February 2011 - galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: rc: Backed out of changeset 5085:0ce482e2ec78
by Bitbucket 18 Feb '11

18 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/0320a5b0d1a7/ changeset: r5086:0320a5b0d1a7 user: rc date: 2011-02-18 17:18:52 summary: Backed out of changeset 5085:0ce482e2ec78 affected #: 1 file (244 bytes) --- a/lib/galaxy/web/controllers/requests_common.py Fri Feb 18 10:49:46 2011 -0500 +++ b/lib/galaxy/web/controllers/requests_common.py Fri Feb 18 11:18:52 2011 -0500 @@ -445,7 +445,6 @@ kwd[ 'message' ] = message handle_error( **kwd ) if params.get( 'save_samples_button', False ): - samples = [] if encoded_selected_sample_ids: # We need the list of displayable_sample_widgets to include the same number # of objects that that request.samples has so that we can enumerate over each @@ -453,6 +452,7 @@ # used the multi-select check boxes when editing sample widgets, but didn't # select all of them. We'll first get the set of samples corresponding to the # checked sample ids. + samples = [] selected_samples = [] for encoded_sample_id in encoded_selected_sample_ids: sample = trans.sa_session.query( trans.model.Sample ).get( trans.security.decode_id( encoded_sample_id ) ) @@ -467,7 +467,7 @@ sample_widgets = self.__get_sample_widgets( trans, request, samples, **kwd ) else: sample_widgets = displayable_sample_widgets - return self.__save_samples( trans, cntrller, request, samples, sample_widgets, saving_new_samples=False, **kwd ) + return self.__save_samples( trans, cntrller, request, sample_widgets, saving_new_samples=False, **kwd ) request_widgets = self.__get_request_widgets( trans, request.id ) sample_copy_select_field = self.__build_copy_sample_select_field( trans, displayable_sample_widgets ) libraries_select_field, folders_select_field = self.__build_library_and_folder_select_fields( trans, @@ -806,8 +806,7 @@ elif params.get( 'add_sample_button', False ): return self.add_sample( trans, cntrller, request_id, **kwd ) elif params.get( 'save_samples_button', False ): - samples = [] - return self.__save_samples( trans, cntrller, request, samples, displayable_sample_widgets, saving_new_samples=True, **kwd ) + return self.__save_samples( trans, cntrller, request, displayable_sample_widgets, saving_new_samples=True, **kwd ) request_widgets = self.__get_request_widgets( trans, request.id ) sample_copy_select_field = self.__build_copy_sample_select_field( trans, displayable_sample_widgets ) libraries_select_field, folders_select_field = self.__build_library_and_folder_select_fields( trans, @@ -1084,7 +1083,7 @@ request_widgets=request_widgets, displayable_sample_widgets=displayable_sample_widgets, sample_copy_select_field=sample_copy_select_field ) - def __save_samples( self, trans, cntrller, request, samples, sample_widgets, saving_new_samples=False, **kwd ): + def __save_samples( self, trans, cntrller, request, samples, saving_new_samples=False, **kwd ): # Here we handle saving all new samples added by the user as well as saving # changes to any subset of the request's samples. A sample will not have an # associated SampleState until the request is submitted, at which time the @@ -1100,7 +1099,7 @@ else: redirect_action = 'edit_samples' # Check for duplicate sample names within the request - self.__validate_sample_names( trans, cntrller, request, sample_widgets, **kwd ) + self.__validate_sample_names( trans, cntrller, request, samples, **kwd ) if not saving_new_samples: library = None folder = None @@ -1129,16 +1128,17 @@ # TODO: make changes necessary to just send the samples... encoded_selected_sample_ids = self.__get_encoded_selected_sample_ids( trans, request, **kwd ) # Make sure all samples have a unique bar_code if the state is changing - for sample_index, sample in enumerate( samples ): - if sample is None: + for sample_index in range( len( samples ) ): + current_sample = samples[ sample_index ] + if current_sample is None: # We have a None value because the user did not select this sample # on which to perform the action. continue - current_sample = sample_widgets[ sample_index ] + request_sample = request.samples[ sample_index ] bar_code = current_sample[ 'bar_code' ] if bar_code: # If the sample has a new bar_code, make sure it is unique. - bc_message = self.__validate_bar_code( trans, sample, bar_code ) + bc_message = self.__validate_bar_code( trans, request_sample, bar_code ) if bc_message: message += bc_message kwd[ 'message' ] = message @@ -1153,15 +1153,11 @@ library_id = params.get( 'sample_operation_library_id', 'none' ) folder_id = params.get( 'sample_operation_folder_id', 'none' ) library, folder = self.__get_library_and_folder( trans, library_id, folder_id ) - for sample_index, sample in enumerate( samples ): - if sample is None: - # We have a None value because the user did not select this sample - # on which to perform the action. - continue - current_sample = sample_widgets[ sample_index ] + for sample_index in range( len( samples ) ): + current_sample = samples[ sample_index ] current_sample[ 'library' ] = library current_sample[ 'folder' ] = folder - self.__update_samples( trans, cntrller, request, sample_widgets, **kwd ) + self.__update_samples( trans, cntrller, request, samples, **kwd ) message = 'Changes made to the samples have been saved. ' else: # Saving a newly created sample. The sample will not have an associated SampleState @@ -1169,9 +1165,9 @@ # set to the first SampleState configured for the request's RequestType configured # by the admin ( i.e., the sample's SampleState would be set to request.type.states[0] ). new_samples = [] - for index in range( len( sample_widgets ) - len( request.samples ) ): + for index in range( len( samples ) - len( request.samples ) ): sample_index = len( request.samples ) - sample_widget = sample_widgets[ sample_index ] + sample_widget = samples[ sample_index ] form_values = trans.model.FormValues( request.type.sample_form, sample_widget[ 'field_values' ] ) trans.sa_session.add( form_values ) trans.sa_session.flush() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: rc: bug fix: bulk operations on samples for changing target data libraries was broken
by Bitbucket 18 Feb '11

18 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/0ce482e2ec78/ changeset: r5085:0ce482e2ec78 user: rc date: 2011-02-18 16:49:46 summary: bug fix: bulk operations on samples for changing target data libraries was broken affected #: 1 file (244 bytes) --- a/lib/galaxy/web/controllers/requests_common.py Fri Feb 18 10:42:13 2011 -0500 +++ b/lib/galaxy/web/controllers/requests_common.py Fri Feb 18 10:49:46 2011 -0500 @@ -445,6 +445,7 @@ kwd[ 'message' ] = message handle_error( **kwd ) if params.get( 'save_samples_button', False ): + samples = [] if encoded_selected_sample_ids: # We need the list of displayable_sample_widgets to include the same number # of objects that that request.samples has so that we can enumerate over each @@ -452,7 +453,6 @@ # used the multi-select check boxes when editing sample widgets, but didn't # select all of them. We'll first get the set of samples corresponding to the # checked sample ids. - samples = [] selected_samples = [] for encoded_sample_id in encoded_selected_sample_ids: sample = trans.sa_session.query( trans.model.Sample ).get( trans.security.decode_id( encoded_sample_id ) ) @@ -467,7 +467,7 @@ sample_widgets = self.__get_sample_widgets( trans, request, samples, **kwd ) else: sample_widgets = displayable_sample_widgets - return self.__save_samples( trans, cntrller, request, sample_widgets, saving_new_samples=False, **kwd ) + return self.__save_samples( trans, cntrller, request, samples, sample_widgets, saving_new_samples=False, **kwd ) request_widgets = self.__get_request_widgets( trans, request.id ) sample_copy_select_field = self.__build_copy_sample_select_field( trans, displayable_sample_widgets ) libraries_select_field, folders_select_field = self.__build_library_and_folder_select_fields( trans, @@ -806,7 +806,8 @@ elif params.get( 'add_sample_button', False ): return self.add_sample( trans, cntrller, request_id, **kwd ) elif params.get( 'save_samples_button', False ): - return self.__save_samples( trans, cntrller, request, displayable_sample_widgets, saving_new_samples=True, **kwd ) + samples = [] + return self.__save_samples( trans, cntrller, request, samples, displayable_sample_widgets, saving_new_samples=True, **kwd ) request_widgets = self.__get_request_widgets( trans, request.id ) sample_copy_select_field = self.__build_copy_sample_select_field( trans, displayable_sample_widgets ) libraries_select_field, folders_select_field = self.__build_library_and_folder_select_fields( trans, @@ -1083,7 +1084,7 @@ request_widgets=request_widgets, displayable_sample_widgets=displayable_sample_widgets, sample_copy_select_field=sample_copy_select_field ) - def __save_samples( self, trans, cntrller, request, samples, saving_new_samples=False, **kwd ): + def __save_samples( self, trans, cntrller, request, samples, sample_widgets, saving_new_samples=False, **kwd ): # Here we handle saving all new samples added by the user as well as saving # changes to any subset of the request's samples. A sample will not have an # associated SampleState until the request is submitted, at which time the @@ -1099,7 +1100,7 @@ else: redirect_action = 'edit_samples' # Check for duplicate sample names within the request - self.__validate_sample_names( trans, cntrller, request, samples, **kwd ) + self.__validate_sample_names( trans, cntrller, request, sample_widgets, **kwd ) if not saving_new_samples: library = None folder = None @@ -1128,17 +1129,16 @@ # TODO: make changes necessary to just send the samples... encoded_selected_sample_ids = self.__get_encoded_selected_sample_ids( trans, request, **kwd ) # Make sure all samples have a unique bar_code if the state is changing - for sample_index in range( len( samples ) ): - current_sample = samples[ sample_index ] - if current_sample is None: + for sample_index, sample in enumerate( samples ): + if sample is None: # We have a None value because the user did not select this sample # on which to perform the action. continue - request_sample = request.samples[ sample_index ] + current_sample = sample_widgets[ sample_index ] bar_code = current_sample[ 'bar_code' ] if bar_code: # If the sample has a new bar_code, make sure it is unique. - bc_message = self.__validate_bar_code( trans, request_sample, bar_code ) + bc_message = self.__validate_bar_code( trans, sample, bar_code ) if bc_message: message += bc_message kwd[ 'message' ] = message @@ -1153,11 +1153,15 @@ library_id = params.get( 'sample_operation_library_id', 'none' ) folder_id = params.get( 'sample_operation_folder_id', 'none' ) library, folder = self.__get_library_and_folder( trans, library_id, folder_id ) - for sample_index in range( len( samples ) ): - current_sample = samples[ sample_index ] + for sample_index, sample in enumerate( samples ): + if sample is None: + # We have a None value because the user did not select this sample + # on which to perform the action. + continue + current_sample = sample_widgets[ sample_index ] current_sample[ 'library' ] = library current_sample[ 'folder' ] = folder - self.__update_samples( trans, cntrller, request, samples, **kwd ) + self.__update_samples( trans, cntrller, request, sample_widgets, **kwd ) message = 'Changes made to the samples have been saved. ' else: # Saving a newly created sample. The sample will not have an associated SampleState @@ -1165,9 +1169,9 @@ # set to the first SampleState configured for the request's RequestType configured # by the admin ( i.e., the sample's SampleState would be set to request.type.states[0] ). new_samples = [] - for index in range( len( samples ) - len( request.samples ) ): + for index in range( len( sample_widgets ) - len( request.samples ) ): sample_index = len( request.samples ) - sample_widget = samples[ sample_index ] + sample_widget = sample_widgets[ sample_index ] form_values = trans.model.FormValues( request.type.sample_form, sample_widget[ 'field_values' ] ) trans.sa_session.add( form_values ) trans.sa_session.flush() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Fix typo in Intersect tool description.
by Bitbucket 18 Feb '11

18 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/e7bc439ef1dd/ changeset: r5084:e7bc439ef1dd user: dan date: 2011-02-18 16:42:13 summary: Fix typo in Intersect tool description. affected #: 1 file (0 bytes) --- a/tools/new_operations/intersect.xml Thu Feb 17 17:21:54 2011 -0500 +++ b/tools/new_operations/intersect.xml Fri Feb 18 10:42:13 2011 -0500 @@ -1,5 +1,5 @@ <tool id="gops_intersect_1" name="Intersect"> - <description>the intervals of two datastes</description> + <description>the intervals of two datasets</description><command interpreter="python">gops_intersect.py $input1 $input2 $output Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: kanwei: Update pysam egg to 0.4.1
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/5fa0593cd83c/ changeset: r5083:5fa0593cd83c user: kanwei date: 2011-02-17 23:21:54 summary: Update pysam egg to 0.4.1 affected #: 1 file (0 bytes) --- a/eggs.ini Thu Feb 17 15:35:07 2011 -0500 +++ b/eggs.ini Thu Feb 17 17:21:54 2011 -0500 @@ -21,7 +21,7 @@ pbs_python = 4.1.0 psycopg2 = 2.0.13 pycrypto = 2.0.1 -pysam = 0.1.1 +pysam = 0.4.1 pysqlite = 2.5.6 python_lzo = 1.08_2.03_static simplejson = 2.1.1 @@ -69,7 +69,7 @@ bx_python = _14b6a6c95da6 GeneTrack = _dev_48da9e998f0caf01c5be731e926f4b0481f658f0 SQLAlchemy = _dev_r6498 -pysam = _kanwei_90e03180969d +pysam = _kanwei_a92c29d5cdec ; dependency source urls, necessary for scrambling. for an explanation, see ; the wiki page above Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: kanwei: Add a "format_source" attribute to the ToolConfig output data element [JJ Johnson]. Closes #470
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/a86e1fa82a89/ changeset: r5082:a86e1fa82a89 user: kanwei date: 2011-02-17 21:35:07 summary: Add a "format_source" attribute to the ToolConfig output data element [JJ Johnson]. Closes #470 affected #: 2 files (426 bytes) --- a/lib/galaxy/tools/__init__.py Thu Feb 17 14:48:53 2011 -0500 +++ b/lib/galaxy/tools/__init__.py Thu Feb 17 15:35:07 2011 -0500 @@ -249,10 +249,11 @@ (format, metadata_source, parent) """ - def __init__( self, name, format=None, metadata_source=None, + def __init__( self, name, format=None, format_source=None, metadata_source=None, parent=None, label=None, filters = None, actions = None ): self.name = name self.format = format + self.format_source = format_source self.metadata_source = metadata_source self.parent = parent self.label = label @@ -559,6 +560,7 @@ output = ToolOutput( data_elem.get("name") ) output.format = data_elem.get("format", "data") output.change_format = data_elem.findall("change_format") + output.format_source = data_elem.get("format_source", None) output.metadata_source = data_elem.get("metadata_source", "") output.parent = data_elem.get("parent", None) output.label = util.xml_text( data_elem, "label" ) --- a/lib/galaxy/tools/actions/__init__.py Thu Feb 17 14:48:53 2011 -0500 +++ b/lib/galaxy/tools/actions/__init__.py Thu Feb 17 15:35:07 2011 -0500 @@ -244,6 +244,12 @@ ext = output.format if ext == "input": ext = input_ext + if output.format_source is not None and output.format_source in inp_data: + try: + ext = inp_data[output.format_source].ext + except Exception, e: + pass + #process change_format tags if output.change_format: if params is None: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 17 Feb '11

17 Feb '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/bdcc4ca64eee/ changeset: r5080:bdcc4ca64eee user: kellyv date: 2011-02-17 19:46:40 summary: Fixed BFAST functional tests (corrected problem with chromosome names in test files) affected #: 4 files (4.4 KB) --- a/test-data/bfast_out1.sam Thu Feb 17 12:05:39 2011 -0500 +++ b/test-data/bfast_out1.sam Thu Feb 17 13:46:40 2011 -0500 @@ -1,23 +1,23 @@ @HD VN:0.1.2 SO:unsorted GO:none -@SQ SN:phiX LN:5386 +@SQ SN:phiX174 LN:5386 @PG ID:bfast VN:0.6.4d -random_phiX_region_0 0 phiX 553 255 50M * 0 0 TTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_1 0 phiX 3693 255 50M * 0 0 GTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_2 0 phiX 375 255 50M * 0 0 AATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_3 0 phiX 3168 255 50M * 0 0 GGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_4 0 phiX 5254 255 50M * 0 0 ACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGAC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_5 0 phiX 5066 255 50M * 0 0 AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_6 0 phiX 1226 255 50M * 0 0 CACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_7 0 phiX 1096 255 50M * 0 0 AACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_8 0 phiX 535 255 50M * 0 0 CTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_9 0 phiX 3669 255 50M * 0 0 CAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_10 0 phiX 4887 255 50M * 0 0 TACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_11 0 phiX 1849 255 50M * 0 0 TATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_12 0 phiX 4145 255 50M * 0 0 AGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_13 0 phiX 1853 255 50M * 0 0 TTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_14 0 phiX 2800 255 50M * 0 0 CCGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_15 0 phiX 1910 255 50M * 0 0 AACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_16 0 phiX 3366 255 50M * 0 0 GCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_17 0 phiX 2165 255 50M * 0 0 CATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_18 0 phiX 2051 255 50M * 0 0 TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 -random_phiX_region_19 0 phiX 5099 255 50M * 0 0 GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_0 0 phiX174 553 255 50M * 0 0 TTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_1 0 phiX174 3693 255 50M * 0 0 GTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_2 0 phiX174 375 255 50M * 0 0 AATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_3 0 phiX174 3168 255 50M * 0 0 GGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_4 0 phiX174 5254 255 50M * 0 0 ACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGAC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_5 0 phiX174 5066 255 50M * 0 0 AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_6 0 phiX174 1226 255 50M * 0 0 CACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_7 0 phiX174 1096 255 50M * 0 0 AACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_8 0 phiX174 535 255 50M * 0 0 CTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_9 0 phiX174 3669 255 50M * 0 0 CAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_10 0 phiX174 4887 255 50M * 0 0 TACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_11 0 phiX174 1849 255 50M * 0 0 TATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_12 0 phiX174 4145 255 50M * 0 0 AGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_13 0 phiX174 1853 255 50M * 0 0 TTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_14 0 phiX174 2800 255 50M * 0 0 CCGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2300 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:11T38 XA:i:0 +random_phiX_region_15 0 phiX174 1910 255 50M * 0 0 AACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_16 0 phiX174 3366 255 50M * 0 0 GCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_17 0 phiX174 2165 255 50M * 0 0 CATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_18 0 phiX174 2051 255 50M * 0 0 TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_19 0 phiX174 5099 255 50M * 0 0 GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 --- a/test-data/bfast_out2.sam Thu Feb 17 12:05:39 2011 -0500 +++ b/test-data/bfast_out2.sam Thu Feb 17 13:46:40 2011 -0500 @@ -1,23 +1,23 @@ @HD VN:0.1.2 SO:unsorted GO:none -@SQ SN:phiX LN:5386 +@SQ SN:phiX174 LN:5386 @PG ID:bfast VN:0.6.4d -random_phiX_region_0 0 phiX 553 255 50M * 0 0 TTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G10122032013310033101313321021200111002331002233200 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_1 0 phiX 3693 255 50M * 0 0 GTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G01032113212201012120321021321231001331220321233013 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_2 0 phiX 375 255 50M * 0 0 AATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20332013022003213122121021031212011032031313100201 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_3 0 phiX 3168 255 50M * 0 0 GGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G00130020212022012020131310131203210311202213031002 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_4 0 phiX 5254 255 50M * 0 0 ACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGAC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G21331000022222231222301220321002000210312113230321 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_5 0 phiX 5066 255 50M * 0 0 AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G22323002203102011012211230000101023211233231202001 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_6 0 phiX 1226 255 50M * 0 0 CACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31131003310112011211023030210213120202310111030313 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_7 0 phiX 1096 255 50M * 0 0 AACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCG """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20123122030103323321033212202023222310213303101033 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_8 0 phiX 535 255 50M * 0 0 CTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G32231132231233213310122032013310033101313321021200 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_9 0 phiX 3669 255 50M * 0 0 CAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31003210022003121223310201032113212201012120321021 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_10 0 phiX 4887 255 50M * 0 0 TACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G13112133130013233121023323111331202133200002113102 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_11 0 phiX 1849 255 50M * 0 0 TATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G13311003122201333201102310002033023121332123002222 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_12 0 phiX 4145 255 50M * 0 0 AGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G22222302211220002313313120033101221023233031011233 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_13 0 phiX 1853 255 50M * 0 0 TTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G10031222013332011023100020330231213321230022223021 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_14 0 phiX 2800 255 50M * 0 0 CCGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G30300310330131003311010100213101001012230120031033 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_15 0 phiX 1910 255 50M * 0 0 AACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20133230020113200121203331032333013210332100211000 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_16 0 phiX 3366 255 50M * 0 0 GCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G03030230012220321000022232031230003131012102110321 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_17 0 phiX 2165 255 50M * 0 0 CATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAG """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31312303312101211100201212031021210110131211020332 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_18 0 phiX 2051 255 50M * 0 0 TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G11013323103313330202313311002220213203321102022012 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- -random_phiX_region_19 0 phiX 5099 255 50M * 0 0 GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G03211233231202001022023211021220321220312230331012 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_0 0 phiX174 553 255 50M * 0 0 TTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G10122032013310033101313321021200111002331002233200 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_1 0 phiX174 3693 255 50M * 0 0 GTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G01032113212201012120321021321231001331220321233013 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_2 0 phiX174 375 255 50M * 0 0 AATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20332013022003213122121021031212011032031313100201 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_3 0 phiX174 3168 255 50M * 0 0 GGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G00130020212022012020131310131203210311202213031002 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_4 0 phiX174 5254 255 50M * 0 0 ACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGAC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G21331000022222231222301220321002000210312113230321 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_5 0 phiX174 5066 255 50M * 0 0 AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G22323002203102011012211230000101023211233231202001 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_6 0 phiX174 1226 255 50M * 0 0 CACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31131003310112011211023030210213120202310111030313 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_7 0 phiX174 1096 255 50M * 0 0 AACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCG """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20123122030103323321033212202023222310213303101033 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_8 0 phiX174 535 255 50M * 0 0 CTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G32231132231233213310122032013310033101313321021200 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_9 0 phiX174 3669 255 50M * 0 0 CAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31003210022003121223310201032113212201012120321021 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_10 0 phiX174 4887 255 50M * 0 0 TACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G13112133130013233121023323111331202133200002113102 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_11 0 phiX174 1849 255 50M * 0 0 TATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G13311003122201333201102310002033023121332123002222 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_12 0 phiX174 4145 255 50M * 0 0 AGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G22222302211220002313313120033101221023233031011233 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_13 0 phiX174 1853 255 50M * 0 0 TTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G10031222013332011023100020330231213321230022223021 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_14 0 phiX174 2800 255 50M * 0 0 CCGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGC """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2300 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:11T38 CS:Z:G30300310330131003311010100213101001012230120031033 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_15 0 phiX174 1910 255 50M * 0 0 AACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G20133230020113200121203331032333013210332100211000 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_16 0 phiX174 3366 255 50M * 0 0 GCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G03030230012220321000022232031230003131012102110321 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_17 0 phiX174 2165 255 50M * 0 0 CATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAG """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G31312303312101211100201212031021210110131211020332 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_18 0 phiX174 2051 255 50M * 0 0 TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G11013323103313330202313311002220213203321102022012 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- +random_phiX_region_19 0 phiX174 5099 255 50M * 0 0 GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACT """""""""""""""""""""""""""""""""""""""""""""""""` PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 CS:Z:G03211233231202001022023211021220321220312230331012 CQ:Z:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ CM:i:0 XA:i:0 XE:Z:-------------------------------------------------- --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bfast_out3.sam Thu Feb 17 13:46:40 2011 -0500 @@ -0,0 +1,23 @@ +@HD VN:0.1.2 SO:unsorted GO:none +@SQ SN:phiX LN:5386 +@PG ID:bfast VN:0.6.4d +random_phiX_region_0 0 phiX 553 255 50M * 0 0 TTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_1 0 phiX 3693 255 50M * 0 0 GTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_2 0 phiX 375 255 50M * 0 0 AATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_3 0 phiX 3168 255 50M * 0 0 GGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_4 0 phiX 5254 255 50M * 0 0 ACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGAC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_5 0 phiX 5066 255 50M * 0 0 AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_6 0 phiX 1226 255 50M * 0 0 CACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_7 0 phiX 1096 255 50M * 0 0 AACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_8 0 phiX 535 255 50M * 0 0 CTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_9 0 phiX 3669 255 50M * 0 0 CAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_10 0 phiX 4887 255 50M * 0 0 TACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_11 0 phiX 1849 255 50M * 0 0 TATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_12 0 phiX 4145 255 50M * 0 0 AGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_13 0 phiX 1853 255 50M * 0 0 TTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_14 0 phiX 2800 255 50M * 0 0 CCGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGC ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2300 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:11T38 XA:i:0 +random_phiX_region_15 0 phiX 1910 255 50M * 0 0 AACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_16 0 phiX 3366 255 50M * 0 0 GCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_17 0 phiX 2165 255 50M * 0 0 CATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAG ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_18 0 phiX 2051 255 50M * 0 0 TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 +random_phiX_region_19 0 phiX 5099 255 50M * 0 0 GCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACT ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ PG:Z:bfast AS:i:2500 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:50 XA:i:0 --- a/tools/sr_mapping/bfast_wrapper.xml Thu Feb 17 12:05:39 2011 -0500 +++ b/tools/sr_mapping/bfast_wrapper.xml Thu Feb 17 13:46:40 2011 -0500 @@ -370,7 +370,7 @@ <param name="suppressHeader" value="False" /><param name="indexing_repeatmasker" value="" /><param name="indexing_option_selector" value="default" /> - <output name="output" ftype="sam" file="bfast_out1.sam" lines_diff="2" /> + <output name="output" ftype="sam" file="bfast_out3.sam" lines_diff="2" /></test></tests></tool> http://bitbucket.org/galaxy/galaxy-central/changeset/885f04ae671e/ changeset: r5081:885f04ae671e user: kellyv date: 2011-02-17 20:48:53 summary: merge affected #: 0 files (0 bytes) --- a/templates/library/common/ldda_info.mako Thu Feb 17 13:46:40 2011 -0500 +++ b/templates/library/common/ldda_info.mako Thu Feb 17 14:48:53 2011 -0500 @@ -117,14 +117,14 @@ </div> %if ldda.creating_job_associations: <% job = ldda.creating_job_associations[0].job %> - %if job.stdout.strip() != '': + %if job.stdout and job.stdout.strip() != '': <div class="form-row"><label>Job Standard Output</label><pre>${job.stdout}</pre><div style="clear: both"></div></div> %endif - %if job.stderr.strip() != '': + %if job.stderr and job.stderr.strip() != '': <div class="form-row"><label>Job Standard Error</label><pre>${job.stderr}</pre> --- a/tools/ngs_rna/cuffdiff_wrapper.xml Thu Feb 17 13:46:40 2011 -0500 +++ b/tools/ngs_rna/cuffdiff_wrapper.xml Thu Feb 17 14:48:53 2011 -0500 @@ -90,7 +90,7 @@ <param name="fdr" type="float" value="0.05" label="False Discovery Rate" help="The allowed false discovery rate."/><param name="min_mapqual" type="integer" value="0" label="Min SAM Mapping Quality" help="Instructs Cufflinks to ignore alignments with a SAM mapping quality lower than this number."/> - <param name="min_alignment_count" type="integer" value="0" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/> + <param name="min_alignment_count" type="integer" value="1000" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/><param name="do_normalization" type="select" label="Perform quartile normalization" help="Removes top 25% of genes from FPKM denominator to improve accuracy of differential expression calls for low abundance transcripts."><option value="No">No</option><option value="Yes">Yes</option> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Set default value for Cuffdiff's minimum alignment count parameter to reflect v0.9.3
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/144e064fa5c5/ changeset: r5079:144e064fa5c5 user: jgoecks date: 2011-02-17 20:25:56 summary: Set default value for Cuffdiff's minimum alignment count parameter to reflect v0.9.3 affected #: 1 file (3 bytes) --- a/tools/ngs_rna/cuffdiff_wrapper.xml Thu Feb 17 13:57:38 2011 -0500 +++ b/tools/ngs_rna/cuffdiff_wrapper.xml Thu Feb 17 14:25:56 2011 -0500 @@ -90,7 +90,7 @@ <param name="fdr" type="float" value="0.05" label="False Discovery Rate" help="The allowed false discovery rate."/><param name="min_mapqual" type="integer" value="0" label="Min SAM Mapping Quality" help="Instructs Cufflinks to ignore alignments with a SAM mapping quality lower than this number."/> - <param name="min_alignment_count" type="integer" value="0" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/> + <param name="min_alignment_count" type="integer" value="1000" label="Min Alignment Count" help="The minimum number of alignments in a locus for needed to conduct significance testing on changes in that locus observed between samples."/><param name="do_normalization" type="select" label="Perform quartile normalization" help="Removes top 25% of genes from FPKM denominator to improve accuracy of differential expression calls for low abundance transcripts."><option value="No">No</option><option value="Yes">Yes</option> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Fix displaying the stdout/stderr of a library upload when the stdout/stderr is None
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/d83fa80e8321/ changeset: r5078:d83fa80e8321 user: natefoo date: 2011-02-17 19:57:38 summary: Fix displaying the stdout/stderr of a library upload when the stdout/stderr is None affected #: 1 file (30 bytes) --- a/templates/library/common/ldda_info.mako Thu Feb 17 12:05:39 2011 -0500 +++ b/templates/library/common/ldda_info.mako Thu Feb 17 13:57:38 2011 -0500 @@ -117,14 +117,14 @@ </div> %if ldda.creating_job_associations: <% job = ldda.creating_job_associations[0].job %> - %if job.stdout.strip() != '': + %if job.stdout and job.stdout.strip() != '': <div class="form-row"><label>Job Standard Output</label><pre>${job.stdout}</pre><div style="clear: both"></div></div> %endif - %if job.stderr.strip() != '': + %if job.stderr and job.stderr.strip() != '': <div class="form-row"><label>Job Standard Error</label><pre>${job.stderr}</pre> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dannon: Adjustment to dataset line estimation.
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/2a3b27d59bd3/ changeset: r5077:2a3b27d59bd3 user: dannon date: 2011-02-17 18:05:39 summary: Adjustment to dataset line estimation. Estimate is now rounded to only the first two digits, like: ~65,000 lines, to make it clearer that it's an estimate. Will no longer try to estimate for small files, however they ended up without lines set. affected #: 3 files (757 bytes) --- a/lib/galaxy/datatypes/data.py Thu Feb 17 08:45:09 2011 -0500 +++ b/lib/galaxy/datatypes/data.py Thu Feb 17 12:05:39 2011 -0500 @@ -388,7 +388,23 @@ return 'text/plain' def set_meta( self, dataset, **kwd ): """ - Set the number of lines of data in dataset, + Set the number of lines of data in dataset. + """ + dataset.metadata.data_lines = self.count_data_lines(dataset) + def estimate_file_lines( self, dataset ): + """ + Perform a rough estimate by extrapolating number of lines from a small read. + """ + sample_size = 1048576 + dataset_fh = open( dataset.file_name ) + dataset_read = dataset_fh.read(sample_size) + dataset_fh.close() + sample_lines = dataset_read.count('\n') + est_lines = int(sample_lines * (float(dataset.get_size()) / float(sample_size))) + return est_lines + def count_data_lines(self, dataset): + """ + Count the number of lines of data in dataset, skipping all blank lines and comments. """ data_lines = 0 @@ -396,16 +412,7 @@ line = line.strip() if line and not line.startswith( '#' ): data_lines += 1 - dataset.metadata.data_lines = data_lines - def estimate_file_lines( self, dataset ): - # Perform a rough estimate by extrapolating number of lines from a small read. - sample_size = 1048576 - dataset_fh = open( dataset.file_name ) - dataset_read = dataset_fh.read(sample_size) - dataset_fh.close() - sample_lines = dataset_read.count('\n') - est_lines = int(sample_lines * (float(dataset.get_size()) / float(sample_size))) - return est_lines + return data_lines def set_peek( self, dataset, line_count=None, is_multi_byte=False ): if not dataset.dataset.purged: # The file must exist on disk for the get_file_peek() method @@ -418,8 +425,13 @@ # Number of lines is not known ( this should not happen ), and auto-detect is # needed to set metadata # This can happen when the file is larger than max_optional_metadata_filesize. - est_lines = self.estimate_file_lines(dataset) - dataset.blurb = "~%s %s" % ( util.commaify(str(est_lines)), inflector.cond_plural(est_lines, "line") ) + if int(dataset.get_size()) <= 1048576: + #Small dataset, recount all lines and reset peek afterward. + dataset.metadata.data_lines = self.count_data_lines(dataset) + self.set_peek(dataset) + else: + est_lines = self.estimate_file_lines(dataset) + dataset.blurb = "~%s %s" % ( util.commaify(util.roundify(str(est_lines))), inflector.cond_plural(est_lines, "line") ) else: dataset.blurb = "%s %s" % util.commaify( str(line_count) ), inflector.cond_plural(line_count, "line") else: --- a/lib/galaxy/datatypes/interval.py Thu Feb 17 08:45:09 2011 -0500 +++ b/lib/galaxy/datatypes/interval.py Thu Feb 17 12:05:39 2011 -0500 @@ -71,7 +71,7 @@ else: # Number of lines is not known ( this should not happen ), and auto-detect is # needed to set metadata - dataset.blurb = "~%s regions" % util.commaify( str( self.estimate_file_lines(dataset) ) ) + dataset.blurb = "~%s regions" % util.commaify(util.roundify(str(self.estimate_file_lines(dataset)))) else: dataset.blurb = "%s regions" % util.commaify( str( line_count ) ) else: --- a/lib/galaxy/util/__init__.py Thu Feb 17 08:45:09 2011 -0500 +++ b/lib/galaxy/util/__init__.py Thu Feb 17 12:05:39 2011 -0500 @@ -298,7 +298,16 @@ return new else: return commaify(new) - + +def roundify(amount, sfs = 2): + """ + Take a number in string form and truncate to 'sfs' significant figures. + """ + if len(amount) <= sfs: + return amount + else: + return amount[0:sfs] + '0'*(len(amount) - sfs) + def object_to_string( obj ): return binascii.hexlify( pickle.dumps( obj, 2 ) ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Add wc tool to tool_conf.xml.main
by Bitbucket 17 Feb '11

17 Feb '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/bae2fec3cb1b/ changeset: r5076:bae2fec3cb1b user: dan date: 2011-02-17 14:45:09 summary: Add wc tool to tool_conf.xml.main affected #: 1 file (38 bytes) --- a/tool_conf.xml.main Wed Feb 16 21:46:23 2011 -0500 +++ b/tool_conf.xml.main Thu Feb 17 08:45:09 2011 -0500 @@ -42,7 +42,8 @@ <tool file="filters/randomlines.xml" /><tool file="filters/headWrapper.xml" /><tool file="filters/tailWrapper.xml" /> - <tool file="filters/trimmer.xml" /> + <tool file="filters/trimmer.xml" /> + <tool file="filters/wc_gnu.xml" /></section><section name="Convert Formats" id="convert"><tool file="filters/bed2gff.xml" /> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0