February 2011 - galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: jgoecks: Parse custom build len files using tabs rather than all whitespace; this matches the output produced by the tool 'Compute Sequence Length'
by Bitbucket 01 Feb '11

01 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/90a97c6aee95/ changeset: r4972:90a97c6aee95 user: jgoecks date: 2011-02-01 19:32:02 summary: Parse custom build len files using tabs rather than all whitespace; this matches the output produced by the tool 'Compute Sequence Length' affected #: 2 files (132 bytes) --- a/lib/galaxy/web/controllers/tracks.py Tue Feb 01 13:20:18 2011 -0500 +++ b/lib/galaxy/web/controllers/tracks.py Tue Feb 01 13:32:02 2011 -0500 @@ -313,8 +313,9 @@ for line in open( len_file ): if line.startswith("#"): continue - # LEN files are just whitespace separated - fields = line.split() + # LEN files have format: + # <chrom_name><tab><chrom_length> + fields = line.split("\t") manifest[fields[0]] = int(fields[1]) return manifest --- a/lib/galaxy/web/controllers/user.py Tue Feb 01 13:20:18 2011 -0500 +++ b/lib/galaxy/web/controllers/user.py Tue Feb 01 13:32:02 2011 -0500 @@ -1275,8 +1275,10 @@ counter = 0 f = open(new_len.file_name, "w") + # LEN files have format: + # <chrom_name><tab><chrom_length> for line in len_text.split("\n"): - lst = line.strip().split() + lst = line.strip().split("\t") if not lst or len(lst) < 2: lines_skipped += 1 continue Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix Manage your API keys link on the user preferences page.
by Bitbucket 01 Feb '11

01 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/7d19d6962076/ changeset: r4971:7d19d6962076 user: greg date: 2011-02-01 19:20:18 summary: Fix Manage your API keys link on the user preferences page. affected #: 1 file (18 bytes) --- a/templates/user/index.mako Tue Feb 01 13:11:24 2011 -0500 +++ b/templates/user/index.mako Tue Feb 01 13:20:18 2011 -0500 @@ -13,7 +13,7 @@ <li><a href="${h.url_for( controller='user', action='show_info' )}">${_('Manage your information')}</a></li><li><a href="${h.url_for( controller='user', action='set_default_permissions' )}">${_('Change default permissions')}</a> for new histories</li> %if trans.app.config.enable_api: - <li><a href="${h.url_for( controller='user', action='api_keys' )}">${_('Manage your API Keys')}</a> for new histories</li> + <li><a href="${h.url_for( controller='user', action='api_keys' )}">${_('Manage your API keys')}</a></li> %endif %if trans.app.config.enable_openid: <li><a href="${h.url_for( controller='user', action='openid_manage' )}">${ ('Manage OpenIDs')}</a> linked to your account</li> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Brad Chapman's patch for fixing an issue where the current user roles were not passed to a template.
by Bitbucket 01 Feb '11

01 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/5297d8f24693/ changeset: r4970:5297d8f24693 user: greg date: 2011-02-01 19:11:24 summary: Brad Chapman's patch for fixing an issue where the current user roles were not passed to a template. affected #: 2 files (114 bytes) --- a/lib/galaxy/web/controllers/library.py Tue Feb 01 11:21:41 2011 -0500 +++ b/lib/galaxy/web/controllers/library.py Tue Feb 01 13:11:24 2011 -0500 @@ -110,6 +110,7 @@ search_term=search_term, comptypes=comptypes, lddas=lddas, + current_user_roles=trans.get_current_user_roles(), show_deleted=show_deleted, use_panels=use_panels, message=message, --- a/scripts/data_libraries/build_lucene_index.py Tue Feb 01 11:21:41 2011 -0500 +++ b/scripts/data_libraries/build_lucene_index.py Tue Feb 01 13:11:24 2011 -0500 @@ -61,7 +61,7 @@ fname = "" else: fname = ldda.dataset.get_file_name() - yield ldda.id, fname, _get_dataset_metadata(ldda) + yield ldda.id, fname, _get_dataset_metadata(ldda).replace("\n", " ") def _get_dataset_metadata(ldda): """Retrieve descriptions and information associated with a dataset. Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Apply patch from Brad Chapman that fixes an issue when downloading a zip archive of library datasets. Also include some miscellansous imporvements and code cleanup related to changes made in change set 4964:82107691d26e.
by Bitbucket 01 Feb '11

01 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/1d4dbfe2e2ce/ changeset: r4969:1d4dbfe2e2ce user: greg date: 2011-02-01 17:21:41 summary: Apply patch from Brad Chapman that fixes an issue when downloading a zip archive of library datasets. Also include some miscellansous imporvements and code cleanup related to changes made in change set 4964:82107691d26e. affected #: 10 files (5.6 KB) --- a/lib/galaxy/util/streamball.py Tue Feb 01 11:20:02 2011 -0500 +++ b/lib/galaxy/util/streamball.py Tue Feb 01 11:21:41 2011 -0500 @@ -1,7 +1,7 @@ """ A simple wrapper for writing tarballs as a stream. """ - +import os import logging, tarfile log = logging.getLogger( __name__ ) @@ -26,3 +26,19 @@ tf.add( file, arcname=rel ) tf.close() return [] + +class ZipBall(object): + def __init__(self, tmpf, tmpd): + self._tmpf = tmpf + self._tmpd = tmpd + def stream(self, environ, start_response): + response_write = start_response( self.wsgi_status, self.wsgi_headeritems ) + tmpfh = open( self._tmpf ) + response_write(tmpfh.read()) + tmpfh.close() + try: + os.unlink( self._tmpf ) + os.rmdir( self._tmpd ) + except OSError: + log.exception( "Unable to remove temporary library download archive and directory" ) + return [] --- a/lib/galaxy/web/controllers/library.py Tue Feb 01 11:20:02 2011 -0500 +++ b/lib/galaxy/web/controllers/library.py Tue Feb 01 11:21:41 2011 -0500 @@ -35,7 +35,7 @@ attach_popup=False, filterable="advanced" ), ] - columns.append( grids.MulticolFilterColumn( "search library dataset name, info, message, dbkey", + columns.append( grids.MulticolFilterColumn( "search dataset name, info, message, dbkey", cols_to_filter=[ columns[0], columns[1] ], key="free-text-search", visible=False, --- a/lib/galaxy/web/controllers/library_admin.py Tue Feb 01 11:20:02 2011 -0500 +++ b/lib/galaxy/web/controllers/library_admin.py Tue Feb 01 11:21:41 2011 -0500 @@ -50,7 +50,7 @@ # Columns that are valid for filtering but are not visible. grids.DeletedColumn( "Deleted", key="deleted", visible=False, filterable="advanced" ) ] - columns.append( grids.MulticolFilterColumn( "search library dataset name, info, message, dbkey", + columns.append( grids.MulticolFilterColumn( "search dataset name, info, message, dbkey", cols_to_filter=[ columns[0], columns[1] ], key="free-text-search", visible=False, --- a/lib/galaxy/web/controllers/library_common.py Tue Feb 01 11:20:02 2011 -0500 +++ b/lib/galaxy/web/controllers/library_common.py Tue Feb 01 11:21:41 2011 -0500 @@ -1706,20 +1706,12 @@ fname = lname.replace( ' ', '_' ) + '_files' if action == 'zip': archive.close() - tmpfh = open( tmpf ) - # clean up now - try: - os.unlink( tmpf ) - os.rmdir( tmpd ) - except OSError: - error = True - log.exception( "Unable to remove temporary library download archive and directory" ) - message = "Unable to create archive for download, please report this error" - status = 'error' - if not error: - trans.response.set_content_type( "application/x-zip-compressed" ) - trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) - return tmpfh + trans.response.set_content_type( "application/x-zip-compressed" ) + trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) + archive = util.streamball.ZipBall(tmpf, tmpd) + archive.wsgi_status = trans.response.wsgi_status() + archive.wsgi_headeritems = trans.response.wsgi_headeritems() + return archive.stream elif action == 'ngxzip': trans.response.set_content_type( "application/zip" ) trans.response.headers[ "Content-Disposition" ] = "attachment; filename=%s.%s" % (fname,outext) @@ -1831,11 +1823,11 @@ hist_names_str = ", ".join( [ target_history.name for target_history in target_histories ] ) num_source = len( ldda_ids ) - invalid_datasets num_target = len( target_histories ) - message = "%i %s have been imported into %i %s: %s" % ( num_source, - inflector.cond_plural( num_source, "dataset" ), - num_target, - inflector.cond_plural( num_target, "history" ), - hist_names_str ) + message = "%i %s imported into %i %s: %s" % ( num_source, + inflector.cond_plural( num_source, "dataset" ), + num_target, + inflector.cond_plural( num_target, "history" ), + hist_names_str ) trans.sa_session.refresh( current_history ) current_user_roles = trans.get_current_user_roles() source_lddas = [] @@ -2240,7 +2232,7 @@ # Perform search parser = MultifieldParser( [ 'name', 'info', 'dbkey', 'message' ], schema=schema ) # Search term with wildcards may be slow... - results = searcher.search( parser.parse( '*' + search_term + '*' ), minscore=0.1 ) + results = searcher.search( parser.parse( '*' + search_term + '*' ), minscore=0.5 ) ldda_ids = [ result[ 'id' ] for result in results ] lddas = [] for ldda_id in ldda_ids: --- a/scripts/data_libraries/build_whoosh_index.py Tue Feb 01 11:20:02 2011 -0500 +++ b/scripts/data_libraries/build_whoosh_index.py Tue Feb 01 11:21:41 2011 -0500 @@ -63,7 +63,10 @@ else: info = '' dbkey = ldda.metadata.dbkey - message = ldda.message + if ldda.message: + message = ldda.message + else: + message = '' yield id, name, info, dbkey, message def get_sa_session_and_needed_config_settings( ini_file ): --- a/templates/library/common/browse_library.mako Tue Feb 01 11:20:02 2011 -0500 +++ b/templates/library/common/browse_library.mako Tue Feb 01 11:21:41 2011 -0500 @@ -1,6 +1,7 @@ <%namespace file="/message.mako" import="render_msg" /><%namespace file="/library/common/library_item_info.mako" import="render_library_item_info" /><%namespace file="/library/common/common.mako" import="render_actions_on_multiple_items" /> +<%namespace file="/library/common/common.mako" import="render_compression_types_help" /><%namespace file="/library/common/common.mako" import="common_javascripts" /><%! @@ -564,34 +565,6 @@ </script> %endif - - ## Help about compression types - - <div class="libraryItemBody"> - <p class="infomark"> - TIP: You can download individual library files by selecting "Download this dataset" from the context menu (triangle) next to the dataset's name. - </p> - </div> - %if len( comptypes ) > 1: - <div class="libraryItemBody"> - <p class="infomark"> - TIP: Multiple compression options are available for downloading library datasets: - </p> - <ul style="padding-left: 1em; list-style-type: disc;"> - %if 'gz' in comptypes: - <li>gzip: Recommended for fast network connections - %if trans.app.config.upstream_gzip: - NOTE: The file you receive will be an uncompressed .tar file - this is because the Galaxy server compresses it and your browser decompresses it on the fly. - %endif - </li> - %endif - %if 'bz2' in comptypes: - <li>bzip2: Recommended for slower network connections (smaller size but takes longer to compress)</li> - %endif - %if 'zip' in comptypes: - <li>zip: Not recommended but is provided as an option for those who cannot open the above formats</li> - %endif - </ul> - </div> - %endif + + ${render_compression_types_help( comptypes )} </%def> --- a/templates/library/common/common.mako Tue Feb 01 11:20:02 2011 -0500 +++ b/templates/library/common/common.mako Tue Feb 01 11:21:41 2011 -0500 @@ -43,6 +43,36 @@ </script></%def> +<%def name="render_compression_types_help( comptypes )"> + <div class="libraryItemBody"> + <p class="infomark"> + TIP: You can download individual library datasets by selecting "Download this dataset" from the context menu (triangle) next to each dataset's name. + </p> + </div> + %if len( comptypes ) > 1: + <div class="libraryItemBody"> + <p class="infomark"> + TIP: Several compression options are available for downloading multiple library datasets simultaneously: + </p> + <ul style="padding-left: 1em; list-style-type: disc;"> + %if 'gz' in comptypes: + <li>gzip: Recommended for fast network connections + %if trans.app.config.upstream_gzip: + NOTE: The file you receive will be an uncompressed .tar file - this is because the Galaxy server compresses it and your browser decompresses it on the fly. + %endif + </li> + %endif + %if 'bz2' in comptypes: + <li>bzip2: Recommended for slower network connections (smaller size but takes longer to compress)</li> + %endif + %if 'zip' in comptypes: + <li>zip: Not recommended but is provided as an option for those who cannot open the above formats</li> + %endif + </ul> + </div> + %endif +</%def> + <%def name="render_upload_form( cntrller, upload_option, action, library_id, folder_id, replace_dataset, file_formats, dbkeys, space_to_tab, link_data_only, widgets, roles_select_list, history, show_deleted )"><% import os, os.path --- a/templates/library/common/import_datasets_to_histories.mako Tue Feb 01 11:20:02 2011 -0500 +++ b/templates/library/common/import_datasets_to_histories.mako Tue Feb 01 11:21:41 2011 -0500 @@ -58,8 +58,14 @@ <select id="single-dest-select" name="target_history_ids"><option value=""></option> %for i, target_history in enumerate( target_histories ): - <% encoded_id = trans.security.encode_id( target_history.id ) %> - <option value="${encoded_id}">${i + 1}: ${h.truncate( target_history.name, 30 )}</option> + <% + encoded_id = trans.security.encode_id( target_history.id ) + if target_history == current_history: + current_history_text = " (current history)" + else: + current_history_text = "" + %> + <option value="${encoded_id}">${i + 1}: ${h.truncate( target_history.name, 30 )}${current_history_text}</option> %endfor </select><br/><br/> @@ -68,12 +74,15 @@ <div id="multiple-destination" style="display: none;"> %for i, target_history in enumerate( target_histories ): <% - cur_history_text = "" encoded_id = trans.security.encode_id( target_history.id ) + if target_history == current_history: + current_history_text = " (current history)" + else: + current_history_text = "" %><div class="form-row"><input type="checkbox" name="target_history_ids" id="target_history_${encoded_id}" value="${encoded_id}"/> - <label for="target_history_${encoded_id}" style="display: inline; font-weight:normal;">${i + 1}: ${target_history.name}${cur_history_text}</label> + <label for="target_history_${encoded_id}" style="display: inline; font-weight:normal;">${i + 1}: ${target_history.name}${current_history_text}</label></div> %endfor </div> --- a/templates/library/common/library_dataset_search_results.mako Tue Feb 01 11:20:02 2011 -0500 +++ b/templates/library/common/library_dataset_search_results.mako Tue Feb 01 11:21:41 2011 -0500 @@ -1,6 +1,7 @@ <%namespace file="/message.mako" import="render_msg" /><%namespace file="/library/common/browse_library.mako" import="render_dataset" /><%namespace file="/library/common/common.mako" import="render_actions_on_multiple_items" /> +<%namespace file="/library/common/common.mako" import="render_compression_types_help" /><%namespace file="/library/common/common.mako" import="common_javascripts" /><%! @@ -127,35 +128,7 @@ ${render_actions_on_multiple_items( actions_to_exclude=[ 'manage_permissions' ] )} </table></form> - ## Help about compression types - - <div class="libraryItemBody"> - <p class="infomark"> - TIP: You can download individual library files by selecting "Download this dataset" from the context menu (triangle) next to the dataset's name. - </p> - </div> - %if len( comptypes ) > 1: - <div class="libraryItemBody"> - <p class="infomark"> - TIP: Multiple compression options are available for downloading library datasets: - </p> - <ul style="padding-left: 1em; list-style-type: disc;"> - %if 'gz' in comptypes: - <li>gzip: Recommended for fast network connections - %if trans.app.config.upstream_gzip: - NOTE: The file you receive will be an uncompressed .tar file - this is because the Galaxy server compresses it and your browser decompresses it on the fly. - %endif - </li> - %endif - %if 'bz2' in comptypes: - <li>bzip2: Recommended for slower network connections (smaller size but takes longer to compress)</li> - %endif - %if 'zip' in comptypes: - <li>zip: Not recommended but is provided as an option for those who cannot open the above formats</li> - %endif - </ul> - </div> - %endif + ${render_compression_types_help( comptypes )} %elif status != 'error': <p>The string "${search_term}" was not found in any of the following information components for any library datasets that you can access.</p> ${render_searched_components()} --- a/test/functional/test_library_security.py Tue Feb 01 11:20:02 2011 -0500 +++ b/test/functional/test_library_security.py Tue Feb 01 11:21:41 2011 -0500 @@ -300,7 +300,7 @@ library_id=self.security.encode_id( library1.id ), ldda_ids=self.security.encode_id( ldda2.id ), new_history_name='goodbye', - strings_displayed=[ '1 dataset have been imported into 1 history' ] ) + strings_displayed=[ '1 dataset imported into 1 history' ] ) self.logout() # regular_user2 should not be able to see ldda2 self.login( email=regular_user2.email ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 01 Feb '11

01 Feb '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/d6559b2d69fc/ changeset: r4967:d6559b2d69fc user: jgoecks date: 2011-02-01 17:19:40 summary: Use classes instead of ids in tool menu URLs so that search works correctly when recently used menu is visible. affected #: 1 file (6 bytes) --- a/templates/root/tool_menu.mako Mon Jan 31 18:25:33 2011 -0500 +++ b/templates/root/tool_menu.mako Tue Feb 01 11:19:40 2011 -0500 @@ -21,9 +21,9 @@ ## ${tool.description.replace( '[[', '<a href="link" target="galaxy_main">' % $tool.id ).replace( "]]", "</a>" ) <% tool_id = re.sub( '[^a-z0-9_]', '_', tool.id.lower() ) %> %if tool.name: - <a id="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${_(tool.name)}</a> ${tool.description} + <a class="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${_(tool.name)}</a> ${tool.description} %else: - <a id="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${tool.description}</a> + <a class="link-${tool_id}" href="${link}" target=${tool.target} minsizehint="${tool.uihints.get( 'minwidth', -1 )}">${tool.description}</a> %endif </div> %endif @@ -140,7 +140,7 @@ $(".toolSectionWrapper").find(".toolTitle").hide(); if ( data.length != 0 ) { // Map tool ids to element ids and join them. - var s = $.map( data, function( n, i ) { return "#link-" + n.toLowerCase().replace(/[^a-z0-9_]/g,'_'); } ).join( ", " ); + var s = $.map( data, function( n, i ) { return ".link-" + n.toLowerCase().replace(/[^a-z0-9_]/g,'_'); } ).join( ", " ); // First pass to show matching tools and their parents. $(s).each( function() { http://bitbucket.org/galaxy/galaxy-central/changeset/f9770f73f784/ changeset: r4968:f9770f73f784 user: jgoecks date: 2011-02-01 17:20:02 summary: Merge. affected #: 0 files (0 bytes) --- a/datatypes_conf.xml.sample Tue Feb 01 11:19:40 2011 -0500 +++ b/datatypes_conf.xml.sample Tue Feb 01 11:20:02 2011 -0500 @@ -114,6 +114,7 @@ <datatype extension="taxonomy" type="galaxy.datatypes.tabular:Taxonomy" display_in_upload="true"/><datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/><datatype extension="txt" type="galaxy.datatypes.data:Text" display_in_upload="true"/> + <datatype extension="memexml" type="galaxy.datatypes.xml:MEMEXml" display_in_upload="true"/><datatype extension="blastxml" type="galaxy.datatypes.xml:BlastXml" display_in_upload="true"/><datatype extension="vcf" type="galaxy.datatypes.tabular:Vcf" display_in_upload="true"><converter file="vcf_to_interval_index_converter.xml" target_datatype="interval_index"/> --- a/lib/galaxy/datatypes/xml.py Tue Feb 01 11:19:40 2011 -0500 +++ b/lib/galaxy/datatypes/xml.py Tue Feb 01 11:20:02 2011 -0500 @@ -39,3 +39,18 @@ line = line.rstrip( '\n\r' ) if line != blastxml_header[ i ]: return False + +class MEMEXml( data.Text ): + """MEME XML Output data""" + file_ext = "memexml" + + def set_peek( self, dataset, is_multi_byte=False ): + """Set the peek and blurb text""" + if not dataset.dataset.purged: + dataset.peek = data.get_file_peek( dataset.file_name, is_multi_byte=is_multi_byte ) + dataset.blurb = 'MEME XML data' + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def sniff( self, filename ): + return False --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme/meme/meme_output_html_1.html Tue Feb 01 11:20:02 2011 -0500 @@ -0,0 +1,2819 @@ +<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> +<html> +<head> +<meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> +<title>MEME</title> +<style type="text/css"> + /* The following is the content of meme.css */ + body { background-color:white; font-size: 12px; font-family: Verdana, Arial, Helvetica, sans-serif;} + + div.help { + display: inline-block; + margin: 0px; + padding: 0px; + width: 12px; + height: 13px; + background-image: url("help.gif"); + background-image: url("data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAAwAAAANAQMAAACn5x0BAAAAAXNSR0IArs4c6QAAAAZQTFRFAAAAnp6eqp814gAAAAF0Uk5TAEDm2GYAAAABYktHRACIBR1IAAAACXBIWXMAAAsTAAALEwEAmpwYAAAAB3RJTUUH2gMJBQgGYqhNZQAAACZJREFUCNdj+P+BoUGAoV+AYeYEEGoWYGgTYGgRAAm2gRGQ8f8DAOnhC2lYnqs6AAAAAElFTkSuQmCC"); + } + + p.spaced { line-height: 1.8em;} + + p.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + + td.jump { font-size: 13px; color: #ffffff; background-color: #00666a; + font-family: Georgia, "Times New Roman", Times, serif;} + + a.jump { margin: 15px 0 0; font-style: normal; font-variant: small-caps; + font-weight: bolder; font-family: Georgia, "Times New Roman", Times, serif;} + + h2.mainh {font-size: 1.5em; font-style: normal; margin: 15px 0 0; + font-variant: small-caps; font-family: Georgia, "Times New Roman", Times, serif;} + + h2.line {border-bottom: 1px solid #CCCCCC; font-size: 1.5em; font-style: normal; + margin: 15px 0 0; padding-bottom: 3px; font-variant: small-caps; + font-family: Georgia, "Times New Roman", Times, serif;} + + h4 {border-bottom: 1px solid #CCCCCC; font-size: 1.2em; font-style: normal; + margin: 10px 0 0; padding-bottom: 3px; font-family: Georgia, "Times New Roman", Times, serif;} + + h5 {margin: 0px} + + a.help { font-size: 9px; font-style: normal; text-transform: uppercase; + font-family: Georgia, "Times New Roman", Times, serif;} + + div.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + + div.pad1 { margin: 10px 5px;} + + div.pad2 { margin: 25px 5px 5px;} + h2.pad2 { padding: 25px 5px 5px;} + + div.pad3 { padding: 5px 0px 10px 30px;} + + div.box { border: 2px solid #CCCCCC; padding:10px;} + + div.bar { border-left: 7px solid #00666a; padding:5px; margin-top:25px; } + + div.subsection {margin:25px 0px;} + + img {border:0px none;} + + th.majorth {text-align:left;} + th.minorth {font-weight:normal; text-align:left; width:8em; padding: 3px 0px;} + th.actionth {font-weight:normal; text-align:left;} + + .strand_name {text-align:left;} + .strand_side {padding:0px 10px;} + .strand_start {padding:0px 10px;} + .strand_pvalue {text-align:center; padding:0px 10px;} + .strand_lflank {text-align:right; padding-right:5px; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace; color:gray;} + .strand_seq {text-align:center; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace;} + .strand_rflank {text-align:left; padding-left:5px; font-weight:bold; font-size:large; font-family: 'Courier New', Courier, monospace; color:gray;} + + .block_td {height:25px;} + .block_container {position:relative; width:99%; height:25px; padding:0px; margin:0px;} + .block_motif {position:absolute; z-index:3; height:12px; top:0px; text-align:center; vertical-align:middle; background-color:cyan;} + .block_rule {position:absolute; z-index:2; width:100%; height:1px; top:12px; left:0px; background-color:gray;} + .block_plus_sym {position:absolute; z-index:4; width:12px; height:12px; top:0px; left:0px; color:gray;} + .block_minus_sym {position:absolute; z-index:4; width:12px; height:12px; top:13px; left:0px; color:gray;} + + .tic_major {position:absolute; border-left:2px solid blue; height:0.5em; top:0em;} + .tic_minor {position:absolute; border-left:1px solid blue; height:0.2em; top:0em;} + .tic_label {position:absolute; top:0.5em; height: 1em; text-align:center; vertical-align:middle} + + .explain h5 {font-size:1em; margin-left: 1em;} + + div.doc {margin-left: 2em; margin-bottom: 3em;} + + div.tabArea { + font-size: 80%; + font-weight: bold; + } + + a.tab { + background-color: #ddddff; + border: 1px solid #000000; + border-top-width: 0px; + padding: 2px 1em 2px 1em; + text-decoration: none; + } + + a.tab, a.tab:visited { + color: #808080; + } + + a.tab:hover { + background-color: #d0d0d0; + color: #606060; + } + a.tab.activeTab, a.tab.activeTab:hover, a.tab.activeTab:visited { + background-color: #f0f0f0; + color: #000000; + } + div.tabMain { + border: 1px solid #000000; + background-color: #ffffff; + padding: 5px; + margin-right: 5px; + } + th.trainingset { + border-bottom: thin dashed black; + font-weight:normal; + padding:0px 10px; + } + + </style> +<script type="text/javascript"> + //====================================================================== + // start Alphabet object + //====================================================================== + function Alphabet(alphabet, bg) { + //variable prototype + this.freqs = new Array(); + this.alphabet = new Array(); + this.letter_count = 0; + //method prototype + this.get_ic = Alphabet_get_ic; + this.get_size = Alphabet_get_size; + this.get_index = Alphabet_get_index; + this.get_letter = Alphabet_get_letter; + this.get_colour = Alphabet_get_colour; + this.get_bg_freq = Alphabet_get_bg_freq; + this.is_nucleotide = Alphabet_is_nucleotide; + this.is_ambig = Alphabet_is_ambig; + this.toString = Alphabet_to_string; + //construct + var is_letter = /^\w$/; + var is_prob = /^((1(\.0+)?)|(0(\.\d+)?))$/; + for (var pos = 0; pos < alphabet.length; pos++) { + var letter = alphabet.charAt(pos); + if (is_letter.test(letter)) { + this.alphabet[this.letter_count] = letter.toUpperCase(); + this.freqs[this.letter_count] = -1; + this.letter_count++; + } + } + if (!(bg === undefined)) { + var parts = bg.split(/\s+/); + for (var i = 0, pos = 0; (i + 1) < parts.length; i += 2) { + var letter = parts[i]; + var freq = parts[i+1]; + if (is_letter.test(letter) && is_prob.test(freq)) { + letter = letter.toUpperCase(); //find the letter it matches + for (;pos < this.letter_count; pos++) { + if (this.alphabet[pos] == letter) break; + } + if (pos >= this.letter_count) throw "NOT_IN_ALPHABET"; + this.freqs[pos] = (+freq); + } + } + } + } + + + function Alphabet_get_ic() { + if (this.is_nucleotide()) { + return 2; + } else { + return Math.log(20) / Math.LN2; + } + } + + function Alphabet_get_size() { + return this.letter_count; + } + + function Alphabet_get_letter(alph_index) { + if (alph_index < 0 || alph_index >= this.letter_count) { + throw "BAD_ALPHABET_INDEX"; + } + return this.alphabet[alph_index]; + } + + function Alphabet_get_bg_freq(alph_index) { + if (alph_index < 0 || alph_index >= this.letter_count) { + throw "BAD_ALPHABET_INDEX"; + } + if (this.freqs[alph_index] == -1) throw "BG_FREQ_NOT_SET"; + return this.freqs[alph_index]; + } + + function Alphabet_get_colour(alph_index) { + var red = "rgb(204,0,0)"; + var blue = "rgb(0,0,204)"; + var orange = "rgb(255,179,0)"; + var green = "rgb(0,128,0)"; + var yellow = "rgb(255,255,0)"; + var purple = "rgb(204,0,204)"; + var magenta = "rgb(255,0,255)"; + var pink = "rgb(255,204,204)"; + var turquoise = "rgb(51,230,204)"; + if (alph_index < 0 || alph_index >= this.letter_count) { + throw "BAD_ALPHABET_INDEX"; + } + if (this.is_nucleotide()) { + switch (this.alphabet[alph_index]) { + case "A": + return red; + case "C": + return blue; + case "G": + return orange; + case "T": + return green; + } + } else { + switch (this.alphabet[alph_index]) { + case "A": + case "C": + case "F": + case "I": + case "L": + case "V": + case "W": + case "M": + return blue; + case "N": + case "Q": + case "S": + case "T": + return green; + case "D": + case "E": + return magenta; + case "K": + case "R": + return red; + case "H": + return pink; + case "G": + return orange; + case "P": + return yellow; + case "Y": + return turquoise; + } + } + return "black"; + } + + function Alphabet_is_ambig(alph_index) { + if (alph_index < 0 || alph_index >= this.letter_count) { + throw "BAD_ALPHABET_INDEX"; + } + if (this.is_nucleotide()) { + return ("ACGT".indexOf(this.alphabet[alph_index]) == -1); + } else { + return ("ACDEFGHIKLMNPQRSTVWY".indexOf(this.alphabet[alph_index]) == -1); + } + } + + function Alphabet_get_index(letter) { + for (i = 0; i < this.letter_count; i++) { + if (this.alphabet[i] == letter.toUpperCase()) return i; + } + throw "UNKNOWN_LETTER"; + } + + function Alphabet_is_nucleotide() { + //TODO basic method, make better + if (this.letter_count < 20) return true; + return false; + } + + function Alphabet_to_string() { + return (this.is_nucleotide() ? "Nucleotide" : "Protein") + " Alphabet " + (this.alphabet.join("")); + } + + //====================================================================== + // end Alphabet object + //====================================================================== + + //====================================================================== + // start Symbol object + //====================================================================== + function Symbol(alph_index, scale, alphabet) { + //variable prototype + this.symbol = alphabet.get_letter(alph_index); + this.scale = scale; + this.colour = alphabet.get_colour(alph_index); + //function prototype + this.get_symbol = Symbol_get_symbol; + this.get_scale = Symbol_get_scale; + this.get_colour = Symbol_get_colour; + this.toString = Symbol_to_string; + } + + function Symbol_get_symbol() { + return this.symbol; + } + + function Symbol_get_scale() { + return this.scale; + } + + function Symbol_get_colour() { + return this.colour; + } + + function Symbol_to_string() { + return this.symbol + " " + (Math.round(this.scale*1000)/10) + "%"; + } + + function compare_symbol(sym1, sym2) { + if (sym1.get_scale() < sym2.get_scale()) { + return -1; + } else if (sym1.get_scale() > sym2.get_scale()) { + return 1; + } else { + return 0; + } + } + //====================================================================== + // end Symbol object + //====================================================================== + + //====================================================================== + // start Pspm object + //====================================================================== + function Pspm(pssm, name) { + //variable prototype + this.alph_length = 0; + this.motif_length = 0; + this.pspm = new Array(); + this.name = (typeof name == "string" ? name : ""); + this.nsites = 0; + this.evalue = 0; + //function prototype + this.copy = Pspm_copy; + this.reverse_complement = Pspm_reverse_complement; + this.get_stack = Pspm_get_stack; + this.get_stack_ic = Pspm_get_stack_ic; + this.get_motif_length = Pspm_get_motif_length; + this.get_alph_length = Pspm_get_alph_length; + this.toString = Pspm_to_string; + //construct + var pspm_header = /letter-probability matrix:\s+alength=\s+(\d+)\s+w=\s+(\d+)(\s+nsites=\s+(\S+))?(\s+E=\s+(\S+))?\s*/; + var is_prob = /^((1(\.0+)?)|(0(\.\d+)?))$/; + var is_empty = /^\s*$/; + var lines = pssm.split(/\s*\n\s*/); + var read_pssm = false; + var line_num = 0; + var col_num = 0; + for (line_index in lines) { + //exclude inherited properties and undefined properties + if (!lines.hasOwnProperty(line_index) || lines[line_index] === undefined) continue; + + var line = lines[line_index]; + if (is_empty.test(line)) { + continue; + } + if (!read_pssm) { + var header_match = pspm_header.exec(line); + if (header_match != null) { + read_pssm = true; + this.alph_length = (+header_match[1]); + this.motif_length = (+header_match[2]); + if (header_match[4]) this.nsites = parseFloat(header_match[4]);//not always an integer + if (header_match[6]) this.evalue = parseFloat(header_match[6]); + this.pspm = new Array(this.motif_length); + } + continue; + } + if (line_num >= this.motif_length) { + throw "TOO_MANY_ROWS"; + } + this.pspm[line_num] = new Array(this.alph_length); + col_num = 0; + var parts = line.split(/\s+/); + for (part_index in parts) { + //exclude inherited properties and undefined properties + if (!parts.hasOwnProperty(part_index) || parts[part_index] === undefined) continue; + + var prob = parts[part_index]; + if (!is_prob.test(prob)) continue; + if (col_num >= this.alph_length) { + throw "TOO_MANY_COLS"; + } + this.pspm[line_num][col_num] = (+prob); + col_num++; + } + if (col_num != this.alph_length) { + throw "TOO_FEW_COLS"; + } + line_num++; + } + if (line_num != this.motif_length) { + throw "TOO_FEW_ROWS"; + } + } + + function Clone() {} + + function Pspm_copy() { + Clone.prototype = this; + var clone = new Clone(); + //so far only a shallow copy, need to copy everything + clone.alph_length = (0+this.alph_length); + clone.motif_length = (0+this.motif_length); + clone.pspm = new Array(this.motif_length); + for (row = 0; row < this.motif_length; row++) { + clone.pspm[row] = new Array(this.alph_length); + for (col = 0; col < this.alph_length; col++) { + clone.pspm[row][col] = (0+this.pspm[row][col]); + } + } + return clone; + } + + function Pspm_reverse_complement(alphabet) { + if (this.alph_length != alphabet.get_size()) { + throw "ALPHABET_MISMATCH"; + } + if (!alphabet.is_nucleotide()) { + throw "NO_PROTEIN_RC"; + } + //reverse + var x = 0; + var y = this.motif_length-1; + while (x < y) { + var temp = this.pspm[x]; + this.pspm[x] = this.pspm[y]; + this.pspm[y] = temp; + x++; + y--; + } + //complement + var a_index = alphabet.get_index("A"); + var c_index = alphabet.get_index("C"); + var g_index = alphabet.get_index("G"); + var t_index = alphabet.get_index("T"); + for (i = 0; i < this.motif_length; i++) { + var row = this.pspm[i]; + //swap A and T + var temp = row[a_index]; + row[a_index] = row[t_index]; + row[t_index] = temp; + //swap C and G + temp = row[c_index]; + row[c_index] = row[g_index]; + row[g_index] = temp; + } + //note that ambigs are ignored because they don't effect motifs + return this; //allow function chaining... + } + + function Pspm_get_stack(position, alphabet) { + if (this.alph_length != alphabet.get_size()) { + throw "ALPHABET_MISMATCH"; + } + var row = this.pspm[position]; + var stack_ic = this.get_stack_ic(position, alphabet); + var alphabet_ic = alphabet.get_ic(); + var stack = new Array(); + for (i = 0; i < this.alph_length; i++) { + if (alphabet.is_ambig(i)) continue; + var sym = new Symbol(i, row[i]*stack_ic/alphabet_ic, alphabet); + if (sym.get_scale() <= 0) continue; + stack.push(sym); + } + stack.sort(compare_symbol); + return stack; + } + + function Pspm_get_stack_ic(position, alphabet) { + if (this.alph_length != alphabet.get_size()) { + throw "ALPHABET_MISMATCH"; + } + var row = this.pspm[position]; + var H = 0; + for (var i = 0; i < this.alph_length; i++) { + if (alphabet.is_ambig(i)) continue; + if (row[i] == 0) continue; + H -= (row[i] * (Math.log(row[i]) / Math.LN2)); + } + return alphabet.get_ic() - H; + } + + function Pspm_get_error(alphabet) { + var asize; + if (this.nsites == 0) return 0; + if (alphabet.is_nucleotide()) { + asize = 4; + } else { + asize = 20; + } + return (asize-1) / (2 * Math.log(2)*this.nsites); + } + + function Pspm_get_motif_length() { + return this.motif_length; + } + + function Pspm_get_alph_length() { + return this.alph_length; + } + + function Pspm_to_string() { + var str = ""; + for (row_index in this.pspm) { + //exclude inherited properties and undefined properties + if (!this.pspm.hasOwnProperty(row_index) || this.pspm[row_index] === undefined) continue; + + var row = this.pspm[row_index]; + str += row.join("\t") + "\n"; + } + return str; + } + //====================================================================== + // end Pspm object + //====================================================================== + + //====================================================================== + // start Logo object + //====================================================================== + function Logo(alphabet, fine_text) { + this.alphabet = alphabet; + this.fine_text = fine_text; + this.pspm_list = []; + this.pspm_column = []; + this.rows = 0; + this.columns = 0; + + //functions + this.add_pspm = Logo_add_pspm; + this.get_columns = Logo_get_columns; + this.get_rows = Logo_get_rows; + this.get_pspm = Logo_get_pspm; + this.get_offset = Logo_get_offset; + } + + function Logo_add_pspm(pspm, column) { + if (column === undefined) column = 0; + else if (column < 0) throw "COLUMN_OUT_OF_BOUNDS"; + this.pspm_list[this.rows] = pspm; + this.pspm_column[this.rows] = column; + this.rows++; + var col = column + pspm.get_motif_length(); + if (col > this.columns) this.columns = col; + } + + function Logo_get_columns() { + return this.columns; + } + + function Logo_get_rows() { + return this.rows; + } + + function Logo_get_pspm(row_index) { + if (row_index < 0 || row_index >= this.rows) throw "INDEX_OUT_OF_BOUNDS"; + return this.pspm_list[row_index]; + } + + function Logo_get_offset(row_index) { + if (row_index < 0 || row_index >= this.rows) throw "INDEX_OUT_OF_BOUNDS"; + return this.pspm_column[row_index]; + } + + //====================================================================== + // end Logo object + //====================================================================== + + //====================================================================== + // start RasterizedAlphabet + //====================================================================== + + // Rasterize Alphabet + // 1) Measure width of text at default font for all symbols in alphabet + // 2) sort in width ascending + // 3) Drop the top and bottom 10% (designed to ignore outliers like 'W' and 'I') + // 4) Calculate the average as the maximum scaling factor (designed to stop I becoming a rectangular blob). + // 5) Assume scale of zero would result in width of zero, interpolate scale required to make perfect width font + // 6) Draw text onto temp canvas at calculated scale + // 7) Find bounds of drawn text + // 8) Paint on to another canvas at the desired height (but only scaling width to fit if larger). + function RasterizedAlphabet(alphabet, font, target_width) { + //variable prototypes + this.lookup = []; //a map of letter to index + this.rasters = []; //a list of rasters + this.dimensions = []; //a list of dimensions + + //function prototypes + this.draw = RasterizedAlphabet_draw; + + //construct + var default_size = 60; // size of square to assume as the default width + var safety_pad = 20; // pixels to pad around so we don't miss the edges + // create a canvas to do our rasterizing on + var canvas = document.createElement("canvas"); + // assume the default font would fit in a canvas of 100 by 100 + canvas.width = default_size + 2 * safety_pad; + canvas.height = default_size + 2 * safety_pad; + // check for canvas support before attempting anything + if (!canvas.getContext) throw "NO_CANVAS_SUPPORT"; + var ctx = canvas.getContext('2d'); + // check for html5 text drawing support + if (!supports_text(ctx)) throw "NO_CANVAS_TEXT_SUPPORT"; + // calculate the middle + var middle = Math.round(canvas.width / 2); + // calculate the baseline + var baseline = Math.round(canvas.height - safety_pad); + // list of widths + var widths = []; + var count = 0; + var letters = []; + //now measure each letter in the alphabet + for (var i = 0; i < alphabet.get_size(); ++i) { + if (alphabet.is_ambig(i)) continue; //skip ambigs as they're never rendered + var letter = alphabet.get_letter(i); + letters.push(letter); + var pos = count++; + this.lookup[letter] = pos; + //clear the canvas + canvas.width = canvas.width; + // get the context and prepare to draw our width test + var ctx = canvas.getContext('2d'); + ctx.font = font; + ctx.fillStyle = alphabet.get_colour(i); + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + // draw the test text + ctx.fillText(letter, 0, 0); + //measure + var size = RasterizedAlphabet_measure(ctx, canvas.width, canvas.height); + if (size.width == 0) throw "INVISIBLE_LETTER"; //maybe the fill was white on white? + widths.push(size.width); + this.dimensions[pos] = size; + } + //sort the widths + widths.sort(function(a,b) {return a - b;}); + //drop 10% of the items off each end + var tenpercent = Math.floor(widths.length / 10); + for (var i = 0; i < tenpercent; ++i) { + widths.pop(); + widths.shift(); + } + //calculate average width + var avg_width = 0; + for (var i = 0; i < widths.length; ++i) avg_width += widths[i]; + avg_width /= widths.length; + // calculate scales + for (var i = 0; i < this.dimensions.length; ++i) { + var size = this.dimensions[i]; + // calculate scale + var scale = target_width / Math.max(avg_width, size.width); + // estimate scaled height + var target_height = size.height * scale; + // create an approprately sized canvas + var raster = document.createElement("canvas"); + raster.width = target_width; // if it goes over the edge too bad... + raster.height = target_height + safety_pad * 2; + // calculate the middle + middle = Math.round(raster.width / 2); + // calculate the baseline + baseline = Math.round(raster.height - safety_pad); + // get the context and prepare to draw the rasterized text + ctx = raster.getContext('2d'); + ctx.font = font; + ctx.fillStyle = alphabet.get_colour(i); + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + ctx.save(); + ctx.scale(scale, scale); + // draw the rasterized text + ctx.fillText(letters[i], 0, 0); + ctx.restore(); + this.rasters[i] = raster; + this.dimensions[i] = RasterizedAlphabet_measure(ctx, raster.width, raster.height); + } + } + + function RasterizedAlphabet_measure(ctx, cwidth, cheight) { + var data = ctx.getImageData(0, 0, cwidth, cheight).data; + var r = 0, c = 0;// r: row, c: column + var top_line = -1, bottom_line = -1, left_line = -1, right_line = -1; + var txt_width = 0, txt_height = 0; + // Find the top-most line with a non-white pixel + for (r = 0; r < cheight; r++) { + for (c = 0; c < cwidth; c++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + top_line = r; + break; + } + } + if (top_line != -1) break; + } + + //find the last line with a non-white pixel + if (top_line != -1) { + for (r = cheight-1; r >= top_line; r--) { + for(c = 0; c < cwidth; c++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + bottom_line = r; + break; + } + } + if (bottom_line != -1) break; + } + txt_height = bottom_line - top_line + 1; + } + + // Find the left-most line with a non-white pixel + for (c = 0; c < cwidth; c++) { + for (r = 0; r < cheight; r++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + left_line = c; + break; + } + } + if (left_line != -1) break; + } + + //find the right most line with a non-white pixel + if (left_line != -1) { + for (c = cwidth-1; c >= left_line; c--) { + for(r = 0; r < cheight; r++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + right_line = c; + break; + } + } + if (right_line != -1) break; + } + txt_width = right_line - left_line + 1; + } + + //return the bounds + return {bound_top: top_line, bound_bottom: bottom_line, bound_left: left_line, bound_right: right_line, width: txt_width, height: txt_height}; + } + + function RasterizedAlphabet_draw(ctx, letter, dx, dy, dWidth, dHeight) { + var index = this.lookup[letter]; + var raster = this.rasters[index]; + var size = this.dimensions[index]; + ctx.drawImage(raster, 0, size.bound_top -1, raster.width, size.height+1, dx, dy, dWidth, dHeight); + } + + //====================================================================== + // end RasterizedAlphabet + //====================================================================== + + //====================================================================== + // start LogoMetrics object + //====================================================================== + + function LogoMetrics(ctx, canvas_width, canvas_height, logo_columns, logo_rows, allow_space_for_names) { + if (allow_space_for_names === undefined) allow_space_for_names = false; + //variable prototypes + this.canvas_width = canvas_width; + this.canvas_height = canvas_height; + this.scale_x = 1; + this.scale_y = 1; + this.pad_top = 5; + this.pad_left = 10; + this.pad_right = 5; + this.pad_bottom = 0; + this.pad_middle = 20; + this.name_height = 14; + this.name_font = "bold " + this.name_height + "px Times, sans-serif"; + this.name_spacer = 0; + this.y_label = "bits" + this.y_label_height = 12; + this.y_label_font = "bold " + this.y_label_height + "px Helvetica, sans-serif"; + this.y_label_spacer = 3; + this.y_num_height = 12; + this.y_num_width = 0; + this.y_num_font = "bold " + this.y_num_height + "px Helvetica, sans-serif"; + this.y_tic_width = 5; + this.stack_pad_left = 0; + this.stack_font = "bold 25px Helvetica, sans-serif"; + this.stack_height = 90; + this.stack_width = 26; + this.stacks_pad_right = 5; + this.x_num_above = 2; + this.x_num_height = 12; + this.x_num_width = 0; + this.x_num_font = "bold " + this.x_num_height + "px Helvetica, sans-serif"; + this.fine_txt_height = 6; + this.fine_txt_above = 2; + this.fine_txt_font = "normal " + this.fine_txt_height + "px Helvetica, sans-serif"; + this.letter_metrics = new Array(); + this.summed_width = 0; + this.summed_height = 0; + //function prototypes + //none + //calculate the width of the y axis numbers + ctx.font = this.y_num_font; + for (var i = 0; i <= 2; i++) { + this.y_num_width = Math.max(this.y_num_width, ctx.measureText("" + i).width); + } + //calculate the width of the x axis numbers (but they are rotated so it becomes height) + ctx.font = this.x_num_font; + for (var i = 1; i <= logo_columns; i++) { + this.x_num_width = Math.max(this.x_num_width, ctx.measureText("" + i).width); + } + + //calculate how much vertical space we want to draw this + //first we add the padding at the top and bottom since that's always there + this.summed_height += this.pad_top + this.pad_bottom; + //all except the last row have the same amount of space allocated to them + if (logo_rows > 1) { + var row_height = this.stack_height + this.pad_middle; + if (allow_space_for_names) { + row_height += this.name_height; + //the label is allowed to overlap into the spacer + row_height += Math.max(this.y_num_height/2, this.name_spacer); + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } else { + row_height += this.y_num_height/2; + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } + this.summed_height += row_height * (logo_rows - 1); + } + //the last row has the name and fine text below it but no padding + this.summed_height += this.stack_height + this.y_num_height/2; + if (allow_space_for_names) { + this.summed_height += this.fine_txt_height + this.fine_txt_above + this.name_height; + this.summed_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above + this.name_spacer); + } else { + this.summed_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above + this.fine_txt_height + this.fine_txt_above); + } + + //calculate how much horizontal space we want to draw this + //first add the padding at the left and right since that's always there + this.summed_width += this.pad_left + this.pad_right; + //add on the space for the y-axis label + this.summed_width += this.y_label_height + this.y_label_spacer; + //add on the space for the y-axis + this.summed_width += this.y_num_width + this.y_tic_width; + //add on the space for the stacks + this.summed_width += (this.stack_pad_left + this.stack_width) * logo_columns; + //add on the padding after the stacks (an offset from the fine text) + this.summed_width += this.stacks_pad_right; + + //calculate scaling factors + this.scale_y = this.canvas_height / this.summed_height; + this.scale_x = this.canvas_width / this.summed_width; + + //maintain aspect ratio + if (this.scale_y > this.scale_x) { + this.scale_y = this.scale_x; + } else { + this.scale_x = this.scale_y; + } + + + } + + //====================================================================== + // end LogoMetrics object + //====================================================================== + + + //found this trick at http://talideon.com/weblog/2005/02/detecting-broken-images-js.cfm + function image_ok(img) { + // During the onload event, IE correctly identifies any images that + // weren't downloaded as not complete. Others should too. Gecko-based + // browsers act like NS4 in that they report this incorrectly. + if (!img.complete) { + return false; + } + // However, they do have two very useful properties: naturalWidth and + // naturalHeight. These give the true size of the image. If it failed + // to load, either of these should be zero. + if (typeof img.naturalWidth != "undefined" && img.naturalWidth == 0) { + return false; + } + // No other way of checking: assume it's ok. + return true; + } + + function supports_text(ctx) { + if (!ctx.fillText) return false; + if (!ctx.measureText) return false; + return true; + } + + //draws the scale, returns the width + function draw_scale(ctx, metrics, alphabet_ic) { + var tic_height = metrics.stack_height / alphabet_ic; + ctx.save(); + ctx.lineWidth = 1.5; + ctx.translate(metrics.y_label_height, metrics.y_num_height/2); + //draw the axis label + ctx.save(); + ctx.font = metrics.y_label_font; + ctx.translate(0, metrics.stack_height/2); + ctx.save(); + ctx.rotate(-(Math.PI / 2)); + ctx.textAlign = "center"; + ctx.fillText("bits", 0, 0); + ctx.restore(); + ctx.restore(); + + ctx.translate(metrics.y_label_spacer + metrics.y_num_width, 0); + + //draw the axis tics + ctx.save(); + ctx.translate(0, metrics.stack_height); + ctx.font = metrics.y_num_font; + ctx.textAlign = "right"; + ctx.textBaseline = "middle"; + for (var i = 0; i <= alphabet_ic; i++) { + //draw the number + ctx.fillText("" + i, 0, 0); + //draw the tic + ctx.beginPath(); + ctx.moveTo(0, 0); + ctx.lineTo(metrics.y_tic_width, 0); + ctx.stroke(); + //prepare for next tic + ctx.translate(0, -tic_height); + } + ctx.restore(); + + ctx.translate(metrics.y_tic_width, 0); + + ctx.beginPath(); + ctx.moveTo(0, 0); + ctx.lineTo(0, metrics.stack_height); + ctx.stroke(); + + ctx.restore(); + } + + function draw_stack_num(ctx, metrics, row_index) { + ctx.save(); + ctx.font = metrics.x_num_font; + ctx.translate(metrics.stack_width / 2, metrics.stack_height + metrics.x_num_above); + ctx.save(); + ctx.rotate(-(Math.PI / 2)); + ctx.textBaseline = "middle" + ctx.textAlign = "right" + ctx.fillText("" + (row_index + 1), 0, 0); + ctx.restore(); + ctx.restore(); + } + + function draw_stack(ctx, metrics, symbols, raster) { + var preferred_pad = 0; + var sym_min = 5; + + ctx.save();//1 + ctx.translate(0, metrics.stack_height); + for (var i in symbols) { + //exclude inherited properties and undefined properties + if (!symbols.hasOwnProperty(i) || symbols[i] === undefined) continue; + + var sym = symbols[i]; + var sym_height = metrics.stack_height * sym.get_scale(); + + var pad = preferred_pad; + if (sym_height - pad < sym_min) { + pad = Math.min(pad, Math.max(0, sym_height - sym_min)); + } + sym_height -= pad; + + //translate to the correct position + ctx.translate(0, -(pad/2 + sym_height)); + //draw + raster.draw(ctx, sym.get_symbol(), 0, 0, metrics.stack_width, sym_height); + //translate past the padding + ctx.translate(0, -(pad/2)); + } + ctx.restore();//1 + } + + //draws a stack of symbols + function draw_stack_old(ctx, metrics, symbols) { + var lpad = 2; + var sym_min = 5; + var pos = metrics.stack_height; + for (var i in symbols) { + //exclude inherited properties and undefined properties + if (!symbols.hasOwnProperty(i) || symbols[i] === undefined) continue; + + var sym = symbols[i]; + var sym_height = metrics.stack_height*sym.get_scale(); + var letter = metrics.get_letter_metrics(sym.get_symbol()); + //attempting to draw something smaller than a pixel causes display corruption + if (sym_height >= 1) { + //it's better to see the letter than to pad it + var pad = lpad; + if (sym_height - pad < sym_min) { + pad = Math.min(pad, Math.max(0, sym_height - sym_min)); + } + //move to the correct drawing position + ctx.save();//s1 + ctx.translate(0, pos); + //create a clipping rectangle to ensure the letter doesn't overlap when it's distorted + ctx.save();//s2 + //ctx.beginPath(); //disabled clipping because after the improvements in the text metrics it looks better without + //ctx.moveTo(-metrics.stack_width/2,0); + //ctx.lineTo(metrics.stack_width/2, 0); + //ctx.lineTo(metrics.stack_width/2, -sym_height); + //ctx.lineTo(-metrics.stack_width/2, -sym_height); + //ctx.lineTo(-metrics.stack_width/2,0); + //ctx.clip(); + //now draw + ctx.translate(0, -(pad/2)); + ctx.translate(0, -letter.get_descent(sym_height - pad)); + ctx.fillStyle = sym.get_colour(); + ctx.textAlign = "center"; + ctx.save();//s3 + ctx.scale(letter.wscale, letter.get_hscale(sym_height - pad)); + ctx.fillText(sym.get_symbol(), 0, 0); + ctx.restore();//s3 + + ctx.restore();//s2 + ctx.restore();//s1 + } + + pos = pos - sym_height; + } + } + + function draw_logo_on_canvas(logo, canvas, show_names, scale) { + var draw_name = (typeof show_names == "boolean" ? show_names : (logo.get_rows() > 1)); + var cwidth = canvas.width; + var cheight = canvas.height; + //need a minimum 46 x 120 canvas to draw the font size checks on + if (canvas.width < 46) canvas.width = 46; + if (canvas.height < 120) canvas.height = 120; + var ctx = canvas.getContext('2d'); + //assume that the user wants the canvas scaled equally so calculate what the best width for this image should be + var metrics = new LogoMetrics(ctx, canvas.width, canvas.height, logo.get_columns(), logo.get_rows(), draw_name); + ctx.save();//s1 + if (typeof scale == "number") { + //resize the canvas to fit the scaled logo + cwidth = metrics.summed_width * scale; + cheight = metrics.summed_height * scale; + } else { + if (cwidth == 0 || cheight == 0 || scale == 0) { + throw "CANVAS_MUST_HAVE_DIMENSIONS"; + } + scale = Math.min(cwidth / metrics.summed_width, cheight / metrics.summed_height); + } + var raster = new RasterizedAlphabet(logo.alphabet, metrics.stack_font, metrics.stack_width * scale * 2); + if (cwidth != canvas.width || cheight != canvas.height) { + canvas.width = cwidth; + canvas.height = cheight; + //as the canvas has been resized the context is now out of date + ctx = canvas.getContext('2d'); + } + ctx.scale(scale, scale); + ctx.save();//s2 + ctx.save();//s7 + //create margin + ctx.translate(metrics.pad_left, metrics.pad_top); + for (var pspm_i = 0; pspm_i < logo.get_rows(); ++pspm_i) { + var pspm = logo.get_pspm(pspm_i); + var offset = logo.get_offset(pspm_i); + //optionally draw name if this isn't the last row or is the only row + if (draw_name && (logo.get_rows() == 1 || pspm_i != (logo.get_rows()-1))) { + ctx.save();//s4 + ctx.translate(metrics.summed_width/2, metrics.name_height); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s4 + ctx.translate(0, metrics.name_height + Math.min(0, metrics.name_spacer - metrics.y_num_height/2)); + } + //draw scale + draw_scale(ctx, metrics, logo.alphabet.get_ic()); + ctx.save();//s5 + //translate across past the scale + ctx.translate(metrics.y_label_height + metrics.y_label_spacer + + metrics.y_num_width + metrics.y_tic_width, 0); + //draw letters + ctx.translate(0, metrics.y_num_height / 2); + for (var col_index = 0; col_index < logo.get_columns(); col_index++) { + ctx.translate(metrics.stack_pad_left,0); + if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) { + var motif_position = col_index - offset; + draw_stack_num(ctx, metrics, motif_position); + draw_stack(ctx, metrics, pspm.get_stack(motif_position, logo.alphabet), raster); + } + ctx.translate(metrics.stack_width, 0); + } + ctx.restore();//s5 + ////optionally draw name if this is the last row but isn't the only row + if (draw_name && (logo.get_rows() != 1 && pspm_i == (logo.get_rows()-1))) { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width + metrics.name_spacer)); + + ctx.save();//s6 + ctx.translate(metrics.summed_width/2, metrics.name_height); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s6 + ctx.translate(0, metrics.name_height); + } else { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width)); + } + //if not the last row then add middle padding + if (pspm_i != (logo.get_rows() -1)) { + ctx.translate(0, metrics.pad_middle); + } + } + ctx.restore();//s7 + ctx.translate(metrics.summed_width - metrics.pad_right, metrics.summed_height - metrics.pad_bottom); + ctx.font = metrics.fine_txt_font; + ctx.textAlign = "right"; + ctx.fillText(logo.fine_text, 0,0); + ctx.restore();//s2 + ctx.restore();//s1 + } + + function create_canvas(c_width, c_height, c_id, c_title, c_display) { + var canvas = document.createElement("canvas"); + //check for canvas support before attempting anything + if (!canvas.getContext) return null; + var ctx = canvas.getContext('2d'); + //check for html5 text drawing support + if (!supports_text(ctx)) return null; + //size the canvas + canvas.width = c_width; + canvas.height = c_height; + canvas.id = c_id; + canvas.title = c_title; + canvas.style.display = c_display; + return canvas; + } + + function logo_1(alphabet, fine_text, pspm) { + var logo = new Logo(alphabet, fine_text); + logo.add_pspm(pspm); + return logo; + } + + function logo_2(alphabet, fine_text, target, query, query_offset) { + var logo = new Logo(alphabet, fine_text); + if (query_offset < 0) { + logo.add_pspm(target, -query_offset); + logo.add_pspm(query); + } else { + logo.add_pspm(target); + logo.add_pspm(query, query_offset); + } + return logo; + } + + /* + * Specifies an alternate source for an image. + * If the image with the image_id specified has + * not loaded then a generated logo will be used + * to replace it. + * + * Note that the image must either have dimensions + * or a scale must be set. + */ + function alternate_logo(logo, image_id, scale) { + var image = document.getElementById(image_id); + if (!image) { + alert("Can't find specified image id (" + image_id + ")"); + return; + } + //if the image has loaded then there is no reason to use the canvas + if (image_ok(image)) return; + //the image has failed to load so replace it with a canvas if we can. + var canvas = create_canvas(image.width, image.height, image_id, image.title, image.style.display); + if (canvas == null) return; + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, undefined, scale); + //replace the image with the canvas + image.parentNode.replaceChild(canvas, image); + } + + /* + * Specifes that the element with the specified id + * should be replaced with a generated logo. + */ + function replace_logo(logo, replace_id, scale, title_txt, display_style) { + var element = document.getElementById(replace_id); + if (!replace_id) { + alert("Can't find specified id (" + replace_id + ")"); + return; + } + //found the element! + var canvas = create_canvas(50, 120, replace_id, title_txt, display_style); + if (canvas == null) return; + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, undefined, scale); + //replace the element with the canvas + element.parentNode.replaceChild(canvas, element); + } + + //example code for creating a logo + //function do_load() { + // var alphabet = new Alphabet(document.getElementById("alphabet").value, document.getElementById("bgfreq").value); + // var pspm = new Pspm(document.getElementById("pspm1").value); + // var pspm_rc = pspm.copy().reverse_complement(alphabet); + // draw_logo(pspm, alphabet, "Motif 1", "logo1"); + // draw_logo(pspm_rc, alphabet, "Motif 1 Reverse Complement", "logo_rc1"); + //} + + + function setup() { + var motif_count = 1; + //create canvas logos + var alphabet = new Alphabet(document.getElementById("alphabet").value, document.getElementById("bgfreq").value); + for (var i = 1; i <= motif_count; i++) { + var pspm = new Pspm(document.getElementById("pspm" + i).value); + var logo = logo_1(alphabet, "MEME", pspm); + alternate_logo(logo, "thumbnail_logo_" + i, 0.5); + alternate_logo(logo, "logo_img_" + i, 1); + + } + + //ensure radio buttons have data generated for them by fireing events + var allInputs = document.getElementsByTagName("input"); + for (var i = 0; i < allInputs.length; i++) { + var input = allInputs[i]; + if (input.type == "radio" && input.checked) { + var evt = document.createEvent("MouseEvents"); + evt.initMouseEvent("click", true, true, window, 0, 0, 0, 0, 0, false, false, false, false, 0, null); + input.dispatchEvent(evt); + } + } + + for (var i = 1; i <= motif_count; i++) { + tbl = document.getElementById("tbl_sites_" + i); + wireUpTable(tbl, false); + tbl = document.getElementById("tbl_blocks_" + i); + wireUpTable(tbl, true); + } + } + function showDesc(source, targetid) { + document.getElementById(targetid).childNodes[0].nodeValue = source.title; + } + function hideDesc(targetid) { + document.getElementById(targetid).childNodes[0].nodeValue = "Mouse-over buttons for more information."; + } + function showEmbededFormat(motifnum, format) { + var source = document.getElementById(format + motifnum); + var txtarea = document.getElementById("format_display_area_" + motifnum); + txtarea.value = source.value; + txtarea.style.display = 'block'; + } + function hideFormat(motifnum) { + var txtarea = document.getElementById("format_display_area_" + motifnum); + txtarea.style.display = 'none'; + } + function block2raw(block) { + var raw = ""; + var endpat = /\/\//; + var wordpat = /\S+/gi; + var lines = block.split("\n"); + for (i = 2; i < lines.length; ++i) { + if (lines[i].match(endpat) != null) break; + var words = lines[i].match(wordpat); + raw += words[3] + "\n"; + } + return raw; + } + function block2fasta(block) { + var fasta = ""; + var endpat = /\/\//; + var wordpat = /\S+/gi; + var lines = block.split("\n"); + for (i = 2; i < lines.length; ++i) { + if (lines[i].match(endpat) != null) break; + var words = lines[i].match(wordpat); + var start = words[2].substring(0, words[2].length - 1); + fasta += ">" + words[0] + " ( start= " + start + " )\n" + words[3] + "\n"; + } + return fasta; + } + function showRaw(motifnum) { + var source = document.getElementById('blocks' + motifnum); + var txtarea = document.getElementById("format_display_area_" + motifnum); + txtarea.value = block2raw(source.value); + txtarea.style.display = 'block'; + } + function showFasta(motifnum) { + var source = document.getElementById('blocks' + motifnum); + var txtarea = document.getElementById("format_display_area_" + motifnum); + txtarea.value = block2fasta(source.value); + txtarea.style.display = 'block'; + } + function showHidden(prefix) { + document.getElementById(prefix + '_activator').style.display = 'none'; + document.getElementById(prefix + '_deactivator').style.display = 'block'; + document.getElementById(prefix + '_data').style.display = 'block'; + } + function hideShown(prefix) { + document.getElementById(prefix + '_activator').style.display = 'block'; + document.getElementById(prefix + '_deactivator').style.display = 'none'; + document.getElementById(prefix + '_data').style.display = 'none'; + } + function wireUpTable(table, skiplast) { + if (table && table.rows) { + var nRows = table.rows.length; + if (skiplast) {nRows--;} + for (var i = 1; i < nRows; i++) { + var row = table.rows[i]; + row.style.cursor = 'pointer'; + row.onclick = function() + { + processHighlight(this); + } + } + } else { + alert(table); + } + } + function processHighlight(sourceRow) { + var name = sourceRow.cells[0].firstChild.nodeValue; + + for (var i = 1; i <= 1; i++) { + tbl = document.getElementById("tbl_sites_" + i); + highlightTable(name, tbl); + tbl = document.getElementById("tbl_blocks_" + i); + highlightTable(name, tbl); + } + } + function highlightTable(name, table) { + if (table == null) return; + nRows = table.rows.length; + for (var i = 0; i < nRows; i++) { + var row = table.rows[i]; + if(row.cells[0].firstChild.nodeValue == name) { + row.style.backgroundColor = "#aaffaa"; + } else { + row.style.backgroundColor = "white"; + } + } + } + function warnExternal() { + if (confirm("Using BLOCKS requires the data to be sent to an external webservice even if you have setup your own meme installation. Continue?")) { + return true; + } + return false; + } + function clickLogoTab(is_rc, num) { + var stdTab = document.getElementById("logo_tab_std_" + num); + var rcTab = document.getElementById("logo_tab_rc_" + num); + var logoImg = document.getElementById("logo_img_" + num); + var logoRcImg = document.getElementById("logo_rc_img_" + num); + if (is_rc) { + logoImg.style.display = 'none'; + logoRcImg.style.display = 'block'; + rcTab.setAttribute("class", "tab activeTab"); + stdTab.setAttribute("class", "tab"); + } else { + logoRcImg.style.display = 'none'; + logoImg.style.display = 'block'; + rcTab.setAttribute("class", "tab"); + stdTab.setAttribute("class", "tab activeTab"); + } + } + </script> +</head> +<body onload="javascript:setup()"><form enctype="application/x-www-form-urlencoded" method="post" target="_new" action="http://dan/meme_request.cgi"> + +<input type="hidden" name="version" value="MEME version 4.5.0"> +<input type="hidden" name="alphabet" id="alphabet" value="ACDEFGHIKLMNPQRSTVWY"> +<input type="hidden" name="strands" value="none"> +<input type="hidden" name="bgfreq" id="bgfreq" value="A 0.291 C 0.229 D 0.001 E 0.001 F 0.001 G 0.255 H 0.001 I 0.001 K 0.001 +L 0.001 M 0.001 N 0.001 P 0.001 Q 0.001 R 0.001 S 0.001 T 0.215 V 0.001 +W 0.001 Y 0.001"> +<input type="hidden" name="name" value="dan.dat"> +<input type="hidden" name="combinedblock" value=" +chr21_19617074_19617124_+ 1.22e-03 1 50 1 39 3.06e-05 +chr21_26934381_26934431_+ 2.21e-03 1 50 1 27 5.52e-05 +chr21_28217753_28217803_- 7.29e-01 0 50 +chr21_31710037_31710087_- 2.37e-03 1 50 1 14 5.94e-05 +chr21_31744582_31744632_- 1.22e-03 1 50 1 12 3.06e-05 +chr21_31768316_31768366_+ 1.53e-03 1 50 1 0 3.82e-05 +chr21_31914206_31914256_- 6.70e-04 1 50 1 15 1.68e-05 +chr21_31933633_31933683_- 1.81e-03 1 50 1 4 4.54e-05 +chr21_31962741_31962791_- 1.61e-02 0 50 +chr21_31964683_31964733_+ 1.36e-04 1 50 1 13 3.41e-06 +chr21_31973364_31973414_+ 1.99e-01 0 50 +chr21_31992870_31992920_+ 3.47e-04 1 50 1 16 8.67e-06 +chr21_32185595_32185645_- 3.47e-04 1 50 1 18 8.67e-06 +chr21_32202076_32202126_- 2.01e-04 1 50 1 13 5.01e-06 +chr21_32253899_32253949_- 8.11e-04 1 50 1 19 2.03e-05 +chr21_32410820_32410870_- 3.47e-04 1 50 1 21 8.67e-06 +chr21_36411748_36411798_- 2.71e-03 1 50 1 22 6.78e-05 +chr21_37838750_37838800_- 8.23e-02 0 50 +chr21_45705687_45705737_+ 1.53e-03 1 50 1 37 3.82e-05 +chr21_45971413_45971463_- 1.36e-04 1 50 1 9 3.41e-06 +chr21_45978668_45978718_- 6.37e-04 1 50 1 4 1.59e-05 +chr21_45993530_45993580_+ 1.60e-04 1 50 1 7 4.00e-06 +chr21_46020421_46020471_+ 4.83e-04 1 50 1 2 1.21e-05 +chr21_46031920_46031970_+ 2.43e-04 1 50 1 15 6.06e-06 +chr21_46046964_46047014_+ 4.26e-05 1 50 1 12 1.06e-06 +chr21_46057197_46057247_+ 1.36e-04 1 50 1 36 3.41e-06 +chr21_46086869_46086919_- 4.30e-02 0 50 +chr21_46102103_46102153_- 4.30e-02 0 50 +chr21_47517957_47518007_+ 6.37e-04 1 50 1 32 1.59e-05 +chr21_47575506_47575556_- 1.61e-03 1 50 1 30 4.02e-05 +"> +<input type="hidden" name="nmotifs" value="1"> + +<input type="hidden" id="motifblock1" name="motifblock1" value=" +BL MOTIF 1 width=11 seqs=25 +"> +<input type="hidden" id="pssm1" name="pssm1" value=" +log-odds matrix: alength= 20 w= 11 n= 25 bayes= 5.33554 E= 2.4e-011 +-32 -680 91 77 7 138 -20 55 64 107 11 150 142 72 87 396 -148 221 -140 -36 +-11 -680 89 76 7 137 -21 55 63 107 10 149 141 71 87 396 -239 220 -140 -36 +-79 41 4 21 -7 44 -62 42 -5 99 0 99 138 52 42 399 -46 223 -173 -68 +11 -677 48 47 -2 127 -43 46 27 101 3 124 138 60 62 397 -235 220 -160 -55 +-596 -820 12 -21 -53 -267 -74 37 16 44 -37 98 31 9 19 319 212 127 -193 -95 +165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8 +-838 -990 -89 -149 -151 -841 -161 -117 -113 -66 -209 -68 -69 -129 -91 111 221 -55 -255 -173 +176 -858 -79 -103 -115 -717 -148 -95 -108 -17 -162 -61 -12 -95 -69 193 -737 52 -240 -153 +134 -686 0 16 -12 -553 -68 44 -8 96 -9 88 124 41 36 384 11 216 -177 -71 +165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8 +147 -614 89 129 93 -121 12 160 113 217 108 144 144 111 125 447 -241 332 -81 22 + +"> +<input type="hidden" id="pspm1" name="pspm1" value=" +letter-probability matrix: alength= 20 w= 11 nsites= 25 E= 2.4e-011 +0.240000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.080000 0.000000 0.000000 0.000000 +0.280000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 +0.160000 0.320000 0.000000 0.000000 0.000000 0.360000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.000000 0.000000 0.000000 +0.320000 0.000000 0.000000 0.000000 0.000000 0.640000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 +0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 +0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 +0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 +1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 +0.760000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.240000 0.000000 0.000000 0.000000 +0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 +0.840000 0.000000 0.000000 0.000000 0.000000 0.120000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 + +"> +<input type="hidden" id="blocks1" name="BLOCKS1" value=" +BL MOTIF 1 width=11 seqs=25 +chr21_46046964_46047014_+ ( 12) GGGGTATAAAA 1 +chr21_46057197_46057247_+ ( 36) GGCATATAAAA 1 +chr21_45971413_45971463_- ( 9) GGCATATAAAA 1 +chr21_31964683_31964733_+ ( 13) GGCATATAAAA 1 +chr21_45993530_45993580_+ ( 7) GGAGTATAAAA 1 +chr21_32202076_32202126_- ( 13) GAGGTATAAAA 1 +chr21_46031920_46031970_+ ( 15) AGGGTATAAAA 1 +chr21_32410820_32410870_- ( 21) GATGTATAAAA 1 +chr21_32185595_32185645_- ( 18) GGGATATATAA 1 +chr21_31992870_31992920_+ ( 16) GATGTATAAAA 1 +chr21_46020421_46020471_+ ( 2) GACATATAAAA 1 +chr21_47517957_47518007_+ ( 32) GGGGTATAAAG 1 +chr21_45978668_45978718_- ( 4) GGGGTATAAAG 1 +chr21_31914206_31914256_- ( 15) AGAGTATAAAA 1 +chr21_32253899_32253949_- ( 19) GATATATAAAA 1 +chr21_31744582_31744632_- ( 12) AGCATATATAA 1 +chr21_19617074_19617124_+ ( 39) TGGGTATATAA 1 +chr21_45705687_45705737_+ ( 37) GGGGTATAACA 1 +chr21_31768316_31768366_+ ( 0) AACGTATATAA 1 +chr21_47575506_47575556_- ( 30) AGCGTATAAAG 1 +chr21_26934381_26934431_+ ( 27) GAGTTATAAAA 1 +chr21_31710037_31710087_- ( 14) TGAGTATATAA 1 +chr21_36411748_36411798_- ( 22) GGCATCTAAAA 1 +chr21_31933633_31933683_- ( 2) AGAGTATATAT 1 +chr21_31962741_31962791_- ( 13) GTTGGATAAAA 1 +// + +"> + +<a name="top_buttons"></a><div class="pad1"> +<h1><img src="http://meme.nbcr.net/meme/images/meme.png" alt="MEME"></h1> +<p class="spaced"> + For further information on how to interpret these results or to get a + copy of the MEME software please access + <a href="http://meme.nbcr.net/">http://meme.nbcr.net</a>. + </p> +</div> +<div class="pad2"> +<a class="jump" href="#overview">Discovered Motifs</a> + | + <a class="jump" href="#combined">Block diagrams of Motifs</a> + | + <a class="jump" href="#version">Program information</a> + | + <a class="jump" href="#explanation">Explanation</a> +</div> +<a name="overview"></a><h2 class="mainh pad2">Discovered Motifs</h2> +<div class="box"> +<h4>Motif Overview</h4> +<div class="pad"><table> +<col style="text-align: center"> +<col style="text-align: right"> +<col style="text-align: right"> +<col> +<tbody><tr> +<td><a href="#motif_1">Motif 1</a></td> +<td style="padding-left:20px"><ul> +<li>2.4e-011</li> +<li>25 sites</li> +</ul></td> +<td style="padding-left:20px"></td> +<td style="padding-left:20px;"><a href="#motif_1"><img style="display:block; height:75px" src="logo1.png" id="thumbnail_logo_1" alt="Motif 1 Logo"></a></td> +</tr></tbody> +</table></div> +<h4>Further Analysis</h4> +<div class="pad"> + Submit all motifs to + <input name="do_MAST_all" value="MAST" type="submit" title="Search sequence databases for the best combined matches with these motifs using MAST." onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')"> + <a href="#MAST_doc" title="Click for more information on MAST." class="help"><div class="help"></div></a> + + <input name="do_FIMO_all" value="FIMO" type="submit" title="Search sequence databases for all matches with these motifs using FIMO." onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')"> + <a href="#FIMO_doc" title="Click for more information on FIMO." class="help"><div class="help"></div></a> + + <input name="do_BLOCKS_all" value="BLOCKS" type="submit" title="Submit these motifs to BLOCKS multiple alignment processor." onclick="return warnExternal()" onmouseover="javascript:showDesc(this, 'overview_action_desc')" onmouseout="javascript:hideDesc('overview_action_desc')"> + <a href="#BLOCKS_doc" title="Click for more information on BLOCKS." class="help"><div class="help"></div></a> + <span id="overview_action_desc">Mouse-over buttons for more information.</span> +</div> +</div> +<a name="motif_1"></a><table width="100%" border="0" cellspacing="1" cellpadding="4" bgcolor="#FFFFFF"><tr> +<td><h2 class="mainh">Motif 1</h2></td> +<td align="right" valign="bottom"><a href="#top_buttons">Top</a></td> +</tr></table> +<div class="box"> +<table style="width:100%; background-color:#ddddff"> +<tr> +<th class="majorth"><h4>Summary <a href="#summary_doc"><div class="help"></div></a> +</h4></th> +<th class="majorth"><h4>Sequence Logo <a href="#logo_doc"><div class="help"></div></a> +</h4></th> +</tr> +<tr> +<td style="width:15em; vertical-align:text-top;"> +<table style="width:100%; " cellspacing="0"> +<col> +<col style="text-align:left;"> +<tr> +<th class="minorth">E-value</th> +<td>2.4e-011</td> +</tr> +<tr> +<th class="minorth">Width</th> +<td>11</td> +</tr> +<tr> +<th class="minorth">Sites</th> +<td>25</td> +</tr> +</table> +<a href="javascript:showHidden('summary_extra_1')" id="summary_extra_1_activator">show more</a><div id="summary_extra_1_data" style="display:none"><table style="width:100%;" cellspacing="0"> +<tr><th colspan="2" class="minorth">Log Likelihood Ratio <a href="#llr_doc"><div class="help"></div></a> +</th></tr> +<tr> +<td style="width:8em;"> </td> +<td>239</td> +</tr> +<tr><th colspan="2" class="minorth">Information Content <a href="#ic_doc"><div class="help"></div></a> +</th></tr> +<tr> +<td> </td> +<td>40.0 (bits)</td> +</tr> +<tr><th colspan="2" class="minorth">Relative Entropy <a href="#re_doc"><div class="help"></div></a> +</th></tr> +<tr> +<td> </td> +<td>13.8 (bits)</td> +</tr> +</table></div> +<a href="javascript:hideShown('summary_extra_1')" id="summary_extra_1_deactivator" style="display:none;">show less</a> +</td> +<td> +<div class="tabMain"><img src="logo1.png" style="display:block;" id="logo_img_1" height="140" width="260" alt="PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide"></div> +<div class="tabArea"><a id="logo_tab_std_1" href="javascript:clickLogoTab(false,1)" class="tab activeTab">Standard</a></div> +<br> + Download LOGO <a href="#download_doc" class="help"><div class="help"></div></a> + + Orientation: + <select name="logorc_1"><option value="false">standard</option> +<option value="true" disabled>reverse complement</option></select> + + SSC: + <select name="logossc_1"><option value="false">off</option> +<option value="true">on</option></select> + + Format: + <select name="logoformat_1"><option value="png">web (png)</option> +<option value="eps">publication (eps)</option></select> + + Width: + <input type="text" size="2" maxlength="5" value="11" title="Width of logo in cm." name="logowidth_1"> cm + + Height: + <input type="text" size="2" maxlength="5" value="7.5" title="Height of logo in cm." name="logoheight_1"> cm + + <input type="submit" value="Download" title="Download a logo" name="do_LOGO_1"> +</td> +</tr> +</table> +<h4>Regular expression <a href="#regular_expression_doc" class="help"><div class="help"></div></a> +</h4> +<p class="pad"> +[GA][GA][GC][GA]TATA[AT]AA +</p> +<h4>Further Analysis <a href="#further_analysis_doc" class="help"><div class="help"></div></a> +</h4> +<div class="pad"> + Submit this motif to + <input type="submit" name="do_MAST_1" value="MAST" title="Scan sequence databases for the best match in each sequence using MAST." onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')"> + <a href="#MAST_doc" title="Click for more information on MAST." class="help"><div class="help"></div></a> + + <input type="submit" name="do_FIMO_1" value="FIMO" title="Scan sequence databases for all matches with this motif using FIMO." onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')"> + <a href="#FIMO_doc" title="Click for more information on FIMO." class="help"><div class="help"></div></a> + + <input type="submit" name="do_BLOCKS_1" value="BLOCKS" title="Submit this motif to BLOCKS multiple alignment processor." onclick="return warnExternal()" onmouseover="javascript:showDesc(this, 'motif1_action_desc')" onmouseout="javascript:hideDesc('motif1_action_desc')"> + <a href="#BLOCKS_doc" title="Click for more information on BLOCKS." class="help"><div class="help"></div></a> + <span id="motif1_action_desc">Mouse-over buttons for more information.</span> +</div> +<h4>Data Formats <a href="#formats_doc" class="help"><div class="help"></div></a> +</h4> +<div class="pad"> + View the motif in + <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'pspm')">PSPM Format + <a href="#format_PSPM_doc" title="Click for more information on PSPMs." class="help"><div class="help"></div></a> + + <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'pssm')">PSSM Format + <a href="#format_PSSM_doc" title="Click for more information on PSSMs." class="help"><div class="help"></div></a> + + <input name="format_display_1" type="radio" onclick="javascript:showEmbededFormat(1, 'blocks')">BLOCKS Format + <a href="#format_BLOCKS_doc" title="Click for more information on BLOCKS format." class="help"><div class="help"></div></a> + + <input name="format_display_1" type="radio" onclick="javascript:showFasta(1)">FASTA Format + <a href="#format_FASTA_doc" title="Click for more information on FASTA format." class="help"><div class="help"></div></a> + + <input name="format_display_1" type="radio" onclick="javascript:showRaw(1)">Raw Format + <a href="#format_raw_doc" title="Click for more information on raw format." class="help"><div class="help"></div></a> + + or + <input name="format_display_1" type="radio" onclick="javascript:hideFormat(1)" checked>Hide<br><textarea id="format_display_area_1" rows="20" style="display:none; width:100%;" readonly></textarea><noscript>This feature requires javascript.</noscript> +</div> +<h4>Sites <a href="#sites_doc" class="help"><div class="help"></div></a> +</h4> +<div class="pad"> +<p>Click on any row to highlight sequence in all motifs.</p> +<table id="tbl_sites_1" cellpadding="0.5cm"> +<col style=""> +<col style=""> +<col style=""> +<col style=""> +<col style=""> +<col style=""> +<thead><tr> +<th>Name <a name="sites1"></a> +</th> +<th>Start</th> +<th> +<i>p</i>-value</th> +<th colspan="3">Sites <a href="#sites_doc" class="help"><div class="help"></div></a> +</th> +</tr></thead> +<tbody> +<tr> +<td class="strand_name">chr21_46046964_46047014_+</td> +<td class="strand_start">12</td> +<td class="strand_pvalue">1.06e-06</td> +<td class="strand_lflank">AAGGCCAGGA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCCTGAGAGC</td> +</tr> +<tr> +<td class="strand_name">chr21_46057197_46057247_+</td> +<td class="strand_start">36</td> +<td class="strand_pvalue">3.41e-06</td> +<td class="strand_lflank">ACAGGCCCTG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCC</td> +</tr> +<tr> +<td class="strand_name">chr21_45971413_45971463_-</td> +<td class="strand_start">9</td> +<td class="strand_pvalue">3.41e-06</td> +<td class="strand_lflank">CAGGCCCTG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCCCCAGCAG</td> +</tr> +<tr> +<td class="strand_name">chr21_31964683_31964733_+</td> +<td class="strand_start">13</td> +<td class="strand_pvalue">3.41e-06</td> +<td class="strand_lflank">GATTCACTGA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GGCCCTCTGC</td> +</tr> +<tr> +<td class="strand_name">chr21_45993530_45993580_+</td> +<td class="strand_start">7</td> +<td class="strand_pvalue">4.00e-06</td> +<td class="strand_lflank">CCAAGGA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCCCCACAAA</td> +</tr> +<tr> +<td class="strand_name">chr21_32202076_32202126_-</td> +<td class="strand_start">13</td> +<td class="strand_pvalue">5.01e-06</td> +<td class="strand_lflank">CCACCAGCTT</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">AGCCCTGTAC</td> +</tr> +<tr> +<td class="strand_name">chr21_46031920_46031970_+</td> +<td class="strand_start">15</td> +<td class="strand_pvalue">6.06e-06</td> +<td class="strand_lflank">ATACCCAGGG</td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">CCTCAGCAGC</td> +</tr> +<tr> +<td class="strand_name">chr21_32410820_32410870_-</td> +<td class="strand_start">21</td> +<td class="strand_pvalue">8.67e-06</td> +<td class="strand_lflank">AATCACTGAG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GTCCCAGGGA</td> +</tr> +<tr> +<td class="strand_name">chr21_32185595_32185645_-</td> +<td class="strand_start">18</td> +<td class="strand_pvalue">8.67e-06</td> +<td class="strand_lflank">CACCAGAGCT</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">AGAAGGTTCT</td> +</tr> +<tr> +<td class="strand_name">chr21_31992870_31992920_+</td> +<td class="strand_start">16</td> +<td class="strand_pvalue">8.67e-06</td> +<td class="strand_lflank">CACTATTGAA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">TTTCATTTGC</td> +</tr> +<tr> +<td class="strand_name">chr21_46020421_46020471_+</td> +<td class="strand_start">2</td> +<td class="strand_pvalue">1.21e-05</td> +<td class="strand_lflank">GA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCCAACATCC</td> +</tr> +<tr> +<td class="strand_name">chr21_47517957_47518007_+</td> +<td class="strand_start">32</td> +<td class="strand_pvalue">1.59e-05</td> +<td class="strand_lflank">CCGGCGGGGC</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span> +</td> +<td class="strand_rflank">GGGGCGG</td> +</tr> +<tr> +<td class="strand_name">chr21_45978668_45978718_-</td> +<td class="strand_start">4</td> +<td class="strand_pvalue">1.59e-05</td> +<td class="strand_lflank">CAGA</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span> +</td> +<td class="strand_rflank">GTTCCGACCA</td> +</tr> +<tr> +<td class="strand_name">chr21_31914206_31914256_-</td> +<td class="strand_start">15</td> +<td class="strand_pvalue">1.68e-05</td> +<td class="strand_lflank">CCCACTACTT</td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">TCATTCTGAG</td> +</tr> +<tr> +<td class="strand_name">chr21_32253899_32253949_-</td> +<td class="strand_start">19</td> +<td class="strand_pvalue">2.03e-05</td> +<td class="strand_lflank">CACCAGCAAG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GCTCAGGAGT</td> +</tr> +<tr> +<td class="strand_name">chr21_31744582_31744632_-</td> +<td class="strand_start">12</td> +<td class="strand_pvalue">3.06e-05</td> +<td class="strand_lflank">CAGGTCTAAG</td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">CTTGGAGTCC</td> +</tr> +<tr> +<td class="strand_name">chr21_19617074_19617124_+</td> +<td class="strand_start">39</td> +<td class="strand_pvalue">3.06e-05</td> +<td class="strand_lflank">CCTCGGGACG</td> +<td class="strand_seq"> +<span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank"></td> +</tr> +<tr> +<td class="strand_name">chr21_45705687_45705737_+</td> +<td class="strand_start">37</td> +<td class="strand_pvalue">3.82e-05</td> +<td class="strand_lflank">CGTGGTCGCG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GC</td> +</tr> +<tr> +<td class="strand_name">chr21_31768316_31768366_+</td> +<td class="strand_start">0</td> +<td class="strand_pvalue">3.82e-05</td> +<td class="strand_lflank"></td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">C</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">ATGGTCCTGT</td> +</tr> +<tr> +<td class="strand_name">chr21_47575506_47575556_-</td> +<td class="strand_start">30</td> +<td class="strand_pvalue">4.02e-05</td> +<td class="strand_lflank">GCTGCCGGTG</td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:orange;">G</span> +</td> +<td class="strand_rflank">GCCCTGGCG</td> +</tr> +<tr> +<td class="strand_name">chr21_26934381_26934431_+</td> +<td class="strand_start">27</td> +<td class="strand_pvalue">5.52e-05</td> +<td class="strand_lflank">AGTCACAAGT</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">GGGTCGCACG</td> +</tr> +<tr> +<td class="strand_name">chr21_31710037_31710087_-</td> +<td class="strand_start">14</td> +<td class="strand_pvalue">5.94e-05</td> +<td class="strand_lflank">CCCAGGTTTC</td> +<td class="strand_seq"> +<span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">TCGCCGCACC</td> +</tr> +<tr> +<td class="strand_name">chr21_36411748_36411798_-</td> +<td class="strand_start">22</td> +<td class="strand_pvalue">6.78e-05</td> +<td class="strand_lflank">AGTTTCAGTT</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">C</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">C</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">ATTATATAAC</td> +</tr> +<tr> +<td class="strand_name">chr21_31933633_31933683_-</td> +<td class="strand_start">2</td> +<td class="strand_pvalue">2.08e-04</td> +<td class="strand_lflank">TC</td> +<td class="strand_seq"> +<span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:green;">T</span> +</td> +<td class="strand_rflank">AAATGTTCCT</td> +</tr> +<tr> +<td class="strand_name">chr21_31962741_31962791_-</td> +<td class="strand_start">13</td> +<td class="strand_pvalue">4.05e-04</td> +<td class="strand_lflank">TATAACTCAG</td> +<td class="strand_seq"> +<span style="color:orange;">G</span><span style="color:green;">T</span><span style="color:green;">T</span><span style="color:orange;">G</span><span style="color:orange;">G</span><span style="color:blue;">A</span><span style="color:green;">T</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span><span style="color:blue;">A</span> +</td> +<td class="strand_rflank">TAATTTGTAC</td> +</tr> +</tbody> +</table> +</div> +<h4>Block Diagrams <a href="#diagrams_doc" class="help"><div class="help"></div></a> +</h4> +<div class="pad"> +<p> + The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.<br> + Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information. + </p> +<table id="tbl_blocks_1" style="width:100%;" border="0"> +<col style="width:10em;"> +<col style="width:5em;"> +<col> +<thead><tr> +<th>Name</th> +<th>Lowest <i>p</i>-value</th> +<th>Motif Location</th> +</tr></thead> +<tbody> +<tr> +<td>chr21_19617074_19617124_+</td> +<td>3.06e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:78%; top:5.6px; width:22%; height:5.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.06e-05 starts: 40 ends: 50 "></div> +</div></td> +</tr> +<tr> +<td>chr21_26934381_26934431_+</td> +<td>5.52e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:54%; top:5.9px; width:22%; height:5.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.52e-05 starts: 28 ends: 38 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31710037_31710087_-</td> +<td>5.94e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:28%; top:5.9px; width:22%; height:5.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.94e-05 starts: 15 ends: 25 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31744582_31744632_-</td> +<td>3.06e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:24%; top:5.6px; width:22%; height:5.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.06e-05 starts: 13 ends: 23 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31768316_31768366_+</td> +<td>3.82e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:0%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.82e-05 starts: 1 ends: 11 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31914206_31914256_-</td> +<td>1.68e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:30%; top:5.3px; width:22%; height:5.7px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.68e-05 starts: 16 ends: 26 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31933633_31933683_-</td> +<td>2.08e-04</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:4%; top:6.6px; width:22%; height:4.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 2.08e-04 starts: 3 ends: 13 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31962741_31962791_-</td> +<td>4.05e-04</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:26%; top:6.9px; width:22%; height:4.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.05e-04 starts: 14 ends: 24 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31964683_31964733_+</td> +<td>3.41e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:26%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 14 ends: 24 "></div> +</div></td> +</tr> +<tr> +<td>chr21_31992870_31992920_+</td> +<td>8.67e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:32%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 17 ends: 27 "></div> +</div></td> +</tr> +<tr> +<td>chr21_32185595_32185645_-</td> +<td>8.67e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:36%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 19 ends: 29 "></div> +</div></td> +</tr> +<tr> +<td>chr21_32202076_32202126_-</td> +<td>5.01e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:26%; top:4.6px; width:22%; height:6.4px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 5.01e-06 starts: 14 ends: 24 "></div> +</div></td> +</tr> +<tr> +<td>chr21_32253899_32253949_-</td> +<td>2.03e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:38%; top:5.4px; width:22%; height:5.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 2.03e-05 starts: 20 ends: 30 "></div> +</div></td> +</tr> +<tr> +<td>chr21_32410820_32410870_-</td> +<td>8.67e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:42%; top:4.9px; width:22%; height:6.1px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 8.67e-06 starts: 22 ends: 32 "></div> +</div></td> +</tr> +<tr> +<td>chr21_36411748_36411798_-</td> +<td>6.78e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:44%; top:6px; width:22%; height:5px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 6.78e-05 starts: 23 ends: 33 "></div> +</div></td> +</tr> +<tr> +<td>chr21_45705687_45705737_+</td> +<td>3.82e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:74%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.82e-05 starts: 38 ends: 48 "></div> +</div></td> +</tr> +<tr> +<td>chr21_45971413_45971463_-</td> +<td>3.41e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:18%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 10 ends: 20 "></div> +</div></td> +</tr> +<tr> +<td>chr21_45978668_45978718_-</td> +<td>1.59e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:8%; top:5.2px; width:22%; height:5.8px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.59e-05 starts: 5 ends: 15 "></div> +</div></td> +</tr> +<tr> +<td>chr21_45993530_45993580_+</td> +<td>4.00e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:14%; top:4.5px; width:22%; height:6.5px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.00e-06 starts: 8 ends: 18 "></div> +</div></td> +</tr> +<tr> +<td>chr21_46020421_46020471_+</td> +<td>1.21e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:4%; top:5.1px; width:22%; height:5.9px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.21e-05 starts: 3 ends: 13 "></div> +</div></td> +</tr> +<tr> +<td>chr21_46031920_46031970_+</td> +<td>6.06e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:30%; top:4.7px; width:22%; height:6.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 6.06e-06 starts: 16 ends: 26 "></div> +</div></td> +</tr> +<tr> +<td>chr21_46046964_46047014_+</td> +<td>1.06e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:24%; top:3.8px; width:22%; height:7.2px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.06e-06 starts: 13 ends: 23 "></div> +</div></td> +</tr> +<tr> +<td>chr21_46057197_46057247_+</td> +<td>3.41e-06</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:72%; top:4.4px; width:22%; height:6.6px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 3.41e-06 starts: 37 ends: 47 "></div> +</div></td> +</tr> +<tr> +<td>chr21_47517957_47518007_+</td> +<td>1.59e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:64%; top:5.2px; width:22%; height:5.8px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 1.59e-05 starts: 33 ends: 43 "></div> +</div></td> +</tr> +<tr> +<td>chr21_47575506_47575556_-</td> +<td>4.02e-05</td> +<td class="block_td"><div class="block_container"> +<div class="block_rule" style="width:100%"></div> +<div class="block_motif" style="left:60%; top:5.7px; width:22%; height:5.3px; background-color:aqua; border: 1px solid black;" title="Motif 1 p-value: 4.02e-05 starts: 31 ends: 41 "></div> +</div></td> +</tr> +<tr> +<td colspan="2"> </td> +<td class="block_td" style="color: blue;"><div class="block_container"> +<div class="tic_major" style="left:0%"><div class="tic_label" style="left:-0.5em; width:1em;">0</div></div> +<div class="tic_minor" style="left:4%;"></div> +<div class="tic_minor" style="left:8%;"></div> +<div class="tic_minor" style="left:12%;"></div> +<div class="tic_minor" style="left:16%;"></div> +<div class="tic_major" style="left:20%"><div class="tic_label" style="left:-1em; width:2em;">10</div></div> +<div class="tic_minor" style="left:24%;"></div> +<div class="tic_minor" style="left:28%;"></div> +<div class="tic_minor" style="left:32%;"></div> +<div class="tic_minor" style="left:36%;"></div> +<div class="tic_major" style="left:40%"><div class="tic_label" style="left:-1em; width:2em;">20</div></div> +<div class="tic_minor" style="left:44%;"></div> +<div class="tic_minor" style="left:48%;"></div> +<div class="tic_minor" style="left:52%;"></div> +<div class="tic_minor" style="left:56%;"></div> +<div class="tic_major" style="left:60%"><div class="tic_label" style="left:-1em; width:2em;">30</div></div> +<div class="tic_minor" style="left:64%;"></div> +<div class="tic_minor" style="left:68%;"></div> +<div class="tic_minor" style="left:72%;"></div> +<div class="tic_minor" style="left:76%;"></div> +<div class="tic_major" style="left:80%"><div class="tic_label" style="left:-1em; width:2em;">40</div></div> +<div class="tic_minor" style="left:84%;"></div> +<div class="tic_minor" style="left:88%;"></div> +<div class="tic_minor" style="left:92%;"></div> +<div class="tic_minor" style="left:96%;"></div> +<div class="tic_major" style="left:100%"><div class="tic_label" style="left:-1em; width:2em;">50</div></div> +</div></td> +</tr> +</tbody> +</table> +</div> +<p>Time 1.6 secs.</p> +</div> +<div class="bar"> +<div style="text-align:right;"><a href="#top_buttons">Top</a></div> +<div class="subsection"> +<a name="version"></a><h5>MEME version</h5>4.5.0 (Release date: Thu Oct 14 08:44:28 EST 2010) + </div> +<div class="subsection"> +<a name="reference"></a><h5>Reference</h5> + Timothy L. Bailey and Charles Elkan, + "Fitting a mixture model by expectation maximization to discover + motifs in biopolymers", Proceedings of the Second International + Conference on Intelligent Systems for Molecular Biology, pp. 28-36, + AAAI Press, Menlo Park, California, 1994. + </div> +<a name="sequences"></a><a href="javascript:showHidden('trainingseq')" id="trainingseq_activator">show training set...</a><div class="subsection" id="trainingseq_data" style="display:none;"> +<h5>Training set:</h5> + Datafile = dan.dat<br> + Alphabet = ACDEFGHIKLMNPQRSTVWY<br><table> +<col> +<col> +<col> +<tr style="vertical-align:top;"> +<td><table class="trainingset"> +<col> +<col> +<col> +<tr> +<th>Sequence name</th> +<th>Weighting</th> +<th>Length</th> +</tr> +<tr> +<td>chr21_19617074_19617124_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31710037_31710087_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31914206_31914256_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31964683_31964733_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_32185595_32185645_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_32410820_32410870_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_45705687_45705737_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_45993530_45993580_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46046964_46047014_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46102103_46102153_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +</table></td> +<td><table class="trainingset"> +<col> +<col> +<col> +<tr> +<th>Sequence name</th> +<th>Weighting</th> +<th>Length</th> +</tr> +<tr> +<td>chr21_26934381_26934431_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31744582_31744632_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31933633_31933683_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31973364_31973414_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_32202076_32202126_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_36411748_36411798_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_45971413_45971463_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46020421_46020471_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46057197_46057247_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_47517957_47518007_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +</table></td> +<td><table class="trainingset"> +<col> +<col> +<col> +<tr> +<th>Sequence name</th> +<th>Weighting</th> +<th>Length</th> +</tr> +<tr> +<td>chr21_28217753_28217803_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31768316_31768366_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31962741_31962791_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_31992870_31992920_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_32253899_32253949_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_37838750_37838800_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_45978668_45978718_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46031920_46031970_+</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_46086869_46086919_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +<tr> +<td>chr21_47575506_47575556_-</td> +<td>1.000000</td> +<td>50</td> +</tr> +</table></td> +</tr> +</table> +</div> +<a href="javascript:hideShown('trainingseq')" style="display:none;" id="trainingseq_deactivator">hide training set...</a><div class="subsection"> +<a name="command"></a><h5>Command line summary</h5> +<textarea rows="1" style="width:100%;" readonly>meme dan.dat -o /dataset_dan_files -nostatus </textarea><br> + Letter frequencies in dataset<br><div style="margin-left:25px;">A: 0.294 C: 0.231 D: 0.000 E: 0.000 F: 0.000 G: 0.257 H: 0.000 I: 0.000 K: 0.000 L: 0.000 M: 0.000 N: 0.000 P: 0.000 Q: 0.000 R: 0.000 S: 0.000 T: 0.217 V: 0.000 W: 0.000 Y: 0.000</div> +<br> + Background letter frequencies (from dataset with add-one prior applied):<br><div style="margin-left:25px;">A: 0.291 C: 0.229 D: 0.001 E: 0.001 F: 0.001 G: 0.255 H: 0.001 I: 0.001 K: 0.001 L: 0.001 M: 0.001 N: 0.001 P: 0.001 Q: 0.001 R: 0.001 S: 0.001 T: 0.215 V: 0.001 W: 0.001 Y: 0.001</div> +<br> +</div> +<div class="subsection"> +<a name="stopped"></a><h5>Stopping Reason</h5>Stopped because nmotifs = 1 reached. Program ran on <i>dan</i>. + </div> +<a href="javascript:showHidden('model')" id="model_activator">show model parameters...</a><div class="subsection" id="model_data" style="display:none;"> +<h5>Model parameters</h5> +<textarea style="width:100%;" rows="28" readonly> +host = dan +type = zoops +nmotifs = 1 +evalue_threshold = inf +object_function = E-value of product of p-values +min_width = 8 +max_width = 50 +minic = 0.00 +wg = 11 +ws = 1 +endgaps = yes +minsites = 2 +maxsites = 30 +wnsites = 0.8 +prob = 1 +spmap = pam +spfuzz = 120 +prior = megap +beta = 7500 +maxiter = 50 +distance = 1e-05 +num_sequences = 30 +num_positions = 1500 +seed = 0 +seqfrac = 1 +strands = none +priors_file = prior30.plib +reason_for_stopping = Stopped because nmotifs = 1 reached. +</textarea> +</div> +<a href="javascript:hideShown('model')" style="display:none;" id="model_deactivator">hide model parameters...</a> +</div> +<span class="explain"><a name="explanation"></a><table width="100%" border="0" cellspacing="1" cellpadding="4" bgcolor="#FFFFFF"><tr> +<td><h2 class="mainh">Explanation of MEME Results</h2></td> +<td align="right" valign="bottom"><a href="#top_buttons">Top</a></td> +</tr></table> +<div class="box"> +<h4>The MEME results consist of</h4> +<ul> +<li>The <a href="#overview"><b>overview</b></a> of all discovered motifs.</li> +<li>Information on each of the <a href="#motifs"><b>motifs</b></a> MEME discovered, including: + <ol> +<li> + A <a href="#summary_doc"><b>summary table</b></a> showing the width, number of contributing sites, log likelihood ratio, + statistical significance, information content and relative entropy of the motif. + </li> +<li>A <a href="#logo_doc"><b>sequence LOGO</b></a>.</li> +<li>Downloadable <a href="#download"><b>LOGO files</b></a> suitable for publication.</li> +<li>A <a href="#regular_expression_doc"><b>regular expression</b></a> describing the motif.</li> +<li>Some <a href="#further_analysis_doc"><b>further analysis</b></a> that can be performed on the motif.</li> +<li>A list of <a href="#formats_doc"><b>data formats</b></a> describing the motif.</li> +<li>The <a href="#sites_doc"><b>contributing sites</b></a> of the motif sorted by <i>p</i>-value and aligned with each other.</li> +<li> + The <a href="#diagrams_doc"><b>block diagrams</b></a> of the contributing sites of the motif within each sequence in the training set. + </li> +</ol> +</li> +<li>A <a href="#combined"><b>combined block diagram</b></a> showing an optimized (non-overlapping) + tiling of all of the motifs onto each of the sequences in the training set. + </li> +<li>The <a href="#version"><b>version</b></a> of MEME and the date it was released.</li> +<li>The <a href="#reference"><b>reference</b></a> to cite if you use MEME in your research.</li> +<li> + A description of the <a href="#sequences"><b>sequences</b></a> you submitted (the "training set") showing the name, + "weight" and length of each sequence. + </li> +<li>The <a href="#command"><b>command line summary</b></a> detailing the parameters with which you ran MEME.</li> +<li>The reason why MEME <a href="#stopped"><b>stopped</b></a> and the name of the CPU on which it ran.</li> +<li>This <b>explanation</b> of how to interpret MEME results.</li> +</ul> +<a name="motifs"></a><h4>Motifs</h4> +<p> + For each motif that it discovers in the training set, + MEME prints the following information: + </p> +<a name="summary_doc"></a><h5>Summary Table</h5> +<div class="doc"> +<p> + This summary table gives the main attributes of the motif. + </p> +<dl> +<dt> +<i>E</i>-value</dt> +<dd> + The statistical significance of the motif. MEME usually finds the most statistically significant (low <i>E</i>-value) motifs first. + The <i>E</i>-value of a motif is based on its log likelihood ratio, width, sites, the background letter frequencies (given in the + <a href="#command">command line summary</a>), and the size of the training set. The <i>E</i>-value is an estimate of the expected + number of motifs with the given log likelihood ratio (or higher), and with the same width and site count, that one would find in + a similarly sized set of random sequences. (In random sequences each position is independent with letters chosen according to + the background letter frequencies.) + </dd> +<dt>Width</dt> +<dd>The width of the motif. Each motif describes a pattern of a fixed with as no gaps are allowed in MEME motifs.</dd> +<dt>Sites</dt> +<dd>The number of sites contributing to the construction of the motif.</dd> +<dt> +<a name="llr_doc"></a>Log Likelihood Ratio</dt> +<dd> + The log likelihood ratio of the motif.The log likelihood ratio is the logarithm of the ratio of the probability of the occurrences + of the motif given the motif model (likelihood given the motif) versus their probability given the background model + (likelihood given the null model). (Normally the background model is a 0-order Markov model using the background letter + frequencies, but higher order Markov models may be specified via the <b>-bfile</b> option to MEME.) + </dd> +<dt> +<a name="ic_doc"></a>Information Content</dt> +<dd> + The information content of the motif in bits. It is equal to the sum of the <b>uncorrected</b> information content, <tt>R()</tt>, + in the columns of the <a href="#logo_doc">LOGO</a>. This is equal relative entropy of the motif relative to a uniform background frequency + model. + </dd> +<dt> +<a name="re_doc"></a>Relative Entropy</dt> +<dd> + The relative entropy of the motif, computed in bits and relative to the background letter frequencies given in the + <a href="#command">command line summary</a>. It is equal to the log-likelihood ratio (llr) divided by the + number of contributing sites of the motif times <tt>1/ln(2)</tt>,<br><br><tt>re = llr / (sites * ln(2))</tt>. + </dd> +</dl> +</div> +<a name="logo_doc"></a><h5 class="doc">Sequence LOGO</h5> +<div class="doc"> +<p> + MEME motifs are represented by position-specific probability matrices + that specify the probability of each possible letter appearing at each + possible position in an occurrence of the motif. These are displayed + as "sequence LOGOS", containing stacks of letters at each position + in the motif. The total height of the stack is the "information + content" of that position in the motif in bits. The height of the + individual letters in a stack is the probability of the letter at that + position multiplied by the total information content of the stack. + </p> +<p> + Note: The MEME LOGO differs from those produced by the + <a href="http://weblogo.berkeley.edu">Weblogo</a> program + because a <b>small-sample correction is NOT applied</b>. + However, MEME LOGOs in PNG and encapsulated postscript (EPS) formats + <b>with small-sample correction (SSC)</b> are available by clicking + on the download button with "SSC" set to "on" under + <a href="#download_doc">Download LOGO</a>. + The MEME LOGOs without small sample correction are similarly available. + Error bars are included in the LOGOs with small-sample correction. + </p> +<p> + Modern web browsers supporting the canvas element and it's text manipulation functions as described in the + html 5 standard, can render the sequence LOGOs without needing the images. The browsers which work with this + feature are: + </p> +<ul> +<li>Firefox 3.5 and above</li> +<li>Safari 4 and above</li> +<li>Google Chrome 4 and above</li> +</ul> +<p> + Unfortunately Internet Explorer 8 does not support any html 5 features. + </p> +<p> + The information content of each motif position is computed as described in the paper by Schneider and Stephens, + "Sequence Logos: A New Way to Display Consensus Sequences" but + <b>the small-sample correction, <tt>e(n)</tt>, is set to zero for the LOGO displayed in the MEME output.</b> + The corrected information content of position <tt>i</tt> is given by + </p> +<pre> + R(i) for amino acids = log2(20) - (H(i) + e(n)) (1a) + R(i) for nucleic acids = 2 - (H(i) + e(n)) (1b) + </pre> +<p>where H(i) is the entropy of position <tt>i</tt>,</p> +<pre> + H(l) = - (Sum f(a,i) * log2[ f(a,i) ]). (2) + </pre> +<p> + Here, f(a,i) is the frequency of base or amino acid <tt>a</tt> at position <tt>i</tt>, and <tt>e(n)</tt> is the small-sample correction + for an alignment of <tt>n</tt> letters. The height of letter <tt>a</tt> in column <tt>i</tt> is given by + </p> +<pre> + height = f(a,i) * R(i) (3) + </pre> +<p>The approximation for the small-sample correction, <tt>e(n)</tt>, is given by:</p> +<pre> + e(n) = (s-1) / (2 * ln(2) * n), (4) + </pre> +<p>where <tt>s</tt> is 4 for nucleotides, 20 for amino acids, and <tt>n</tt> is the number of sequences in the alignment.</p> +<p> + The letters in the logos are colored as follows.<br> + For DNA sequences, the letter categories contain one letter each. + </p> +<table border="1"> +<thead><tr> +<th>NUCLEIC ACIDS</th> +<th>COLOR</th> +</tr></thead> +<tbody> +<tr> +<td>A</td> +<td style="color:red;">RED</td> +</tr> +<tr> +<td>C</td> +<td style="color:blue;">BLUE</td> +</tr> +<tr> +<td>G</td> +<td style="color:orange;">ORANGE</td> +</tr> +<tr> +<td>T</td> +<td style="color:green;">GREEN</td> +</tr> +</tbody> +</table> +<p>For proteins, the categories are based on the biochemical properties of the various amino acids.</p> +<table border="1"> +<thead><tr> +<th>AMINO ACIDS</th> +<th>COLOR</th> +<th>PROPERTIES</th> +</tr></thead> +<tbody> +<tr> +<td>A, C, F, I, L, V, W and M</td> +<td style="color:blue;">BLUE</td> +<td>Most hydrophobic[Kyte and Doolittle, 1982]</td> +</tr> +<tr> +<td>NQST</td> +<td style="color:green;">GREEN</td> +<td>Polar, non-charged, non-aliphatic residues</td> +</tr> +<tr> +<td>DE</td> +<td style="color:magenta;">MAGENTA</td> +<td>Acidic</td> +</tr> +<tr> +<td>KR</td> +<td style="color:red;">RED</td> +<td>Positively charged</td> +</tr> +<tr> +<td>H</td> +<td style="color:pink;">PINK</td> +<td> </td> +</tr> +<tr> +<td>G</td> +<td style="color:orange;">ORANGE</td> +<td> </td> +</tr> +<tr> +<td>P</td> +<td style="color:yellow;">YELLOW</td> +<td> </td> +</tr> +<tr> +<td>Y</td> +<td style="color:turquoise;">TURQUOISE</td> +<td> </td> +</tr> +</tbody> +</table> +<p> + J. Kyte and R. Doolittle, 1982. "A Simple Method for Displaying the Hydropathic Character of a Protein", + J. Mol Biol. 157, 105-132. + </p> +<p><b>Note:</b> the "text" output format of MEME preserves the historical MEME format where LOGOS are replaced by a simplified probability + matrix, a relative entropy plot, and a multi-level consensus sequence. + </p> +</div> +<a name="download_doc"></a><h5 class="doc">Download LOGO</h5> +<div class="doc"><p> + Logos can be generated on the fly by the meme webservice and you may specify a number of options to customize them to your needs. + The options are: + <dl> +<dt>Orientation</dt> +<dd>Only valid for nucleotide motifs. Generate the standard view or the reverse complemented view of the motif.</dd> +<dt>SSC</dt> +<dd>Use small sample correction and show errorbars on the image. + Small sample correction is used by the <a href="http://weblogo.berkeley.edu">Weblogo</a> program.</dd> +<dt>Format</dt> +<dd>The format of the generated image. + If the image is to be used on the web then png is recommend. + If the image is to be published then eps is recommended. + </dd> +<dt>Width</dt> +<dd>The width of the generated image in centimetres.</dd> +<dt>Height</dt> +<dd>The height of the generated image in centimetres.</dd> +</dl></p></div> +<a name="regular_expression_doc"></a><h5>Regular Expression</h5> +<div class="doc"><p> + This is a regular expression (RE) describing the motif. In each column, all letters with observed frequencies greater than 0.2 are shown; + less-frequent letters are not included in the RE. MEME regular expressions are interpreted as follows: single letters match that letter; + groups of letters in square brackets match any of the letters in the group. Regular expressions can be used for searching for the motif + in sequences (using, for example, <a href="http://nar.oxfordjournals.org/cgi/content/full/33/suppl_2/W262">PatMatch</a>) but the search + accuracy will usually be better with the PSSM (using, for example <a href="http://meme.nbcr.net/meme/mast-intro.html">MAST</a>.) + </p></div> +<a name="further_analysis_doc"></a><h5>Further Analysis</h5> +<div class="doc"> +<p>Either as a group or individually the motifs have a number of options for further analysis.</p> +<dl> +<dt> +<a name="MAST_doc"></a>MAST</dt> +<dd> + Finds the best matching positions for a set of motifs in each sequence provided to it, ranked by the combined score of each sequence. + For more information about MAST please read the <a href="http://meme.nbcr.net/meme/mast-intro.html">introduction</a>. + </dd> +<dt> +<a name="FIMO_doc"></a>FIMO</dt> +<dd> + Finds all matches for a motif. + For more information about FIMO please read the <a href="http://meme.nbcr.net/meme/fimo-intro.html">introduction</a>. + </dd> +<dt> +<a name="TOMTOM_doc"></a>TOMTOM</dt> +<dd> + Compares a single motif to a database of motifs. + For more information about TOMTOM please read the <a href="http://meme.nbcr.net/meme/tomtom-intro.html">introduction</a>. + </dd> +<dt> +<a name="GOMO_doc"></a>GOMO</dt> +<dd> + Identifies possible roles of DNA binding motifs. + For more information about GOMO please read the <a href="http://meme.nbcr.net/meme/gomo-intro.html">introduction</a>. + </dd> +<dt> +<a name="BLOCKS_doc"></a>BLOCKS</dt> +<dd> + Submit to Blocks Multiple Alignment Processor where you can do several things like create phylogeny trees and search the blocks + against a database of other blocks (protein only). For more information about BLOCKS Multiple Alignment Processor please visit the + <a href="http://blocks.fhcrc.org/blocks/process_blocks.html">website</a>. + </dd> +</dl> +</div> +<a name="formats_doc"></a><h5>Data Formats</h5> +<div class="doc"> +<p>The extracted data is avaliable in the following formats.</p> +<dl> +<dt> +<a name="format_PSPM_doc"></a>PSPM Format</dt> +<dd> + The motif itself is a position-specific probability matrix giving, for each position in the pattern, the observed frequency ("probability") + of each possible letter. The probability matrix is printed "sideways"--columns correspond to the letters in the alphabet (in the same order + as shown in the simplified motif) and rows corresponding to the positions of the motif, position one first. The motif is preceded by a line + starting with "letter-probability matrix:" and containing the length of the alphabet, width of the motif, number of occurrences of the motif, + and the <i>E</i>-value of the motif.<br><b>Note:</b> Earlier versions of MEME gave the posterior probabilities--the probability after applying a prior on letter frequencies--rather + than the observed frequencies. These versions of MEME also gave the number of <i>possible</i> positions for the motif rather than the actual + number of occurrences. The output from these earlier versions of MEME can be distinguished by "n=" rather than "nsites=" in the line + preceding the matrix. + </dd> +<dt> +<a name="format_PSSM_doc"></a>PSSM Format</dt> +<dd> + The position-specific scoring matrix corresponding to the motif is printed for use by database search programs such as MAST. + This matrix is a log-odds matrix calculated by taking 100 times the log (base 2) of the ratio <i>p/f</i> at each position in + the motif where <i>p</i> is the probability of a particular letter at that position in the motif, and <i>f</i> is the background + frequency of the letter (given in the <a href="#command">command line summary</a> section.) This is the same matrix that is used + above in computing the <i>p</i>-values of the occurrences of the motif in the <a href="#sites_doc">Sites</a> + and <a href="#diagrams_doc">Block Diagrams</a> sections. The scoring matrix is printed "sideways"--columns + correspond to the letters in the alphabet (in the same order as shown in the simplified motif) and rows corresponding to the + positions of the motif, position one first. The scoring matrix is preceded by a line starting with "log-odds matrix:" and + containing the length of the alphabet, width of the motif, number of characters in the training set, the scoring threshold + (obsolete) and the motif <i>E</i>-value.<br><b>Note:</b> The probability <i>p</i> used to compute the PSSM is <i>not</i> exactly the same as the corresponding value in the + Position Specific Probability Matrix (PSPM). The values of <i>p</i> used to compute the PSSM take into account the motif prior, + whereas the values in the PSPM are just the <i>observed</i> frequencies of letters in the motif sites. + </dd> +<dt> +<a name="format_BLOCKS_doc"></a>BLOCKS Format</dt> +<dd> + For use with <a href="http://blocks.fhcrc.org/blocks">BLOCKS tools</a>. + </dd> +<dt> +<a name="format_FASTA_doc"></a>FASTA Format</dt> +<dd> + The FASTA format as described <a href="http://meme.nbcr.net/meme/doc/fasta-format.html">here</a>. + </dd> +<dt> +<a name="format_raw_doc"></a>Raw Format</dt> +<dd> + Just the sites of the sequences that contributed to the motif. One site per line. + </dd> +</dl> +</div> +<a name="sites_doc"></a><h5 class="doc">Sites</h5> +<div class="doc"><p> + MEME displays the occurrences (sites) of the motif in the training set. The sites are shown aligned with each other, and the ten sequence + positions preceding and following each site are also shown. Each site is identified by the name of the sequence where it occurs, + the strand (if both strands of DNA sequences are being used), and the position in the sequence where the site begins. When the DNA strand + is specified, '+' means the sequence in the training set, and '-' means the reverse complement of the training set sequence. + (For '-' strands, the 'start' position is actually the position on the <b>positive</b> strand where the site ends.) The sites are <b>listed + in order of increasing statistical significance</b> (<i>p</i>-value). The <i>p</i>-value of a site is computed from the the match score of + the site with the <a href="#format_PSSM_doc">position specific scoring matrix</a> for the motif. The <i>p</i>-value gives the probability of a + random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the + <b>position <i>p</i>-value</b> by the MAST algorithm.) + </p></div> +<a name="diagrams_doc"></a><h5 class="doc">Block Diagrams</h5> +<div class="doc"><p> + The occurrences of the motif in the training set sequences are shown as coloured blocks on a line. One diagram is printed for each + sequence showing all the sites contributating to that motif in that sequence. The sequences are <b>listed in the same order as in the input</b> + to make it easier to compare multiple block diagrams. Additionally the best <i>p</i>-value for the sequence/motif combination is + listed though this may not be in ascending order as with the sites. The <i>p</i>-value of an occurrence is the probability of a single + random subsequence the length of the motif, generated according to the 0-order background model, having a score at least as high as + the score of the occurrence. When the DNA strand is specified '+', it means the motif appears from left to right on the sequence, and '-' + means the motif appears from right to left on the complementary strand. A sequence position scale is shown at the end of each table of + block diagrams. + </p></div> +<a name="combined_doc"></a><h5>Combined Block Diagrams</h5> +<div class="doc"> +<p> + The motif occurrences shown in the motif summary <b>may not be exactly the same as those reported in each motif section</b> because + only motifs with a position <em>p</em>-value of 0.0001 that don't overlap other, more significant motif occurrences are shown. + </p> +<p> + See the documentation for <a href="http://meme.nbcr.net/meme/mast-output.html">MAST output</a> for the definition of position and + combined <em>p</em>-values. + </p> +</div> +</div></span><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br> +</form></body> +</html> --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme/meme/meme_output_txt_1.txt Tue Feb 01 11:20:02 2011 -0500 @@ -0,0 +1,325 @@ +******************************************************************************** +MEME - Motif discovery tool +******************************************************************************** +MEME version 4.5.0 (Release date: Thu Oct 14 08:44:28 EST 2010) + +For further information on how to interpret these results or to get +a copy of the MEME software please access http://meme.nbcr.net. + +This file may be used as input to the MAST algorithm for searching +sequence databases for matches to groups of motifs. MAST is available +for interactive use and downloading at http://meme.nbcr.net. +******************************************************************************** + + +******************************************************************************** +REFERENCE +******************************************************************************** +If you use this program in your research, please cite: + +Timothy L. Bailey and Charles Elkan, +"Fitting a mixture model by expectation maximization to discover +motifs in biopolymers", Proceedings of the Second International +Conference on Intelligent Systems for Molecular Biology, pp. 28-36, +AAAI Press, Menlo Park, California, 1994. +******************************************************************************** + + +******************************************************************************** +TRAINING SET +******************************************************************************** +DATAFILE= dan.dat +ALPHABET= ACDEFGHIKLMNPQRSTVWY +Sequence name Weight Length Sequence name Weight Length +------------- ------ ------ ------------- ------ ------ +chr21_19617074_19617124_ 1.0000 50 chr21_26934381_26934431_ 1.0000 50 +chr21_28217753_28217803_ 1.0000 50 chr21_31710037_31710087_ 1.0000 50 +chr21_31744582_31744632_ 1.0000 50 chr21_31768316_31768366_ 1.0000 50 +chr21_31914206_31914256_ 1.0000 50 chr21_31933633_31933683_ 1.0000 50 +chr21_31962741_31962791_ 1.0000 50 chr21_31964683_31964733_ 1.0000 50 +chr21_31973364_31973414_ 1.0000 50 chr21_31992870_31992920_ 1.0000 50 +chr21_32185595_32185645_ 1.0000 50 chr21_32202076_32202126_ 1.0000 50 +chr21_32253899_32253949_ 1.0000 50 chr21_32410820_32410870_ 1.0000 50 +chr21_36411748_36411798_ 1.0000 50 chr21_37838750_37838800_ 1.0000 50 +chr21_45705687_45705737_ 1.0000 50 chr21_45971413_45971463_ 1.0000 50 +chr21_45978668_45978718_ 1.0000 50 chr21_45993530_45993580_ 1.0000 50 +chr21_46020421_46020471_ 1.0000 50 chr21_46031920_46031970_ 1.0000 50 +chr21_46046964_46047014_ 1.0000 50 chr21_46057197_46057247_ 1.0000 50 +chr21_46086869_46086919_ 1.0000 50 chr21_46102103_46102153_ 1.0000 50 +chr21_47517957_47518007_ 1.0000 50 chr21_47575506_47575556_ 1.0000 50 +******************************************************************************** + +******************************************************************************** +COMMAND LINE SUMMARY +******************************************************************************** +This information can also be useful in the event you wish to report a +problem with the MEME software. + +command: meme dan.dat -o dan/dataset_dan_files -nostatus + +model: mod= zoops nmotifs= 1 evt= inf +object function= E-value of product of p-values +width: minw= 8 maxw= 50 minic= 0.00 +width: wg= 11 ws= 1 endgaps= yes +nsites: minsites= 2 maxsites= 30 wnsites= 0.8 +theta: prob= 1 spmap= pam spfuzz= 120 +global: substring= yes branching= no wbranch= no +em: prior= megap b= 7500 maxiter= 50 + distance= 1e-05 +data: n= 1500 N= 30 + +sample: seed= 0 seqfrac= 1 +Dirichlet mixture priors file: prior30.plib +Letter frequencies in dataset: +A 0.294 C 0.231 D 0.000 E 0.000 F 0.000 G 0.257 H 0.000 I 0.000 K 0.000 +L 0.000 M 0.000 N 0.000 P 0.000 Q 0.000 R 0.000 S 0.000 T 0.217 V 0.000 +W 0.000 Y 0.000 +Background letter frequencies (from dataset with add-one prior applied): +A 0.291 C 0.229 D 0.001 E 0.001 F 0.001 G 0.255 H 0.001 I 0.001 K 0.001 +L 0.001 M 0.001 N 0.001 P 0.001 Q 0.001 R 0.001 S 0.001 T 0.215 V 0.001 +W 0.001 Y 0.001 +******************************************************************************** + + +******************************************************************************** +MOTIF 1 width = 11 sites = 25 llr = 239 E-value = 2.4e-011 +******************************************************************************** +-------------------------------------------------------------------------------- + Motif 1 Description +-------------------------------------------------------------------------------- +Simplified A 2323:a:a8a8 +pos.-specific C ::3:::::::: +probability D ::::::::::: +matrix E ::::::::::: + F ::::::::::: + G 7746::::::1 + H ::::::::::: + I ::::::::::: + K ::::::::::: + L ::::::::::: + M ::::::::::: + N ::::::::::: + P ::::::::::: + Q ::::::::::: + R ::::::::::: + S ::::::::::: + T 1:2:a:a:2:: + V ::::::::::: + W ::::::::::: + Y ::::::::::: + + bits 10.6 + 9.5 + 8.5 + 7.4 +Relative 6.3 +Entropy 5.3 +(13.8 bits) 4.2 + 3.2 + 2.1 * ** + 1.1 ** ******** + 0.0 ----------- + +Multilevel GGGGTATAAAA +consensus AACA T +sequence + + +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 sites sorted by position p-value +-------------------------------------------------------------------------------- +Sequence name Start P-value Site +------------- ----- --------- ----------- +chr21_46046964_46047014_ 13 1.06e-06 AAGGCCAGGA GGGGTATAAAA GCCTGAGAGC +chr21_46057197_46057247_ 37 3.41e-06 ACAGGCCCTG GGCATATAAAA GCC +chr21_45971413_45971463_ 10 3.41e-06 CAGGCCCTG GGCATATAAAA GCCCCAGCAG +chr21_31964683_31964733_ 14 3.41e-06 GATTCACTGA GGCATATAAAA GGCCCTCTGC +chr21_45993530_45993580_ 8 4.00e-06 CCAAGGA GGAGTATAAAA GCCCCACAAA +chr21_32202076_32202126_ 14 5.01e-06 CCACCAGCTT GAGGTATAAAA AGCCCTGTAC +chr21_46031920_46031970_ 16 6.06e-06 ATACCCAGGG AGGGTATAAAA CCTCAGCAGC +chr21_32410820_32410870_ 22 8.67e-06 AATCACTGAG GATGTATAAAA GTCCCAGGGA +chr21_32185595_32185645_ 19 8.67e-06 CACCAGAGCT GGGATATATAA AGAAGGTTCT +chr21_31992870_31992920_ 17 8.67e-06 CACTATTGAA GATGTATAAAA TTTCATTTGC +chr21_46020421_46020471_ 3 1.21e-05 GA GACATATAAAA GCCAACATCC +chr21_47517957_47518007_ 33 1.59e-05 CCGGCGGGGC GGGGTATAAAG GGGGCGG +chr21_45978668_45978718_ 5 1.59e-05 CAGA GGGGTATAAAG GTTCCGACCA +chr21_31914206_31914256_ 16 1.68e-05 CCCACTACTT AGAGTATAAAA TCATTCTGAG +chr21_32253899_32253949_ 20 2.03e-05 CACCAGCAAG GATATATAAAA GCTCAGGAGT +chr21_31744582_31744632_ 13 3.06e-05 CAGGTCTAAG AGCATATATAA CTTGGAGTCC +chr21_19617074_19617124_ 40 3.06e-05 CCTCGGGACG TGGGTATATAA +chr21_45705687_45705737_ 38 3.82e-05 CGTGGTCGCG GGGGTATAACA GC +chr21_31768316_31768366_ 1 3.82e-05 . AACGTATATAA ATGGTCCTGT +chr21_47575506_47575556_ 31 4.02e-05 GCTGCCGGTG AGCGTATAAAG GCCCTGGCG +chr21_26934381_26934431_ 28 5.52e-05 AGTCACAAGT GAGTTATAAAA GGGTCGCACG +chr21_31710037_31710087_ 15 5.94e-05 CCCAGGTTTC TGAGTATATAA TCGCCGCACC +chr21_36411748_36411798_ 23 6.78e-05 AGTTTCAGTT GGCATCTAAAA ATTATATAAC +chr21_31933633_31933683_ 3 2.08e-04 TC AGAGTATATAT AAATGTTCCT +chr21_31962741_31962791_ 14 4.05e-04 TATAACTCAG GTTGGATAAAA TAATTTGTAC +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 block diagrams +-------------------------------------------------------------------------------- +SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM +------------- ---------------- ------------- +chr21_46046964_46047014_ 1.1e-06 12_[1]_27 +chr21_46057197_46057247_ 3.4e-06 36_[1]_3 +chr21_45971413_45971463_ 3.4e-06 9_[1]_30 +chr21_31964683_31964733_ 3.4e-06 13_[1]_26 +chr21_45993530_45993580_ 4e-06 7_[1]_32 +chr21_32202076_32202126_ 5e-06 13_[1]_26 +chr21_46031920_46031970_ 6.1e-06 15_[1]_24 +chr21_32410820_32410870_ 8.7e-06 21_[1]_18 +chr21_32185595_32185645_ 8.7e-06 18_[1]_21 +chr21_31992870_31992920_ 8.7e-06 16_[1]_23 +chr21_46020421_46020471_ 1.2e-05 2_[1]_37 +chr21_47517957_47518007_ 1.6e-05 32_[1]_7 +chr21_45978668_45978718_ 1.6e-05 4_[1]_35 +chr21_31914206_31914256_ 1.7e-05 15_[1]_24 +chr21_32253899_32253949_ 2e-05 19_[1]_20 +chr21_31744582_31744632_ 3.1e-05 12_[1]_27 +chr21_19617074_19617124_ 3.1e-05 39_[1] +chr21_45705687_45705737_ 3.8e-05 37_[1]_2 +chr21_31768316_31768366_ 3.8e-05 [1]_39 +chr21_47575506_47575556_ 4e-05 30_[1]_9 +chr21_26934381_26934431_ 5.5e-05 27_[1]_12 +chr21_31710037_31710087_ 5.9e-05 14_[1]_25 +chr21_36411748_36411798_ 6.8e-05 22_[1]_17 +chr21_31933633_31933683_ 0.00021 2_[1]_37 +chr21_31962741_31962791_ 0.0004 13_[1]_26 +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 in BLOCKS format +-------------------------------------------------------------------------------- +BL MOTIF 1 width=11 seqs=25 +chr21_46046964_46047014_ ( 13) GGGGTATAAAA 1 +chr21_46057197_46057247_ ( 37) GGCATATAAAA 1 +chr21_45971413_45971463_ ( 10) GGCATATAAAA 1 +chr21_31964683_31964733_ ( 14) GGCATATAAAA 1 +chr21_45993530_45993580_ ( 8) GGAGTATAAAA 1 +chr21_32202076_32202126_ ( 14) GAGGTATAAAA 1 +chr21_46031920_46031970_ ( 16) AGGGTATAAAA 1 +chr21_32410820_32410870_ ( 22) GATGTATAAAA 1 +chr21_32185595_32185645_ ( 19) GGGATATATAA 1 +chr21_31992870_31992920_ ( 17) GATGTATAAAA 1 +chr21_46020421_46020471_ ( 3) GACATATAAAA 1 +chr21_47517957_47518007_ ( 33) GGGGTATAAAG 1 +chr21_45978668_45978718_ ( 5) GGGGTATAAAG 1 +chr21_31914206_31914256_ ( 16) AGAGTATAAAA 1 +chr21_32253899_32253949_ ( 20) GATATATAAAA 1 +chr21_31744582_31744632_ ( 13) AGCATATATAA 1 +chr21_19617074_19617124_ ( 40) TGGGTATATAA 1 +chr21_45705687_45705737_ ( 38) GGGGTATAACA 1 +chr21_31768316_31768366_ ( 1) AACGTATATAA 1 +chr21_47575506_47575556_ ( 31) AGCGTATAAAG 1 +chr21_26934381_26934431_ ( 28) GAGTTATAAAA 1 +chr21_31710037_31710087_ ( 15) TGAGTATATAA 1 +chr21_36411748_36411798_ ( 23) GGCATCTAAAA 1 +chr21_31933633_31933683_ ( 3) AGAGTATATAT 1 +chr21_31962741_31962791_ ( 14) GTTGGATAAAA 1 +// + +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 position-specific scoring matrix +-------------------------------------------------------------------------------- +log-odds matrix: alength= 20 w= 11 n= 1200 bayes= 5.33554 E= 2.4e-011 + -32 -680 91 77 7 138 -20 55 64 107 11 150 142 72 87 396 -148 221 -140 -36 + -11 -680 89 76 7 137 -21 55 63 107 10 149 141 71 87 396 -239 220 -140 -36 + -79 41 4 21 -7 44 -62 42 -5 99 0 99 138 52 42 399 -46 223 -173 -68 + 11 -677 48 47 -2 127 -43 46 27 101 3 124 138 60 62 397 -235 220 -160 -55 + -596 -820 12 -21 -53 -267 -74 37 16 44 -37 98 31 9 19 319 212 127 -193 -95 + 165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8 + -838 -990 -89 -149 -151 -841 -161 -117 -113 -66 -209 -68 -69 -129 -91 111 221 -55 -255 -173 + 176 -858 -79 -103 -115 -717 -148 -95 -108 -17 -162 -61 -12 -95 -69 193 -737 52 -240 -153 + 134 -686 0 16 -12 -553 -68 44 -8 96 -9 88 124 41 36 384 11 216 -177 -71 + 165 -261 70 110 77 -521 -4 147 95 201 90 121 124 91 107 425 -527 314 -95 8 + 147 -614 89 129 93 -121 12 160 113 217 108 144 144 111 125 447 -241 332 -81 22 +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 position-specific probability matrix +-------------------------------------------------------------------------------- +letter-probability matrix: alength= 20 w= 11 nsites= 25 E= 2.4e-011 + 0.240000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.080000 0.000000 0.000000 0.000000 + 0.280000 0.000000 0.000000 0.000000 0.000000 0.680000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 + 0.160000 0.320000 0.000000 0.000000 0.000000 0.360000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.160000 0.000000 0.000000 0.000000 + 0.320000 0.000000 0.000000 0.000000 0.000000 0.640000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 + 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.960000 0.000000 0.000000 0.000000 + 0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 + 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 + 1.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 + 0.760000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.240000 0.000000 0.000000 0.000000 + 0.960000 0.040000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 + 0.840000 0.000000 0.000000 0.000000 0.000000 0.120000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.000000 0.040000 0.000000 0.000000 0.000000 +-------------------------------------------------------------------------------- + +-------------------------------------------------------------------------------- + Motif 1 regular expression +-------------------------------------------------------------------------------- +[GA][GA][GC][GA]TATA[AT]AA +-------------------------------------------------------------------------------- + + + + +Time 1.56 secs. + +******************************************************************************** + + +******************************************************************************** +SUMMARY OF MOTIFS +******************************************************************************** + +-------------------------------------------------------------------------------- + Combined block diagrams: non-overlapping sites with p-value < 0.0001 +-------------------------------------------------------------------------------- +SEQUENCE NAME COMBINED P-VALUE MOTIF DIAGRAM +------------- ---------------- ------------- +chr21_19617074_19617124_ 1.22e-03 39_[1(3.06e-05)] +chr21_26934381_26934431_ 2.21e-03 27_[1(5.52e-05)]_12 +chr21_28217753_28217803_ 7.29e-01 50 +chr21_31710037_31710087_ 2.37e-03 14_[1(5.94e-05)]_25 +chr21_31744582_31744632_ 1.22e-03 12_[1(3.06e-05)]_27 +chr21_31768316_31768366_ 1.53e-03 [1(3.82e-05)]_39 +chr21_31914206_31914256_ 6.70e-04 15_[1(1.68e-05)]_24 +chr21_31933633_31933683_ 1.81e-03 4_[1(4.54e-05)]_35 +chr21_31962741_31962791_ 1.61e-02 50 +chr21_31964683_31964733_ 1.36e-04 13_[1(3.41e-06)]_26 +chr21_31973364_31973414_ 1.99e-01 50 +chr21_31992870_31992920_ 3.47e-04 16_[1(8.67e-06)]_23 +chr21_32185595_32185645_ 3.47e-04 18_[1(8.67e-06)]_21 +chr21_32202076_32202126_ 2.01e-04 13_[1(5.01e-06)]_26 +chr21_32253899_32253949_ 8.11e-04 19_[1(2.03e-05)]_20 +chr21_32410820_32410870_ 3.47e-04 21_[1(8.67e-06)]_18 +chr21_36411748_36411798_ 2.71e-03 22_[1(6.78e-05)]_17 +chr21_37838750_37838800_ 8.23e-02 50 +chr21_45705687_45705737_ 1.53e-03 37_[1(3.82e-05)]_2 +chr21_45971413_45971463_ 1.36e-04 9_[1(3.41e-06)]_30 +chr21_45978668_45978718_ 6.37e-04 4_[1(1.59e-05)]_35 +chr21_45993530_45993580_ 1.60e-04 7_[1(4.00e-06)]_32 +chr21_46020421_46020471_ 4.83e-04 2_[1(1.21e-05)]_37 +chr21_46031920_46031970_ 2.43e-04 15_[1(6.06e-06)]_24 +chr21_46046964_46047014_ 4.26e-05 12_[1(1.06e-06)]_27 +chr21_46057197_46057247_ 1.36e-04 36_[1(3.41e-06)]_3 +chr21_46086869_46086919_ 4.30e-02 50 +chr21_46102103_46102153_ 4.30e-02 50 +chr21_47517957_47518007_ 6.37e-04 32_[1(1.59e-05)]_7 +chr21_47575506_47575556_ 1.61e-03 30_[1(4.02e-05)]_9 +-------------------------------------------------------------------------------- + +******************************************************************************** + + +******************************************************************************** +Stopped because nmotifs = 1 reached. +******************************************************************************** + +CPU: dan + +******************************************************************************** --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme/meme/meme_output_xml_1.xml Tue Feb 01 11:20:02 2011 -0500 @@ -0,0 +1,1284 @@ +<?xml version='1.0' encoding='UTF-8' standalone='yes'?> + +<!DOCTYPE MEME[ +<!ELEMENT MEME ( + training_set, + model, + motifs, + scanned_sites_summary? +)> +<!ATTLIST MEME + version CDATA #REQUIRED + release CDATA #REQUIRED +> + +<!ELEMENT training_set (alphabet, ambigs, sequence+, letter_frequencies)> +<!ATTLIST training_set datafile CDATA #REQUIRED length CDATA #REQUIRED> +<!ELEMENT alphabet (letter+)> +<!ATTLIST alphabet id (amino-acid|nucleotide) #REQUIRED + length CDATA #REQUIRED> +<!ELEMENT ambigs (letter+)> +<!ELEMENT letter EMPTY> +<!ATTLIST letter id ID #REQUIRED> +<!ATTLIST letter symbol CDATA #REQUIRED> +<!ELEMENT sequence EMPTY> +<!ATTLIST sequence id ID #REQUIRED + name CDATA #REQUIRED + length CDATA #REQUIRED + weight CDATA #REQUIRED +> +<!ELEMENT letter_frequencies (alphabet_array)> + + +<!ELEMENT model ( + command_line, + host, + type, + nmotifs, + evalue_threshold, + object_function, + min_width, + max_width, + minic, + wg, + ws, + endgaps, + minsites, + maxsites, + wnsites, + prob, + spmap, + spfuzz, + prior, + beta, + maxiter, + distance, + num_sequences, + num_positions, + seed, + seqfrac, + strands, + priors_file, + reason_for_stopping, + background_frequencies +)> +<!ELEMENT command_line (#PCDATA)*> +<!ELEMENT host (#PCDATA)*> +<!ELEMENT type (#PCDATA)*> +<!ELEMENT nmotifs (#PCDATA)*> +<!ELEMENT evalue_threshold (#PCDATA)*> +<!ELEMENT object_function (#PCDATA)*> +<!ELEMENT min_width (#PCDATA)*> +<!ELEMENT max_width (#PCDATA)*> +<!ELEMENT minic (#PCDATA)*> +<!ELEMENT wg (#PCDATA)*> +<!ELEMENT ws (#PCDATA)*> +<!ELEMENT endgaps (#PCDATA)*> +<!ELEMENT minsites (#PCDATA)*> +<!ELEMENT maxsites (#PCDATA)*> +<!ELEMENT wnsites (#PCDATA)*> +<!ELEMENT prob (#PCDATA)*> +<!ELEMENT spmap (#PCDATA)*> +<!ELEMENT spfuzz (#PCDATA)*> +<!ELEMENT prior (#PCDATA)*> +<!ELEMENT beta (#PCDATA)*> +<!ELEMENT maxiter (#PCDATA)*> +<!ELEMENT distance (#PCDATA)*> +<!ELEMENT num_sequences (#PCDATA)*> +<!ELEMENT num_positions (#PCDATA)*> +<!ELEMENT seed (#PCDATA)*> +<!ELEMENT seqfrac (#PCDATA)*> +<!ELEMENT strands (#PCDATA)*> +<!ELEMENT priors_file (#PCDATA)*> +<!ELEMENT reason_for_stopping (#PCDATA)*> +<!ELEMENT background_frequencies (alphabet_array)> +<!ATTLIST background_frequencies source CDATA #REQUIRED> + + +<!ELEMENT motifs (motif+)> +<!ELEMENT motif (scores, probabilities, regular_expression?, contributing_sites)> +<!ATTLIST motif id ID #REQUIRED + name CDATA #REQUIRED + width CDATA #REQUIRED + sites CDATA #REQUIRED + llr CDATA #REQUIRED + ic CDATA #REQUIRED + re CDATA #REQUIRED + bayes_threshold CDATA #REQUIRED + e_value CDATA #REQUIRED + elapsed_time CDATA #REQUIRED + url CDATA "" +> +<!ELEMENT scores (alphabet_matrix)> +<!ELEMENT probabilities (alphabet_matrix)> +<!ELEMENT regular_expression (#PCDATA)*> + + + +<!ELEMENT contributing_sites (contributing_site+)> +<!ELEMENT contributing_site (left_flank, site, right_flank)> +<!ATTLIST contributing_site sequence_id IDREF #REQUIRED + position CDATA #REQUIRED + strand (plus|minus|none) 'none' + pvalue CDATA #REQUIRED +> + +<!ELEMENT left_flank (#PCDATA)> + +<!ELEMENT site (letter_ref+)> + +<!ELEMENT right_flank (#PCDATA)> + + + +<!ELEMENT scanned_sites_summary (scanned_sites+)> +<!ATTLIST scanned_sites_summary p_thresh CDATA #REQUIRED> +<!ELEMENT scanned_sites (scanned_site*)> +<!ATTLIST scanned_sites sequence_id IDREF #REQUIRED + pvalue CDATA #REQUIRED + num_sites CDATA #REQUIRED> +<!ELEMENT scanned_site EMPTY> +<!ATTLIST scanned_site motif_id IDREF #REQUIRED + strand (plus|minus|none) 'none' + position CDATA #REQUIRED + pvalue CDATA #REQUIRED> + + + +<!ELEMENT letter_ref EMPTY> +<!ATTLIST letter_ref letter_id IDREF #REQUIRED> + +<!ELEMENT alphabet_array (value+)> +<!ELEMENT value (#PCDATA)> +<!ATTLIST value letter_id IDREF #REQUIRED> + + +<!ELEMENT alphabet_matrix (alphabet_array+)> + +]> + +<MEME version="4.5.0" release="Thu Oct 14 08:44:28 EST 2010"> +<training_set datafile="/dan_110.dat" length="30"> +<alphabet id="amino-acid" length="20"> +<letter id="letter_A" symbol="A"/> +<letter id="letter_C" symbol="C"/> +<letter id="letter_D" symbol="D"/> +<letter id="letter_E" symbol="E"/> +<letter id="letter_F" symbol="F"/> +<letter id="letter_G" symbol="G"/> +<letter id="letter_H" symbol="H"/> +<letter id="letter_I" symbol="I"/> +<letter id="letter_K" symbol="K"/> +<letter id="letter_L" symbol="L"/> +<letter id="letter_M" symbol="M"/> +<letter id="letter_N" symbol="N"/> +<letter id="letter_P" symbol="P"/> +<letter id="letter_Q" symbol="Q"/> +<letter id="letter_R" symbol="R"/> +<letter id="letter_S" symbol="S"/> +<letter id="letter_T" symbol="T"/> +<letter id="letter_V" symbol="V"/> +<letter id="letter_W" symbol="W"/> +<letter id="letter_Y" symbol="Y"/> +</alphabet> +<ambigs> +<letter id="letter_B" symbol="B"/> +<letter id="letter_U" symbol="U"/> +<letter id="letter_X" symbol="X"/> +<letter id="letter_Z" symbol="Z"/> +<letter id="letter_star" symbol="*"/> +<letter id="letter_-" symbol="-"/> +</ambigs> +<sequence id="sequence_0" name="chr21_19617074_19617124_+" length="50" weight="1.000000" /> +<sequence id="sequence_1" name="chr21_26934381_26934431_+" length="50" weight="1.000000" /> +<sequence id="sequence_2" name="chr21_28217753_28217803_-" length="50" weight="1.000000" /> +<sequence id="sequence_3" name="chr21_31710037_31710087_-" length="50" weight="1.000000" /> +<sequence id="sequence_4" name="chr21_31744582_31744632_-" length="50" weight="1.000000" /> +<sequence id="sequence_5" name="chr21_31768316_31768366_+" length="50" weight="1.000000" /> +<sequence id="sequence_6" name="chr21_31914206_31914256_-" length="50" weight="1.000000" /> +<sequence id="sequence_7" name="chr21_31933633_31933683_-" length="50" weight="1.000000" /> +<sequence id="sequence_8" name="chr21_31962741_31962791_-" length="50" weight="1.000000" /> +<sequence id="sequence_9" name="chr21_31964683_31964733_+" length="50" weight="1.000000" /> +<sequence id="sequence_10" name="chr21_31973364_31973414_+" length="50" weight="1.000000" /> +<sequence id="sequence_11" name="chr21_31992870_31992920_+" length="50" weight="1.000000" /> +<sequence id="sequence_12" name="chr21_32185595_32185645_-" length="50" weight="1.000000" /> +<sequence id="sequence_13" name="chr21_32202076_32202126_-" length="50" weight="1.000000" /> +<sequence id="sequence_14" name="chr21_32253899_32253949_-" length="50" weight="1.000000" /> +<sequence id="sequence_15" name="chr21_32410820_32410870_-" length="50" weight="1.000000" /> +<sequence id="sequence_16" name="chr21_36411748_36411798_-" length="50" weight="1.000000" /> +<sequence id="sequence_17" name="chr21_37838750_37838800_-" length="50" weight="1.000000" /> +<sequence id="sequence_18" name="chr21_45705687_45705737_+" length="50" weight="1.000000" /> +<sequence id="sequence_19" name="chr21_45971413_45971463_-" length="50" weight="1.000000" /> +<sequence id="sequence_20" name="chr21_45978668_45978718_-" length="50" weight="1.000000" /> +<sequence id="sequence_21" name="chr21_45993530_45993580_+" length="50" weight="1.000000" /> +<sequence id="sequence_22" name="chr21_46020421_46020471_+" length="50" weight="1.000000" /> +<sequence id="sequence_23" name="chr21_46031920_46031970_+" length="50" weight="1.000000" /> +<sequence id="sequence_24" name="chr21_46046964_46047014_+" length="50" weight="1.000000" /> +<sequence id="sequence_25" name="chr21_46057197_46057247_+" length="50" weight="1.000000" /> +<sequence id="sequence_26" name="chr21_46086869_46086919_-" length="50" weight="1.000000" /> +<sequence id="sequence_27" name="chr21_46102103_46102153_-" length="50" weight="1.000000" /> +<sequence id="sequence_28" name="chr21_47517957_47518007_+" length="50" weight="1.000000" /> +<sequence id="sequence_29" name="chr21_47575506_47575556_-" length="50" weight="1.000000" /> +<letter_frequencies> +<alphabet_array> +<value letter_id="letter_A">0.294</value> +<value letter_id="letter_C">0.231</value> +<value letter_id="letter_D">0.000</value> +<value letter_id="letter_E">0.000</value> +<value letter_id="letter_F">0.000</value> +<value letter_id="letter_G">0.257</value> +<value letter_id="letter_H">0.000</value> +<value letter_id="letter_I">0.000</value> +<value letter_id="letter_K">0.000</value> +<value letter_id="letter_L">0.000</value> +<value letter_id="letter_M">0.000</value> +<value letter_id="letter_N">0.000</value> +<value letter_id="letter_P">0.000</value> +<value letter_id="letter_Q">0.000</value> +<value letter_id="letter_R">0.000</value> +<value letter_id="letter_S">0.000</value> +<value letter_id="letter_T">0.217</value> +<value letter_id="letter_V">0.000</value> +<value letter_id="letter_W">0.000</value> +<value letter_id="letter_Y">0.000</value> +</alphabet_array> +</letter_frequencies> +</training_set> +<model> +<command_line>meme /dan.dat -o /dataset_dan_files -nostatus </command_line> +<host>dan</host> +<type>zoops</type> +<nmotifs>1</nmotifs> +<evalue_threshold>inf</evalue_threshold> +<object_function>E-value of product of p-values</object_function> +<min_width>8</min_width> +<max_width>50</max_width> +<minic> 0.00</minic> +<wg>11</wg> +<ws>1</ws> +<endgaps>yes</endgaps> +<minsites>2</minsites> +<maxsites>30</maxsites> +<wnsites>0.8</wnsites> +<prob>1</prob> +<spmap>pam</spmap> +<spfuzz>120</spfuzz> +<prior>megap</prior> +<beta>7500</beta> +<maxiter>50</maxiter> +<distance>1e-05</distance> +<num_sequences>30</num_sequences> +<num_positions>1500</num_positions> +<seed>0</seed> +<seqfrac> 1</seqfrac> +<strands>none</strands> +<priors_file>prior30.plib</priors_file> +<reason_for_stopping>Stopped because nmotifs = 1 reached.</reason_for_stopping> +<background_frequencies source="dataset with add-one prior applied"> +<alphabet_array> +<value letter_id="letter_A">0.291</value> +<value letter_id="letter_C">0.229</value> +<value letter_id="letter_D">0.001</value> +<value letter_id="letter_E">0.001</value> +<value letter_id="letter_F">0.001</value> +<value letter_id="letter_G">0.255</value> +<value letter_id="letter_H">0.001</value> +<value letter_id="letter_I">0.001</value> +<value letter_id="letter_K">0.001</value> +<value letter_id="letter_L">0.001</value> +<value letter_id="letter_M">0.001</value> +<value letter_id="letter_N">0.001</value> +<value letter_id="letter_P">0.001</value> +<value letter_id="letter_Q">0.001</value> +<value letter_id="letter_R">0.001</value> +<value letter_id="letter_S">0.001</value> +<value letter_id="letter_T">0.215</value> +<value letter_id="letter_V">0.001</value> +<value letter_id="letter_W">0.001</value> +<value letter_id="letter_Y">0.001</value> +</alphabet_array> +</background_frequencies> +</model> +<motifs> +<motif id="motif_1" name="1" width="11" sites="25" ic="40.0" re="13.8" llr="239" e_value="2.4e-011" bayes_threshold="5.33554" elapsed_time="1.563760"> +<scores> +<alphabet_matrix> +<alphabet_array> +<value letter_id="letter_A">-32</value> +<value letter_id="letter_C">-680</value> +<value letter_id="letter_D">91</value> +<value letter_id="letter_E">77</value> +<value letter_id="letter_F">7</value> +<value letter_id="letter_G">138</value> +<value letter_id="letter_H">-20</value> +<value letter_id="letter_I">55</value> +<value letter_id="letter_K">64</value> +<value letter_id="letter_L">107</value> +<value letter_id="letter_M">11</value> +<value letter_id="letter_N">150</value> +<value letter_id="letter_P">142</value> +<value letter_id="letter_Q">72</value> +<value letter_id="letter_R">87</value> +<value letter_id="letter_S">396</value> +<value letter_id="letter_T">-148</value> +<value letter_id="letter_V">221</value> +<value letter_id="letter_W">-140</value> +<value letter_id="letter_Y">-36</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">-11</value> +<value letter_id="letter_C">-680</value> +<value letter_id="letter_D">89</value> +<value letter_id="letter_E">76</value> +<value letter_id="letter_F">7</value> +<value letter_id="letter_G">137</value> +<value letter_id="letter_H">-21</value> +<value letter_id="letter_I">55</value> +<value letter_id="letter_K">63</value> +<value letter_id="letter_L">107</value> +<value letter_id="letter_M">10</value> +<value letter_id="letter_N">149</value> +<value letter_id="letter_P">141</value> +<value letter_id="letter_Q">71</value> +<value letter_id="letter_R">87</value> +<value letter_id="letter_S">396</value> +<value letter_id="letter_T">-239</value> +<value letter_id="letter_V">220</value> +<value letter_id="letter_W">-140</value> +<value letter_id="letter_Y">-36</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">-79</value> +<value letter_id="letter_C">41</value> +<value letter_id="letter_D">4</value> +<value letter_id="letter_E">21</value> +<value letter_id="letter_F">-7</value> +<value letter_id="letter_G">44</value> +<value letter_id="letter_H">-62</value> +<value letter_id="letter_I">42</value> +<value letter_id="letter_K">-5</value> +<value letter_id="letter_L">99</value> +<value letter_id="letter_M">0</value> +<value letter_id="letter_N">99</value> +<value letter_id="letter_P">138</value> +<value letter_id="letter_Q">52</value> +<value letter_id="letter_R">42</value> +<value letter_id="letter_S">399</value> +<value letter_id="letter_T">-46</value> +<value letter_id="letter_V">223</value> +<value letter_id="letter_W">-173</value> +<value letter_id="letter_Y">-68</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">11</value> +<value letter_id="letter_C">-677</value> +<value letter_id="letter_D">48</value> +<value letter_id="letter_E">47</value> +<value letter_id="letter_F">-2</value> +<value letter_id="letter_G">127</value> +<value letter_id="letter_H">-43</value> +<value letter_id="letter_I">46</value> +<value letter_id="letter_K">27</value> +<value letter_id="letter_L">101</value> +<value letter_id="letter_M">3</value> +<value letter_id="letter_N">124</value> +<value letter_id="letter_P">138</value> +<value letter_id="letter_Q">60</value> +<value letter_id="letter_R">62</value> +<value letter_id="letter_S">397</value> +<value letter_id="letter_T">-235</value> +<value letter_id="letter_V">220</value> +<value letter_id="letter_W">-160</value> +<value letter_id="letter_Y">-55</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">-596</value> +<value letter_id="letter_C">-820</value> +<value letter_id="letter_D">12</value> +<value letter_id="letter_E">-21</value> +<value letter_id="letter_F">-53</value> +<value letter_id="letter_G">-267</value> +<value letter_id="letter_H">-74</value> +<value letter_id="letter_I">37</value> +<value letter_id="letter_K">16</value> +<value letter_id="letter_L">44</value> +<value letter_id="letter_M">-37</value> +<value letter_id="letter_N">98</value> +<value letter_id="letter_P">31</value> +<value letter_id="letter_Q">9</value> +<value letter_id="letter_R">19</value> +<value letter_id="letter_S">319</value> +<value letter_id="letter_T">212</value> +<value letter_id="letter_V">127</value> +<value letter_id="letter_W">-193</value> +<value letter_id="letter_Y">-95</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">165</value> +<value letter_id="letter_C">-261</value> +<value letter_id="letter_D">70</value> +<value letter_id="letter_E">110</value> +<value letter_id="letter_F">77</value> +<value letter_id="letter_G">-521</value> +<value letter_id="letter_H">-4</value> +<value letter_id="letter_I">147</value> +<value letter_id="letter_K">95</value> +<value letter_id="letter_L">201</value> +<value letter_id="letter_M">90</value> +<value letter_id="letter_N">121</value> +<value letter_id="letter_P">124</value> +<value letter_id="letter_Q">91</value> +<value letter_id="letter_R">107</value> +<value letter_id="letter_S">425</value> +<value letter_id="letter_T">-527</value> +<value letter_id="letter_V">314</value> +<value letter_id="letter_W">-95</value> +<value letter_id="letter_Y">8</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">-838</value> +<value letter_id="letter_C">-990</value> +<value letter_id="letter_D">-89</value> +<value letter_id="letter_E">-149</value> +<value letter_id="letter_F">-151</value> +<value letter_id="letter_G">-841</value> +<value letter_id="letter_H">-161</value> +<value letter_id="letter_I">-117</value> +<value letter_id="letter_K">-113</value> +<value letter_id="letter_L">-66</value> +<value letter_id="letter_M">-209</value> +<value letter_id="letter_N">-68</value> +<value letter_id="letter_P">-69</value> +<value letter_id="letter_Q">-129</value> +<value letter_id="letter_R">-91</value> +<value letter_id="letter_S">111</value> +<value letter_id="letter_T">221</value> +<value letter_id="letter_V">-55</value> +<value letter_id="letter_W">-255</value> +<value letter_id="letter_Y">-173</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">176</value> +<value letter_id="letter_C">-858</value> +<value letter_id="letter_D">-79</value> +<value letter_id="letter_E">-103</value> +<value letter_id="letter_F">-115</value> +<value letter_id="letter_G">-717</value> +<value letter_id="letter_H">-148</value> +<value letter_id="letter_I">-95</value> +<value letter_id="letter_K">-108</value> +<value letter_id="letter_L">-17</value> +<value letter_id="letter_M">-162</value> +<value letter_id="letter_N">-61</value> +<value letter_id="letter_P">-12</value> +<value letter_id="letter_Q">-95</value> +<value letter_id="letter_R">-69</value> +<value letter_id="letter_S">193</value> +<value letter_id="letter_T">-737</value> +<value letter_id="letter_V">52</value> +<value letter_id="letter_W">-240</value> +<value letter_id="letter_Y">-153</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">134</value> +<value letter_id="letter_C">-686</value> +<value letter_id="letter_D">0</value> +<value letter_id="letter_E">16</value> +<value letter_id="letter_F">-12</value> +<value letter_id="letter_G">-553</value> +<value letter_id="letter_H">-68</value> +<value letter_id="letter_I">44</value> +<value letter_id="letter_K">-8</value> +<value letter_id="letter_L">96</value> +<value letter_id="letter_M">-9</value> +<value letter_id="letter_N">88</value> +<value letter_id="letter_P">124</value> +<value letter_id="letter_Q">41</value> +<value letter_id="letter_R">36</value> +<value letter_id="letter_S">384</value> +<value letter_id="letter_T">11</value> +<value letter_id="letter_V">216</value> +<value letter_id="letter_W">-177</value> +<value letter_id="letter_Y">-71</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">165</value> +<value letter_id="letter_C">-261</value> +<value letter_id="letter_D">70</value> +<value letter_id="letter_E">110</value> +<value letter_id="letter_F">77</value> +<value letter_id="letter_G">-521</value> +<value letter_id="letter_H">-4</value> +<value letter_id="letter_I">147</value> +<value letter_id="letter_K">95</value> +<value letter_id="letter_L">201</value> +<value letter_id="letter_M">90</value> +<value letter_id="letter_N">121</value> +<value letter_id="letter_P">124</value> +<value letter_id="letter_Q">91</value> +<value letter_id="letter_R">107</value> +<value letter_id="letter_S">425</value> +<value letter_id="letter_T">-527</value> +<value letter_id="letter_V">314</value> +<value letter_id="letter_W">-95</value> +<value letter_id="letter_Y">8</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">147</value> +<value letter_id="letter_C">-614</value> +<value letter_id="letter_D">89</value> +<value letter_id="letter_E">129</value> +<value letter_id="letter_F">93</value> +<value letter_id="letter_G">-121</value> +<value letter_id="letter_H">12</value> +<value letter_id="letter_I">160</value> +<value letter_id="letter_K">113</value> +<value letter_id="letter_L">217</value> +<value letter_id="letter_M">108</value> +<value letter_id="letter_N">144</value> +<value letter_id="letter_P">144</value> +<value letter_id="letter_Q">111</value> +<value letter_id="letter_R">125</value> +<value letter_id="letter_S">447</value> +<value letter_id="letter_T">-241</value> +<value letter_id="letter_V">332</value> +<value letter_id="letter_W">-81</value> +<value letter_id="letter_Y">22</value> +</alphabet_array> +</alphabet_matrix> +</scores> +<probabilities> +<alphabet_matrix> +<alphabet_array> +<value letter_id="letter_A">0.240000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.680000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.080000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.280000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.680000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.040000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.160000</value> +<value letter_id="letter_C">0.320000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.360000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.160000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.320000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.640000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.040000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.000000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.040000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.960000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.960000</value> +<value letter_id="letter_C">0.040000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.000000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.000000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.000000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.000000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">1.000000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">1.000000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.000000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.000000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.760000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.000000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.240000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.960000</value> +<value letter_id="letter_C">0.040000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.000000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.000000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +<alphabet_array> +<value letter_id="letter_A">0.840000</value> +<value letter_id="letter_C">0.000000</value> +<value letter_id="letter_D">0.000000</value> +<value letter_id="letter_E">0.000000</value> +<value letter_id="letter_F">0.000000</value> +<value letter_id="letter_G">0.120000</value> +<value letter_id="letter_H">0.000000</value> +<value letter_id="letter_I">0.000000</value> +<value letter_id="letter_K">0.000000</value> +<value letter_id="letter_L">0.000000</value> +<value letter_id="letter_M">0.000000</value> +<value letter_id="letter_N">0.000000</value> +<value letter_id="letter_P">0.000000</value> +<value letter_id="letter_Q">0.000000</value> +<value letter_id="letter_R">0.000000</value> +<value letter_id="letter_S">0.000000</value> +<value letter_id="letter_T">0.040000</value> +<value letter_id="letter_V">0.000000</value> +<value letter_id="letter_W">0.000000</value> +<value letter_id="letter_Y">0.000000</value> +</alphabet_array> +</alphabet_matrix> +</probabilities> +<regular_expression> +[GA][GA][GC][GA]TATA[AT]AA +</regular_expression> +<contributing_sites> +<contributing_site sequence_id="sequence_24" position="12" strand="none" pvalue="1.06e-06" > +<left_flank>AAGGCCAGGA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCCTGAGAGC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_25" position="36" strand="none" pvalue="3.41e-06" > +<left_flank>ACAGGCCCTG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_19" position="9" strand="none" pvalue="3.41e-06" > +<left_flank>CAGGCCCTG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCCCCAGCAG</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_9" position="13" strand="none" pvalue="3.41e-06" > +<left_flank>GATTCACTGA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GGCCCTCTGC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_21" position="7" strand="none" pvalue="4.00e-06" > +<left_flank>CCAAGGA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCCCCACAAA</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_13" position="13" strand="none" pvalue="5.01e-06" > +<left_flank>CCACCAGCTT</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>AGCCCTGTAC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_23" position="15" strand="none" pvalue="6.06e-06" > +<left_flank>ATACCCAGGG</left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>CCTCAGCAGC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_15" position="21" strand="none" pvalue="8.67e-06" > +<left_flank>AATCACTGAG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GTCCCAGGGA</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_12" position="18" strand="none" pvalue="8.67e-06" > +<left_flank>CACCAGAGCT</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>AGAAGGTTCT</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_11" position="16" strand="none" pvalue="8.67e-06" > +<left_flank>CACTATTGAA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>TTTCATTTGC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_22" position="2" strand="none" pvalue="1.21e-05" > +<left_flank>GA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCCAACATCC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_28" position="32" strand="none" pvalue="1.59e-05" > +<left_flank>CCGGCGGGGC</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +</site> +<right_flank>GGGGCGG</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_20" position="4" strand="none" pvalue="1.59e-05" > +<left_flank>CAGA</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +</site> +<right_flank>GTTCCGACCA</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_6" position="15" strand="none" pvalue="1.68e-05" > +<left_flank>CCCACTACTT</left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>TCATTCTGAG</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_14" position="19" strand="none" pvalue="2.03e-05" > +<left_flank>CACCAGCAAG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GCTCAGGAGT</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_4" position="12" strand="none" pvalue="3.06e-05" > +<left_flank>CAGGTCTAAG</left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>CTTGGAGTCC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_0" position="39" strand="none" pvalue="3.06e-05" > +<left_flank>CCTCGGGACG</left_flank> +<site> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank></right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_18" position="37" strand="none" pvalue="3.82e-05" > +<left_flank>CGTGGTCGCG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_5" position="0" strand="none" pvalue="3.82e-05" > +<left_flank></left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>ATGGTCCTGT</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_29" position="30" strand="none" pvalue="4.02e-05" > +<left_flank>GCTGCCGGTG</left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +</site> +<right_flank>GCCCTGGCG</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_1" position="27" strand="none" pvalue="5.52e-05" > +<left_flank>AGTCACAAGT</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>GGGTCGCACG</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_3" position="14" strand="none" pvalue="5.94e-05" > +<left_flank>CCCAGGTTTC</left_flank> +<site> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>TCGCCGCACC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_16" position="22" strand="none" pvalue="6.78e-05" > +<left_flank>AGTTTCAGTT</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_C"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>ATTATATAAC</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_7" position="2" strand="none" pvalue="2.08e-04" > +<left_flank>TC</left_flank> +<site> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +</site> +<right_flank>AAATGTTCCT</right_flank> +</contributing_site> +<contributing_site sequence_id="sequence_8" position="13" strand="none" pvalue="4.05e-04" > +<left_flank>TATAACTCAG</left_flank> +<site> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_G"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_T"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +<letter_ref letter_id="letter_A"/> +</site> +<right_flank>TAATTTGTAC</right_flank> +</contributing_site> +</contributing_sites> +</motif> +</motifs> +<scanned_sites_summary p_thresh="0.0001"> +<scanned_sites sequence_id="sequence_0" pvalue="1.22e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="39" pvalue="3.06e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_1" pvalue="2.21e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="27" pvalue="5.52e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_2" pvalue="7.29e-01" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_3" pvalue="2.37e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="14" pvalue="5.94e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_4" pvalue="1.22e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="12" pvalue="3.06e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_5" pvalue="1.53e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="0" pvalue="3.82e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_6" pvalue="6.70e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="15" pvalue="1.68e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_7" pvalue="1.81e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="4" pvalue="4.54e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_8" pvalue="1.61e-02" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_9" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="13" pvalue="3.41e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_10" pvalue="1.99e-01" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_11" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="16" pvalue="8.67e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_12" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="18" pvalue="8.67e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_13" pvalue="2.01e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="13" pvalue="5.01e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_14" pvalue="8.11e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="19" pvalue="2.03e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_15" pvalue="3.47e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="21" pvalue="8.67e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_16" pvalue="2.71e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="22" pvalue="6.78e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_17" pvalue="8.23e-02" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_18" pvalue="1.53e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="37" pvalue="3.82e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_19" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="9" pvalue="3.41e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_20" pvalue="6.37e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="4" pvalue="1.59e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_21" pvalue="1.60e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="7" pvalue="4.00e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_22" pvalue="4.83e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="2" pvalue="1.21e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_23" pvalue="2.43e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="15" pvalue="6.06e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_24" pvalue="4.26e-05" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="12" pvalue="1.06e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_25" pvalue="1.36e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="36" pvalue="3.41e-06"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_26" pvalue="4.30e-02" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_27" pvalue="4.30e-02" num_sites="0"></scanned_sites> +<scanned_sites sequence_id="sequence_28" pvalue="6.37e-04" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="32" pvalue="1.59e-05"/> +</scanned_sites> +<scanned_sites sequence_id="sequence_29" pvalue="1.61e-03" num_sites="1"><scanned_site motif_id="motif_1" strand="none" position="30" pvalue="4.02e-05"/> +</scanned_sites> +</scanned_sites_summary> +</MEME> --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_input_1.fasta Tue Feb 01 11:20:02 2011 -0500 @@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG --- a/tool_conf.xml.sample Tue Feb 01 11:19:40 2011 -0500 +++ b/tool_conf.xml.sample Tue Feb 01 11:20:02 2011 -0500 @@ -197,6 +197,9 @@ <tool file="evolution/codingSnps.xml" /><tool file="evolution/add_scores.xml" /></section> + <section name="Motif Tools" id="motifs"> + <tool file="meme/meme.xml"/> + </section><section name="Metagenomic analyses" id="tax_manipulation"><tool file="taxonomy/gi2taxonomy.xml" /><tool file="taxonomy/t2t_report.xml" /> --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/meme/meme.xml Tue Feb 01 11:20:02 2011 -0500 @@ -0,0 +1,347 @@ +<tool id="meme_meme" name="MEME" version="1.0.0"> + <requirements><requirement type='package'>meme</requirement></requirements> + <description>- Multiple Em for Motif Elicitation</description> + <command>meme "$input1" -o "${html_outfile.files_path}" + -nostatus + + ##-p 8 ##number of processors + + #if str( $options_type.options_type_selector ) == 'advanced': + -sf "${ str( $options_type.sf ).replace( ' ', '_' ) }" + -${options_type.alphabet_type.alphabet_type_selector} + -mod "${options_type.mod_type.mod_type_selector}" + -nmotifs "${options_type.nmotifs}" + -wnsites "${options_type.wnsites}" + + #if $options_type.evt < float('inf'): + -evt "${options_type.evt}" + #end if + + #if str( $options_type.mod_type.mod_type_selector ) != 'oops': + #if str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'nsites': + -nsites "${options_type.mod_type.motif_occurrence_type.nsites}" + #elif str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'min_max_sites': + -minsites "${options_type.mod_type.motif_occurrence_type.minsites}" -maxsites "${options_type.mod_type.motif_occurrence_type.maxsites}" + #end if + #end if + + #if str( $options_type.motif_width_type.motif_width_type_selector ) == 'exact': + -w "${options_type.motif_width_type.width}" + #else + -minw "${options_type.motif_width_type.minw}" -maxw "${options_type.motif_width_type.maxw}" + #end if + + #if str( $options_type.motif_trim_type.motif_trim_type_selector ) == 'nomatrim': + -nomatrim + #else + -wg "${options_type.motif_trim_type.wg}" -ws "${options_type.motif_trim_type.ws}" ${options_type.motif_trim_type.noendgaps} + #end if + + #if str( $options_type.bfile ) != 'None': + -bfile "${options_type.bfile}" + #end if + + #if str( $options_type.pspfile ) != 'None': + -psp "${options_type.pspfile}" + #end if + + #if str( $options_type.alphabet_type.alphabet_type_selector ) == "dna": + ${options_type.alphabet_type.revcomp} ${options_type.alphabet_type.pal} + #end if + + -maxiter "${options_type.maxiter}" -distance "${options_type.distance}" + + -prior "${options_type.alphabet_type.prior_type.prior_type_selector}" + #if str( $options_type.alphabet_type.prior_type.prior_type_selector ) != 'addone': + -b "${options_type.alphabet_type.prior_type.prior_b}" + #if str( $options_type.alphabet_type.prior_type.plib ) != 'None': + -plib "${options_type.alphabet_type.prior_type.plib}" + #end if + #end if + + #if str( $options_type.alphabet_type.spmap_type.spmap_type_selector ) == 'cons': + -cons "${options_type.alphabet_type.spmap_type.cons}" + #else + -spmap "${options_type.alphabet_type.spmap_type.spmap_type_selector}" + -spfuzz "${options_type.alphabet_type.spmap_type.spfuzz}" + #end if + + #if str( $options_type.branching_type.branching_type_selector ) == 'x_branch': + -x_branch -bfactor "${options_type.branching_type.bfactor}" -heapsize "${options_type.branching_type.heapsize}" + #end if + + ##-maxsize "1000000" ##remove hardcoded maxsize? should increase number of processors instead + + #end if + + 2>&1 || echo "Error running MEME." + + + && mv ${html_outfile.files_path}/meme.html ${html_outfile} + + && mv ${html_outfile.files_path}/meme.txt ${txt_outfile} + + && mv ${html_outfile.files_path}/meme.xml ${xml_outfile} + + </command> + <inputs> + <param format="fasta" name="input1" type="data" label="Sequences"/> + + <conditional name="options_type"> + <param name="options_type_selector" type="select" label="Options Configuration"> + <option value="basic" selected="true">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> +  + </when> + <when value="advanced"> + + <param name="sf" type="text" value="Galaxy FASTA Input" label="Name of sequence set" /> + + <conditional name="alphabet_type"> + <param name="alphabet_type_selector" type="select" label="Sequence Alphabet"> + <option value="protein">Protein</option> + <option value="dna" selected="true">DNA</option> + </param> + <when value="protein"> + <conditional name="prior_type"> + <param name="prior_type_selector" type="select" label="Choice of prior"> + <option value="dirichlet">simple Dirichlet prior</option> + <option value="dmix" selected="true">mixture of Dirichlets prior</option> + <option value="mega">extremely low variance dmix</option> + <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option> + <option value="addone">add +1 to each observed count</option> + </param> + <when value="dirichlet"> + <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="dmix"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="mega"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="megap"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="addone"> +  + </when> + </conditional> + <conditional name="spmap_type"> + <param name="spmap_type_selector" type="select" label="EM starting points"> + <option value="uni">uni</option> + <option value="pam" selected="true">pam</option> + <option value="cons">Use starting point from string</option> + </param> + <when value="uni"> + <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" /> + </when> + <when value="pam"> + <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" /> + </when> + <when value="cons"> + <param name="cons" type="text" value="" label="Starting point from string" /> + </when> + </conditional> + </when> + <when value="dna"> + <param name="revcomp" label="Check reverse complement" type="boolean" truevalue="-revcomp" falsevalue="" checked="False"/> + <param name="pal" label="Check for palindromes" type="boolean" truevalue="-pal" falsevalue="" checked="False"/> + <conditional name="prior_type"> + <param name="prior_type_selector" type="select" label="Sequence Alphabet"> + <option value="dirichlet" selected="true">simple Dirichlet prior</option> + <option value="dmix">mixture of Dirichlets prior</option> + <option value="mega">extremely low variance dmix</option> + <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option> + <option value="addone">add +1 to each observed count</option> + </param> + <when value="dirichlet"> + <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="dmix"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="mega"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="megap"> + <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" /> + <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" /> + </when> + <when value="addone"> +  + </when> + </conditional> + <conditional name="spmap_type"> + <param name="spmap_type_selector" type="select" label="EM starting points"> + <option value="uni" selected="true">uni</option> + <option value="pam">pam</option> + <option value="cons">Use starting point from string</option> + </param> + <when value="uni"> + <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" /> + </when> + <when value="pam"> + <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" /> + </when> + <when value="cons"> + <param name="cons" type="text" value="" label="Starting point from string" /> + </when> + </conditional> + </when> + </conditional> + + <param name="nmotifs" type="integer" value="1" label="Number of different motifs to search" /> + <param name="evt" type="float" value="inf" label="E-value to stop looking for motifs" /> + <conditional name="mod_type"> + <param name="mod_type_selector" type="select" label="Expected motif distribution"> + <option value="oops">One Occurrence Per Sequence</option> + <option value="zoops" selected="true">Zero or One Occurrence Per Sequence</option> + <option value="anr">Any Number of Repetitions</option> + </param> + <when value="oops"> +  + </when> + <when value="zoops"> + <conditional name="motif_occurrence_type"> + <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences"> + <option value="default" selected="true">Use defaults</option> + <option value="nsites">nsites</option> + <option value="min_max_sites">min and max sites</option> + </param> + <when value="default"> +  + </when> + <when value="nsites"> + <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" /> + </when> + <when value="min_max_sites"> + <param name="minsites" type="integer" value="1" label="minsites" /> + <param name="maxsites" type="integer" value="50" label="maxsites" /> + </when> + </conditional> + </when> + <when value="anr"> + <conditional name="motif_occurrence_type"> + <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences"> + <option value="default" selected="true">Use defaults</option> + <option value="nsites">nsites</option> + <option value="min_max_sites">min and max sites</option> + </param> + <when value="default"> +  + </when> + <when value="nsites"> + <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" /> + </when> + <when value="min_max_sites"> + <param name="minsites" type="integer" value="1" label="minsites" /> + <param name="maxsites" type="integer" value="50" label="maxsites" /> + </when> + </conditional> + </when> + </conditional> + <param name="wnsites" type="float" value="0.8" label="Weight on the prior on nsites" /> + + <conditional name="motif_width_type"> + <param name="motif_width_type_selector" type="select" label="Motif width type"> + <option value="exact">Exact width</option> + <option value="range" selected="true">Specify a range</option> + </param> + <when value="exact"> + <param name="width" type="integer" value="10" label="Width of motif to search" /> + </when> + <when value="range"> + <param name="minw" type="integer" value="8" label="Min width of motif to search" /> + <param name="maxw" type="integer" value="50" label="Max width of motif to search" /> + </when> + </conditional> + + <conditional name="motif_trim_type"> + <param name="motif_trim_type_selector" type="select" label="Motif trim type"> + <option value="nomatrim">No motif trim</option> + <option value="trim" selected="true">Trim motif</option> + </param> + <when value="nomatrim"> +  + </when> + <when value="trim"> + <param name="wg" type="integer" value="11" label="Gap cost" /> + <param name="ws" type="integer" value="1" label="Space cost" /> + <param name="noendgaps" label="Do not penalize endgaps" type="boolean" truevalue="-noendgaps" falsevalue="" checked="False"/> + </when> + </conditional> + + <param name="bfile" type="data" format="txt" optional="True" label="Background Model" /> + <param name="pspfile" type="data" format="txt" optional="True" label="Position-Specific Prior" /> + + <param name="maxiter" type="integer" value="50" label="Number of iterations of EM to run" /> + <param name="distance" type="float" value="0.001" label="Convergence criterion" /> + + <conditional name="branching_type"> + <param name="branching_type_selector" type="select" label="x-branching type"> + <option value="x_branch">Perform x-branching</option> + <option value="no_x_branch" selected="true">No x-branching</option> + </param> + <when value="no_x_branch"> +  + </when> + <when value="x_branch"> + <param name="bfactor" type="integer" value="3" label="Number of iterations of branching" /> + <param name="heapsize" type="integer" value="64" label="Maximum number of heaps to use" /> + </when> + </conditional> + + </when> + </conditional> + + <param name="non_commercial_use" label="I certify that I am not using this tool for commercial purposes." type="boolean" truevalue="NON_COMMERCIAL_USE" falsevalue="COMMERCIAL_USE" checked="False"> + <validator type="expression" message="This tool is only available for non-commercial use.">value == True</validator> + </param> + + </inputs> + <outputs> + <data format="html" name="html_outfile" label="${tool.name} on ${on_string} (html)"/> + <data format="txt" name="txt_outfile" label="${tool.name} on ${on_string} (text)"/> + <data format="memexml" name="xml_outfile" label="${tool.name} on ${on_string} (xml)"/> + </outputs> + <tests> + <test> + <param name="input1" value="meme_input_1.fasta" ftype="fasta" dbkey="hg19"/> + <param name="options_type_selector" value="basic"/> + <param name="non_commercial_use" value="True"/> + <output name="html_outfile" file="meme/meme/meme_output_html_1.html" lines_diff="14"/> + <output name="txt_outfile" file="meme/meme/meme_output_txt_1.txt" lines_diff="12"/> + <output name="xml_outfile" file="meme/meme/meme_output_xml_1.xml" lines_diff="8"/> + </test> + </tests> + <help> + +.. class:: warningmark + +**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted. Before using, be sure to review, agree, and comply with the license.** + +If you want to specify sequence weights, you must include them at the top of your input FASTA file. + +.. class:: infomark + +**To cite MEME:** +Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994. + + +For detailed information on MEME, click here_. To view the license_. + +.. _here: http://meme.nbcr.net/meme/meme-intro.html +.. _license: http://meme.nbcr.net/meme/COPYRIGHT.html + + </help> +</tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Add MEME tool configuration file.
by Bitbucket 01 Feb '11

01 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/8c81782aa093/ changeset: r4966:8c81782aa093 user: dan date: 2011-02-01 17:17:44 summary: Add MEME tool configuration file. affected #: 8 files (722 bytes) Diff too large to display. Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0