron', help='Maximum intron length that may be found during closure search' ) parser.add_option( '', '--min-coverage-intron', dest='min_coverage_intron', help='Minimum intron length that may be found during coverage search' ) parser.add_option( '', '--max-coverage-intron', dest='max_coverage_intron', help='Maximum intron length that may be found during coverage search' ) - parser.add_option( '', '--seg-mismatches', dest='seg_mismatches', help='Number of mismatches allowed in each segment alignment for reads mapped independently' ) - parser.add_option( '', '--seg-length', dest='seg_length', help='Minimum length of read segments' ) # Wrapper options. parser.add_option( '-1', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) @@ -107,6 +123,15 @@ def __main__(): if float( options.junction_filter ) != 0.0: opts += ' -F %s' % options.junction_filter opts += ' -g %s' % options.max_multihits + # Custom junctions options. + if options.gene_model_annotations: + opts += ' -G %s' % options.gene_model_annotations + if options.raw_juncs: + opts += ' -j %s' % options.raw_juncs + if options.no_novel_juncs: + opts += ' --no-novel-juncs' + + # Search type options. if options.coverage_search: opts += ' --coverage-search --min-coverage-intron %s --max-coverage-intron %s' % ( options.min_coverage_intron, options.max_coverage_intron ) else: --- a/tools/ngs_rna/tophat_wrapper.xml +++ b/tools/ngs_rna/tophat_wrapper.xml @@ -45,6 +45,21 @@ --max-segment-intron $singlePaired.sParams.max_segment_intron --seg-mismatches=$singlePaired.sParams.seg_mismatches --seg-length=$singlePaired.sParams.seg_length + + ## Supplying junctions parameters. + #if $singlePaired.sParams.own_junctions.use_junctions == "Yes": + #if $singlePaired.sParams.own_junctions.gene_model_ann.use_annotations == "Yes": + -G $singlePaired.sParams.own_junctions.gene_model_ann.gene_annotation_model + #end if + #if $singlePaired.sParams.own_junctions.raw_juncs.use_juncs == "Yes": + -j $singlePaired.sParams.own_junctions.raw_juncs.raw_juncs + #end if + ## TODO: No idea why a string cast is necessary, but it is: + #if str($singlePaired.sParams.own_junctions.no_novel_juncs) == "Yes": + --no-novel-juncs + #end if + #end if + #if $singlePaired.sParams.closure_search.use_search == "Yes": --closure-search --min-closure-exon $singlePaired.sParams.closure_search.min_closure_exon @@ -60,8 +75,8 @@ #else: --no-coverage-search #end if - ## No idea why the type conversion is necessary, but it seems to be. - #if str ($singlePaired.sParams.microexon_search) == "Yes": + ## TODO: No idea why the type conversion is necessary, but it seems to be. + #if str($singlePaired.sParams.microexon_search) == "Yes": --microexon-search #end if #end if @@ -81,6 +96,21 @@ --max-segment-intron $singlePaired.pParams.max_segment_intron --seg-mismatches=$singlePaired.pParams.seg_mismatches --seg-length=$singlePaired.pParams.seg_length + + ## Supplying junctions parameters. + #if $singlePaired.pParams.own_junctions.use_junctions == "Yes": + #if $singlePaired.pParams.own_junctions.gene_model_ann.use_annotations == "Yes": + -G $singlePaired.pParams.own_junctions.gene_model_ann.gene_annotation_model + #end if + #if $singlePaired.pParams.own_junctions.raw_juncs.use_juncs == "Yes": + -j $singlePaired.pParams.own_junctions.raw_juncs.raw_juncs + #end if + ## TODO: No idea why type cast is necessary, but it is: + #if str($singlePaired.pParams.own_junctions.no_novel_juncs) == "Yes": + --no-novel-juncs + #end if + #end if + #if $singlePaired.pParams.closure_search.use_search == "Yes": --closure-search --min-closure-exon $singlePaired.pParams.closure_search.min_closure_exon @@ -96,7 +126,7 @@ #else: --no-coverage-search #end if - ## No idea why the type conversion is necessary, but it seems to be. + ## TODO: No idea why the type conversion is necessary, but it seems to be. #if str ($singlePaired.pParams.microexon_search) == "Yes": --microexon-search #end if @@ -146,6 +176,42 @@ <param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /><param name="seg_mismatches" type="integer" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /><param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> + +  + <conditional name="own_junctions"> + <param name="use_junctions" type="select" label="Use Own Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <conditional name="gene_model_ann"> + <param name="use_annotations" type="select" label="Use Gene Annotation Model"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="gtf" name="gene_annotation_model" type="data" label="Gene Model Annotations" help="TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping."/> + </when> + </conditional> + <conditional name="raw_juncs"> + <param name="use_juncs" type="select" label="Use Raw Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="interval" name="raw_juncs" type="data" label="Raw Junctions" help="Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-] left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive."/> + </when> + </conditional> + <param name="no_novel_juncs" type="select" label="Only look for supplied junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </when> + <when value="No" /> + </conditional> + <conditional name="closure_search"><param name="use_search" type="select" label="Use Closure Search"> @@ -201,6 +267,41 @@ <param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /><param name="seg_mismatches" type="integer" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /><param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> +  + <conditional name="own_junctions"> + <param name="use_junctions" type="select" label="Use Own Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <conditional name="gene_model_ann"> + <param name="use_annotations" type="select" label="Use Gene Annotation Model"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="gtf" name="gene_annotation_model" type="data" label="Gene Model Annotations" help="TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping."/> + </when> + </conditional> + <conditional name="raw_juncs"> + <param name="use_juncs" type="select" label="Use Raw Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="interval" name="raw_juncs" type="data" label="Raw Junctions" help="Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-] left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive."/> + </when> + </conditional> + <param name="no_novel_juncs" type="select" label="Only look for supplied junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </when> + <when value="No" /> + </conditional> + <conditional name="closure_search"><param name="use_search" type="select" label="Use Closure Search"> @@ -385,8 +486,11 @@ This is a list of implemented Tophat opt -F/--min-isoform-fraction 0.0-1.0 TopHat filters out junctions supported by too few alignments. Suppose a junction spanning two exons, is supported by S reads. Let the average depth of coverage of exon A be D, and assume that it is higher than B. If S / D is less than the minimum isoform fraction, the junction is not reported. A value of zero disables the filter. The default is 0.15. - -g/--max-multihits INT Instructs TopHat to allow up to this many alignments to the reference for a given read, and suppresses all alignments for reads with more than this many + -g/--max-multihits INT Instructs TopHat to allow up to this many alignments to the reference for a given read, and suppresses all alignments for reads with more than this many alignments. The default is 40. + -G/--GTF [GTF 2.2 file] Supply TopHat with a list of gene model annotations. TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping. + -j/--raw-juncs [juncs file] Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-], left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive. + -no-novel-juncs Only look for junctions indicated in the supplied GFF file. (ignored without -G) --no-closure-search Disables the mate pair closure-based search for junctions. Currently, has no effect - closure search is off by default. --closure-search Enables the mate pair closure-based search for junctions. Closure-based search should only be used when the expected inner distance between mates is small (about or less than 50bp) --no-coverage-search Disables the coverage based search for junctions.

1 0

galaxy-dist commit cf8bef68e8be: Correction to docstring for Tool.build_param_dict() -- from peter@maubp.freeserve.co.uk
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User jeremy goecks <jeremy.goecks(a)emory.edu> # Date 1288810958 14400 # Node ID cf8bef68e8befb8b6631578b71ff69f701fc0d4d # Parent b1ec8342053f3cdcd0a081ff28f077a76bd188cc Correction to docstring for Tool.build_param_dict() -- from peter(a)maubp.freeserve.co.uk --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -1333,7 +1333,7 @@ class Tool: line. Each value is wrapped in a `InputValueWrapper`, which allows all the attributes of the value to be used in the template, *but* when the __str__ method is called it actually calls the - `to_param_dict_value` method of the associated input. + `to_param_dict_string` method of the associated input. """ param_dict = dict() # All parameters go into the param_dict

1 0

galaxy-dist commit b1ec8342053f: Adding NGS simulation tool
by commits-noreply＠bitbucket.org 20 Nov '10

20 Nov '10

# HG changeset patch -- Bitbucket.org # Project galaxy-dist # URL http://bitbucket.org/galaxy/galaxy-dist/overview # User Kelly Vincent <kpvincent(a)bx.psu.edu> # Date 1288806772 14400 # Node ID b1ec8342053f3cdcd0a081ff28f077a76bd188cc # Parent 9d68027b01096e2b32101234878d11946c03d08c Adding NGS simulation tool --- /dev/null +++ b/tool-data/ngs_sim_fasta.loc.sample @@ -0,0 +1,20 @@ +#This is a sample file distributed with Galaxy that enables the NGS simulation +#tool to use some FASTA files. You will need to make sure that these FASTA files +#are in place and then create the ngs_sim.loc file similar to this one (store it +#in this directory) that points to the locations of those files. The ngs_sim.loc +#file has this format (white space characters are TAB characters): +# +#<unique_build_id><dbkey><display_name><file_base_path> +# +#So, for example, if you had hg18chrM.fa in +#/data/path/hg18/seq/, +#then the ngs_sim.loc entry would look like this: +# +#hg18chrM hg18 hg18chrM /data/path/hg18/seq/hg18chrM.fa +# +#Your ngs_sim.loc file should include an entry per line for each FASTA file you +#have stored. +# +#hg18chrM hg18 hg18chrM /data/path/hg18/seq/hg18chrM.fa +#phiX174 phiX phiX174 /data/path/genome/phiX/seq/phiX.fa +#pUC18 pUC18 pUC18 /data/path/genome/pUC18/seq/pUC18.fa Binary file test-data/ngs_simulation_out3.png has changed --- /dev/null +++ b/tools/ngs_simulation/ngs_simulation.xml @@ -0,0 +1,217 @@ +<tool id="ngs_simulation" name="Simulate" version="1.0.0"> + + <description>Illumina runs</description> + <command interpreter="python"> + ngs_simulation.py + #if $in_type.input_type == "built-in" + --input="${ filter( lambda x: str( x[0] ) == str( $in_type.genome ), $__app__.tool_data_tables[ 'ngs_sim_fasta' ].get_fields() )[0][-1] }" + --genome=$genome + #else + --input=$in_type.input1 + #end if + --read_len=$read_len + --avg_coverage=$avg_coverage + --error_rate=$error_rate + --num_sims=$num_sims + --polymorphism=$polymorphism + --detection_thresh=$detection_thresh + --output_png=$output_png + --summary_out=$summary_out + --output_summary=$output_summary + --new_file_path=$__new_file_path__ + </command> + + <inputs> + <conditional name="in_type"> + <param name="input_type" type="select" label="Use a built-in FASTA file or one from the history?"> + <option value="built-in">Built-in</option> + <option value="history">History file</option> + </param> + <when value="built-in"> + <param name="genome" type="select" label="Select a built-in genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_data_table="ngs_sim_fasta" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="fasta" label="Input genome (FASTA format)" /> + </when> + </conditional> + <param name="read_len" type="integer" value="76" label="Read length" /> + <param name="avg_coverage" type="integer" value="200" label="Average coverage" /> + <param name="error_rate" type="float" value="0.001" label="Error rate or quality score" help="Quality score if integer 1 or greater; error rate if between 0 and 1" /> + <param name="num_sims" type="integer" value="100" label="The number of simulations to run" /> + <param name="polymorphism" type="select" multiple="true" label="Frequency/ies for minor allele"> + <option value="0.001">0.001</option> + <option value="0.002">0.002</option> + <option value="0.003">0.003</option> + <option value="0.004">0.004</option> + <option value="0.005">0.005</option> + <option value="0.006">0.006</option> + <option value="0.007">0.007</option> + <option value="0.008">0.008</option> + <option value="0.009">0.009</option> + <option value="0.01">0.01</option> + <option value="0.02">0.02</option> + <option value="0.03">0.03</option> + <option value="0.04">0.04</option> + <option value="0.05">0.05</option> + <option value="0.06">0.06</option> + <option value="0.07">0.07</option> + <option value="0.08">0.08</option> + <option value="0.09">0.09</option> + <option value="0.1">0.1</option> + <option value="0.2">0.2</option> + <option value="0.3">0.3</option> + <option value="0.4">0.4</option> + <option value="0.5">0.5</option> + <option value="0.6">0.6</option> + <option value="0.7">0.7</option> + <option value="0.8">0.8</option> + <option value="0.9">0.9</option> + <option value="1.0">1.0</option> + </param> + <param name="detection_thresh" type="select" multiple="true" label="Detection thresholds"> + <option value="0.001">0.001</option> + <option value="0.002">0.002</option> + <option value="0.003">0.003</option> + <option value="0.004">0.004</option> + <option value="0.005">0.005</option> + <option value="0.006">0.006</option> + <option value="0.007">0.007</option> + <option value="0.008">0.008</option> + <option value="0.009">0.009</option> + <option value="0.01">0.01</option> + <option value="0.02">0.02</option> + <option value="0.03">0.03</option> + <option value="0.04">0.04</option> + <option value="0.05">0.05</option> + <option value="0.06">0.06</option> + <option value="0.07">0.07</option> + <option value="0.08">0.08</option> + <option value="0.09">0.09</option> + <option value="0.1">0.1</option> + <option value="0.2">0.2</option> + <option value="0.3">0.3</option> + <option value="0.4">0.4</option> + <option value="0.5">0.5</option> + <option value="0.6">0.6</option> + <option value="0.7">0.7</option> + <option value="0.8">0.8</option> + <option value="0.9">0.9</option> + <option value="1.0">1.0</option> + </param> + <param name="summary_out" type="boolean" truevalue="true" falsevalue="false" checked="true" label="Include a (text) summary file for all the simulations" /> + + </inputs> + <outputs> + <data format="png" name="output_png" /> + <data format="tabular" name="output_summary"> + <filter>summary_out == True</filter> + </data> + + </outputs> + <tests> +  +  + </tests> + <help> + +**What it does** + +This tool simulates an Illumina run and provides plots of false positives and false negatives. It allows for a range of simulation parameters to be set. Note that this simulation sets only one (randomly chosen) position in the genome as polymorphic, according to the value specified. Superimposed on this are "sequencing errors", which are uniformly (and randomly) distributed. Polymorphisms are assigned using the detection threshold, so if the detection threshold is set to the same as the minor allele frequency, the expected false negative rate is 50%. + +**Parameter list** + +These are the parameters that should be set for the simulation:: + + Read length (which is the same for all reads) + Average Coverage + Frequency for Minor Allele + Sequencing Error Rate + Detection Threshold + Number of Simulations + +You also should choose to use either a built-in genome or supply your own FASTA file. + +**Output** + +There are one or two. The first is a png that contains two different plots and is always generated. The second is optional and is a text file with some summary information about the simulations that were run. Below are some example outputs for a 10-simulation run on phiX with the default settings:: + + Read length 76 + Average coverage 200 + Error rate/quality score 0.001 + Number of simulations 100 + Frequencies for minor allele 0.002 + 0.004 + Detection thresholds 0.003 + 0.005 + 0.007 + Include summary file Yes + +Plot output (png): + +.. image:: ../static/images/ngs_simulation.png + +Summary output (txt):: + + FP FN GENOMESIZE.5386 fprate hetcol errcol + Min. : 71.0 Min. :0.0 Mode:logical Min. :0.01318 Min. :0.004 Min. :0.007 + 1st Qu.:86.0 1st Qu.:1.0 NA's:10 1st Qu.:0.01597 1st Qu.:0.004 1st Qu.:0.007 + Median :92.5 Median :1.0 NA Median :0.01717 Median :0.004 Median :0.007 + Mean :93.6 Mean :0.9 NA Mean :0.01738 Mean :0.004 Mean :0.007 + 3rd Qu.:100.8 3rd Qu.:1.0 NA 3rd Qu.:0.01871 3rd Qu.:0.004 3rd Qu.:0.007 + Max. :123.0 Max. :1.0 NA Max. :0.02284 Max. :0.004 Max. :0.007 + + False Positive Rate Summary + 0.003 0.005 0.007 + 0.001 0.17711 0.10854 0.01673 + 0.009 0.18049 0.10791 0.01738 + + False Negative Rate Summary + 0.003 0.005 0.007 + 0.001 1.0 0.8 1.0 + 0.009 0.4 0.7 0.9 + + + </help> +</tool> + + Binary file test-data/ngs_simulation_out1.png has changed --- a/tool_conf.xml.sample +++ b/tool_conf.xml.sample @@ -312,6 +312,9 @@ <tool file="genetrack/genetrack_indexer.xml" /><tool file="genetrack/genetrack_peak_prediction.xml" /></section> + <section name="NGS: Simulation" id="ngs-simulation"> + <tool file="ngs_simulation/ngs_simulation.xml" /> + </section><section name="SNP/WGA: Data; Filters" id="rgdat"><label text="Data: Import and upload" id="rgimport" /><tool file="data_source/upload.xml"/> --- /dev/null +++ b/test-data/ngs_simulation_in1.fasta @@ -0,0 +1,41 @@ +>gi|209210|gb|L09136.1|SYNPUC18CV pUC18c cloning vector (beta-galactosidase mRNA on complementary strand) +TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCT +GTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGG +CTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGAT +GCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATC +GGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTA +ACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCG +ACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT +GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATG +AGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG +CTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGC +TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACG +GTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAAC +CGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGAC +GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT +CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG +GCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTG +TGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGT +AAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT +GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTC +TGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAG +CGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC +TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAA +AAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTA +AACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCA +TCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG +CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAG +GGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCT +AGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCAC +GCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCAT +GTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTA +TCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGA +CTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTC +AATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGG +CGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGAT +CTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAA +GGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTAT +CAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGC +GCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAA +TAGGCGTATCACGAGGCCCTTTCGTC + --- a/tool_data_table_conf.xml.sample +++ b/tool_data_table_conf.xml.sample @@ -1,22 +1,27 @@ <tables> -  - <table name="indexed_maf_files"> - <columns>name, value, dbkey, species</columns> - <file path="tool-data/maf_index.loc" /> +  + <table name="bfast_indexes" comment_char="#"> + <columns>value, dbkey, formats, name, path</columns> + <file path="tool-data/bfast_indexes.loc" /> + </table> +  + <table name="bowtie_indexes"> + <columns>name, value</columns> + <file path="tool-data/bowtie_indices.loc" /></table><table name="bwa_indexes"><columns>name, value</columns><file path="tool-data/bwa_index.loc" /></table> -  - <table name="bowtie_indexes"> - <columns>name, value</columns> - <file path="tool-data/bowtie_indices.loc" /> +  + <table name="indexed_maf_files"> + <columns>name, value, dbkey, species</columns> + <file path="tool-data/maf_index.loc" /></table> -  - <table name="bfast_indexes" comment_char="#"> - <columns>value, dbkey, formats, name, path</columns> - <file path="tool-data/bfast_indexes.loc" /> +  + <table name="ngs_sim_fasta" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/ngs_sim_fasta.loc" /></table></tables> --- /dev/null +++ b/tools/ngs_simulation/ngs_simulation.py @@ -0,0 +1,280 @@ +#!/usr/bin/env python + +""" +Runs Ben's simulation. + +usage: %prog [options] + -i, --input=i: Input genome (FASTA format) + -g, --genome=g: If built-in, the genome being used + -l, --read_len=l: Read length + -c, --avg_coverage=c: Average coverage + -e, --error_rate=e: Error rate (0-1) + -n, --num_sims=n: Number of simulations to run + -p, --polymorphism=p: Frequency/ies for minor allele (comma-separate list of 0-1) + -d, --detection_thresh=d: Detection thresholds (comma-separate list of 0-1) + -p, --output_png=p: Plot output + -s, --summary_out=s: Whether or not to output a file with summary of all simulations + -m, --output_summary=m: File name for output summary of all simulations + -f, --new_file_path=f: Directory for summary output files + +""" +# removed output of all simulation results on request (not working) +# -r, --sim_results=r: Output all tabular simulation results (number of polymorphisms times number of detection thresholds) +# -o, --output=o: Base name for summary output for each run + +from rpy import * +import os +import random, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + # validate parameters + error = '' + try: + read_len = int( options.read_len ) + if read_len <= 0: + raise Exception, ' greater than 0' + except TypeError, e: + error = ': %s' % str( e ) + if error: + stop_err( 'Make sure your number of reads is an integer value%s' % error ) + error = '' + try: + avg_coverage = int( options.avg_coverage ) + if avg_coverage <= 0: + raise Exception, ' greater than 0' + except Exception, e: + error = ': %s' % str( e ) + if error: + stop_err( 'Make sure your average coverage is an integer value%s' % error ) + error = '' + try: + error_rate = float( options.error_rate ) + if error_rate >= 1.0: + error_rate = 10 ** ( -error_rate / 10.0 ) + elif error_rate < 0: + raise Exception, ' between 0 and 1' + except Exception, e: + error = ': %s' % str( e ) + if error: + stop_err( 'Make sure the error rate is a decimal value%s or the quality score is at least 1' % error ) + try: + num_sims = int( options.num_sims ) + except TypeError, e: + stop_err( 'Make sure the number of simulations is an integer value: %s' % str( e ) ) + if len( options.polymorphism ) > 0: + polymorphisms = [ float( p ) for p in options.polymorphism.split( ',' ) ] + else: + stop_err( 'Select at least one polymorphism value to use' ) + if len( options.detection_thresh ) > 0: + detection_threshes = [ float( dt ) for dt in options.detection_thresh.split( ',' ) ] + else: + stop_err( 'Select at least one detection threshold to use' ) + + # mutation dictionaries + hp_dict = { 'A':'G', 'G':'A', 'C':'T', 'T':'C', 'N':'N' } # heteroplasmy dictionary + mt_dict = { 'A':'C', 'C':'A', 'G':'T', 'T':'G', 'N':'N'} # misread dictionary + + # read fasta file to seq string + all_lines = open( options.input, 'rb' ).readlines() + seq = '' + for line in all_lines: + line = line.rstrip() + if line.startswith('>'): + pass + else: + seq += line.upper() + seq_len = len( seq ) + + # output file name template +# removed output of all simulation results on request (not working) +# if options.sim_results == "true": +# out_name_template = os.path.join( options.new_file_path, 'primary_output%s_' + options.output + '_visible_tabular' ) +# else: +# out_name_template = tempfile.NamedTemporaryFile().name + '_%s' + out_name_template = tempfile.NamedTemporaryFile().name + '_%s' + print 'out_name_template:', out_name_template + + # set up output files + outputs = {} + i = 1 + for p in polymorphisms: + outputs[ p ] = {} + for d in detection_threshes: + outputs[ p ][ d ] = out_name_template % i + i += 1 + + # run sims + for polymorphism in polymorphisms: + for detection_thresh in detection_threshes: + output = open( outputs[ polymorphism ][ detection_thresh ], 'wb' ) + output.write( 'FP\tFN\tGENOMESIZE=%s\n' % seq_len ) + sim_count = 0 + while sim_count < num_sims: + # randomly pick heteroplasmic base index + hbase = random.choice( range( 0, seq_len ) ) + #hbase = seq_len/2#random.randrange( 0, seq_len ) + # create 2D quasispecies list + qspec = map( lambda x: [], [0] * seq_len ) + # simulate read indices and assign to quasispecies + i = 0 + while i < ( avg_coverage * ( seq_len / read_len ) ): # number of reads (approximates coverage) + start = random.choice( range( 0, seq_len ) ) + #start = seq_len/2#random.randrange( 0, seq_len ) # assign read start + if random.random() < 0.5: # positive sense read + end = start + read_len # assign read end + if end > seq_len: # overshooting origin + read = range( start, seq_len ) + range( 0, ( end - seq_len ) ) + else: # regular read + read = range( start, end ) + else: # negative sense read + end = start - read_len # assign read end + if end < -1: # overshooting origin + read = range( start, -1, -1) + range( ( seq_len - 1 ), ( seq_len + end ), -1 ) + else: # regular read + read = range( start, end, -1 ) + # assign read to quasispecies list by index + for j in read: + if j == hbase and random.random() < polymorphism: # heteroplasmic base is variant with p = het + ref = hp_dict[ seq[ j ] ] + else: # ref is the verbatim reference nucleotide (all positions) + ref = seq[ j ] + if random.random() < error_rate: # base in read is misread with p = err + qspec[ j ].append( mt_dict[ ref ] ) + else: # otherwise we carry ref through to the end + qspec[ j ].append(ref) + # last but not least + i += 1 + bases, fpos, fneg = {}, 0, 0 # last two will be outputted to summary file later + for i, nuc in enumerate( seq ): + cov = len( qspec[ i ] ) + bases[ 'A' ] = qspec[ i ].count( 'A' ) + bases[ 'C' ] = qspec[ i ].count( 'C' ) + bases[ 'G' ] = qspec[ i ].count( 'G' ) + bases[ 'T' ] = qspec[ i ].count( 'T' ) + # calculate max NON-REF deviation + del bases[ nuc ] + maxdev = float( max( bases.values() ) ) / cov + # deal with non-het sites + if i != hbase: + if maxdev >= detection_thresh: # greater than detection threshold = false positive + fpos += 1 + # deal with het sites + if i == hbase: + hnuc = hp_dict[ nuc ] # let's recover het variant + if ( float( bases[ hnuc ] ) / cov ) < detection_thresh: # less than detection threshold = false negative + fneg += 1 + del bases[ hnuc ] # ignore het variant + maxdev = float( max( bases.values() ) ) / cov # check other non-ref bases at het site + if maxdev >= detection_thresh: # greater than detection threshold = false positive (possible) + fpos += 1 + # output error sums and genome size to summary file + output.write( '%d\t%d\n' % ( fpos, fneg ) ) + sim_count += 1 + # close output up + output.close() + + # Parameters (heteroplasmy, error threshold, colours) + r( ''' + het=c(%s) + err=c(%s) + grade = (0:32)/32 + hues = rev(gray(grade)) + ''' % ( ','.join( [ str( p ) for p in polymorphisms ] ), ','.join( [ str( d ) for d in detection_threshes ] ) ) ) + + # Suppress warnings + r( 'options(warn=-1)' ) + + # Create allsum (for FP) and allneg (for FN) objects + r( 'allsum <- data.frame()' ) + for polymorphism in polymorphisms: + for detection_thresh in detection_threshes: + output = outputs[ polymorphism ][ detection_thresh ] + cmd = ''' + ngsum = read.delim('%s', header=T) + ngsum$fprate <- ngsum$FP/%s + ngsum$hetcol <- %s + ngsum$errcol <- %s + allsum <- rbind(allsum, ngsum) + ''' % ( output, seq_len, polymorphism, detection_thresh ) + r( cmd ) + + if os.path.getsize( output ) == 0: + for p in outputs.keys(): + for d in outputs[ p ].keys(): + sys.stderr.write(outputs[ p ][ d ] + ' '+str( os.path.getsize( outputs[ p ][ d ] ) )+'\n') + + if options.summary_out == "true": + r( 'write.table(summary(ngsum), file="%s", quote=FALSE, sep="\t", row.names=FALSE)' % options.output_summary ) + + # Summary objects (these could be printed) + r( ''' + tr_pos <- tapply(allsum$fprate,list(allsum$hetcol,allsum$errcol), mean) + tr_neg <- tapply(allsum$FN,list(allsum$hetcol,allsum$errcol), mean) + cat('\nFalse Positive Rate Summary\n\t', file='%s', append=T, sep='\t') + write.table(format(tr_pos, digits=4), file='%s', append=T, quote=F, sep='\t') + cat('\nFalse Negative Rate Summary\n\t', file='%s', append=T, sep='\t') + write.table(format(tr_neg, digits=4), file='%s', append=T, quote=F, sep='\t') + ''' % tuple( [ options.output_summary ] * 4 ) ) + + # Setup graphs + #pdf(paste(prefix,'_jointgraph.pdf',sep=''), 15, 10) + r( ''' + png('%s', width=800, height=500, units='px', res=250) + layout(matrix(data=c(1,2,1,3,1,4), nrow=2, ncol=3), widths=c(4,6,2), heights=c(1,10,10)) + ''' % options.output_png ) + + # Main title + genome = '' + if options.genome: + genome = '%s: ' % options.genome + r( ''' + par(mar=c(0,0,0,0)) + plot(1, type='n', axes=F, xlab='', ylab='') + text(1,1,paste('%sVariation in False Positives and Negatives (', %s, ' simulations, coverage ', %s,')', sep=''), font=2, family='sans', cex=0.7) + ''' % ( genome, options.num_sims, options.avg_coverage ) ) + + # False positive boxplot + r( ''' + par(mar=c(5,4,2,2), las=1, cex=0.35) + boxplot(allsum$fprate ~ allsum$errcol, horizontal=T, ylim=rev(range(allsum$fprate)), cex.axis=0.85) + title(main='False Positives', xlab='false positive rate', ylab='') + ''' ) + + # False negative heatmap (note zlim command!) + num_polys = len( polymorphisms ) + num_dets = len( detection_threshes ) + r( ''' + par(mar=c(5,4,2,1), las=1, cex=0.35) + image(1:%s, 1:%s, tr_neg, zlim=c(0,1), col=hues, xlab='', ylab='', axes=F, border=1) + axis(1, at=1:%s, labels=rownames(tr_neg), lwd=1, cex.axis=0.85, axs='i') + axis(2, at=1:%s, labels=colnames(tr_neg), lwd=1, cex.axis=0.85) + title(main='False Negatives', xlab='minor allele frequency', ylab='detection threshold') + ''' % ( num_polys, num_dets, num_polys, num_dets ) ) + + # Scale alongside + r( ''' + par(mar=c(2,2,2,3), las=1) + image(1, grade, matrix(grade, ncol=length(grade), nrow=1), col=hues, xlab='', ylab='', xaxt='n', las=1, cex.axis=0.85) + title(main='Key', cex=0.35) + mtext('false negative rate', side=1, cex=0.35) + ''' ) + + # Close graphics + r( ''' + layout(1) + dev.off() + ''' ) + + # Tidy up +# r( 'rm(folder,prefix,sim,cov,het,err,grade,hues,i,j,ngsum)' ) + +if __name__ == "__main__" : __main__() --- /dev/null +++ b/test-data/ngs_simulation_out2.tabular @@ -0,0 +1,19 @@ + FP FN GENOMESIZE.2686 fprate hetcol errcol +Min. :0.00 Min. :0 Mode:logical Min. :0.000e+00 Min. :0.1 Min. :0.02 +1st Qu.:0.00 1st Qu.:0 NA's:25 1st Qu.:0.000e+00 1st Qu.:0.1 1st Qu.:0.02 +Median :0.00 Median :0 NA Median :0.000e+00 Median :0.1 Median :0.02 +Mean :0.04 Mean :0 NA Mean :1.489e-05 Mean :0.1 Mean :0.02 +3rd Qu.:0.00 3rd Qu.:0 NA 3rd Qu.:0.000e+00 3rd Qu.:0.1 3rd Qu.:0.02 +Max. :1.00 Max. :0 NA Max. :3.723e-04 Max. :0.1 Max. :0.02 + +False Positive Rate Summary + 0.01 0.02 +0.02 9.710e-03 4.468e-05 +0.04 9.680e-03 1.489e-05 +0.1 9.695e-03 1.489e-05 + +False Negative Rate Summary + 0.01 0.02 +0.02 0.16 0.52 +0.04 0.00 0.04 +0.1 0.00 0.00

1 0

← Newer
1
...
5
6
7
8
9
10
11
...
29
Older →

Jump to page:

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

galaxy-commits November 2010