May 2011 - galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: 2 new changesets
by Bitbucket 17 May '11

17 May '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/eec910f20a4e/ changeset: r5575:eec910f20a4e user: fubar date: 2011-05-17 18:52:24 summary: separated ngs picard tools and removed fastqc wrapper lgpl annotation affected #: 2 files (192 bytes) --- a/tool_conf.xml.sample Tue May 17 12:14:32 2011 -0400 +++ b/tool_conf.xml.sample Tue May 17 12:52:24 2011 -0400 @@ -242,19 +242,6 @@ <section name="NGS: QC and manipulation" id="NGS_QC"><label text="FastQC: fastq/sam/bam" id="fastqcsambam" /><tool file="rgenetics/rgFastQC.xml" /> - <label text="QC/Metrics for sam/bam" id="qcsambam"/> - <tool file="picard/picard_BamIndexStats.xml" /> - <tool file="picard/rgPicardASMetrics.xml" /> - <tool file="picard/rgPicardGCBiasMetrics.xml" /> - <tool file="picard/rgPicardLibComplexity.xml" /> - <tool file="picard/rgPicardInsertSize.xml" /> - <tool file="picard/rgPicardHsMetrics.xml" /> - <label text="bam/sam Cleaning" id="picard-tools" /> - <tool file="picard/picard_AddOrReplaceReadGroups.xml" /> - <tool file="picard/picard_ReorderSam.xml" /> - <tool file="picard/picard_ReplaceSamHeader.xml" /> - <tool file="picard/rgPicardFixMate.xml" /> - <tool file="picard/rgPicardMarkDups.xml" /><label text="Illumina fastq" id="illumina" /><tool file="fastq/fastq_groomer.xml" /><tool file="fastq/fastq_paired_end_splitter.xml" /> @@ -293,6 +280,21 @@ <tool file="fastx_toolkit/fastx_reverse_complement.xml" /><tool file="fastx_toolkit/fastx_trimmer.xml" /></section> + <section name="NGS: Picard (beta)" id="picard_beta"> + <label text="QC/Metrics for sam/bam" id="qcsambam"/> + <tool file="picard/picard_BamIndexStats.xml" /> + <tool file="picard/rgPicardASMetrics.xml" /> + <tool file="picard/rgPicardGCBiasMetrics.xml" /> + <tool file="picard/rgPicardLibComplexity.xml" /> + <tool file="picard/rgPicardInsertSize.xml" /> + <tool file="picard/rgPicardHsMetrics.xml" /> + <label text="bam/sam Cleaning" id="picard-clean" /> + <tool file="picard/picard_AddOrReplaceReadGroups.xml" /> + <tool file="picard/picard_ReorderSam.xml" /> + <tool file="picard/picard_ReplaceSamHeader.xml" /> + <tool file="picard/rgPicardFixMate.xml" /> + <tool file="picard/rgPicardMarkDups.xml" /> + </section><!-- Keep this section commented until it includes tools that will be hosted on test/main. The velvet wrappers have been --- a/tools/rgenetics/rgFastQC.xml Tue May 17 12:14:32 2011 -0400 +++ b/tools/rgenetics/rgFastQC.xml Tue May 17 12:52:24 2011 -0400 @@ -55,15 +55,10 @@ This Galaxy tool wrapper is part of the rgenetics toolkit. Contaminants file parameter borrowed from the independently -developed fastqcwrapper contributed to the galaxy community tool shed +developed fastqcwrapper_ contributed to the galaxy community tool shed by j johnson -copyright Ross Lazarus at g mail dot com 2011 -Licensed under the LGPL_ - .. _fastqcwrapper: http%3A//community.g2.bx.psu.edu/tool/browse_tools%3F%26webapp%3Dcommunity%26operation%3Dview_tool%26id%3D256f9f17b153ce60 -.. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> http://bitbucket.org/galaxy/galaxy-central/changeset/fa0480c6a01d/ changeset: r5576:fa0480c6a01d user: fubar date: 2011-05-17 19:04:35 summary: cleaned up picard tool names - own section so (picard) was redundant affected #: 12 files (349 bytes) --- a/tools/picard/picard_AddOrReplaceReadGroups.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/picard_AddOrReplaceReadGroups.xml Tue May 17 13:04:35 2011 -0400 @@ -1,6 +1,5 @@ -<tool name="Add or Replace Groups:" id="picard_ARRG" version="0.2.0"> +<tool name="Add or Replace Groups" id="picard_ARRG" version="0.2.0"><requirements><requirement type="package">picard</requirement></requirements> - <description>(Picard)</description><command interpreter="python"> picard_wrapper.py --input="$inputFile" --- a/tools/picard/picard_BamIndexStats.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/picard_BamIndexStats.xml Tue May 17 13:04:35 2011 -0400 @@ -1,6 +1,5 @@ -<tool name="BAM Index Statistics:" id="picard_BamIndexStats" version="0.2.0"> +<tool name="BAM Index Statistics" id="picard_BamIndexStats" version="0.2.0"><requirements><requirement type="package">picard</requirement></requirements> - <description>(Picard)</description><command interpreter="python"> picard_wrapper.py --input "$input_file" --- a/tools/picard/picard_MarkDuplicates.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/picard_MarkDuplicates.xml Tue May 17 13:04:35 2011 -0400 @@ -1,5 +1,4 @@ -<tool name="Mark Duplicates:" id="picard_MarkDuplicates" version="0.01"> - <description>(Picard)</description> +<tool name="Mark Duplicates" id="picard_MarkDuplicates" version="0.01"><command interpreter="python"> picard_wrapper.py --input="$input_file" --- a/tools/picard/picard_ReorderSam.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/picard_ReorderSam.xml Tue May 17 13:04:35 2011 -0400 @@ -1,6 +1,5 @@ -<tool name="Reorder SAM:" id="picard_ReorderSam" version="0.3.0"> +<tool name="Reorder SAM" id="picard_ReorderSam" version="0.3.0"><requirements><requirement type="package">picard</requirement></requirements> - <description>(Picard)</description><command interpreter="python"> picard_wrapper.py --input=$inputFile --- a/tools/picard/picard_ReplaceSamHeader.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/picard_ReplaceSamHeader.xml Tue May 17 13:04:35 2011 -0400 @@ -1,6 +1,5 @@ -<tool name="Replace Sam Header:" id="picard_ReplaceSamHeader" version="0.2.0"> +<tool name="Replace Sam Header" id="picard_ReplaceSamHeader" version="0.2.0"><requirements><requirement type="package">picard</requirement></requirements> - <description>(Picard)</description><command interpreter="python"> picard_wrapper.py --input "$inputFile" --- a/tools/picard/rgPicardASMetrics.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardASMetrics.xml Tue May 17 13:04:35 2011 -0400 @@ -1,5 +1,4 @@ -<tool name="Sam/bam Alignment Summary Metrics:" id="PicardASMetrics" version="0.03"> - <description>(Picard)</description> +<tool name="Sam/bam Alignment Summary Metrics" id="PicardASMetrics" version="0.03"><command interpreter="python"> picard_wrapper.py -i "$input_file" -d "$html_file.files_path" -t "$html_file" --assumesorted "$sorted" -b "$bisulphite" --adaptors "$adaptors" --maxinsert "$maxinsert" -n "$out_prefix" --- a/tools/picard/rgPicardFixMate.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardFixMate.xml Tue May 17 13:04:35 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="Paired Read Mate Fixer:" id="rgPicFixMate" version="0.2.0"> +<tool name="Paired Read Mate Fixer" id="rgPicFixMate" version="0.2.0"><description>for paired data</description><command interpreter="python"> picard_wrapper.py -i "$input_file" -o "$out_file" --tmpdir "${__new_file_path__}" -n "$out_prefix" --- a/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 13:04:35 2011 -0400 @@ -1,5 +1,4 @@ -<tool name="Sam/bam GC Bias Metrics:" id="PicardGCBiasMetrics" version="0.01"> - <description>(Picard)</description> +<tool name="Sam/bam GC Bias Metrics" id="PicardGCBiasMetrics" version="0.01"><command interpreter="python"> picard_wrapper.py -i "$input_file" -d "$html_file.files_path" -t "$html_file" --windowsize "$windowsize" --mingenomefrac "$mingenomefrac" -n "$out_prefix" --tmpdir "${__new_file_path__}" --- a/tools/picard/rgPicardHsMetrics.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardHsMetrics.xml Tue May 17 13:04:35 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="Sam/bam Hybrid Selection Metrics:" id="PicardHsMetrics" version="0.01"> +<tool name="Sam/bam Hybrid Selection Metrics" id="PicardHsMetrics" version="0.01"><description>For (eg exome) targeted data</description><command interpreter="python"> --- a/tools/picard/rgPicardInsertSize.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardInsertSize.xml Tue May 17 13:04:35 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="Insertion size metrics:" id="PicardInsertSize" version="0.3.0"> +<tool name="Insertion size metrics" id="PicardInsertSize" version="0.3.0"><description>for PAIRED data</description><requirements><requirement type="package">picard</requirement></requirements><command interpreter="python"> --- a/tools/picard/rgPicardLibComplexity.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardLibComplexity.xml Tue May 17 13:04:35 2011 -0400 @@ -1,5 +1,4 @@ -<tool name="Estimate Library Complexity:" id="rgEstLibComp" version="0.01"> - <description>(Picard)</description> +<tool name="Estimate Library Complexity" id="rgEstLibComp" version="0.01"><command interpreter="python"> picard_wrapper.py -i "$input_file" -n "$out_prefix" --tmpdir "${__new_file_path__}" --minid "$minIDbases" --maxdiff "$maxDiff" --minmeanq "$minMeanQ" --readregex "$readRegex" --optdupdist "$optDupeDist" --- a/tools/picard/rgPicardMarkDups.xml Tue May 17 12:52:24 2011 -0400 +++ b/tools/picard/rgPicardMarkDups.xml Tue May 17 13:04:35 2011 -0400 @@ -1,5 +1,4 @@ -<tool name="Mark Duplicates:" id="rgPicardMarkDups" version="0.01"> - <description>(Picard)</description> +<tool name="Mark Duplicate reads" id="rgPicardMarkDups" version="0.01"><command interpreter="python"> picard_wrapper.py -i "$input_file" -n "$out_prefix" --tmpdir "${__new_file_path__}" -o "$out_file" --remdups "$remDups" --assumesorted "$assumeSorted" --readregex "$readRegex" --optdupdist "$optDupeDist" Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 3 new changesets
by Bitbucket 17 May '11

17 May '11

3 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/67e2f1881067/ changeset: r5572:67e2f1881067 user: fubar date: 2011-05-17 16:29:06 summary: amerkinized spelin' and removed copyright notices on some picard tool forms affected #: 7 files (3.3 KB) --- a/tools/picard/rgPicardASMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardASMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -183,24 +183,6 @@ Picard and Samtools go together. They are external to and completely independent of Galaxy. We acknowledge that all credit for their methods and contribution are due to them. -Here, you can apply Picard tools through Galaxy which you may find much easier than through the native Picard command line interface. - - - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardFixMate.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardFixMate.xml Tue May 17 10:29:06 2011 -0400 @@ -101,7 +101,7 @@ if a tool fails unexpectedly when you run it in Galaxy. All the Picard tools are freely available and are documented -at http://picard.sourceforge.net/command-line-overview.shtml#CollectAlignmentS… +at http://picard.sourceforge.net/command-line-overview.shtml Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 Code cleaned up and the ugliest hacks repaired by Raphael Lullis. @@ -109,18 +109,6 @@ It takes a village of programmers to wrap a picard tool ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardGCBiasMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -162,22 +162,5 @@ They are external to and completely independent of Galaxy. We acknowledge that all credit for their methods and contribution are due to them. -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> --- a/tools/picard/rgPicardHsMetrics.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardHsMetrics.xml Tue May 17 10:29:06 2011 -0400 @@ -1,5 +1,5 @@ <tool name="Sam/bam Hybrid Selection Metrics:" id="PicardHsMetrics" version="0.01"> - <description>For (eg exome) targetted data</description> + <description>For (eg exome) targeted data</description><command interpreter="python"> picard_wrapper.py -i "$input_file" -d "$html_file.files_path" -t "$html_file" --datatype "$input_file.ext" @@ -139,19 +139,6 @@ aligned short read sequence data. Sequence data must be chosen from the sam/bam format files in your current history. Target and bait files must be selected from the UCSC BED format in your current history. ------ - -.. class:: infomark - -**Copyright** - -This is part of the rgenetics toolkit. - -Written by Ross Lazarus 2010 -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> --- a/tools/picard/rgPicardInsertSize.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardInsertSize.xml Tue May 17 10:29:06 2011 -0400 @@ -78,23 +78,8 @@ if a tool fails unexpectedly when you run it in Galaxy. All the Picard tools are freely available and are documented -at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSize… +at http://picard.sourceforge.net/command-line-overview.shtml -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artifacts are available licensed under the LGPL -Other dependencies are licensed at the author's discretion - please see each individual package for details </help></tool> --- a/tools/picard/rgPicardLibComplexity.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardLibComplexity.xml Tue May 17 10:29:06 2011 -0400 @@ -121,22 +121,6 @@ All the Picard tools are freely available and are documented at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSize… ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artefacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - - .. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> --- a/tools/picard/rgPicardMarkDups.xml Tue May 17 01:57:04 2011 -0400 +++ b/tools/picard/rgPicardMarkDups.xml Tue May 17 10:29:06 2011 -0400 @@ -120,24 +120,6 @@ All the Picard tools are freely available and are documented at http://picard.sourceforge.net/command-line-overview.shtml#CollectInsertSize… -Here, you can apply Picard tools through Galaxy which might be easier than through the native Picard command line interface. - ------ - -.. class:: infomark - -**Copyright** - -This Galaxy tool is a component of the rgenetics toolkit. - -Written by and copyright Ross Lazarus, ross.lazarus at gmail etc, September 2010 -Code cleaned up and the ugliest hacks repaired by Raphael Lullis - -All rgenetics artifacts are available licensed under the LGPL_ -Other dependencies are licensed at the author's discretion - please see each individual package for details - -.. _LGPL: http://www.gnu.org/copyleft/lesser.html - </help></tool> http://bitbucket.org/galaxy/galaxy-central/changeset/d6a905426210/ changeset: r5573:d6a905426210 user: fubar date: 2011-05-17 17:39:52 summary: branch merge affected #: 2 files (331 bytes) --- a/tools/ngs_rna/cufflinks_wrapper.py Tue May 17 10:29:06 2011 -0400 +++ b/tools/ngs_rna/cufflinks_wrapper.py Tue May 17 11:39:52 2011 -0400 @@ -34,9 +34,12 @@ where each end is 50bp, you should set -r to be 200. The default is 45bp.') parser.add_option( '-G', '--GTF', dest='GTF', help='Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.' ) - # Normalization options. + # Normalization options. parser.add_option( "-N", "--quartile-normalization", dest="do_normalization", action="store_true" ) + # Wrapper / Galaxy options. + parser.add_option( '-A', '--assembled-isoforms-output', dest='assembled_isoforms_output_file', help='Assembled isoforms output file; formate is GTF.' ) + # Advanced Options: parser.add_option( '--num-importance-samples', dest='num_importance_samples', help='Sets the number of importance samples generated for each locus during abundance estimation. Default: 1000' ) parser.add_option( '--max-mle-iterations', dest='max_mle_iterations', help='Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000' ) @@ -136,6 +139,9 @@ except OverflowError: pass tmp_stderr.close() + + # Copy outputs. + shutil.copyfile( "transcripts.gtf" , options.assembled_isoforms_output_file ) # Error checking. if returncode != 0: --- a/tools/ngs_rna/cufflinks_wrapper.xml Tue May 17 10:29:06 2011 -0400 +++ b/tools/ngs_rna/cufflinks_wrapper.xml Tue May 17 11:39:52 2011 -0400 @@ -6,6 +6,7 @@ <command interpreter="python"> cufflinks_wrapper.py --input=$input + --assembled-isoforms-output=$assembled_isoforms --num-threads="4" -I $max_intron_len -F $min_isoform_fraction @@ -95,7 +96,7 @@ <outputs><data format="tabular" name="genes_expression" label="${tool.name} on ${on_string}: gene expression" from_work_dir="genes.fpkm_tracking"/><data format="tabular" name="transcripts_expression" label="${tool.name} on ${on_string}: transcript expression" from_work_dir="isoforms.fpkm_tracking"/> - <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts" from_work_dir="transcripts.gtf"/> + <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts"/></outputs><tests> http://bitbucket.org/galaxy/galaxy-central/changeset/56b4c606cfd5/ changeset: r5574:56b4c606cfd5 user: fubar date: 2011-05-17 18:14:32 summary: branch merge with Kelly's fixes affected #: 5 files (16.5 KB) --- a/tools/maf/genebed_maf_to_fasta.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/genebed_maf_to_fasta.xml Tue May 17 12:14:32 2011 -0400 @@ -8,6 +8,7 @@ <inputs><param name="input1" type="data" format="bed" label="Gene BED File"><validator type="unspecified_build" /> + <validator type="expression" message="Input must be in BED12 format.">value.metadata.columns >= 12</validator></param><conditional name="maf_source_type"><param name="maf_source" type="select" label="MAF Source"> --- a/tools/maf/interval2maf.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/interval2maf.xml Tue May 17 12:14:32 2011 -0400 @@ -55,7 +55,7 @@ </when></conditional><conditional name="split_blocks_by_species_selector"> - <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="See the Split MAF blocks by Species tool for more information."> + <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="Not usually applicable. See help below for more information."><option value="split_blocks_by_species">Split by species</option><option value="dont_split_blocks_by_species" selected="true">Do not split</option></param> @@ -112,5 +112,176 @@ .. image:: ./static/images/maf_icons/interval2maf.png +------- + +**Split blocks by species** + +This option examines each MAF block for multiple occurrences of a species in a single block. When this occurs, a block is split into multiple blocks where every combination of one sequence per species per block is represented. + +The interface for this option has two inputs: + + * **MAF file to split**. Choose multiple alignments from history to be split by species. + * **Collapse empty alignment columns**. Should alignment columns containing only gaps in the new blocks be removed. + + + +**Example 1**: **Collapse empty alignment columns is Yes**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that no columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT-GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC--GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC-GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGCAG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC---AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC---AG + + + +**Example 2**: **Collapse empty alignment columns is No**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that some columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + </help></tool> --- a/tools/maf/maf_to_bed.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/maf_to_bed.xml Tue May 17 12:14:32 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_BED1" name="Maf to BED" force_history_refresh="True"> - <description>Converts a MAF formated file to the BED format</description> + <description>Converts a MAF formatted file to the BED format</description><command interpreter="python">maf_to_bed.py $input1 $out_file1 $species $complete_blocks $__new_file_path__</command><inputs><param format="maf" name="input1" type="data" label="MAF file to convert"/> --- a/tools/maf/maf_to_fasta.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/maf/maf_to_fasta.xml Tue May 17 12:14:32 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"> - <description>Converts a MAF formated file to FASTA format</description> + <description>Converts a MAF formatted file to FASTA format</description><command interpreter="python"> #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 --- a/tools/ngs_rna/tophat_wrapper.xml Tue May 17 11:39:52 2011 -0400 +++ b/tools/ngs_rna/tophat_wrapper.xml Tue May 17 12:14:32 2011 -0400 @@ -1,4 +1,4 @@ -<tool id="tophat" name="Tophat" version="1.2.0"> +<tool id="tophat" name="Tophat" version="1.2.1"><description>Find splice junctions using RNA-seq data</description><requirements><requirement type="package">tophat</requirement> @@ -100,7 +100,7 @@ --seg-length=$singlePaired.pParams.seg_length --library-type=$singlePaired.pParams.library_type - ## Indel search. + ## Indel search. #if $singlePaired.pParams.indel_search.allow_indel_search == "Yes": --allow-indels --max-insertion-length $singlePaired.pParams.indel_search.max_insertion_length @@ -386,6 +386,23 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data><data format="bed" name="deletions" label="${tool.name} on ${on_string}: deletions" from_work_dir="tophat_out/deletions.bed"><filter> @@ -396,9 +413,62 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data> - <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"/> - <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"/> + <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data></outputs><tests> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Update tool help for some MAF tools.
by Bitbucket 17 May '11

17 May '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/3c898577b4ee/ changeset: r5571:3c898577b4ee user: dan date: 2011-05-17 18:07:25 summary: Update tool help for some MAF tools. affected #: 4 files (13.1 KB) --- a/tools/maf/genebed_maf_to_fasta.xml Tue May 17 12:05:07 2011 -0400 +++ b/tools/maf/genebed_maf_to_fasta.xml Tue May 17 12:07:25 2011 -0400 @@ -8,6 +8,7 @@ <inputs><param name="input1" type="data" format="bed" label="Gene BED File"><validator type="unspecified_build" /> + <validator type="expression" message="Input must be in BED12 format.">value.metadata.columns >= 12</validator></param><conditional name="maf_source_type"><param name="maf_source" type="select" label="MAF Source"> --- a/tools/maf/interval2maf.xml Tue May 17 12:05:07 2011 -0400 +++ b/tools/maf/interval2maf.xml Tue May 17 12:07:25 2011 -0400 @@ -55,7 +55,7 @@ </when></conditional><conditional name="split_blocks_by_species_selector"> - <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="See the Split MAF blocks by Species tool for more information."> + <param name="split_blocks_by_species" type="select" label="Split blocks by species" help="Not usually applicable. See help below for more information."><option value="split_blocks_by_species">Split by species</option><option value="dont_split_blocks_by_species" selected="true">Do not split</option></param> @@ -112,5 +112,176 @@ .. image:: ./static/images/maf_icons/interval2maf.png +------- + +**Split blocks by species** + +This option examines each MAF block for multiple occurrences of a species in a single block. When this occurs, a block is split into multiple blocks where every combination of one sequence per species per block is represented. + +The interface for this option has two inputs: + + * **MAF file to split**. Choose multiple alignments from history to be split by species. + * **Collapse empty alignment columns**. Should alignment columns containing only gaps in the new blocks be removed. + + + +**Example 1**: **Collapse empty alignment columns is Yes**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that no columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT-GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC--GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC-GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC-GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGCAG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC---AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC---AG + + + +**Example 2**: **Collapse empty alignment columns is No**: + +For the following alignment:: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + +the tool will create **a single** history item containing 12 alignment blocks (notice that some columns contain only gaps):: + + ##maf version=1 + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 85 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723125 83 - 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCT--GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTCGTCCTCAG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 85 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984545 83 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTT--GTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTCCTCAG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 + 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTT------AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + + a score=2047408.0 + s species1.chr1 147984645 79 - 245522847 ATGGCGTCGGCCTCCTCCGGGCCGTCGTC---GGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGTC---AG + s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG + s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG + </help></tool> --- a/tools/maf/maf_to_bed.xml Tue May 17 12:05:07 2011 -0400 +++ b/tools/maf/maf_to_bed.xml Tue May 17 12:07:25 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_BED1" name="Maf to BED" force_history_refresh="True"> - <description>Converts a MAF formated file to the BED format</description> + <description>Converts a MAF formatted file to the BED format</description><command interpreter="python">maf_to_bed.py $input1 $out_file1 $species $complete_blocks $__new_file_path__</command><inputs><param format="maf" name="input1" type="data" label="MAF file to convert"/> --- a/tools/maf/maf_to_fasta.xml Tue May 17 12:05:07 2011 -0400 +++ b/tools/maf/maf_to_fasta.xml Tue May 17 12:07:25 2011 -0400 @@ -1,5 +1,5 @@ <tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"> - <description>Converts a MAF formated file to FASTA format</description> + <description>Converts a MAF formatted file to FASTA format</description><command interpreter="python"> #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: kellyv: Modified Tophat wrapper so dbkey will be properly set both for built-in and history references
by Bitbucket 17 May '11

17 May '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/0c1251f25c6b/ changeset: r5570:0c1251f25c6b user: kellyv date: 2011-05-17 18:05:07 summary: Modified Tophat wrapper so dbkey will be properly set both for built-in and history references affected #: 1 file (3.4 KB) --- a/tools/ngs_rna/tophat_wrapper.xml Tue May 17 11:21:26 2011 -0400 +++ b/tools/ngs_rna/tophat_wrapper.xml Tue May 17 12:05:07 2011 -0400 @@ -1,4 +1,4 @@ -<tool id="tophat" name="Tophat" version="1.2.0"> +<tool id="tophat" name="Tophat" version="1.2.1"><description>Find splice junctions using RNA-seq data</description><requirements><requirement type="package">tophat</requirement> @@ -100,7 +100,7 @@ --seg-length=$singlePaired.pParams.seg_length --library-type=$singlePaired.pParams.library_type - ## Indel search. + ## Indel search. #if $singlePaired.pParams.indel_search.allow_indel_search == "Yes": --allow-indels --max-insertion-length $singlePaired.pParams.indel_search.max_insertion_length @@ -386,6 +386,23 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data><data format="bed" name="deletions" label="${tool.name} on ${on_string}: deletions" from_work_dir="tophat_out/deletions.bed"><filter> @@ -396,9 +413,62 @@ ( singlePaired['pParams']['indel_search']['allow_indel_search'] == 'Yes' ) ) ) </filter> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions></data> - <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"/> - <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"/> + <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </data></outputs><tests> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Enable Cufflinks to work when setting metadata externally.
by Bitbucket 17 May '11

17 May '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/ccef03be136b/ changeset: r5569:ccef03be136b user: jgoecks date: 2011-05-17 17:21:26 summary: Enable Cufflinks to work when setting metadata externally. affected #: 2 files (331 bytes) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: kellyv: Numerous updates to Picard tools: Cleaned up and standardized wrapper's Python code, removing redundant variables and using the same ones in different segment of code when possible; Changed sam/bam outputs to be bam by default and use change_format if user requests sam and removed redundant output parameters; Got tests passing for AddOrReplaceReadGroups; Relaxed the matching constraints for output for BamIndexStats and InsertSize wrappers Standardized on the p
by Bitbucket 17 May '11

17 May '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/39a034c36baa/ changeset: r5568:39a034c36baa user: kellyv date: 2011-05-17 07:57:04 summary: Numerous updates to Picard tools: Cleaned up and standardized wrapper's Python code, removing redundant variables and using the same ones in different segment of code when possible; Changed sam/bam outputs to be bam by default and use change_format if user requests sam and removed redundant output parameters; Got tests passing for AddOrReplaceReadGroups; Relaxed the matching constraints for output for BamIndexStats and InsertSize wrappers Standardized on the parameter output-format rather than newformat to indicate sam preference over bam affected #: 14 files (2.5 KB) --- a/test-data/picard_ARRG_output1.sam Mon May 16 17:08:06 2011 -0400 +++ b/test-data/picard_ARRG_output1.sam Tue May 17 01:57:04 2011 -0400 @@ -3,22 +3,22 @@ @SQ SN:chr2 LN:100001 @SQ SN:chr3 LN:10001 @SQ SN:chr4 LN:1001 -@RG ID:1 PL:illumina PU:plat LB:lib SM:sam1 -bar:record:4 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:6 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:1 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:3 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:1 141 chr1 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:7 77 chr1 20 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:8 77 chr1 30 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:4 141 chr1 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:5 77 chr1 40 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:6 141 chr1 50 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:2 77 chr2 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:2 141 chr2 30 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:3 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:8 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:5 141 chr3 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:9 77 chr4 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:1 -bar:record:7 141 chr4 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 -bar:record:9 141 chr4 60 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:1 +@RG ID:one PL:illumina PU:peaewe LB:lib SM:sam1 +bar:record:4 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:6 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:1 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:3 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:1 141 chr1 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:7 77 chr1 20 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:8 77 chr1 30 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:4 141 chr1 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:5 77 chr1 40 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:6 141 chr1 50 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:2 77 chr2 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:2 141 chr2 30 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:3 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:8 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:5 141 chr3 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:9 77 chr4 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:one +bar:record:7 141 chr4 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one +bar:record:9 141 chr4 60 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:one --- a/test-data/picard_ARRG_output2.sam Mon May 16 17:08:06 2011 -0400 +++ b/test-data/picard_ARRG_output2.sam Tue May 17 01:57:04 2011 -0400 @@ -2,14 +2,23 @@ @SQ SN:chr1 LN:10001 @SQ SN:chr2 LN:100001 @SQ SN:chr3 LN:10001 +@SQ SN:chr4 LN:1001 @RG ID:M5 PL:IL PU:PLAT LB:LIB DS:description with spaces SM:smp CN:FamousCenter bar:record:4 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 +bar:record:6 77 chr1 1 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 bar:record:1 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 bar:record:3 77 chr1 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 bar:record:1 141 chr1 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 +bar:record:7 77 chr1 20 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 +bar:record:8 77 chr1 30 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 bar:record:4 141 chr1 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 bar:record:5 77 chr1 40 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 +bar:record:6 141 chr1 50 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 bar:record:2 77 chr2 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 bar:record:2 141 chr2 30 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 bar:record:3 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 +bar:record:8 141 chr3 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 bar:record:5 141 chr3 40 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 +bar:record:9 77 chr4 10 0 * * 0 0 AAAAAAAAAAAAA 1111111111111 RG:Z:M5 +bar:record:7 141 chr4 20 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 +bar:record:9 141 chr4 60 0 * * 0 0 CCCCCCCCCCCCC 2222222222222 RG:Z:M5 --- a/test-data/picard_BIS_output1.txt Mon May 16 17:08:06 2011 -0400 +++ b/test-data/picard_BIS_output1.txt Tue May 17 01:57:04 2011 -0400 @@ -13,8 +13,8 @@ <body><div class="document"> Galaxy tool BamIndexStats run at 12/05/2011 14:18:06</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table> +<tr><td><a href="BamIndexStats.log">BamIndexStats.log</a></td></tr><tr><td><a href="BamIndexStats.metrics.txt">BamIndexStats.metrics.txt</a></td></tr> -<tr><td><a href="BamIndexStats.log">BamIndexStats.log</a></td></tr></table><p/><b>Picard on line resources</b><ul><li><a href="http://picard.sourceforge.net/index.shtml">Click here for Picard Documentation</a></li> --- a/test-data/picard_BIS_output2.txt Mon May 16 17:08:06 2011 -0400 +++ b/test-data/picard_BIS_output2.txt Tue May 17 01:57:04 2011 -0400 @@ -13,8 +13,8 @@ <body><div class="document"> Galaxy tool BamIndexStats run at 12/05/2011 14:18:22</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table> +<tr><td><a href="BamIndexStats.log">BamIndexStats.log</a></td></tr><tr><td><a href="BamIndexStats.metrics.txt">BamIndexStats.metrics.txt</a></td></tr> -<tr><td><a href="BamIndexStats.log">BamIndexStats.log</a></td></tr></table><p/><b>Picard on line resources</b><ul><li><a href="http://picard.sourceforge.net/index.shtml">Click here for Picard Documentation</a></li> --- a/tools/picard/picard_AddOrReplaceReadGroups.xml Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/picard_AddOrReplaceReadGroups.xml Tue May 17 01:57:04 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="Add or Replace Groups:" id="picard_ARRG" version="0.01"> +<tool name="Add or Replace Groups:" id="picard_ARRG" version="0.2.0"><requirements><requirement type="package">picard</requirement></requirements><description>(Picard)</description><command interpreter="python"> @@ -8,18 +8,14 @@ --rg-pl="$rgpl" --rg-pu="$rgpu" --rg-sm="$rgsm" + --rg-id="$rgid" --rg-opts=${readGroupOpts.rgOpts} #if $readGroupOpts.rgOpts == "full" - --rg-id="$readGroupOpts.rgid" --rg-cn="$readGroupOpts.rgcn" --rg-ds="$readGroupOpts.rgds" #end if --output-format=$outputFormat - #if str( $outputFormat ) == "sam" - --output-sam=$outFileSam - #else if str( $outputFormat ) == "bam" - --output-sam=$outFileBam - #end if + --output=$outFile -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/AddOrReplaceReadGroups.jar" </command><inputs> @@ -29,14 +25,14 @@ <param name="rgpl" value="" type="text" label="Read group platform" help="illumina, solid, etc." /><param name="rgpu" value="" type="text" label="Read group platform unit" help="like run barcode, etc." /><param name="rgsm" value="" type="text" label="Read group sample name" /> + <param name="rgid" value="1" type="text" label="Read group ID" help="Picard will use a value of '1' if nothing provided" /><conditional name="readGroupOpts"> - <param name="rgOpts" type="select" label="Specify additional (optional) arguments" help="Allows you to set RGID, RGCN, and RGDS"> + <param name="rgOpts" type="select" label="Specify additional (optional) arguments" help="Allows you to set RGCN and RGDS."><option value="preSet">Use pre-set defaults</option><option value="full">Set optional arguments</option></param><when value="preSet" /><when value="full"> - <param name="rgid" value="" type="text" label="Read group ID" /><param name="rgcn" value="" type="text" label="Read group sequencing center name" help="Leave set to <null> for default (none)" /><param name="rgds" value="" type="text" label="Read group description" help="Leave set to <null> for default (none)" /></when> @@ -44,70 +40,58 @@ <param name="outputFormat" type="boolean" checked="True" truevalue="bam" falsevalue="sam" label="Output bam instead of sam" help="Uncheck for sam output" /></inputs><outputs> - <data name="outFileSam" format="sam" label="${tool.name} on ${on_string}: sam with read groups replaced"> - <filter>outputFormat is False</filter> - </data> - <data name="outFileBam" format="bam" label="${tool.name} on ${on_string}: bam with read groups replaced"> - <filter>outputFormat is True</filter> + <data name="outFile" format="bam" label="${tool.name} on ${on_string}: ${outputFormat} with read groups replaced"> + <change_format> + <when input="outputFormat" value="sam" format="sam" /> + </change_format></data></outputs><tests><test> -  + <param name="inputFile" value="picard_ARRG_input1.bam" /> + <param name="rglb" value="lib" /> + <param name="rgpl" value="illumina" /> + <param name="rgpu" value="peaewe" /> + <param name="rgsm" value="sam1" /> + <param name="rgid" value="one" /> + <param name="rgOpts" value="preSet" /> + <param name="outputFormat" value="False" /> + <output name="outFile" file="picard_ARRG_output1.sam" ftype="sam" /> + </test> + <test> + <param name="inputFile" value="picard_ARRG_input1.sam" /> - <param name="rglb" value="lib" /> - <param name="rgpl" value="illumina" /> - <param name="rgpu" value="plat" /> - <param name="rgsm" value="sam1" /> - <param name="rgOpts" value="preSet" /> - <param name="outputFormat" value="sam" /> - <output name="outFileSam" file="picard_ARRG_output1.sam" /> - </test> -  -  -  -  -  - </tests><help> --- a/tools/picard/picard_BamIndexStats.xml Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/picard_BamIndexStats.xml Tue May 17 01:57:04 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="BAM Index Statistics:" id="picard_BamIndexStats" version="0.01"> +<tool name="BAM Index Statistics:" id="picard_BamIndexStats" version="0.2.0"><requirements><requirement type="package">picard</requirement></requirements><description>(Picard)</description><command interpreter="python"> @@ -23,7 +23,7 @@ picard_input_tiny_coord.bam can be created from picard_input_tiny_coord.sam --><param name="input_file" value="picard_input_tiny_coord.bam" ftype="bam" /> - <output name="htmlfile" file="picard_BIS_output1.txt" ftype="html" lines_diff="12"/> + <output name="htmlfile" file="picard_BIS_output1.txt" ftype="html" compare="contains" lines_diff="12"/></test><test><param name="input_file" value="picard_BIS_input1.bam" ftype="bam" /> - <output name="htmlfile" file="picard_BIS_output2.txt" ftype="html" lines_diff="12" /> + <output name="htmlfile" file="picard_BIS_output2.txt" ftype="html" compare="contains" lines_diff="12" /></test></tests><help> --- a/tools/picard/picard_ReorderSam.xml Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/picard_ReorderSam.xml Tue May 17 01:57:04 2011 -0400 @@ -1,22 +1,22 @@ -<tool name="Reorder SAM:" id="picard_ReorderSam" version="0.02"> +<tool name="Reorder SAM:" id="picard_ReorderSam" version="0.3.0"><requirements><requirement type="package">picard</requirement></requirements><description>(Picard)</description><command interpreter="python"> - picard_wrapper.py -d "$html_file.files_path" -t "$html_file" --input=$inputFile + picard_wrapper.py + --input=$inputFile #if $source.indexSource == "built-in" --ref="${ filter( lambda x: str( x[0] ) == str( $source.ref ), $__app__.tool_data_tables[ 'picard_indexes' ].get_fields() )[0][-1] }" #else - --ref-file=$source.refFile + --ref-file=$refFile --species-name=$source.speciesName --build-name=$source.buildName --trunc-names=$source.truncateSeqNames #end if --allow-inc-dict-concord=$allowIncDictConcord --allow-contig-len-discord=$allowContigLenDiscord - --newformat=$outputFormat - --output="$out_file" + --output-format=$outputFormat + --output=$outFile -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/ReorderSam.jar" - --picard-cmd="ReorderSam" </command><inputs><param format="bam,sam" name="inputFile" type="data" label="The sam or bam file in your current history whose header you want to replace" @@ -42,25 +42,21 @@ <param name="allowContigLenDiscord" type="boolean" checked="False" truevalue="true" falsevalue="false" label="Allow contig length discordance?" help="This is dangerous--don't check it unless you know exactly what you're doing!" /><param name="outputFormat" type="boolean" checked="True" truevalue="bam" falsevalue="sam" label="Output bam instead of sam" help="Uncheck for sam output" /></inputs> - <outputs> - <data format="html" name="html_file" label="ReorderBam_on_${on_string}.html" /> - <data format="bam" name="out_file" label="ReorderBam_on_${on_string}.${outputFormat}"> - <change_format> - <when input="outputFormat" value="sam" format="sam" /> - </change_format> + <outputs> + <data name="outFile" format="bam" label="${tool.name} on ${on_string}: reordered ${outputFormat}"> + <change_format> + <when input="outputFormat" value="sam" format="sam" /> + </change_format></data></outputs><tests> -  - <test><param name="inputFile" value="picard_input_tiny_coord.bam" ftype="bam" /><param name="headerFile" value="picard_RSH_input1.bam" ftype="bam" /> - <param name="outputFormat" value="sam" /> - <output name="outFileSam" file="picard_RSH_output1.sam" ftype="sam" /> + <param name="outputFormat" value="False" /> + <output name="outFile" file="picard_RSH_output1.sam" ftype="sam" /></test><test><param name="inputFile" value="picard_input_tiny_coord.sam" ftype="sam" /><param name="headerFile" value="picard_RSH_input1.bam" ftype="bam" /> - <param name="outputFormat" value="sam" /> - <output name="outFileSam" file="picard_RSH_output2.sam" ftype="sam" /> + <param name="outputFormat" value="False" /> + <output name="outFile" file="picard_RSH_output2.sam" ftype="sam" /></test> -  - </tests><help> --- a/tools/picard/picard_wrapper.py Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/picard_wrapper.py Tue May 17 01:57:04 2011 -0400 @@ -36,7 +36,7 @@ """ return time.strftime('%d/%m/%Y %H:%M:%S', time.localtime(time.time())) - + class PicardBase(): """ simple base class with some utilities for Picard @@ -84,7 +84,7 @@ def readLarge(self,fname=None): - """ read a potentially huge file.. + """ read a potentially huge file. """ try: # get stderr, allowing for case where it's very large @@ -152,15 +152,15 @@ cl = ['samtools view -h -b -S -o ',tempbam,infile] tlog,stdouts = self.runCL(cl,outdir) return tlog,tempbam - - def bamToSam(self,infile=None,outdir=None): - """ - use samtools view to convert bam to sam - """ - fd,tempsam = tempfile.mkstemp(dir=outdir,suffix='rgutilsTemp.sam') - cl = ['samtools view -h -o ',tempsam,infile] - tlog,stdouts = self.runCL(cl,outdir) - return tlog,tempsam + + #def bamToSam(self,infile=None,outdir=None): + # """ + # use samtools view to convert bam to sam + # """ + # fd,tempsam = tempfile.mkstemp(dir=outdir,suffix='rgutilsTemp.sam') + # cl = ['samtools view -h -o ',tempsam,infile] + # tlog,stdouts = self.runCL(cl,outdir) + # return tlog,tempsam def sortSam(self, infile=None,outfile=None,outdir=None): """ @@ -264,7 +264,7 @@ if llen > maxloglines: n = min(50,int(maxloglines/2)) rlog += l[:n] - rlog.append('------------ ## %d rows deleted ## --------------\n' % (llen-maxloglines)) + rlog.append('------------ ## %d rows deleted ## --------------\n' % (llen-maxloglines)) rlog += l[-n:] else: rlog += l @@ -303,8 +303,7 @@ o.write(''.join(head)) o.write(''.join(bed)) o.close() - return outf - + return outf def cleanSam(self, insam=None, newsam=None, picardErrors=[],outformat=None): """ @@ -369,9 +368,7 @@ op.add_option('-j','--jar',default='') op.add_option('','--picard-cmd',default=None) # Many tools - op.add_option( '', '--output-txt', dest='output_txt', help='Output file in text format' ) op.add_option( '', '--output-format', dest='output_format', help='Output format' ) - op.add_option( '', '--output-sam', dest='output_sam', help='Output file in SAM or BAM format' ) op.add_option( '', '--bai-file', dest='bai_file', help='The path to the index file for the input bam file' ) op.add_option( '', '--ref', dest='ref', help='Built-in reference with fasta and dict file', default=None ) # CreateSequenceDictionary @@ -390,7 +387,6 @@ op.add_option('', '--maxinsert', default="20") op.add_option('', '--adaptors', action='append', type="string") # FixMateInformation and validate - op.add_option('','--newformat', default='bam') # CollectGcBiasMetrics op.add_option('', '--windowsize', default='100') op.add_option('', '--mingenomefrac', default='0.00001') @@ -437,10 +433,10 @@ # set ref and dict files to use (create if necessary) ref_file_name = opts.ref - if opts.ref_file <> None: + if opts.ref_file <> None: csd = 'CreateSequenceDictionary' realjarpath = os.path.split(opts.jar)[0] - jarpath = os.path.join(realjarpath,'%s.jar' % csd) # for refseq + jarpath = os.path.join(realjarpath,'%s.jar' % csd) # for refseq tmp_ref_fd, tmp_ref_name = tempfile.mkstemp( dir=opts.tmpdir , prefix = pic.picname) ref_file_name = '%s.fasta' % tmp_ref_name # build dict @@ -460,6 +456,15 @@ s = pic.runPic(jarpath, cl) # run relevant command(s) + # define temporary output + # if output is sam, it must have that extension, otherwise bam will be produced + # specify sam or bam file with extension + if opts.output_format == 'sam': + suff = '.sam' + else: + suff = '' + tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir, suffix=suff ) + cl = ['VALIDATION_STRINGENCY=LENIENT',] if pic.picname == 'AddOrReplaceReadGroups': @@ -468,22 +473,22 @@ # input cl.append('INPUT=%s' % opts.input) # outputs - cl.append('OUTPUT=%s' % opts.output) + cl.append('OUTPUT=%s' % tempout) # required read groups cl.append('RGLB="%s"' % opts.rg_library) cl.append('RGPL="%s"' % opts.rg_platform) cl.append('RGPU="%s"' % opts.rg_plat_unit) cl.append('RGSM="%s"' % opts.rg_sample) + if opts.rg_id: + cl.append('RGID="%s"' % opts.rg_id) # optional read groups - if opts.rg_opts == 'full': - if opts.rg_id: - cl.append('RGID="%s"' % opts.rg_id) - if opts.rg_seq_center: - cl.append('RGCN="%s"' % opts.rg_seq_center) - if opts.rg_desc: - cl.append('RGDS="%s"' % opts.rg_desc) - s = pic.runPic(opts.jar, cl) - + if opts.rg_seq_center: + cl.append('RGCN="%s"' % opts.rg_seq_center) + if opts.rg_desc: + cl.append('RGDS="%s"' % opts.rg_desc) + pic.runPic(opts.jar, cl) + haveTempout = True + elif pic.picname == 'BamIndexStats': tmp_fd, tmp_name = tempfile.mkstemp( dir=tmp_dir ) tmp_bam_name = '%s.bam' % tmp_name @@ -494,7 +499,7 @@ pic.delme.append(tmp_bam_name) pic.delme.append(tmp_bai_name) pic.delme.append(tmp_name) - s = pic.runPic( opts.jar, cl ) + s = pic.runPic( opts.jar, cl ) f = open(pic.metricsOut,'a') f.write(s) # got this on stdout from runCl f.write('\n') @@ -525,7 +530,7 @@ except: s = '## unable to symlink %s to %s - different devices? May need to replace with shutil.copy' info = s - shutil.copy(ref_file_name,fakefasta) + shutil.copy(ref_file_name,fakefasta) pic.delme.append(fakefasta) cl.append('ASSUME_SORTED=%s' % opts.assumesorted) adaptorseqs = ''.join([' ADAPTER_SEQUENCE=%s' % x for x in opts.adaptors]) @@ -555,14 +560,14 @@ except: s = '## unable to symlink %s to %s - different devices? May need to replace with shutil.copy' info = s - shutil.copy(ref_file_name,fakefasta) + shutil.copy(ref_file_name,fakefasta) pic.delme.append(fakefasta) x = 'rgPicardGCBiasMetrics' pdfname = '%s.pdf' % x jpgname = '%s.jpg' % x tempout = os.path.join(opts.outdir,'rgPicardGCBiasMetrics.out') temppdf = os.path.join(opts.outdir,pdfname) - cl.append('R=%s' % fakefasta) + cl.append('R=%s' % fakefasta) cl.append('WINDOW_SIZE=%s' % opts.windowsize) cl.append('MINIMUM_GENOME_FRACTION=%s' % opts.mingenomefrac) cl.append('INPUT=%s' % opts.input) @@ -587,7 +592,7 @@ histpdf = 'InsertSizeHist.pdf' cl.append('I=%s' % opts.input) cl.append('O=%s' % pic.metricsOut) - cl.append('HISTOGRAM_FILE=%s' % histpdf) + cl.append('HISTOGRAM_FILE=%s' % histpdf) if opts.taillimit <> '0': cl.append('TAIL_LIMIT=%s' % opts.taillimit) if opts.histwidth <> '0': @@ -623,9 +628,8 @@ # maximum offset between two duplicate clusters cl.append('OPTICAL_DUPLICATE_PIXEL_DISTANCE=%s' % opts.optdupdist) pic.runPic(opts.jar, cl) - + elif pic.picname == 'FixMateInformation': - tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir,prefix='FixMateTempOut') cl.append('I=%s' % opts.input) cl.append('O=%s' % tempout) cl.append('SORT_ORDER=%s' % opts.sortorder) @@ -633,7 +637,6 @@ haveTempout = True elif pic.picname == 'ReorderSam': - tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir,prefix='ReOrderTempOut') # input cl.append('INPUT=%s' % opts.input) # output @@ -650,18 +653,13 @@ haveTempout = True elif pic.picname == 'ReplaceSamHeader': - tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir,prefix='RSHTempOut') cl.append('INPUT=%s' % opts.input) cl.append('OUTPUT=%s' % tempout) cl.append('HEADER=%s' % opts.header_file) - s = pic.runPic(opts.jar, cl) - if opts.output_format == 'sam': - tlog,newsam = pic.bamToSam(tempout,opts.tmpdir) - shutil.move(newsam,opts.output) - else: - shutil.move(tempout,opts.output) - - elif pic.picname == "CalculateHsMetrics": + pic.runPic(opts.jar, cl) + haveTempout = True + + elif pic.picname == 'CalculateHsMetrics': maxloglines = 100 baitfname = os.path.join(opts.outdir,'rgPicardHsMetrics.bait') targetfname = os.path.join(opts.outdir,'rgPicardHsMetrics.target') @@ -675,9 +673,9 @@ cl.append('INPUT=%s' % os.path.abspath(opts.input)) cl.append('OUTPUT=%s' % pic.metricsOut) cl.append('TMP_DIR=%s' % opts.tmpdir) - pic.runPic(opts.jar,cl) + pic.runPic(opts.jar,cl) - elif pic.picname == "ValidateSamFile": + elif pic.picname == 'ValidateSamFile': import pysam doTranspose = False sortedfile = os.path.join(opts.outdir,'rgValidate.sorted') @@ -710,14 +708,12 @@ if opts.bisulphite.lower() <> 'false': cl.append('IS_BISULFITE_SEQUENCED=true') if opts.ref <> None or opts.ref_file <> None: - cl.append('R=%s' % ref_file_name) - pic.runPic(opts.jar,cl) - if opts.datatype == 'sam': + cl.append('R=%s' % ref_file_name) + pic.runPic(opts.jar,cl) + if opts.datatype == 'sam': pic.delme.append(tempbam) newsam = opts.output - outformat = 'bam' - if opts.newformat == 'sam': - outformat = 'sam' + outformat = 'bam' pe = open(pic.metricsOut,'r').readlines() pic.cleanSam(insam=sortedfile, newsam=newsam, picardErrors=pe,outformat=outformat) pic.delme.append(sortedfile) # not wanted @@ -729,11 +725,7 @@ if haveTempout: # Some Picard tools produced a potentially intermediate bam file. # Either just move to final location or create sam - if opts.newformat == 'sam': - tlog, tempsam = pic.bamToSam( tempout, opts.outdir ) - shutil.move(tempsam,os.path.abspath(opts.output)) - else: - shutil.move(tempout, os.path.abspath(opts.output)) + shutil.move(tempout, os.path.abspath(opts.output)) if opts.htmlout <> None or doFix: # return a pretty html page pic.fixPicardOutputs(transpose=doTranspose,maxloglines=maxloglines) --- a/tools/picard/rgPicardFixMate.xml Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/rgPicardFixMate.xml Tue May 17 01:57:04 2011 -0400 @@ -1,8 +1,8 @@ -<tool name="Paired Read Mate Fixer:" id="rgPicFixMate" version="0.01"> +<tool name="Paired Read Mate Fixer:" id="rgPicFixMate" version="0.2.0"><description>for paired data</description><command interpreter="python"> picard_wrapper.py -i "$input_file" -o "$out_file" --tmpdir "${__new_file_path__}" -n "$out_prefix" - --newformat "$newformat" -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/FixMateInformation.jar" --sortorder "$sortOrder" + --output-format "$outputFormat" -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/FixMateInformation.jar" --sortorder "$sortOrder" </command><requirements><requirement type="package">picard</requirement></requirements><inputs> @@ -16,15 +16,12 @@ </param><param name="out_prefix" value="Fix Mate" type="text" label="Title for the output file - use this remind you what the job was for" size="80" /> - <param name="newformat" type="select" label="Output file format" size="2"> - <option value="bam" selected="true">Bam format</option> - <option value="sam">Sam format</option> - </param> + <param name="outputFormat" type="boolean" checked="True" truevalue="bam" falsevalue="sam" label="Output bam instead of sam" help="Uncheck for sam output" /></inputs><outputs> - <data format="bam" name="out_file" label="SortBam_${out_prefix}.${newformat}"> + <data format="bam" name="out_file" label="${tool.name} on ${on_string}: ${outputFormat} with fixed mates"><change_format> - <when input="newformat" value="sam" format="sam" /> + <when input="outputFormat" value="sam" format="sam" /></change_format></data></outputs> @@ -32,14 +29,14 @@ <test><param name="input_file" value="picard_input_sorted_pair.sam" /><param name="sortOrder" value="coordinate" /> - <param name="newformat" value="bam" /> + <param name="outputFormat" value="True" /><param name="out_prefix" value="Test FixMate" /><output name="out_file" file="picard_output_fixmate_sorted_pair.bam" ftype="bam" /></test><test><param name="input_file" value="picard_input_sorted_pair.sam" /><param name="sortOrder" value="coordinate" /> - <param name="newformat" value="sam" /> + <param name="outputFormat" value="False" /><param name="out_prefix" value="Test FixMate" /><output name="out_file" file="picard_output_fixmate_sorted_pair.sam" ftype="sam" /></test> --- a/tools/picard/rgPicardInsertSize.xml Mon May 16 17:08:06 2011 -0400 +++ b/tools/picard/rgPicardInsertSize.xml Tue May 17 01:57:04 2011 -0400 @@ -1,4 +1,4 @@ -<tool name="Insertion size metrics:" id="PicardInsertSize" version="0.02"> +<tool name="Insertion size metrics:" id="PicardInsertSize" version="0.3.0"><description>for PAIRED data</description><requirements><requirement type="package">picard</requirement></requirements><command interpreter="python"> @@ -31,7 +31,7 @@ <param name="tailLimit" value="10000" /><param name="histWidth" value="0" /><param name="minPct" value="0.01" /> - <output name="html_file" file="picard_output_insertsize_tinysam.html" ftype="html" lines_diff="35" /> + <output name="html_file" file="picard_output_insertsize_tinysam.html" ftype="html" compare="contains" lines_diff="40" /></test></tests><help> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: kanwei: trackster: Refactor LineTrack overflow, fix it to work better for Line and Filled modes
by Bitbucket 16 May '11

16 May '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/a66255ab6b93/ changeset: r5567:a66255ab6b93 user: kanwei date: 2011-05-16 23:08:06 summary: trackster: Refactor LineTrack overflow, fix it to work better for Line and Filled modes affected #: 2 files (679 bytes) --- a/lib/galaxy/visualization/tracks/data_providers.py Mon May 16 10:03:47 2011 -0400 +++ b/lib/galaxy/visualization/tracks/data_providers.py Mon May 16 17:08:06 2011 -0400 @@ -336,7 +336,8 @@ num_points = (end-start) / 1280 if num_points < 1: num_points = end - start - num_points = max(num_points, 10) + else: + num_points = min(num_points, 500) data = bbi.query(chrom, start, end, num_points) f.close() --- a/static/scripts/trackster.js Mon May 16 10:03:47 2011 -0400 +++ b/static/scripts/trackster.js Mon May 16 17:08:06 2011 -0400 @@ -3062,14 +3062,13 @@ // Pixel position of 0 on the y axis var y_zero = Math.round( height + min_value / vertical_range * height ); - // Line at 0.0 + // Horizontal line to denote x-axis if ( mode !== "Intensity" ) { ctx.fillStyle = "#aaa"; ctx.fillRect( 0, y_zero, width, 1 ); } ctx.beginPath(); - ctx.fillStyle = this.prefs.color; var x_scaled, y, delta_x_px; if (data.length > 1) { delta_x_px = Math.ceil((data[1][0] - data[0][0]) * w_scale); @@ -3077,8 +3076,10 @@ delta_x_px = 10; } for (var i = 0, len = data.length; i < len; i++) { + ctx.fillStyle = this.prefs.color; x_scaled = Math.round((data[i][0] - view_start) * w_scale); y = data[i][1]; + var top_overflow = false, bot_overflow = false; if (y === null) { if (in_path && mode === "Filled") { ctx.lineTo(x_scaled, height_px); @@ -3087,8 +3088,10 @@ continue; } if (y < min_value) { + bot_overflow = true; y = min_value; } else if (y > max_value) { + top_overflow = true; y = max_value; } @@ -3116,6 +3119,24 @@ } } } + // Draw lines at boundaries if overflowing min or max + ctx.fillStyle = this.prefs.overflow_color; + if (top_overflow || bot_overflow) { + var overflow_x; + if (mode === "Histogram" || mode === "Intensity") { + overflow_x = delta_x_px; + } else { // Line and Filled, which are points + x_scaled -= 2; // Move it over to the left so it's centered on the point + overflow_x = 4; + } + if (top_overflow) { + ctx.fillRect(x_scaled, 0, overflow_x, 3); + } + if (bot_overflow) { + ctx.fillRect(x_scaled, height_px - 3, overflow_x, 3); + } + } + ctx.fillStyle = this.prefs.color; } if (mode === "Filled") { if (in_path) { @@ -3127,38 +3148,6 @@ ctx.stroke(); } - // Draw lines at bounderies if overflowing min or max - var overflow_min_start = -1, - overflow_max_start = -1; - ctx.fillStyle = this.prefs.overflow_color; - var last_x_scaled; - for (var i = 0, len = data.length; i < len; i++) { - y = data[i][1]; - x_scaled = Math.round((data[i][0] - view_start) * w_scale); - - // If we are in a min/max run, check if it should be ended - if ( overflow_max_start >= 0 && ( y === null || y < max_value ) ) { - // Value does not exist or is in valid range, any overflow ends - ctx.fillRect( overflow_max_start, 0, last_x_scaled + delta_x_px - overflow_max_start, 2 ); - overflow_max_start = -1; - } else if ( overflow_min_start >= 0 && ( y === null || y > min_value ) ) { - // Draw bottom overflow bar - ctx.fillRect( overflow_min_start, height - 2, last_x_scaled + delta_x_px - overflow_min_start, 2 ); - overflow_min_start = -1; - } - - // Now check if we should start a new one (this may happen on the same - // base as above if switching between min/max) - if ( y !== null && y > max_value && overflow_max_start < 0 ) { - // Top overflows and we are not already in a run of overflow - overflow_max_start = x_scaled; - } else if ( y !== null && y < min_value && overflow_min_start < 0 ) { - // Bottom overflows and we are not already in a run - overflow_min_start = x_scaled; - } - last_x_scaled = x_scaled; - } - ctx.restore(); } Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 16 May '11

16 May '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/0d6acef66750/ changeset: r5565:0d6acef66750 user: fubar date: 2011-05-16 15:12:19 summary: repairs to rgfakePed tool for generating null genotype data - since removing the _code.py trick of renaming composite file components means all of the parts (eg map and ped) acquire the default name of RgeneticsData, that's what the tool has to create - rather than sensibly named components based on the title - since only way to fix this wart is to reintroduce a bigger wart using the post execution hook, decided to just go with that default base_name to make things more sustanable in the long term affected #: 3 files (594 bytes) --- a/test-data/rgtestouts/rgfakePed/rgfakePedtest1.lped Fri May 13 21:24:03 2011 -0400 +++ b/test-data/rgtestouts/rgfakePed/rgfakePedtest1.lped Mon May 16 09:12:19 2011 -0400 @@ -9,8 +9,8 @@ </head><body><div class="document"> -<li><a href="rgfakePedtest1.ped">rgfakePedtest1.ped</a></li> -<li><a href="rgfakePedtest1.map">rgfakePedtest1.map</a></li> -<br><h3>This is simulated null genotype data generated by Rgenetics!</h3>rgfakePed.py called with command line:<br><pre>/share/shared/galaxy/tools/rgenetics/rgfakePed.py --title rgfakePedtest1 -o /share/shared/galaxy/test-data/rgtestouts/rgfakePed/rgfakePedtest1.lped -p /share/shared/galaxy/test-data/rgtestouts/rgfakePed -c 20 -n 40 -s 10 -w 0 -v 0 -l pbed -d T -m 0 -M 0 +<li><a href="RgeneticsData.map">RgeneticsData.map</a></li> +<li><a href="RgeneticsData.ped">RgeneticsData.ped</a></li> +<br><h3>This is simulated null genotype data generated by Rgenetics!</h3>rgfakePed.py called with command line:<br><pre>/udd/rerla/galaxy-central/tools/rgenetics/rgfakePed.py --title rgfakePedtest1 -o /export/tmp/tmpy7a643/database/files/000/dataset_1.dat -p /udd/rerla/galaxy-central/database/job_working_directory/1/dataset_1_files -c 20 -n 40 -s 10 -w 0.0 -v 0 -l L -d T -m 0.0 -M 0.0 </pre></div></body></html> \ No newline at end of file --- a/tools/rgenetics/rgfakePed.py Fri May 13 21:24:03 2011 -0400 +++ b/tools/rgenetics/rgfakePed.py Mon May 16 09:12:19 2011 -0400 @@ -1,103 +1,103 @@ -#! /usr/local/bin/python2.4 -# pedigree data faker -# specifically designed for scalability testing of -# Shaun Purcel's PLINK package -# derived from John Ziniti's original suggestion -# allele frequency spectrum and random mating added -# ross lazarus me fecit january 13 2007 -# copyright ross lazarus 2007 -# without psyco -# generates about 10k snp genotypes in 2k subjects (666 trios) per minute or so. -# so 500k (a billion genotypes), at about 4 trios/min will a couple of hours to generate -# psyco makes it literally twice as quick!! -# all rights reserved except as granted under the terms of the LGPL -# see http://www.gnu.org/licenses/lgpl.html -# for a copy of the license you receive with this software -# and for your rights and obligations -# especially if you wish to modify or redistribute this code -# january 19 added random missingness inducer -# currently about 15M genos/minute without psyco, 30M/minute with -# so a billion genos should take about 40 minutes with psyco or 80 without... -# added mendel error generator jan 23 rml - - +#! /usr/local/bin/python2.4 +# pedigree data faker +# specifically designed for scalability testing of +# Shaun Purcel's PLINK package +# derived from John Ziniti's original suggestion +# allele frequency spectrum and random mating added +# ross lazarus me fecit january 13 2007 +# copyright ross lazarus 2007 +# without psyco +# generates about 10k snp genotypes in 2k subjects (666 trios) per minute or so. +# so 500k (a billion genotypes), at about 4 trios/min will a couple of hours to generate +# psyco makes it literally twice as quick!! +# all rights reserved except as granted under the terms of the LGPL +# see http://www.gnu.org/licenses/lgpl.html +# for a copy of the license you receive with this software +# and for your rights and obligations +# especially if you wish to modify or redistribute this code +# january 19 added random missingness inducer +# currently about 15M genos/minute without psyco, 30M/minute with +# so a billion genos should take about 40 minutes with psyco or 80 without... +# added mendel error generator jan 23 rml + + import random,sys,time,os,string - -from optparse import OptionParser - - -width = 500000 -ALLELES = ['1','2','3','4'] -prog = os.path.split(sys.argv[0])[-1] -debug = 0 - -"""Natural-order sorting, supporting embedded numbers. -# found at http://lists.canonical.org/pipermail/kragen-hacks/2005-October/000419.html -note test code there removed to conserve brain space -foo9bar2 < foo10bar2 < foo10bar10 - -""" -import random, re, sys - -def natsort_key(item): - chunks = re.split('(\d+(?:\.\d+)?)', item) - for ii in range(len(chunks)): - if chunks[ii] and chunks[ii][0] in '0123456789': - if '.' in chunks[ii]: numtype = float - else: numtype = int - # wrap in tuple with '0' to explicitly specify numbers come first - chunks[ii] = (0, numtype(chunks[ii])) - else: - chunks[ii] = (1, chunks[ii]) - return (chunks, item) - -def natsort(seq): - "Sort a sequence of text strings in a reasonable order." - alist = [item for item in seq] - alist.sort(key=natsort_key) - return alist - - -def makeUniformMAFdist(low=0.02, high=0.5): - """Fake a non-uniform maf distribution to make the data - more interesting. Provide uniform 0.02-0.5 distribution""" - MAFdistribution = [] - for i in xrange(int(100*low),int(100*high)+1): - freq = i/100.0 # uniform - MAFdistribution.append(freq) - return MAFdistribution - -def makeTriangularMAFdist(low=0.02, high=0.5, beta=5): - """Fake a non-uniform maf distribution to make the data - more interesting - more rare alleles """ - MAFdistribution = [] - for i in xrange(int(100*low),int(100*high)+1): - freq = (51 - i)/100.0 # large numbers of small allele freqs - for j in range(beta*i): # or i*i for crude exponential distribution - MAFdistribution.append(freq) - return MAFdistribution - -def makeFbathead(rslist=[], chromlist=[], poslist=[], width=100000): - """header row - """ - res = ['%s_%s_%s' % (chromlist[x], poslist[x], rslist[x]) for x in range(len(rslist))] - return ' '.join(res) - -def makeMap( width=500000, MAFdistribution=[], useGP=False): - """make snp allele and frequency tables for consistent generation""" - usegp = 1 - snpdb = 'snp126' - hgdb = 'hg18' - alleles = [] - freqs = [] - rslist = [] - chromlist = [] - poslist = [] - for snp in range(width): - random.shuffle(ALLELES) - alleles.append(ALLELES[0:2]) # need two DIFFERENT alleles! + +from optparse import OptionParser + +defbasename="RgeneticsData" +width = 500000 +ALLELES = ['1','2','3','4'] +prog = os.path.split(sys.argv[0])[-1] +debug = 0 + +"""Natural-order sorting, supporting embedded numbers. +# found at http://lists.canonical.org/pipermail/kragen-hacks/2005-October/000419.html +note test code there removed to conserve brain space +foo9bar2 < foo10bar2 < foo10bar10 + +""" +import random, re, sys + +def natsort_key(item): + chunks = re.split('(\d+(?:\.\d+)?)', item) + for ii in range(len(chunks)): + if chunks[ii] and chunks[ii][0] in '0123456789': + if '.' in chunks[ii]: numtype = float + else: numtype = int + # wrap in tuple with '0' to explicitly specify numbers come first + chunks[ii] = (0, numtype(chunks[ii])) + else: + chunks[ii] = (1, chunks[ii]) + return (chunks, item) + +def natsort(seq): + "Sort a sequence of text strings in a reasonable order." + alist = [item for item in seq] + alist.sort(key=natsort_key) + return alist + + +def makeUniformMAFdist(low=0.02, high=0.5): + """Fake a non-uniform maf distribution to make the data + more interesting. Provide uniform 0.02-0.5 distribution""" + MAFdistribution = [] + for i in xrange(int(100*low),int(100*high)+1): + freq = i/100.0 # uniform + MAFdistribution.append(freq) + return MAFdistribution + +def makeTriangularMAFdist(low=0.02, high=0.5, beta=5): + """Fake a non-uniform maf distribution to make the data + more interesting - more rare alleles """ + MAFdistribution = [] + for i in xrange(int(100*low),int(100*high)+1): + freq = (51 - i)/100.0 # large numbers of small allele freqs + for j in range(beta*i): # or i*i for crude exponential distribution + MAFdistribution.append(freq) + return MAFdistribution + +def makeFbathead(rslist=[], chromlist=[], poslist=[], width=100000): + """header row + """ + res = ['%s_%s_%s' % (chromlist[x], poslist[x], rslist[x]) for x in range(len(rslist))] + return ' '.join(res) + +def makeMap( width=500000, MAFdistribution=[], useGP=False): + """make snp allele and frequency tables for consistent generation""" + usegp = 1 + snpdb = 'snp126' + hgdb = 'hg18' + alleles = [] + freqs = [] + rslist = [] + chromlist = [] + poslist = [] + for snp in range(width): + random.shuffle(ALLELES) + alleles.append(ALLELES[0:2]) # need two DIFFERENT alleles! freqs.append(random.choice(MAFdistribution)) # more rare alleles - if useGP: + if useGP: try: import MySQLdb genome = MySQLdb.Connect('localhost', 'hg18', 'G3gn0m3') @@ -106,402 +106,402 @@ if debug: print 'cannot connect to local copy of golden path' usegp = 0 - if usegp and useGP: # urrrgghh getting snps into chrom offset order is complicated.... - curs.execute('use %s' % hgdb) - print 'Collecting %d real rs numbers - this may take a while' % width - # get a random draw of enough reasonable (hapmap) snps with frequency data - s = '''select distinct chrom,chromEnd, name from %s where avHet > 0 and chrom not like '%%random' - group by name order by rand() limit %d''' % (snpdb,width) - curs.execute(s) - reslist = curs.fetchall() - reslist = ['%s\t%09d\t%s' % (x[3:],y,z) for x,y,z in reslist] # get rid of chr - reslist = natsort(reslist) - for s in reslist: - chrom,pos,rs = s.split('\t') - rslist.append(rs) - chromlist.append(chrom) - poslist.append(pos) - else: - chrom = '1' - for snp in range(width): - pos = '%d' % (1000*snp) - rs = 'rs00%d' % snp - rslist.append(rs) - chromlist.append(chrom) - poslist.append(pos) - return alleles,freqs, rslist, chromlist, poslist - -def writeMap(fprefix = '', fpath='./', rslist=[], chromlist=[], poslist=[], width = 500000): - """make a faked plink compatible map file - fbat files + if usegp and useGP: # urrrgghh getting snps into chrom offset order is complicated.... + curs.execute('use %s' % hgdb) + print 'Collecting %d real rs numbers - this may take a while' % width + # get a random draw of enough reasonable (hapmap) snps with frequency data + s = '''select distinct chrom,chromEnd, name from %s where avHet > 0 and chrom not like '%%random' + group by name order by rand() limit %d''' % (snpdb,width) + curs.execute(s) + reslist = curs.fetchall() + reslist = ['%s\t%09d\t%s' % (x[3:],y,z) for x,y,z in reslist] # get rid of chr + reslist = natsort(reslist) + for s in reslist: + chrom,pos,rs = s.split('\t') + rslist.append(rs) + chromlist.append(chrom) + poslist.append(pos) + else: + chrom = '1' + for snp in range(width): + pos = '%d' % (1000*snp) + rs = 'rs00%d' % snp + rslist.append(rs) + chromlist.append(chrom) + poslist.append(pos) + return alleles,freqs, rslist, chromlist, poslist + +def writeMap(fprefix = '', fpath='./', rslist=[], chromlist=[], poslist=[], width = 500000): + """make a faked plink compatible map file - fbat files have the map written as a header line""" outf = '%s.map'% (fprefix) - outf = os.path.join(fpath,outf) - amap = open(outf, 'w') - res = ['%s\t%s\t0\t%s' % (chromlist[x],rslist[x],poslist[x]) for x in range(len(rslist))] - res.append('') - amap.write('\n'.join(res)) - amap.close() - -def makeMissing(genos=[], missrate = 0.03, missval = '0'): - """impose some random missingness""" - nsnps = len(genos) - for snp in range(nsnps): # ignore first 6 columns - if random.random() <= missrate: - genos[snp] = '%s %s' % (missval,missval) - return genos - -def makeTriomissing(genos=[], missrate = 0.03, missval = '0'): - """impose some random missingness on a trio - moth eaten like real data""" - for person in (0,1): - nsnps = len(genos[person]) - for snp in range(nsnps): - for person in [0,1,2]: - if random.random() <= missrate: - genos[person][snp] = '%s %s' % (missval,missval) - return genos - - -def makeTriomendel(p1g=(0,0),p2g=(0,0), kiddip = (0,0)): - """impose some random mendels on a trio - there are 8 of the 9 mating types we can simulate reasonable errors for - Note, since random mating dual het parents can produce any genotype we can't generate an interesting - error for them, so the overall mendel rate will be lower than mendrate, depending on - allele frequency...""" - if p1g[0] <> p1g[1] and p2g[0] <> p2g[1]: # both parents het - return kiddip # cannot simulate a mendel error - anything is legal! - elif (p1g[0] <> p1g[1]): # p1 is het parent so p2 must be hom - if p2g[0] == 0: # - make child p2 opposite hom for error - kiddip = (1,1) - else: - kiddip = (0,0) - elif (p2g[0] <> p2g[1]): # p2 is het parent so p1 must be hom - if p1g[0] == 0: # - make child p1 opposite hom for error - kiddip = (1,1) - else: - kiddip = (0,0) - elif (p1g[0] == p1g[1]): # p1 is hom parent and if we get here p2 must also be hom - if p1g[0] == p2g[0]: # both parents are same hom - make child either het or opposite hom for error - if random.random() <= 0.5: - kiddip = (0,1) - else: - if p1g[0] == 0: - kiddip = (1,1) - else: - kiddip = (0,0) - else: # parents are opposite hom - return any hom as an error - if random.random() <= 0.5: - kiddip = (0,0) - else: - kiddip = (1,1) - return kiddip - - - - -def makeFam(width=100, freqs={}, alleles={}, trio=1, missrate=0.03, missval='0', mendrate=0.0): - """this family is a simple trio, constructed by random mating two random genotypes - TODO: why not generate from chromosomes - eg hapmap - set each haplotype locus according to the conditional - probability implied by the surrounding loci - eg use both neighboring pairs, triplets - and quads as observed in hapmap ceu""" - dadped = '%d 1 0 0 1 1 %s' - mumped = '%d 2 0 0 2 1 %s' # a mother is a mum where I come from :) - kidped = '%d 3 1 2 %d %d %s' - family = [] # result accumulator - sex = random.choice((1,2)) # for the kid - affected = random.choice((1,2)) - genos = [[],[],[]] # dad, mum, kid - 0/1 for common,rare initially, then xform to alleles - # parent1...kidn lists of 0/1 for common,rare initially, then xformed to alleles - for snp in xrange(width): - f = freqs[snp] - for i in range(2): # do dad and mum - p = random.random() - a1 = a2 = 0 - if p <= f: # a rare allele - a1 = 1 - p = random.random() - if p <= f: # a rare allele - a2 = 1 - if a1 > a2: - a1,a2 = a2,a1 # so ordering consistent - 00,01,11 - dip = (a1,a2) - genos[i].append(dip) # tuples of 0,1 - a1 = random.choice(genos[0][snp]) # dad gamete - a2 = random.choice(genos[1][snp]) # mum gamete - if a1 > a2: - a1,a2 = a2,a1 # so ordering consistent - 00,01,11 - kiddip = (a1,a2) # NSFW mating! - genos[2].append(kiddip) - if mendrate > 0: - if random.random() <= mendrate: - genos[2][snp] = makeTriomendel(genos[0][snp],genos[1][snp], kiddip) - achoice = alleles[snp] - for g in genos: # now convert to alleles using allele dict - a1 = achoice[g[snp][0]] # get allele letter - a2 = achoice[g[snp][1]] - g[snp] = '%s %s' % (a1,a2) - if missrate > 0: - genos = makeTriomissing(genos=genos,missrate=missrate, missval=missval) - family.append(dadped % (trio,' '.join(genos[0]))) # create a row for each member of trio - family.append(mumped % (trio,' '.join(genos[1]))) - family.append(kidped % (trio,sex,affected,' '.join(genos[2]))) - return family - -def makePerson(width=100, aff=1, freqs={}, alleles={}, id=1, missrate = 0.03, missval='0'): - """make an entire genotype vector for an independent subject""" - sex = random.choice((1,2)) - if not aff: - aff = random.choice((1,2)) - genos = [] #0/1 for common,rare initially, then xform to alleles - family = [] - personped = '%d 1 0 0 %d %d %s' - poly = (0,1) - for snp in xrange(width): - achoice = alleles[snp] - f = freqs[snp] - p = random.random() - a1 = a2 = 0 - if p <= f: # a rare allele - a1 = 1 - p = random.random() - if p <= f: # a rare allele - a2 = 1 - if a1 > a2: - a1,a2 = a2,a1 # so ordering consistent - 00,01,11 - a1 = achoice[a1] # get allele letter - a2 = achoice[a2] - g = '%s %s' % (a1,a2) - genos.append(g) - if missrate > 0.0: - genos = makeMissing(genos=genos,missrate=missrate, missval=missval) - family.append(personped % (id,sex,aff,' '.join(genos))) - return family - -def makeHapmap(fprefix= 'fakebigped',width=100, aff=[], freqs={}, - alleles={}, nsubj = 2000, trios = True, mendrate=0.03, missrate = 0.03, missval='0'): - """ fake a hapmap file and a pedigree file for eg haploview - this is arranged as the transpose of a ped file - cols are subjects, rows are markers - so we need to generate differently since we can't do the transpose in ram reliably for - a few billion genotypes... - """ - outheadprefix = 'rs# alleles chrom pos strand assembly# center protLSID assayLSID panelLSID QCcode %s' - cfake5 = ["illumina","urn:LSID:illumina.hapmap.org:Protocol:Golden_Gate_1.0.0:1", -"urn:LSID:illumina.hapmap.org:Assay:27741:1","urn:lsid:dcc.hapmap.org:Panel:CEPH-30-trios:1","QC+"] - yfake5 = ["illumina","urn:LSID:illumina.hapmap.org:Protocol:Golden_Gate_1.0.0:1", -"urn:LSID:illumina.hapmap.org:Assay:27741:1","urn:LSID:dcc.hapmap.org:Panel:Yoruba-30-trios:1","QC+"] - sampids = ids - if trios: - ts = '%d trios' % int(nsubj/3.) - else: - ts = '%d unrelated subjects' % nsubj - res = ['#%s fake hapmap file %d snps and %s, faked by %s' % (timenow(), width, ts, prog),] - res.append('# ross lazarus me fecit') - res.append(outheadprefix % ' '.join(sampids)) # make a header compatible with hapmap extracts - outf = open('%s.hmap' % (fprefix), 'w') - started = time.time() - if trios: - ntrios = int(nsubj/3.) - for n in ntrios: # each is a dict - row = copy.copy(cfake5) # get first fields - row = map(str,row) - if race == "YRI": - row += yfake5 - elif race == 'CEU': - row += cfake5 - else: - row += ['NA' for x in range(5)] # 5 dummy fields = center protLSID assayLSID panelLSID QCcode - row += [''.join(sorted(line[x])) for x in sampids] # the genotypes in header (sorted) sample id order - res.append(' '.join(row)) - res.append('') - outfname = '%s_%s_%s_%dkb.geno' % (gene,probeid,race,2*flank/1000) - f = file(outfname,'w') - f.write('\n'.join(res)) - f.close() - print '### %s: Wrote %d lines to %s' % (timenow(), len(res),outfname) - - + outf = os.path.join(fpath,outf) + amap = open(outf, 'w') + res = ['%s\t%s\t0\t%s' % (chromlist[x],rslist[x],poslist[x]) for x in range(len(rslist))] + res.append('') + amap.write('\n'.join(res)) + amap.close() + +def makeMissing(genos=[], missrate = 0.03, missval = '0'): + """impose some random missingness""" + nsnps = len(genos) + for snp in range(nsnps): # ignore first 6 columns + if random.random() <= missrate: + genos[snp] = '%s %s' % (missval,missval) + return genos + +def makeTriomissing(genos=[], missrate = 0.03, missval = '0'): + """impose some random missingness on a trio - moth eaten like real data""" + for person in (0,1): + nsnps = len(genos[person]) + for snp in range(nsnps): + for person in [0,1,2]: + if random.random() <= missrate: + genos[person][snp] = '%s %s' % (missval,missval) + return genos + + +def makeTriomendel(p1g=(0,0),p2g=(0,0), kiddip = (0,0)): + """impose some random mendels on a trio + there are 8 of the 9 mating types we can simulate reasonable errors for + Note, since random mating dual het parents can produce any genotype we can't generate an interesting + error for them, so the overall mendel rate will be lower than mendrate, depending on + allele frequency...""" + if p1g[0] <> p1g[1] and p2g[0] <> p2g[1]: # both parents het + return kiddip # cannot simulate a mendel error - anything is legal! + elif (p1g[0] <> p1g[1]): # p1 is het parent so p2 must be hom + if p2g[0] == 0: # - make child p2 opposite hom for error + kiddip = (1,1) + else: + kiddip = (0,0) + elif (p2g[0] <> p2g[1]): # p2 is het parent so p1 must be hom + if p1g[0] == 0: # - make child p1 opposite hom for error + kiddip = (1,1) + else: + kiddip = (0,0) + elif (p1g[0] == p1g[1]): # p1 is hom parent and if we get here p2 must also be hom + if p1g[0] == p2g[0]: # both parents are same hom - make child either het or opposite hom for error + if random.random() <= 0.5: + kiddip = (0,1) + else: + if p1g[0] == 0: + kiddip = (1,1) + else: + kiddip = (0,0) + else: # parents are opposite hom - return any hom as an error + if random.random() <= 0.5: + kiddip = (0,0) + else: + kiddip = (1,1) + return kiddip + + + + +def makeFam(width=100, freqs={}, alleles={}, trio=1, missrate=0.03, missval='0', mendrate=0.0): + """this family is a simple trio, constructed by random mating two random genotypes + TODO: why not generate from chromosomes - eg hapmap + set each haplotype locus according to the conditional + probability implied by the surrounding loci - eg use both neighboring pairs, triplets + and quads as observed in hapmap ceu""" + dadped = '%d 1 0 0 1 1 %s' + mumped = '%d 2 0 0 2 1 %s' # a mother is a mum where I come from :) + kidped = '%d 3 1 2 %d %d %s' + family = [] # result accumulator + sex = random.choice((1,2)) # for the kid + affected = random.choice((1,2)) + genos = [[],[],[]] # dad, mum, kid - 0/1 for common,rare initially, then xform to alleles + # parent1...kidn lists of 0/1 for common,rare initially, then xformed to alleles + for snp in xrange(width): + f = freqs[snp] + for i in range(2): # do dad and mum + p = random.random() + a1 = a2 = 0 + if p <= f: # a rare allele + a1 = 1 + p = random.random() + if p <= f: # a rare allele + a2 = 1 + if a1 > a2: + a1,a2 = a2,a1 # so ordering consistent - 00,01,11 + dip = (a1,a2) + genos[i].append(dip) # tuples of 0,1 + a1 = random.choice(genos[0][snp]) # dad gamete + a2 = random.choice(genos[1][snp]) # mum gamete + if a1 > a2: + a1,a2 = a2,a1 # so ordering consistent - 00,01,11 + kiddip = (a1,a2) # NSFW mating! + genos[2].append(kiddip) + if mendrate > 0: + if random.random() <= mendrate: + genos[2][snp] = makeTriomendel(genos[0][snp],genos[1][snp], kiddip) + achoice = alleles[snp] + for g in genos: # now convert to alleles using allele dict + a1 = achoice[g[snp][0]] # get allele letter + a2 = achoice[g[snp][1]] + g[snp] = '%s %s' % (a1,a2) + if missrate > 0: + genos = makeTriomissing(genos=genos,missrate=missrate, missval=missval) + family.append(dadped % (trio,' '.join(genos[0]))) # create a row for each member of trio + family.append(mumped % (trio,' '.join(genos[1]))) + family.append(kidped % (trio,sex,affected,' '.join(genos[2]))) + return family + +def makePerson(width=100, aff=1, freqs={}, alleles={}, id=1, missrate = 0.03, missval='0'): + """make an entire genotype vector for an independent subject""" + sex = random.choice((1,2)) + if not aff: + aff = random.choice((1,2)) + genos = [] #0/1 for common,rare initially, then xform to alleles + family = [] + personped = '%d 1 0 0 %d %d %s' + poly = (0,1) + for snp in xrange(width): + achoice = alleles[snp] + f = freqs[snp] + p = random.random() + a1 = a2 = 0 + if p <= f: # a rare allele + a1 = 1 + p = random.random() + if p <= f: # a rare allele + a2 = 1 + if a1 > a2: + a1,a2 = a2,a1 # so ordering consistent - 00,01,11 + a1 = achoice[a1] # get allele letter + a2 = achoice[a2] + g = '%s %s' % (a1,a2) + genos.append(g) + if missrate > 0.0: + genos = makeMissing(genos=genos,missrate=missrate, missval=missval) + family.append(personped % (id,sex,aff,' '.join(genos))) + return family + +def makeHapmap(fprefix= 'fakebigped',width=100, aff=[], freqs={}, + alleles={}, nsubj = 2000, trios = True, mendrate=0.03, missrate = 0.03, missval='0'): + """ fake a hapmap file and a pedigree file for eg haploview + this is arranged as the transpose of a ped file - cols are subjects, rows are markers + so we need to generate differently since we can't do the transpose in ram reliably for + a few billion genotypes... + """ + outheadprefix = 'rs# alleles chrom pos strand assembly# center protLSID assayLSID panelLSID QCcode %s' + cfake5 = ["illumina","urn:LSID:illumina.hapmap.org:Protocol:Golden_Gate_1.0.0:1", +"urn:LSID:illumina.hapmap.org:Assay:27741:1","urn:lsid:dcc.hapmap.org:Panel:CEPH-30-trios:1","QC+"] + yfake5 = ["illumina","urn:LSID:illumina.hapmap.org:Protocol:Golden_Gate_1.0.0:1", +"urn:LSID:illumina.hapmap.org:Assay:27741:1","urn:LSID:dcc.hapmap.org:Panel:Yoruba-30-trios:1","QC+"] + sampids = ids + if trios: + ts = '%d trios' % int(nsubj/3.) + else: + ts = '%d unrelated subjects' % nsubj + res = ['#%s fake hapmap file %d snps and %s, faked by %s' % (timenow(), width, ts, prog),] + res.append('# ross lazarus me fecit') + res.append(outheadprefix % ' '.join(sampids)) # make a header compatible with hapmap extracts + outf = open('%s.hmap' % (fprefix), 'w') + started = time.time() + if trios: + ntrios = int(nsubj/3.) + for n in ntrios: # each is a dict + row = copy.copy(cfake5) # get first fields + row = map(str,row) + if race == "YRI": + row += yfake5 + elif race == 'CEU': + row += cfake5 + else: + row += ['NA' for x in range(5)] # 5 dummy fields = center protLSID assayLSID panelLSID QCcode + row += [''.join(sorted(line[x])) for x in sampids] # the genotypes in header (sorted) sample id order + res.append(' '.join(row)) + res.append('') + outfname = '%s_%s_%s_%dkb.geno' % (gene,probeid,race,2*flank/1000) + f = file(outfname,'w') + f.write('\n'.join(res)) + f.close() + print '### %s: Wrote %d lines to %s' % (timenow(), len(res),outfname) + + def makePed(fprefix= 'fakebigped', fpath='./', - width=500000, nsubj=2000, MAFdistribution=[],alleles={}, - freqs={}, fbatstyle=True, mendrate = 0.0, missrate = 0.03, missval='0',fbathead=''): - """fake trios with mendel consistent random mating genotypes in offspring - with consistent alleles and MAFs for the sample""" - res = [] - if fbatstyle: # add a header row with the marker names + width=500000, nsubj=2000, MAFdistribution=[],alleles={}, + freqs={}, fbatstyle=True, mendrate = 0.0, missrate = 0.03, missval='0',fbathead=''): + """fake trios with mendel consistent random mating genotypes in offspring + with consistent alleles and MAFs for the sample""" + res = [] + if fbatstyle: # add a header row with the marker names res.append(fbathead) # header row for fbat outfname = '%s.ped'% (fprefix) outfname = os.path.join(fpath,outfname) - outf = open(outfname,'w') - ntrios = int(nsubj/3.) - outf = open(outfile, 'w') - started = time.time() - for trio in xrange(ntrios): - family = makeFam(width=width, freqs=freqs, alleles=alleles, trio=trio, - missrate = missrate, mendrate=mendrate, missval=missval) - res += family - if (trio + 1) % 10 == 0: # write out to keep ram requirements reasonable - if (trio + 1) % 50 == 0: # show progress - dur = time.time() - started - if dur == 0: - dur = 1.0 - print 'Trio: %d, %4.1f genos/sec at %6.1f sec' % (trio + 1, width*trio*3/dur, dur) - outf.write('\n'.join(res)) - outf.write('\n') - res = [] - if len(res) > 0: # some left - outf.write('\n'.join(res)) - outf.write('\n') - outf.close() + outf = open(outfname,'w') + ntrios = int(nsubj/3.) + outf = open(outfile, 'w') + started = time.time() + for trio in xrange(ntrios): + family = makeFam(width=width, freqs=freqs, alleles=alleles, trio=trio, + missrate = missrate, mendrate=mendrate, missval=missval) + res += family + if (trio + 1) % 10 == 0: # write out to keep ram requirements reasonable + if (trio + 1) % 50 == 0: # show progress + dur = time.time() - started + if dur == 0: + dur = 1.0 + print 'Trio: %d, %4.1f genos/sec at %6.1f sec' % (trio + 1, width*trio*3/dur, dur) + outf.write('\n'.join(res)) + outf.write('\n') + res = [] + if len(res) > 0: # some left + outf.write('\n'.join(res)) + outf.write('\n') + outf.close() if debug: - print '##makeped : %6.1f seconds total runtime' % (time.time() - started) - + print '##makeped : %6.1f seconds total runtime' % (time.time() - started) + def makeIndep(fprefix = 'fakebigped', fpath='./', - width=500000, Nunaff=1000, Naff=1000, MAFdistribution=[], - alleles={}, freqs={}, fbatstyle=True, missrate = 0.03, missval='0',fbathead=''): - """fake a random sample from a random mating sample - with consistent alleles and MAFs""" - res = [] - Ntot = Nunaff + Naff - status = [1,]*Nunaff + width=500000, Nunaff=1000, Naff=1000, MAFdistribution=[], + alleles={}, freqs={}, fbatstyle=True, missrate = 0.03, missval='0',fbathead=''): + """fake a random sample from a random mating sample + with consistent alleles and MAFs""" + res = [] + Ntot = Nunaff + Naff + status = [1,]*Nunaff status += [2,]*Nunaff outf = '%s.ped' % (fprefix) - outf = os.path.join(fpath,outf) - outf = open(outf, 'w') - started = time.time() - #sample = personMaker(width=width, affs=status, freqs=freqs, alleles=alleles, Ntomake=Ntot) - if fbatstyle: # add a header row with the marker names - res.append(fbathead) # header row for fbat - for id in xrange(Ntot): - if id < Nunaff: - aff = 1 - else: - aff = 2 - family = makePerson(width=width, aff=aff, freqs=freqs, alleles=alleles, id=id+1) - res += family - if (id % 50 == 0): # write out to keep ram requirements reasonable - if (id % 200 == 0): # show progress - dur = time.time() - started - if dur == 0: - dur = 1.0 - print 'Id: %d, %4.1f genos/sec at %6.1f sec' % (id, width*id/dur, dur) - outf.write('\n'.join(res)) - outf.write('\n') - res = [] - if len(res) > 0: # some left - outf.write('\n'.join(res)) - outf.write('\n') - outf.close() - print '## makeindep: %6.1f seconds total runtime' % (time.time() - started) - -u = """ -Generate either trios or independent subjects with a prespecified -number of random alleles and a uniform or triangular MAF distribution for -stress testing. No LD is simulated - alleles are random. Offspring for -trios are generated by random mating the random parental alleles so there are -no Mendelian errors unless the -M option is used. Mendelian errors are generated -randomly according to the possible errors given the parental mating type although -this is fresh code and not guaranteed to work quite right yet - comments welcomed - -Enquiries to ross.lazarus(a)gmail.com - -eg to generate 700 trios with 500k snps, use: -fakebigped.py -n 2100 -s 500000 -or to generate 500 independent cases and 500 controls with 100k snps and 0.02 missingness (MCAR), use: -fakebigped.py -c 500 -n 1000 -s 100000 -m 0.02 - -fakebigped.py -o myfake -m 0.05 -s 100000 -n 2000 -will make fbat compatible myfake.ped with 100k markers in -666 trios (total close to 2000 subjects), a uniform MAF distribution and about 5% MCAR missing - -fakebigped.py -o myfake -m 0.05 -s 100000 -n 2000 -M 0.05 -will make fbat compatible myfake.ped with 100k markers in -666 trios (total close to 2000 subjects), a uniform MAF distribution, -about 5% Mendelian errors and about 5% MCAR missing - - -fakebigped.py -o myfakecc -m 0.05 -s 100000 -n 2000 -c 1000 -l -will make plink compatible myfakecc.ped and myfakecc.map (that's what the -l option does), -with 100k markers in 1000 cases and 1000 controls (affection status 2 and 1 respectively), -a triangular MAF distribution (more rare alleles) and about 5% MCAR missing - -You should see about 1/4 million genotypes/second so about an hour for a -500k snps in 2k subjects and about a 4GB ped file - these are BIG!! - -""" - -import sys, os, glob - -galhtmlprefix = """<?xml version="1.0" encoding="utf-8" ?> -<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> -<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> -<head> -<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> -<meta name="generator" content="Galaxy %s tool output - see http://g2.trac.bx.psu.edu/" /> -<title></title> -<link rel="stylesheet" href="/static/style/base.css" type="text/css" /> -</head> -<body> -<div class="document"> -""" - - -def doImport(outfile=None,outpath=None): - """ import into one of the new html composite data types for Rgenetics - Dan Blankenberg with mods by Ross Lazarus - October 2007 - """ - flist = glob.glob(os.path.join(outpath,'*')) - outf = open(outfile,'w') - outf.write(galhtmlprefix % prog) - for i, data in enumerate( flist ): - outf.write('<li><a href="%s">%s</a></li>\n' % (os.path.split(data)[-1],os.path.split(data)[-1])) + outf = os.path.join(fpath,outf) + outf = open(outf, 'w') + started = time.time() + #sample = personMaker(width=width, affs=status, freqs=freqs, alleles=alleles, Ntomake=Ntot) + if fbatstyle: # add a header row with the marker names + res.append(fbathead) # header row for fbat + for id in xrange(Ntot): + if id < Nunaff: + aff = 1 + else: + aff = 2 + family = makePerson(width=width, aff=aff, freqs=freqs, alleles=alleles, id=id+1) + res += family + if (id % 50 == 0): # write out to keep ram requirements reasonable + if (id % 200 == 0): # show progress + dur = time.time() - started + if dur == 0: + dur = 1.0 + print 'Id: %d, %4.1f genos/sec at %6.1f sec' % (id, width*id/dur, dur) + outf.write('\n'.join(res)) + outf.write('\n') + res = [] + if len(res) > 0: # some left + outf.write('\n'.join(res)) + outf.write('\n') + outf.close() + print '## makeindep: %6.1f seconds total runtime' % (time.time() - started) + +u = """ +Generate either trios or independent subjects with a prespecified +number of random alleles and a uniform or triangular MAF distribution for +stress testing. No LD is simulated - alleles are random. Offspring for +trios are generated by random mating the random parental alleles so there are +no Mendelian errors unless the -M option is used. Mendelian errors are generated +randomly according to the possible errors given the parental mating type although +this is fresh code and not guaranteed to work quite right yet - comments welcomed + +Enquiries to ross.lazarus(a)gmail.com + +eg to generate 700 trios with 500k snps, use: +fakebigped.py -n 2100 -s 500000 +or to generate 500 independent cases and 500 controls with 100k snps and 0.02 missingness (MCAR), use: +fakebigped.py -c 500 -n 1000 -s 100000 -m 0.02 + +fakebigped.py -o myfake -m 0.05 -s 100000 -n 2000 +will make fbat compatible myfake.ped with 100k markers in +666 trios (total close to 2000 subjects), a uniform MAF distribution and about 5% MCAR missing + +fakebigped.py -o myfake -m 0.05 -s 100000 -n 2000 -M 0.05 +will make fbat compatible myfake.ped with 100k markers in +666 trios (total close to 2000 subjects), a uniform MAF distribution, +about 5% Mendelian errors and about 5% MCAR missing + + +fakebigped.py -o myfakecc -m 0.05 -s 100000 -n 2000 -c 1000 -l +will make plink compatible myfakecc.ped and myfakecc.map (that's what the -l option does), +with 100k markers in 1000 cases and 1000 controls (affection status 2 and 1 respectively), +a triangular MAF distribution (more rare alleles) and about 5% MCAR missing + +You should see about 1/4 million genotypes/second so about an hour for a +500k snps in 2k subjects and about a 4GB ped file - these are BIG!! + +""" + +import sys, os, glob + +galhtmlprefix = """<?xml version="1.0" encoding="utf-8" ?> +<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> +<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> +<head> +<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> +<meta name="generator" content="Galaxy %s tool output - see http://g2.trac.bx.psu.edu/" /> +<title></title> +<link rel="stylesheet" href="/static/style/base.css" type="text/css" /> +</head> +<body> +<div class="document"> +""" + + +def doImport(outfile=None,outpath=None): + """ import into one of the new html composite data types for Rgenetics + Dan Blankenberg with mods by Ross Lazarus + October 2007 + """ + flist = glob.glob(os.path.join(outpath,'*')) + outf = open(outfile,'w') + outf.write(galhtmlprefix % prog) + for i, data in enumerate( flist ): + outf.write('<li><a href="%s">%s</a></li>\n' % (os.path.split(data)[-1],os.path.split(data)[-1])) outf.write('<br><h3>This is simulated null genotype data generated by Rgenetics!</h3>') outf.write('%s called with command line:<br><pre>' % prog) outf.write(' '.join(sys.argv)) - outf.write('\n</pre>\n') - outf.write("</div></body></html>") - outf.close() - - - -if __name__ == "__main__": - """ - """ - parser = OptionParser(usage=u, version="%prog 0.01") - a = parser.add_option - a("-n","--nsubjects",type="int",dest="Ntot", - help="nsubj: total number of subjects",default=2000) - a("-t","--title",dest="title", - help="title: file basename for outputs",default='fakeped') - a("-c","--cases",type="int",dest="Naff", - help="number of cases: independent subjects with status set to 2 (ie cases). If not set, NTOT/3 trios will be generated", default = 0) - a("-s","--snps",dest="width",type="int", - help="snps: total number of snps per subject", default=1000) - a("-d","--distribution",dest="MAFdist",default="Uniform", - help="MAF distribution - default is Uniform, can be Triangular") - a("-o","--outf",dest="outf", - help="Output file", default = 'fakeped') - a("-p","--outpath",dest="outpath", - help="Path for output files", default = './') - a("-l","--pLink",dest="outstyle", default='L', - help="Ped files as for Plink - no header, separate Map file - default is Plink style") - a("-w","--loWmaf", type="float", dest="lowmaf", default=0.01, help="Lower limit for SNP MAF (minor allele freq)") - a("-m","--missing",dest="missrate",type="float", - help="missing: probability of missing MCAR - default 0.0", default=0.0) - a("-v","--valmiss",dest="missval", - help="missing character: Missing allele code - usually 0 or N - default 0", default="0") - a("-M","--Mendelrate",dest="mendrate",type="float", - help="Mendelian error rate: probability of a mendel error per trio, default=0.0", default=0.0) - a("-H","--noHGRS",dest="useHG",type="int", - help="Use local copy of UCSC snp126 database to generate real rs numbers", default=True) - (options,args) = parser.parse_args() - low = options.lowmaf + outf.write('\n</pre>\n') + outf.write("</div></body></html>") + outf.close() + + + +if __name__ == "__main__": + """ + """ + parser = OptionParser(usage=u, version="%prog 0.01") + a = parser.add_option + a("-n","--nsubjects",type="int",dest="Ntot", + help="nsubj: total number of subjects",default=2000) + a("-t","--title",dest="title", + help="title: file basename for outputs",default='fakeped') + a("-c","--cases",type="int",dest="Naff", + help="number of cases: independent subjects with status set to 2 (ie cases). If not set, NTOT/3 trios will be generated", default = 0) + a("-s","--snps",dest="width",type="int", + help="snps: total number of snps per subject", default=1000) + a("-d","--distribution",dest="MAFdist",default="Uniform", + help="MAF distribution - default is Uniform, can be Triangular") + a("-o","--outf",dest="outf", + help="Output file", default = 'fakeped') + a("-p","--outpath",dest="outpath", + help="Path for output files", default = './') + a("-l","--pLink",dest="outstyle", default='L', + help="Ped files as for Plink - no header, separate Map file - default is Plink style") + a("-w","--loWmaf", type="float", dest="lowmaf", default=0.01, help="Lower limit for SNP MAF (minor allele freq)") + a("-m","--missing",dest="missrate",type="float", + help="missing: probability of missing MCAR - default 0.0", default=0.0) + a("-v","--valmiss",dest="missval", + help="missing character: Missing allele code - usually 0 or N - default 0", default="0") + a("-M","--Mendelrate",dest="mendrate",type="float", + help="Mendelian error rate: probability of a mendel error per trio, default=0.0", default=0.0) + a("-H","--noHGRS",dest="useHG",type="int", + help="Use local copy of UCSC snp126 database to generate real rs numbers", default=True) + (options,args) = parser.parse_args() + low = options.lowmaf try: os.makedirs(options.outpath) except: pass - if options.MAFdist.upper() == 'U': - mafDist = makeUniformMAFdist(low=low, high=0.5) - else: + if options.MAFdist.upper() == 'U': + mafDist = makeUniformMAFdist(low=low, high=0.5) + else: mafDist = makeTriangularMAFdist(low=low, high=0.5, beta=5) alleles,freqs, rslist, chromlist, poslist = makeMap(width=int(options.width), MAFdistribution=mafDist, useGP=False) @@ -511,25 +511,25 @@ title = string.translate(options.title,trantab) if options.outstyle == 'F': - fbatstyle = True - fbathead = makeFbathead(rslist=rslist, chromlist=chromlist, poslist=poslist, width=options.width) + fbatstyle = True + fbathead = makeFbathead(rslist=rslist, chromlist=chromlist, poslist=poslist, width=options.width) else: - fbatstyle = False - writeMap(fprefix=title, rslist=rslist, fpath=options.outpath, - chromlist=chromlist, poslist=poslist, width=options.width) - if options.Naff > 0: # make case control data - makeIndep(fprefix = title, fpath=options.outpath, - width=options.width, Nunaff=options.Ntot-options.Naff, - Naff=options.Naff, MAFdistribution=mafDist,alleles=alleles, freqs=freqs, - fbatstyle=fbatstyle, missrate=options.missrate, missval=options.missval, - fbathead=fbathead) - else: - makePed(fprefix=options.fprefix, fpath=options.fpath, - width=options.width, MAFdistribution=mafDist, nsubj=options.Ntot, - alleles=alleles, freqs=freqs, fbatstyle=fbatstyle, missrate=options.missrate, - mendrate=options.mendrate, missval=options.missval, + fbatstyle = False + writeMap(fprefix=defbasename, rslist=rslist, fpath=options.outpath, + chromlist=chromlist, poslist=poslist, width=options.width) + if options.Naff > 0: # make case control data + makeIndep(fprefix = defbasename, fpath=options.outpath, + width=options.width, Nunaff=options.Ntot-options.Naff, + Naff=options.Naff, MAFdistribution=mafDist,alleles=alleles, freqs=freqs, + fbatstyle=fbatstyle, missrate=options.missrate, missval=options.missval, fbathead=fbathead) - doImport(outfile=options.outf,outpath=options.outpath) - - - + else: + makePed(fprefix=defbasename, fpath=options.fpath, + width=options.width, MAFdistribution=mafDist, nsubj=options.Ntot, + alleles=alleles, freqs=freqs, fbatstyle=fbatstyle, missrate=options.missrate, + mendrate=options.mendrate, missval=options.missval, + fbathead=fbathead) + doImport(outfile=options.outf,outpath=options.outpath) + + + --- a/tools/rgenetics/rgfakePed.xml Fri May 13 21:24:03 2011 -0400 +++ b/tools/rgenetics/rgfakePed.xml Mon May 16 09:12:19 2011 -0400 @@ -1,14 +1,13 @@ -<tool id="rgfakePed1" name="Null genotypes"> +<tool id="rgfakePed1" name="Null genotypes" version="0.02"><description>for testing</description><command interpreter="python">rgfakePed.py --title '$title' -o '$out_file1' -p '$out_file1.files_path' -c '$ncases' -n '$ntotal' -s '$nsnp' -w '$lowmaf' -v '$missingValue' -l '$outFormat' -d '$mafdist' -m '$missingRate' -M '$mendelRate' </command><inputs> - <page><param name="title" - type="text" + type="text" value="Fake_test_geno_data" help="Name for outputs from this job" label="Descriptive short name"/><param name="ntotal" @@ -55,11 +54,10 @@ help = "Missing allele value" label="Missing value for an allele for the output ped file"/> - </page></inputs><outputs> - <data format="lped" name="out_file1" label="${title}.lped" /> + <data format="lped" name="out_file1" label="${title}.lped"/></outputs><tests><test> @@ -74,8 +72,8 @@ <param name="mendelRate" value="0" /><param name="missingValue" value="0" /><output name='out_file1' file='rgtestouts/rgfakePed/rgfakePedtest1.lped' ftype='lped' compare="diff" lines_diff='5'> - <extra_files type="file" name='rgfakePedtest1.ped' value="rgtestouts/rgfakePed/rgfakePedtest1.ped" compare="diff" lines_diff='80'/> - <extra_files type="file" name='rgfakePedtest1.map' value="rgtestouts/rgfakePed/rgfakePedtest1.map" compare="diff" /> + <extra_files type="file" name='RgeneticsData.ped' value="rgtestouts/rgfakePed/rgfakePedtest1.ped" compare="diff" lines_diff='80'/> + <extra_files type="file" name='RgeneticsData.map' value="rgtestouts/rgfakePed/rgfakePedtest1.map" compare="diff" /></output></test></tests> @@ -100,11 +98,15 @@ This tool is very experimental -**Attribution** +.. class:: infomark + +**Attribution and Licensing** + Designed and written for the Rgenetics Galaxy tools copyright Ross Lazarus 2007 (ross.lazarus(a)gmail.com) -Licensed under the terms of the LGPL -as documented http://www.gnu.org/licenses/lgpl.html +Licensed under the terms of the _LGPL + + .. _LGPL: http://www.gnu.org/copyleft/lesser.html </help></tool> http://bitbucket.org/galaxy/galaxy-central/changeset/2790f54a4fe7/ changeset: r5566:2790f54a4fe7 user: fubar date: 2011-05-16 16:03:47 summary: removed python2.4 from rgfakePed.py affected #: 1 file (161 bytes) --- a/tools/rgenetics/rgfakePed.py Mon May 16 09:12:19 2011 -0400 +++ b/tools/rgenetics/rgfakePed.py Mon May 16 10:03:47 2011 -0400 @@ -1,4 +1,6 @@ -#! /usr/local/bin/python2.4 +# modified may 2011 to name components (map/ped) as RgeneticsData to align with default base_name +# otherwise downstream tools fail +# modified march 2011 to remove post execution hook # pedigree data faker # specifically designed for scalability testing of # Shaun Purcel's PLINK package Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 13 May '11

13 May '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/7e460794a191/ changeset: r5563:7e460794a191 user: fubar date: 2011-05-14 02:46:38 summary: picard wrapper typo fixed affected #: 1 file (8 bytes) --- a/tools/picard/picard_wrapper.py Fri May 13 17:12:44 2011 -0400 +++ b/tools/picard/picard_wrapper.py Fri May 13 20:46:38 2011 -0400 @@ -219,8 +219,8 @@ else: tdat = ['\t'.join(x).strip() for x in dat] # back to strings :( tdat = ['<tr class="d%d"><td colspan="2">%s</td></tr>\n' % ((i+len(heads)) % 2,x) for i,x in enumerate(tdat)] - res += tdat - dat = [] + res += tdat + dat = [] res.append('</table>\n') return res http://bitbucket.org/galaxy/galaxy-central/changeset/56be3f4871cd/ changeset: r5564:56be3f4871cd user: fubar date: 2011-05-14 03:24:03 summary: reverting reorder test outputs - PhiX reference used to generate them seems different from that on the buildbot affected #: 2 files (3.7 KB) --- a/test-data/picard_RS_output2.sam Fri May 13 20:46:38 2011 -0400 +++ b/test-data/picard_RS_output2.sam Fri May 13 21:24:03 2011 -0400 @@ -0,0 +1,22 @@ +@HD VN:1.0 SO:unsorted +@SQ SN:phiX174 LN:5386 UR:file:/afs/bx.psu.edu/user/kpvincent/working/phiX.fa M5:f479307bca04825e98008f37e4f6251a +@PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 4 -S --phred33-quals /genome/phiX/bowtie_index/phiX dataset_437.dat" +HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX174 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX174 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1578:331/1 0 phiX174 209 255 50M * 0 0 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX174 1218 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1582:633/1 0 phiX174 1517 255 50M * 0 0 CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX174 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1598:534/1 0 phiX174 1717 255 50M * 0 0 GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1749:466/1 0 phiX174 2201 255 50M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1629:446/1 0 phiX174 2301 255 50M * 0 0 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1763:587/1 0 phiX174 2501 255 50M * 0 0 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1616:363/1 0 phiX174 2718 255 50M * 0 0 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX174 3518 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1768:715/1 0 phiX174 3118 255 50M * 0 0 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 0 phiX174 3818 255 50M * 0 0 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX174 4018 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX174 4418 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 --- a/test-data/picard_RS_output3.sam Fri May 13 20:46:38 2011 -0400 +++ b/test-data/picard_RS_output3.sam Fri May 13 21:24:03 2011 -0400 @@ -1,26 +1,26 @@ @HD VN:1.0 SO:unsorted -@SQ SN:phiX1 LN:1120 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 -@SQ SN:phiX2 LN:1190 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 -@SQ SN:phiX3 LN:1330 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 -@SQ SN:phiX4 LN:910 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 -@SQ SN:phiX5 LN:828 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 +@SQ SN:phiX1 LN:1120 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 +@SQ SN:phiX2 LN:1190 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 +@SQ SN:phiX3 LN:1330 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 +@SQ SN:phiX4 LN:910 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 +@SQ SN:phiX5 LN:828 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 @PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 4 -S --phred33-quals /tmp/tmp1E6jpl/tmpDg42o9 dataset_437.dat" -HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX1 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX3 1208 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 HWI-EAS91_1_30788AAXX:1:1:1578:331/1 0 phiX1 209 255 50M * 0 0 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX1 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX1 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:30G19 NM:i:1 -HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX2 98 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1582:633/1 0 phiX2 397 255 50M * 0 0 CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1598:534/1 0 phiX2 597 255 50M * 0 0 GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX1 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:30G19 NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1616:363/1 0 phiX3 408 255 50M * 0 0 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1629:446/1 4 * 0 0 * * 0 0 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX4 778 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX1 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX4 378 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX2 98 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1749:466/1 0 phiX2 1081 255 50M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX1 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1763:587/1 0 phiX3 191 255 50M * 0 0 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1616:363/1 0 phiX3 408 255 50M * 0 0 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1768:715/1 0 phiX3 808 255 50M * 0 0 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX3 1208 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 0 phiX4 178 255 50M * 0 0 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX4 378 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX4 778 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1629:446/1 4 * 0 0 * * 0 0 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XM:i:0 Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 4 new changesets
by Bitbucket 13 May '11

13 May '11

4 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/2748be87612d/ changeset: r5559:2748be87612d user: fubar date: 2011-05-13 21:23:32 summary: Reordersam fails silently if contig names do not match so added an html log where this can be seen easily. Updated insertsize test affected #: 4 files (1.2 KB) --- a/test-data/picard_output_insertsize_tinysam.html Fri May 13 10:02:28 2011 -0400 +++ b/test-data/picard_output_insertsize_tinysam.html Fri May 13 15:23:32 2011 -0400 @@ -12,7 +12,7 @@ </head><body><div class="document"> -Galaxy tool CollectInsertSizeMetrics run at 12/05/2011 14:33:49</b><br/><table cellpadding="10"><tr><td> +Galaxy tool CollectInsertSizeMetrics run at 13/05/2011 15:20:46</b><br/><table cellpadding="10"><tr><td><a href="InsertSizeHist.pdf"><img src="InsertSizeHist.jpg" title="Click image preview for a print quality PDF version" hspace="10" align="middle"></a></tr></td></table><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table> @@ -26,46 +26,27 @@ <li><a href="http://picard.sourceforge.net/picard-metric-definitions.shtml">Click here for Picard Metrics definitions</a></li></ul><hr/><b>Picard output (transposed to make it easier to see)</b><hr/><table cellpadding="3" > -<tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># net.sf.picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 INPUT=/tmp/6729253.1.all.q/tmpM5wI_h/database/files/001/dataset_1092.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/1028/dataset_1093_files/CollectInsertSizeMetrics.metrics.txt VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true STOP_AFTER=0 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># Started on: Thu May 12 14:33:48 EDT 2011</td></tr><tr class="d0"><td colspan="2">## METRICS CLASS net.sf.picard.analysis.InsertSizeMetrics</td></tr><tr class="d0"><td>MEDIAN_INSERT_SIZE</td><td>96 </td></tr> -<tr class="d1"><td>MIN_INSERT_SIZE</td><td>96 </td></tr> -<tr class="d0"><td>MAX_INSERT_SIZE</td><td>96 </td></tr> -<tr class="d1"><td>MEAN_INSERT_SIZE</td><td>96 </td></tr> -<tr class="d0"><td>STANDARD_DEVIATION</td><td>? </td></tr> -<tr class="d1"><td>READ_PAIRS</td><td>1 </td></tr> -<tr class="d0"><td>PAIR_ORIENTATION</td><td>FR </td></tr> -<tr class="d1"><td>WIDTH_OF_10_PERCENT</td><td>1 </td></tr> -<tr class="d0"><td>WIDTH_OF_20_PERCENT</td><td>1 </td></tr> -<tr class="d1"><td>WIDTH_OF_30_PERCENT</td><td>1 </td></tr> -<tr class="d0"><td>WIDTH_OF_40_PERCENT</td><td>1 </td></tr> -<tr class="d1"><td>WIDTH_OF_50_PERCENT</td><td>1 </td></tr> -<tr class="d0"><td>WIDTH_OF_60_PERCENT</td><td>1 </td></tr> -<tr class="d1"><td>WIDTH_OF_70_PERCENT</td><td>1 </td></tr> -<tr class="d0"><td>WIDTH_OF_80_PERCENT</td><td>1 </td></tr> -<tr class="d1"><td>WIDTH_OF_90_PERCENT</td><td>1 </td></tr> -<tr class="d0"><td>WIDTH_OF_99_PERCENT -</td><td>1 - </td></tr> -<tr class="d0"><td colspan="2">## HISTOGRAM java.lang.Integer</td></tr><tr class="d0"><td colspan="2">insert_size fr_count rf_count</td></tr> -<tr class="d1"><td colspan="2">96 1 0</td></tr> -<tr class="d0"><td colspan="2">201 0 1</td></tr> +<tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># net.sf.picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 INPUT=/dev/shm/tmpHpwBHW/database/files/000/dataset_1.dat OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/2/dataset_2_files/CollectInsertSizeMetrics.metrics.txt VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true STOP_AFTER=0 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># Started on: Fri May 13 15:20:45 EDT 2011</td></tr><tr class="d0"><td colspan="2">## METRICS CLASS net.sf.picard.analysis.InsertSizeMetrics</td></tr><tr class="d1"><td colspan="2">## HISTOGRAM java.lang.Integer</td></tr><tr class="d0"><td colspan="2">MEDIAN_INSERT_SIZE MIN_INSERT_SIZE MAX_INSERT_SIZE MEAN_INSERT_SIZE STANDARD_DEVIATION READ_PAIRS PAIR_ORIENTATION WIDTH_OF_10_PERCENT WIDTH_OF_20_PERCENT WIDTH_OF_30_PERCENT WIDTH_OF_40_PERCENT WIDTH_OF_50_PERCENT WIDTH_OF_60_PERCENT WIDTH_OF_70_PERCENT WIDTH_OF_80_PERCENT WIDTH_OF_90_PERCENT WIDTH_OF_99_PERCENT</td></tr> +<tr class="d1"><td colspan="2">96 96 96 96 ? 1 FR 1 1 1 1 1 1 1 1 1 1</td></tr> +<tr class="d0"><td colspan="2">201 201 201 201 ? 1 RF 1 1 1 1 1 1 1 1 1 1</td></tr> +<tr class="d1"><td colspan="2">insert_size fr_count rf_count</td></tr> +<tr class="d0"><td colspan="2">96 1 0</td></tr> +<tr class="d1"><td colspan="2">201 0 1</td></tr></table><b>Picard Tool Run Log</b><hr/> -<pre>Thu, 12 May 2011 14:33:48 INFO - ## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CollectInsertSizeMetrics.jar VALIDATION_STRINGENCY=LENIENT I=/tmp/6729253.1.all.q/tmpM5wI_h/database/files/001/dataset_1092.dat O=/udd/rerla/galaxy-central/database/job_working_directory/1028/dataset_1093_files/CollectInsertSizeMetrics.metrics.txt HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 returned status 0 and stderr: -[Thu May 12 14:33:48 EDT 2011] net.sf.picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 INPUT=/tmp/6729253.1.all.q/tmpM5wI_h/database/files/001/dataset_1092.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/1028/dataset_1093_files/CollectInsertSizeMetrics.metrics.txt VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true STOP_AFTER=0 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false -WARNING 2011-05-12 14:33:48 SinglePassSamProgram File reports sort order 'queryname', assuming it's coordinate sorted anyway. -INFO 2011-05-12 14:33:48 ProcessExecutor [1] "FR = red" "RF = blue" -INFO 2011-05-12 14:33:48 ProcessExecutor null device -INFO 2011-05-12 14:33:48 ProcessExecutor 1 -[Thu May 12 14:33:48 EDT 2011] net.sf.picard.analysis.CollectInsertSizeMetrics done. +<pre>INFO:root:## executing java -Xmx2g -jar /udd/rerla/rgalaxy/tool-data/shared/jars/CollectInsertSizeMetrics.jar VALIDATION_STRINGENCY=LENIENT I=/dev/shm/tmpHpwBHW/database/files/000/dataset_1.dat O=/udd/rerla/rgalaxy/database/job_working_directory/2/dataset_2_files/CollectInsertSizeMetrics.metrics.txt HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 returned status 0 and stderr: +[Fri May 13 15:20:45 EDT 2011] net.sf.picard.analysis.CollectInsertSizeMetrics HISTOGRAM_FILE=InsertSizeHist.pdf TAIL_LIMIT=10000 MINIMUM_PCT=0.01 INPUT=/dev/shm/tmpHpwBHW/database/files/000/dataset_1.dat OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/2/dataset_2_files/CollectInsertSizeMetrics.metrics.txt VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true STOP_AFTER=0 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false +WARNING 2011-05-13 15:20:45 SinglePassSamProgram File reports sort order 'queryname', assuming it's coordinate sorted anyway. +INFO 2011-05-13 15:20:46 ProcessExecutor [1] "FR = red" "RF = blue" +INFO 2011-05-13 15:20:46 ProcessExecutor null device +INFO 2011-05-13 15:20:46 ProcessExecutor 1 +[Fri May 13 15:20:46 EDT 2011] net.sf.picard.analysis.CollectInsertSizeMetrics done. Runtime.totalMemory()=9109504 -Thu, 12 May 2011 14:33:49 INFO - ## executing mogrify -format jpg -resize x400 /udd/rerla/galaxy-central/database/job_working_directory/1028/dataset_1093_files/InsertSizeHist.pdf returned status 0 and nothing on stderr +INFO:root:## executing mogrify -format jpg -resize x400 /udd/rerla/rgalaxy/database/job_working_directory/2/dataset_2_files/InsertSizeHist.pdf returned status 0 and nothing on stderr -Thu, 12 May 2011 14:33:49 INFO - ## executing mogrify -format jpg -resize x400 /udd/rerla/galaxy-central/database/job_working_directory/1028/dataset_1093_files/InsertSizeHist.pdf returned status 0 and nothing on stderr +INFO:root:## executing mogrify -format jpg -resize x400 /udd/rerla/rgalaxy/database/job_working_directory/2/dataset_2_files/InsertSizeHist.pdf returned status 0 and nothing on stderr </pre><hr/>The freely available <a href="http://picard.sourceforge.net/command-line-overview.shtml">Picard software</a> generated all outputs reported here running as a <a href="http://getgalaxy.org">Galaxy</a> tool</div></body></html> --- a/tools/picard/picard_ReorderSam.xml Fri May 13 10:02:28 2011 -0400 +++ b/tools/picard/picard_ReorderSam.xml Fri May 13 15:23:32 2011 -0400 @@ -1,9 +1,8 @@ -<tool name="Reorder SAM:" id="picard_ReorderSam" version="0.01"> +<tool name="Reorder SAM:" id="picard_ReorderSam" version="0.02"><requirements><requirement type="package">picard</requirement></requirements><description>(Picard)</description><command interpreter="python"> - picard_wrapper.py - --input=$inputFile + picard_wrapper.py -d "$html_file.files_path" -t "$html_file" --input=$inputFile #if $source.indexSource == "built-in" --ref="${ filter( lambda x: str( x[0] ) == str( $source.ref ), $__app__.tool_data_tables[ 'picard_indexes' ].get_fields() )[0][-1] }" #else @@ -15,11 +14,7 @@ --allow-inc-dict-concord=$allowIncDictConcord --allow-contig-len-discord=$allowContigLenDiscord --output-format=$outputFormat - #if str( $outputFormat ) == "sam" - --output=$outFileSam - #else if str( $outputFormat ) == "bam" - --output=$outFileBam - #end if + --output="$out_file" -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/ReorderSam.jar" --picard-cmd="ReorderSam" </command> @@ -47,12 +42,12 @@ <param name="allowContigLenDiscord" type="boolean" checked="False" truevalue="true" falsevalue="false" label="Allow contig length discordance?" help="This is dangerous--don't check it unless you know exactly what you're doing!" /><param name="outputFormat" type="boolean" checked="True" truevalue="bam" falsevalue="sam" label="Output bam instead of sam" help="Uncheck for sam output" /></inputs> - <outputs> - <data name="outFileSam" format="sam" label="${tool.name} on ${on_string}: reordered sam"> - <filter>outputFormat is False</filter> - </data> - <data name="outFileBam" format="bam" label="${tool.name} on ${on_string}: reordered bam"> - <filter>outputFormat is True</filter> + <outputs> + <data format="html" name="html_file" label="ReorderBam_on_${on_string}.html" /> + <data format="bam" name="out_file" label="ReorderBam_on_${on_string}.${outputFormat}"> + <change_format> + <when input="outputFormat" value="sam" format="sam" /> + </change_format></data></outputs><tests> --- a/tools/picard/picard_wrapper.py Fri May 13 10:02:28 2011 -0400 +++ b/tools/picard/picard_wrapper.py Fri May 13 15:23:32 2011 -0400 @@ -50,7 +50,7 @@ assert opts <> None, 'PicardBase needs opts at init' self.opts = opts if self.opts.outdir == None: - self.opts.outdir = self.opts.tmpdir # fixmate has no html file eg + self.opts.outdir = os.getcwd() # fixmate has no html file eg so use temp dir assert self.opts.outdir <> None,'## PicardBase needs a temp directory if no output directory passed in' self.picname = self.baseName(opts.jar) if self.picname.startswith('picard'): @@ -78,10 +78,7 @@ def setLogging(self,logfname="picard_wrapper.log"): """setup a logger """ - today=timenow() logging.basicConfig(level=logging.INFO, - format='%(asctime)s %(levelname)s\n %(message)s', - datefmt='%a, %d %b %Y %H:%M:%S', filename=logfname, filemode='a') @@ -145,6 +142,7 @@ runme.append('-jar %s' % jar) runme += cl s,stdout = self.runCL(cl=runme, output_dir=self.opts.outdir) + print '##s=',s,'\n##stdout=',stdout return stdout def samToBam(self,infile=None,outdir=None): @@ -211,27 +209,39 @@ dat.append(srow) # want lists if row.startswith('## HISTOGRAM'): thist = True - if row.strip() == '' or i == lastr: # last line or blank means write a segment - if len(heads) > 0: - hres = ['<tr class="d%d"><td colspan="2">%s</td></tr>' % (i % 2,x) for i,x in enumerate(heads)] - res += hres - heads = [] - if len(dat) > 0: - if transpose and not thist: - tdat = map(None,*dat) # transpose an arbitrary list of lists - tdat = ['<tr class="d%d"><td>%s</td><td>%s </td></tr>\n' % ((i+len(heads)) % 2,x[0],x[1]) for i,x in enumerate(tdat) if i < maxrows] - missing = len(tdat) - maxrows - if missing > 0: - tdat.append('<tr><td colspan="2">...WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (missing,os.path.basename(picout))) - else: - if thist or not transpose: - dat = ['\t'.join(x).strip() for x in dat] # back to strings :( - tdat = ['<tr class="d%d"><td colspan="2">%s</td></tr>\n' % ((i+len(heads)) % 2,x) for i,x in enumerate(dat) if i < maxrows] - missing = len(tdat) - maxrows - if missing > 0: - tdat.append('<tr><td>...WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (missing,os.path.basename(self.metricsOut))) - res += tdat - dat = [] + if len(heads) > 0: + hres = ['<tr class="d%d"><td colspan="2">%s</td></tr>' % (i % 2,x) for i,x in enumerate(heads)] + res += hres + heads = [] + if len(dat) > 0: + dropRows = len(dat) - maxrows + n = 0 + if dropRows > 0: + n = int(maxrows/2) + if transpose and not thist: + tdat = map(None,*dat) # transpose an arbitrary list of lists + if dropRows > 0: + dat = tdat[:n] + dat.append(('<b>...%d rows not shown - see log...</b>','')) + dat += tdat[-n:] + else: + dat = tdat + tdat = ['<tr class="d%d"><td>%s</td><td>%s </td></tr>\n' % ((i+len(heads)) % 2,x[0],x[1]) for i,x in enumerate(dat)] + if dropRows > 0: + tdat.append('<tr><td colspan="2">## WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (dropRows,os.path.basename(picout))) + else: + if dropRows > 0: + tdat = dat[:n] + tdat.append(('<b>...%d rows not shown - see log...</b>' % dropRows,'')) + tdat += dat[-n:] + else: + tdat = dat + dat = ['\t'.join(x).strip() for x in tdat] # back to strings :( + tdat = ['<tr class="d%d"><td colspan="2">%s</td></tr>\n' % ((i+len(heads)) % 2,x) for i,x in enumerate(dat)] + if dropRows > 0: + tdat.append('<tr><td>## WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (dropRows,os.path.basename(self.metricsOut))) + res += tdat + dat = [] res.append('</table>\n') return res @@ -273,11 +283,15 @@ res.append('<b>Picard Tool Run Log</b><hr/>\n') rlog = ['<pre>',] if llen > maxloglines: - rlog += l[:maxloglines] - rlog.append('\n<b>## WARNING - %d log lines truncated - %s contains entire output' % (llen - maxloglines,self.log_filename)) + n = min(50,int(maxloglines/2)) + rlog += l[:n] + rlog.append('------------ ## %d rows deleted ## --------------\n' % (llen-maxloglines)) + rlog += l[-n:] else: rlog += l rlog.append('</pre>') + if llen > maxloglines: + rlog.append('\n<b>## WARNING - %d log lines truncated - <a href="%s">%s</a> contains entire output</b>' % (llen - maxloglines,self.log_filename,self.log_filename)) res += rlog else: res.append("### Odd, Picard left no log file %s - must have really barfed badly?\n" % self.log_filename) --- a/tools/picard/rgPicardInsertSize.xml Fri May 13 10:02:28 2011 -0400 +++ b/tools/picard/rgPicardInsertSize.xml Fri May 13 15:23:32 2011 -0400 @@ -1,11 +1,11 @@ -<tool name="Insertion size metrics:" id="rgPicInsertSize" version="0.01"> +<tool name="Insertion size metrics:" id="PicardInsertSize" version="0.02"><description>for PAIRED data</description> + <requirements><requirement type="package">picard</requirement></requirements><command interpreter="python"> picard_wrapper.py -i "$input_file" -n "$out_prefix" --tmpdir "${__new_file_path__}" --taillimit "$tailLimit" --histwidth "$histWidth" --minpct "$minPct" -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/CollectInsertSizeMetrics.jar" -d "$html_file.files_path" -t "$html_file" </command> - <requirements><requirement type="package">picard</requirement></requirements><inputs><param format="bam,sam" name="input_file" type="data" label="Input: sam or bam format short read data in your current history" help="If the select list is empty, you need to upload or import some aligned short read data from a shared library"/> http://bitbucket.org/galaxy/galaxy-central/changeset/a7832bbcd110/ changeset: r5560:a7832bbcd110 user: fubar date: 2011-05-13 22:54:31 summary: Picard reorder test fix and parameter changes affected #: 3 files (1.1 KB) --- a/test-data/picard_RS_output3.sam Fri May 13 15:23:32 2011 -0400 +++ b/test-data/picard_RS_output3.sam Fri May 13 16:54:31 2011 -0400 @@ -1,26 +1,26 @@ @HD VN:1.0 SO:unsorted -@SQ SN:phiX1 LN:1120 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 -@SQ SN:phiX2 LN:1190 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 -@SQ SN:phiX3 LN:1330 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 -@SQ SN:phiX4 LN:910 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 -@SQ SN:phiX5 LN:828 UR:picard_RS_input4.fasta AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 +@SQ SN:phiX1 LN:1120 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 +@SQ SN:phiX2 LN:1190 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 +@SQ SN:phiX3 LN:1330 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 +@SQ SN:phiX4 LN:910 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 +@SQ SN:phiX5 LN:828 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 @PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 4 -S --phred33-quals /tmp/tmp1E6jpl/tmpDg42o9 dataset_437.dat" -HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX3 1208 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX1 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1578:331/1 0 phiX1 209 255 50M * 0 0 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX1 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX1 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:30G19 NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX2 98 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1582:633/1 0 phiX2 397 255 50M * 0 0 CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1598:534/1 0 phiX2 597 255 50M * 0 0 GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX1 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:30G19 NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1749:466/1 0 phiX2 1081 255 50M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1763:587/1 0 phiX3 191 255 50M * 0 0 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1616:363/1 0 phiX3 408 255 50M * 0 0 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1768:715/1 0 phiX3 808 255 50M * 0 0 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX3 1208 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 0 phiX4 178 255 50M * 0 0 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX4 378 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX4 778 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 HWI-EAS91_1_30788AAXX:1:1:1629:446/1 4 * 0 0 * * 0 0 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX4 778 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX1 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX4 378 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX2 98 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1749:466/1 0 phiX2 1081 255 50M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX1 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1763:587/1 0 phiX3 191 255 50M * 0 0 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1768:715/1 0 phiX3 808 255 50M * 0 0 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 0 phiX4 178 255 50M * 0 0 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 --- a/tools/picard/picard_ReorderSam.xml Fri May 13 15:23:32 2011 -0400 +++ b/tools/picard/picard_ReorderSam.xml Fri May 13 16:54:31 2011 -0400 @@ -6,14 +6,14 @@ #if $source.indexSource == "built-in" --ref="${ filter( lambda x: str( x[0] ) == str( $source.ref ), $__app__.tool_data_tables[ 'picard_indexes' ].get_fields() )[0][-1] }" #else - --ref-file=$refFile + --ref-file=$source.refFile --species-name=$source.speciesName --build-name=$source.buildName --trunc-names=$source.truncateSeqNames #end if --allow-inc-dict-concord=$allowIncDictConcord --allow-contig-len-discord=$allowContigLenDiscord - --output-format=$outputFormat + --newformat=$outputFormat --output="$out_file" -j "${GALAXY_DATA_INDEX_DIR}/shared/jars/ReorderSam.jar" --picard-cmd="ReorderSam" --- a/tools/picard/picard_wrapper.py Fri May 13 15:23:32 2011 -0400 +++ b/tools/picard/picard_wrapper.py Fri May 13 16:54:31 2011 -0400 @@ -142,7 +142,6 @@ runme.append('-jar %s' % jar) runme += cl s,stdout = self.runCL(cl=runme, output_dir=self.opts.outdir) - print '##s=',s,'\n##stdout=',stdout return stdout def samToBam(self,infile=None,outdir=None): @@ -214,32 +213,12 @@ res += hres heads = [] if len(dat) > 0: - dropRows = len(dat) - maxrows - n = 0 - if dropRows > 0: - n = int(maxrows/2) if transpose and not thist: tdat = map(None,*dat) # transpose an arbitrary list of lists - if dropRows > 0: - dat = tdat[:n] - dat.append(('<b>...%d rows not shown - see log...</b>','')) - dat += tdat[-n:] - else: - dat = tdat - tdat = ['<tr class="d%d"><td>%s</td><td>%s </td></tr>\n' % ((i+len(heads)) % 2,x[0],x[1]) for i,x in enumerate(dat)] - if dropRows > 0: - tdat.append('<tr><td colspan="2">## WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (dropRows,os.path.basename(picout))) + tdat = ['<tr class="d%d"><td>%s</td><td>%s </td></tr>\n' % ((i+len(heads)) % 2,x[0],x[1]) for i,x in enumerate(tdat)] else: - if dropRows > 0: - tdat = dat[:n] - tdat.append(('<b>...%d rows not shown - see log...</b>' % dropRows,'')) - tdat += dat[-n:] - else: - tdat = dat - dat = ['\t'.join(x).strip() for x in tdat] # back to strings :( - tdat = ['<tr class="d%d"><td colspan="2">%s</td></tr>\n' % ((i+len(heads)) % 2,x) for i,x in enumerate(dat)] - if dropRows > 0: - tdat.append('<tr><td>## WARNING: %d rows deleted..see raw file %s for entire output</td></tr>' % (dropRows,os.path.basename(self.metricsOut))) + tdat = ['\t'.join(x).strip() for x in dat] # back to strings :( + tdat = ['<tr class="d%d"><td colspan="2">%s</td></tr>\n' % ((i+len(heads)) % 2,x) for i,x in enumerate(tdat)] res += tdat dat = [] res.append('</table>\n') @@ -654,10 +633,11 @@ haveTempout = True elif pic.picname == 'ReorderSam': + tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir,prefix='ReOrderTempOut') # input cl.append('INPUT=%s' % opts.input) # output - cl.append('OUTPUT=%s' % opts.output) + cl.append('OUTPUT=%s' % tempout) # reference cl.append('REFERENCE=%s' % ref_file_name) # incomplete dict concordance @@ -667,6 +647,7 @@ if opts.allow_contig_len_discord == 'true': cl.append('ALLOW_CONTIG_LENGTH_DISCORDANCE=true') pic.runPic(opts.jar, cl) + haveTempout = True elif pic.picname == 'ReplaceSamHeader': tmp_fd, tempout = tempfile.mkstemp( dir=opts.tmpdir,prefix='RSHTempOut') http://bitbucket.org/galaxy/galaxy-central/changeset/ec0cc878d423/ changeset: r5561:ec0cc878d423 user: fubar date: 2011-05-13 23:12:19 summary: finally have picard reorder tests working affected #: 2 files (3.7 KB) --- a/test-data/picard_RS_output2.sam Fri May 13 16:54:31 2011 -0400 +++ b/test-data/picard_RS_output2.sam Fri May 13 17:12:19 2011 -0400 @@ -1,22 +0,0 @@ -@HD VN:1.0 SO:unsorted -@SQ SN:phiX174 LN:5386 UR:file:/afs/bx.psu.edu/user/kpvincent/working/phiX.fa M5:f479307bca04825e98008f37e4f6251a -@PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 4 -S --phred33-quals /genome/phiX/bowtie_index/phiX dataset_437.dat" -HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX174 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1647:512/1 0 phiX174 401 255 50M * 0 0 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1578:331/1 0 phiX174 209 255 50M * 0 0 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 phiX174 1218 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1582:633/1 0 phiX174 1517 255 50M * 0 0 CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1599:330/1 0 phiX174 803 255 50M * 0 0 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1598:534/1 0 phiX174 1717 255 50M * 0 0 GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1749:466/1 0 phiX174 2201 255 50M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1570:620/1 4 * 0 0 * * 0 0 GAGTAACAAAGTAAAGTTTGGACCGTTTTTGTCTCGTGCTCGTCGCTGCG IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1629:446/1 0 phiX174 2301 255 50M * 0 0 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1763:587/1 0 phiX174 2501 255 50M * 0 0 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1616:363/1 0 phiX174 2718 255 50M * 0 0 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:270/1 0 phiX174 3518 255 50M * 0 0 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1768:715/1 0 phiX174 3118 255 50M * 0 0 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 0 phiX174 3818 255 50M * 0 0 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1673:514/1 0 phiX174 4018 255 50M * 0 0 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1652:270/1 4 * 0 0 * * 0 0 AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGACTTTGCATTGTTTAATTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1572:324/1 4 * 0 0 * * 0 0 AAGGTGCTTAAATTCGTGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII XM:i:0 -HWI-EAS91_1_30788AAXX:1:1:1634:330/1 0 phiX174 4418 255 50M * 0 0 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 --- a/test-data/picard_RS_output3.sam Fri May 13 16:54:31 2011 -0400 +++ b/test-data/picard_RS_output3.sam Fri May 13 17:12:19 2011 -0400 @@ -1,9 +1,9 @@ @HD VN:1.0 SO:unsorted -@SQ SN:phiX1 LN:1120 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 -@SQ SN:phiX2 LN:1190 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 -@SQ SN:phiX3 LN:1330 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 -@SQ SN:phiX4 LN:910 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 -@SQ SN:phiX5 LN:828 UR:dataset_3.dat AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 +@SQ SN:phiX1 LN:1120 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:40156fecb557ec9a4e0e7d0d5379d346 SP:phiX174 +@SQ SN:phiX2 LN:1190 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:3ecdb3921cbd184296cefdc675595fc1 SP:phiX174 +@SQ SN:phiX3 LN:1330 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:60435b7625ee8862e4af3e839b195198 SP:phiX174 +@SQ SN:phiX4 LN:910 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:ae8509d7b91ed64a44dd718513b1fd06 SP:phiX174 +@SQ SN:phiX5 LN:828 UR:dataset_5.dat AS:phiX_buildBlah1.1 M5:459c70115963cbce5021cac2bc9dfbd1 SP:phiX174 @PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 4 -S --phred33-quals /tmp/tmp1E6jpl/tmpDg42o9 dataset_437.dat" HWI-EAS91_1_30788AAXX:1:1:1761:343/1 0 phiX1 5 255 50M * 0 0 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII XA:i:0 MD:Z:50 NM:i:0 HWI-EAS91_1_30788AAXX:1:1:1578:331/1 0 phiX1 209 255 50M * 0 0 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII XA:i:0 MD:Z:50 NM:i:0 http://bitbucket.org/galaxy/galaxy-central/changeset/a4a9c884b805/ changeset: r5562:a4a9c884b805 user: fubar date: 2011-05-13 23:12:44 summary: branch merge affected #: 2 files (67 bytes) --- a/lib/galaxy/visualization/tracks/data_providers.py Fri May 13 17:12:19 2011 -0400 +++ b/lib/galaxy/visualization/tracks/data_providers.py Fri May 13 17:12:44 2011 -0400 @@ -332,10 +332,11 @@ # The first zoom level for BBI files is 640. If too much is requested, it will look at each block instead # of summaries. The calculation done is: zoom <> (end-start)/num_points/2. # Thus, the optimal number of points is (end-start)/num_points/2 = 640 - # num_points = (end-start) / 1280 + # num_points = (end-start) / 1280 num_points = (end-start) / 1280 - if (end - start) < num_points: + if num_points < 1: num_points = end - start + num_points = max(num_points, 10) data = bbi.query(chrom, start, end, num_points) f.close() --- a/static/scripts/trackster.js Fri May 13 17:12:19 2011 -0400 +++ b/static/scripts/trackster.js Fri May 13 17:12:44 2011 -0400 @@ -181,6 +181,7 @@ // Other constants. DENSITY = 200, + RESOLUTION = 5, FEATURE_LEVELS = 10, DEFAULT_DATA_QUERY_WAIT = 5000, // Maximum number of chromosomes that are selectable at any one time. @@ -762,7 +763,7 @@ this.high = Math.ceil(high); // 10^log10(range / DENSITY) Close approximation for browser window, assuming DENSITY = window width - this.resolution = Math.pow( 10, Math.ceil( Math.log( (this.high - this.low) / DENSITY ) / Math.LN10 ) ); + this.resolution = Math.pow( RESOLUTION, Math.ceil( Math.log( (this.high - this.low) / DENSITY ) / Math.log(RESOLUTION) ) ); this.zoom_res = Math.pow( FEATURE_LEVELS, Math.max(0,Math.ceil( Math.log( this.resolution, FEATURE_LEVELS ) / Math.log(FEATURE_LEVELS) ))); // Overview Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0