- galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: 3 new changesets
by Bitbucket 10 Feb '12

10 Feb '12

3 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/eb7a31e38a4c/ changeset: eb7a31e38a4c branch: dynamic_options_memory_fix user: jmchilton date: 2012-02-07 17:35:17 summary: Patch dynamic_options.py to just read just the first megabyte of an input dataset (if it is larger than that). Otherwise Galaxy will attempt the read the entire file into memory, this can causes crashes and freezeups without the user even selecting a bad input (for instance, if a large FASTQ file is the top most history item and a txt input is sought, Galaxy will freezeup as soon as the tool is clicked because it will try to load the options for the top item immediately by default). Though the implementation is not as clean, I am restricting it to a megabyte instead of a number of lines/options in case the top most history item has no line breaks. I imagine in that case the same problem could occur even if the input is restricted to a reasonable number of lines (say 100). affected #: 1 file diff -r 74b6319b38b4b3876d0b81ef1296bb5afc729cc1 -r eb7a31e38a4cf9968d115984ab2ded908d3ddc9e lib/galaxy/tools/parameters/dynamic_options.py --- a/lib/galaxy/tools/parameters/dynamic_options.py +++ b/lib/galaxy/tools/parameters/dynamic_options.py @@ -500,7 +500,16 @@ dataset = other_values.get( self.dataset_ref_name, None ) assert dataset is not None, "Required dataset '%s' missing from input" % self.dataset_ref_name if not dataset: return [] #no valid dataset in history - options = self.parse_file_fields( open( dataset.file_name ) ) + # Ensure parsing dynamic options does not consume more than a megabyte worth memory. + file_size = os.path.getsize( path ) + if os.path.getsize( path ) < 1048576: + options = self.parse_file_fields( open( path ) ) + else: + # Pass just the first megabyte to parse_file_fields. + import StringIO + log.warn( "Attempting to load options from large file, reading just first megabyte" ) + contents = open( path, 'r' ).read( megabyte ) + options = self.parse_file_fields( StringIO.StringIO( contents ) ) elif self.tool_data_table: options = self.tool_data_table.get_fields() else: https://bitbucket.org/galaxy/galaxy-central/changeset/53e55b49a24a/ changeset: 53e55b49a24a branch: dynamic_options_memory_fix user: jmchilton date: 2012-02-07 17:38:00 summary: Fix a typo made with last commit. affected #: 1 file diff -r eb7a31e38a4cf9968d115984ab2ded908d3ddc9e -r 53e55b49a24a8e9a2f00b1c594c4e54c226e8865 lib/galaxy/tools/parameters/dynamic_options.py --- a/lib/galaxy/tools/parameters/dynamic_options.py +++ b/lib/galaxy/tools/parameters/dynamic_options.py @@ -501,6 +501,7 @@ assert dataset is not None, "Required dataset '%s' missing from input" % self.dataset_ref_name if not dataset: return [] #no valid dataset in history # Ensure parsing dynamic options does not consume more than a megabyte worth memory. + path = dataset.file_name file_size = os.path.getsize( path ) if os.path.getsize( path ) < 1048576: options = self.parse_file_fields( open( path ) ) https://bitbucket.org/galaxy/galaxy-central/changeset/046157d1ed8a/ changeset: 046157d1ed8a branch: dynamic_options_memory_fix user: jmchilton date: 2012-02-07 17:50:22 summary: One more fixed typo. affected #: 1 file diff -r 53e55b49a24a8e9a2f00b1c594c4e54c226e8865 -r 046157d1ed8af7ff178c6b1edee9512deccbc0ce lib/galaxy/tools/parameters/dynamic_options.py --- a/lib/galaxy/tools/parameters/dynamic_options.py +++ b/lib/galaxy/tools/parameters/dynamic_options.py @@ -509,7 +509,7 @@ # Pass just the first megabyte to parse_file_fields. import StringIO log.warn( "Attempting to load options from large file, reading just first megabyte" ) - contents = open( path, 'r' ).read( megabyte ) + contents = open( path, 'r' ).read( 1048576 ) options = self.parse_file_fields( StringIO.StringIO( contents ) ) elif self.tool_data_table: options = self.tool_data_table.get_fields() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: save and restore group/multi-track filters.
by Bitbucket 10 Feb '12

10 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/73ba96b2b5a8/ changeset: 73ba96b2b5a8 user: jgoecks date: 2012-02-10 17:13:55 summary: Trackster: save and restore group/multi-track filters. affected #: 1 file diff -r 60d72f4bd1ea1930487e7eedfc3ce78372c00e9c -r 73ba96b2b5a82ee2a292e8b533838c81e30f552b static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -1034,7 +1034,7 @@ this.filters_manager = new FiltersManager(this); this.header_div.after(this.filters_manager.parent_div); // For saving drawables' filter managers when group-level filtering is done: - this.saved_filters_managers = null; + this.saved_filters_managers = []; }; extend(DrawableGroup.prototype, Drawable.prototype, DrawableCollection.prototype, { @@ -1060,33 +1060,15 @@ // TODO: update tipsy text. if (group.filters_manager.visible()) { // Hiding filters. - group.filters_manager.clear_filters(); - - // Restore filter managers. + group.filters_manager.clear_filters(); + group._restore_filter_managers(); // TODO: maintain current filter by restoring and setting saved manager's // settings to current/shared manager's settings. - // TODO: need to restore filter managers when moving drawable outside group. - for (var i = 0; i < group.drawables.length; i++) { - group.drawables[i].filters_manager = group.saved_filters_managers[i]; - } - group.saved_filters_managers = null; + // TODO: need to restore filter managers when moving drawable outside group. } else { // Showing filters. - - // Save tracks' managers and set up shared manager. - if (group.filters_manager.filters.length > 0) { - // For all tracks, save current filter manager and set manager to shared (this object's) manager. - group.saved_filters_managers = []; - for (var i = 0; i < group.drawables.length; i++) { - drawable = group.drawables[i]; - group.saved_filters_managers.push(drawable.filters_manager); - drawable.filters_manager = group.filters_manager; - } - - //TODO: hide filters icons for each drawable. - } - group.filters_manager.init_filters(); + group.setup_multitrack_filtering(); group.request_draw(true); } group.filters_manager.toggle(); @@ -1229,6 +1211,33 @@ } }, /** + * Restore individual track filter managers. + */ + _restore_filter_managers: function() { + for (var i = 0; i < this.drawables.length; i++) { + this.drawables[i].filters_manager = this.saved_filters_managers[i]; + } + this.saved_filters_managers = []; + }, + /** + * + */ + setup_multitrack_filtering: function() { + // Save tracks' managers and set up shared manager. + if (this.filters_manager.filters.length > 0) { + // For all tracks, save current filter manager and set manager to shared (this object's) manager. + this.saved_filters_managers = []; + for (var i = 0; i < this.drawables.length; i++) { + drawable = this.drawables[i]; + this.saved_filters_managers.push(drawable.filters_manager); + drawable.filters_manager = this.filters_manager; + } + + //TODO: hide filters icons for each drawable? + } + this.filters_manager.init_filters(); + }, + /** * Replace group with a single composite track that includes all group's tracks. */ show_composite_track: function() { @@ -1252,6 +1261,21 @@ DrawableCollection.prototype.remove_drawable.call(this, drawable); this.update_icons(); }, + to_dict: function() { + // If filters are visible, need to restore original filter managers before converting to dict. + if (this.filters_manager.visible()) { + this._restore_filter_managers(); + } + + var obj_dict = extend(DrawableCollection.prototype.to_dict.call(this), { "filters": this.filters_manager.to_dict() }); + + // Setup multi-track filtering again. + if (this.filters_manager.visible()) { + this.setup_multitrack_filtering(); + } + + return obj_dict; + }, /** * Restore object from a dictionary created by to_dict() */ @@ -1262,6 +1286,17 @@ for (var i = 0; i < group.drawables.length; i++) { group.content_div.append(group.drawables[i].container_div); } + + // Handle filters. + // FIXME: Pass collection_dict to DrawableCollection/Drawable will make this easier. + var old_manager = group.filters_manager; + group.filters_manager = new FiltersManager(group, collection_dict['filters']); + old_manager.parent_div.replaceWith(group.filters_manager.parent_div); + + if (collection_dict.filters.visible) { + group.setup_multitrack_filtering(); + } + return group; }, request_draw: function(clear_after, force) { Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 3 new changesets
by Bitbucket 10 Feb '12

10 Feb '12

3 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/3bd8bed55631/ changeset: 3bd8bed55631 user: jgoecks date: 2012-02-10 15:23:33 summary: Tophat wrapper modifications: (a) remove parameter junctions_filter and (b) change default value of max_multihits to 20. affected #: 2 files diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 3bd8bed55631728a05a9d873ebff70b74acbfd6e tools/ngs_rna/tophat_wrapper.py --- a/tools/ngs_rna/tophat_wrapper.py +++ b/tools/ngs_rna/tophat_wrapper.py @@ -27,7 +27,6 @@ help='The minimum intron length. TopHat will ignore donor/acceptor pairs closer than this many bases apart.' ) parser.add_option( '-I', '--max-intron-length', dest='max_intron_length', help='The maximum intron length. When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read.' ) - parser.add_option( '-F', '--junction_filter', dest='junction_filter', help='Filter out junctions supported by too few alignments (number of reads divided by average depth of coverage)' ) parser.add_option( '-g', '--max_multihits', dest='max_multihits', help='Maximum number of alignments to be allowed' ) parser.add_option( '', '--initial-read-mismatches', dest='initial_read_mismatches', help='Number of mismatches allowed in the initial read mapping' ) parser.add_option( '', '--seg-mismatches', dest='seg_mismatches', help='Number of mismatches allowed in each segment alignment for reads mapped independently' ) @@ -150,8 +149,6 @@ opts += ' -m %s' % options.splice_mismatches opts += ' -i %s' % options.min_intron_length opts += ' -I %s' % options.max_intron_length - if float( options.junction_filter ) != 0.0: - opts += ' -F %s' % options.junction_filter opts += ' -g %s' % options.max_multihits # Custom junctions options. if options.gene_model_annotations: diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 3bd8bed55631728a05a9d873ebff70b74acbfd6e tools/ngs_rna/tophat_wrapper.xml --- a/tools/ngs_rna/tophat_wrapper.xml +++ b/tools/ngs_rna/tophat_wrapper.xml @@ -34,7 +34,6 @@ -m $singlePaired.sParams.splice_mismatches -i $singlePaired.sParams.min_intron_length -I $singlePaired.sParams.max_intron_length - -F $singlePaired.sParams.junction_filter -g $singlePaired.sParams.max_multihits --min-segment-intron $singlePaired.sParams.min_segment_intron --max-segment-intron $singlePaired.sParams.max_segment_intron @@ -96,7 +95,6 @@ -m $singlePaired.pParams.splice_mismatches -i $singlePaired.pParams.min_intron_length -I $singlePaired.pParams.max_intron_length - -F $singlePaired.pParams.junction_filter -g $singlePaired.pParams.max_multihits --min-segment-intron $singlePaired.pParams.min_segment_intron --max-segment-intron $singlePaired.pParams.max_segment_intron @@ -203,8 +201,8 @@ <param name="max_deletion_length" type="integer" value="3" label="Max deletion length." help="The maximum deletion length." /></when></conditional> - <param name="junction_filter" type="float" value="0.15" label="Minimum isoform fraction: filter out junctions supported by too few alignments (number of reads divided by average depth of coverage)" help="0.0 to 1.0 (0 to turn off)" /> - <param name="max_multihits" type="integer" value="40" label="Maximum number of alignments to be allowed" /> +alignments (number of reads divided by average depth of coverage)" help="0.0 to 1.0 (0 to turn off)" /> + <param name="max_multihits" type="integer" value="20" label="Maximum number of alignments to be allowed" /><param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /><param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /><param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /> @@ -310,8 +308,7 @@ <param name="max_deletion_length" type="integer" value="3" label="Max deletion length." help="The maximum deletion length." /></when></conditional> - <param name="junction_filter" type="float" value="0.15" label="Minimum isoform fraction: filter out junctions supported by too few alignments (number of reads divided by average depth of coverage)" help="0.0 to 1.0 (0 to turn off)" /> - <param name="max_multihits" type="integer" value="40" label="Maximum number of alignments to be allowed" /> + <param name="max_multihits" type="integer" value="20" label="Maximum number of alignments to be allowed" /><param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /><param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /><param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /> @@ -532,7 +529,6 @@ <param name="splice_mismatches" value="0"/><param name="min_intron_length" value="70"/><param name="max_intron_length" value="500000"/> - <param name="junction_filter" value="0.15"/><param name="max_multihits" value="40"/><param name="min_segment_intron" value="50" /><param name="max_segment_intron" value="500000" /> @@ -578,7 +574,6 @@ <param name="splice_mismatches" value="0"/><param name="min_intron_length" value="70"/><param name="max_intron_length" value="500000"/> - <param name="junction_filter" value="0.15"/><param name="max_multihits" value="40"/><param name="min_segment_intron" value="50" /><param name="max_segment_intron" value="500000" /> https://bitbucket.org/galaxy/galaxy-central/changeset/3a9fecf3be20/ changeset: 3a9fecf3be20 user: jgoecks date: 2012-02-10 15:52:01 summary: Trackster: filter bug fix and abstract filter display control. affected #: 3 files diff -r 3bd8bed55631728a05a9d873ebff70b74acbfd6e -r 3a9fecf3be20e2413e8993738312246695fda2d3 lib/galaxy/web/base/controller.py --- a/lib/galaxy/web/base/controller.py +++ b/lib/galaxy/web/base/controller.py @@ -355,7 +355,8 @@ 'name': collection_dict.get( 'name', 'dummy' ), 'obj_type': collection_dict[ 'obj_type' ], 'drawables': drawables, - 'prefs': collection_dict.get( 'prefs', [] ) + 'prefs': collection_dict.get( 'prefs', [] ), + 'filters': collection_dict.get( 'filters', {} ) } def encode_dbkey( dbkey ): diff -r 3bd8bed55631728a05a9d873ebff70b74acbfd6e -r 3a9fecf3be20e2413e8993738312246695fda2d3 lib/galaxy/web/controllers/tracks.py --- a/lib/galaxy/web/controllers/tracks.py +++ b/lib/galaxy/web/controllers/tracks.py @@ -252,7 +252,7 @@ "hda_ldda": hda_ldda, "dataset_id": trans.security.encode_id( dataset.id ), "prefs": {}, - "filters": track_data_provider.get_filters(), + "filters": { 'filters' : track_data_provider.get_filters() }, "tool": get_tool_def( trans, dataset ) } return track @@ -671,7 +671,8 @@ "name": collection_json.get( 'name', '' ), "obj_type": collection_json[ 'obj_type' ], "drawables": unpacked_drawables, - "prefs": collection_json.get( 'prefs' , [] ) + "prefs": collection_json.get( 'prefs' , [] ), + "filters": collection_json.get( 'filters', None ) } # TODO: unpack and validate bookmarks: diff -r 3bd8bed55631728a05a9d873ebff70b74acbfd6e -r 3a9fecf3be20e2413e8993738312246695fda2d3 static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -1032,8 +1032,7 @@ // Set up filters. this.filters_manager = new FiltersManager(this); - this.filters_div = this.filters_manager.parent_div; - this.header_div.after(this.filters_div); + this.header_div.after(this.filters_manager.parent_div); // For saving drawables' filter managers when group-level filtering is done: this.saved_filters_managers = null; }; @@ -1059,7 +1058,7 @@ css_class: "filters-icon", on_click_fn: function(group) { // TODO: update tipsy text. - if (group.filters_div.is(":visible")) { + if (group.filters_manager.visible()) { // Hiding filters. group.filters_manager.clear_filters(); @@ -1090,7 +1089,7 @@ group.filters_manager.init_filters(); group.request_draw(true); } - group.filters_div.toggle(); + group.filters_manager.toggle(); } }, Drawable.prototype.action_icons_def[2] @@ -2421,7 +2420,6 @@ this.track = track; this.alpha_filter = null; this.height_filter = null; - this.visible = false; this.filters = []; // @@ -2489,6 +2487,11 @@ }; extend(FiltersManager.prototype, { + // HTML manipulation and inspection. + show: function() { this.parent_div.show(); }, + hide: function() { this.parent_div.hide(); }, + toggle: function() { this.parent_div.toggle(); }, + visible: function() { return this.parent_div.is(":visible"); }, /** * Returns dictionary for manager. */ @@ -3071,13 +3074,13 @@ css_class: "filters-icon", on_click_fn: function(drawable) { // TODO: update tipsy text. - if (drawable.filters_div.is(":visible")) { + if (drawable.filters_manager.visible()) { drawable.filters_manager.clear_filters(); } else { drawable.filters_manager.init_filters(); } - drawable.filters_div.toggle(); + drawable.filters_manager.toggle(); } }, // Toggle track tool. @@ -3337,8 +3340,7 @@ */ set_filters_manager: function(filters_manager) { this.filters_manager = filters_manager; - this.filters_div = this.filters_manager.parent_div; - this.header_div.after(this.filters_div); + this.header_div.after(this.filters_manager.parent_div); }, /** * Returns representation of object in a dictionary for easy saving. @@ -4405,7 +4407,7 @@ if (track.filters_available !== filters_available) { track.filters_available = filters_available; if (!track.filters_available) { - track.filters_div.hide(); + track.filters_manager.hide(); } track.update_icons(); } https://bitbucket.org/galaxy/galaxy-central/changeset/60d72f4bd1ea/ changeset: 60d72f4bd1ea user: jgoecks date: 2012-02-10 15:52:14 summary: Merge affected #: 2 files diff -r 3a9fecf3be20e2413e8993738312246695fda2d3 -r 60d72f4bd1ea1930487e7eedfc3ce78372c00e9c tools/rgenetics/rgFastQC.py --- a/tools/rgenetics/rgFastQC.py +++ b/tools/rgenetics/rgFastQC.py @@ -37,6 +37,7 @@ fastqc_data.txt per_base_gc_content.png per_base_sequence_content.png sequence_length_distribution.png warning.png """ + serr = '' dummy,tlog = tempfile.mkstemp(prefix='rgFastQClog') sout = open(tlog, 'w') fastq = os.path.basename(self.opts.input) @@ -45,12 +46,18 @@ cl.append('-f %s' % self.opts.informat) if self.opts.contaminants <> None : cl.append('-c %s' % self.opts.contaminants) - cl.append(self.opts.input) + # patch suggested by bwlang https://bitbucket.org/galaxy/galaxy-central/pull-request/30 + # use a symlink in a temporary directory so that the FastQC report reflects the history input file name + fastqinfilename = os.path.basename(self.opts.inputfilename).replace(' ','_') + link_name = os.path.join(self.opts.outputdir, fastqinfilename) + os.symlink(self.opts.input, link_name) + cl.append(link_name) p = subprocess.Popen(' '.join(cl), shell=True, stderr=sout, stdout=sout, cwd=self.opts.outputdir) - return_value = p.wait() + retval = p.wait() sout.close() runlog = open(tlog,'r').readlines() os.unlink(tlog) + os.unlink(link_name) flist = os.listdir(self.opts.outputdir) # fastqc plays games with its output directory name. eesh odpath = None for f in flist: @@ -65,7 +72,8 @@ rep = open(hpath,'r').readlines() # for our new html file but we need to insert our stuff after the <body> tag except: pass - if hpath == None: + if hpath == None: + serr = '\n'.join(runlog) res = ['## odpath=%s: No output found in %s. Output for the run was:<pre>\n' % (odpath,hpath),] res += runlog res += ['</pre>\n', @@ -74,7 +82,7 @@ 'It is also possible that the log shows that fastqc is not installed?<br/>\n', 'If that is the case, please tell the relevant Galaxy administrator that it can be snarfed from<br/>\n', 'http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/<br/>\n',] - return res + return res,1,serr self.fix_fastqcimages(odpath) flist = os.listdir(self.opts.outputdir) # these have now been fixed excludefiles = ['tick.png','warning.png','fastqc_icon.png','error.png'] @@ -84,7 +92,7 @@ rep[i] = rep[i].replace('Images/','') html = self.fix_fastqc(rep,flist,runlog) - return html + return html,retval,serr @@ -129,6 +137,7 @@ if __name__ == '__main__': op = optparse.OptionParser() op.add_option('-i', '--input', default=None) + op.add_option('-j', '--inputfilename', default=None) op.add_option('-o', '--htmloutput', default=None) op.add_option('-d', '--outputdir', default="/tmp/shortread") op.add_option('-f', '--informat', default='fastq') @@ -141,9 +150,12 @@ if not os.path.exists(opts.outputdir): os.makedirs(opts.outputdir) f = FastQC(opts) - html = f.run_fastqc() + html,retval,serr = f.run_fastqc() f = open(opts.htmloutput, 'w') f.write(''.join(html)) f.close() + if retval <> 0: + print >> sys.stderr, serr # indicate failure + diff -r 3a9fecf3be20e2413e8993738312246695fda2d3 -r 60d72f4bd1ea1930487e7eedfc3ce78372c00e9c tools/rgenetics/rgFastQC.xml --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,7 +1,7 @@ -<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.3"> +<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.4"><description>using FastQC from Babraham</description><command interpreter="python"> - rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc + rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc #if $contaminants.dataset and str($contaminants) > '' -c "$contaminants" #end if @@ -16,7 +16,7 @@ help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/></inputs><outputs> - <data format="html" name="html_file" label="${out_prefix}.html" /> + <data format="html" name="html_file" label="${out_prefix}_${on_string}.html" /></outputs><tests><test> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: fubar: Updates to FastQC wrapper
by Bitbucket 09 Feb '12

09 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/9a568ceeb9f5/ changeset: 9a568ceeb9f5 user: fubar date: 2012-02-10 00:40:00 summary: Updates to FastQC wrapper 1) improvement suggested by bwlang to pass the history file name in as the file name to fastqc so it appears in the outputs instead of the previously unhelpful internal galaxy filename 2) lack of html output from fastqc or return of non-zero error code now triggers job failure - outputs may still be there but at least it goes red. affected #: 2 files diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 9a568ceeb9f5e281e7ae3c09d6049ac7d16183d4 tools/rgenetics/rgFastQC.py --- a/tools/rgenetics/rgFastQC.py +++ b/tools/rgenetics/rgFastQC.py @@ -37,6 +37,7 @@ fastqc_data.txt per_base_gc_content.png per_base_sequence_content.png sequence_length_distribution.png warning.png """ + serr = '' dummy,tlog = tempfile.mkstemp(prefix='rgFastQClog') sout = open(tlog, 'w') fastq = os.path.basename(self.opts.input) @@ -45,12 +46,18 @@ cl.append('-f %s' % self.opts.informat) if self.opts.contaminants <> None : cl.append('-c %s' % self.opts.contaminants) - cl.append(self.opts.input) + # patch suggested by bwlang https://bitbucket.org/galaxy/galaxy-central/pull-request/30 + # use a symlink in a temporary directory so that the FastQC report reflects the history input file name + fastqinfilename = os.path.basename(self.opts.inputfilename).replace(' ','_') + link_name = os.path.join(self.opts.outputdir, fastqinfilename) + os.symlink(self.opts.input, link_name) + cl.append(link_name) p = subprocess.Popen(' '.join(cl), shell=True, stderr=sout, stdout=sout, cwd=self.opts.outputdir) - return_value = p.wait() + retval = p.wait() sout.close() runlog = open(tlog,'r').readlines() os.unlink(tlog) + os.unlink(link_name) flist = os.listdir(self.opts.outputdir) # fastqc plays games with its output directory name. eesh odpath = None for f in flist: @@ -65,7 +72,8 @@ rep = open(hpath,'r').readlines() # for our new html file but we need to insert our stuff after the <body> tag except: pass - if hpath == None: + if hpath == None: + serr = '\n'.join(runlog) res = ['## odpath=%s: No output found in %s. Output for the run was:<pre>\n' % (odpath,hpath),] res += runlog res += ['</pre>\n', @@ -74,7 +82,7 @@ 'It is also possible that the log shows that fastqc is not installed?<br/>\n', 'If that is the case, please tell the relevant Galaxy administrator that it can be snarfed from<br/>\n', 'http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/<br/>\n',] - return res + return res,1,serr self.fix_fastqcimages(odpath) flist = os.listdir(self.opts.outputdir) # these have now been fixed excludefiles = ['tick.png','warning.png','fastqc_icon.png','error.png'] @@ -84,7 +92,7 @@ rep[i] = rep[i].replace('Images/','') html = self.fix_fastqc(rep,flist,runlog) - return html + return html,retval,serr @@ -129,6 +137,7 @@ if __name__ == '__main__': op = optparse.OptionParser() op.add_option('-i', '--input', default=None) + op.add_option('-j', '--inputfilename', default=None) op.add_option('-o', '--htmloutput', default=None) op.add_option('-d', '--outputdir', default="/tmp/shortread") op.add_option('-f', '--informat', default='fastq') @@ -141,9 +150,12 @@ if not os.path.exists(opts.outputdir): os.makedirs(opts.outputdir) f = FastQC(opts) - html = f.run_fastqc() + html,retval,serr = f.run_fastqc() f = open(opts.htmloutput, 'w') f.write(''.join(html)) f.close() + if retval <> 0: + print >> sys.stderr, serr # indicate failure + diff -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 -r 9a568ceeb9f5e281e7ae3c09d6049ac7d16183d4 tools/rgenetics/rgFastQC.xml --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,7 +1,7 @@ -<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.3"> +<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.4"><description>using FastQC from Babraham</description><command interpreter="python"> - rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc + rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc #if $contaminants.dataset and str($contaminants) > '' -c "$contaminants" #end if @@ -16,7 +16,7 @@ help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/></inputs><outputs> - <data format="html" name="html_file" label="${out_prefix}.html" /> + <data format="html" name="html_file" label="${out_prefix}_${on_string}.html" /></outputs><tests><test> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: save and restore single track filters.
by Bitbucket 09 Feb '12

09 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/abae2caf3da2/ changeset: abae2caf3da2 user: jgoecks date: 2012-02-09 21:32:38 summary: Trackster: save and restore single track filters. affected #: 4 files diff -r da8591377954b8d2472c1fff3d8e13845ea90fd3 -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 lib/galaxy/visualization/tracks/data_providers.py --- a/lib/galaxy/visualization/tracks/data_providers.py +++ b/lib/galaxy/visualization/tracks/data_providers.py @@ -188,7 +188,7 @@ if isinstance( self.original_dataset.datatype, Gff ): # Can filter by score and GTF attributes. filters = [ { 'name': 'Score', - 'type': 'int', + 'type': 'number', 'index': filter_col, 'tool_id': 'Filter1', 'tool_exp_name': 'c6' } ] @@ -199,7 +199,7 @@ if a_type in [ 'int', 'float' ]: filters.append( { 'name': name, - 'type': a_type, + 'type': 'number', 'index': filter_col, 'tool_id': 'gff_filter_by_attribute', 'tool_exp_name': name } ) @@ -228,7 +228,7 @@ elif isinstance( self.original_dataset.datatype, Bed ): # Can filter by score column only. filters = [ { 'name': 'Score', - 'type': 'int', + 'type': 'number', 'index': filter_col, 'tool_id': 'Filter1', 'tool_exp_name': 'c5' diff -r da8591377954b8d2472c1fff3d8e13845ea90fd3 -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 lib/galaxy/web/base/controller.py --- a/lib/galaxy/web/base/controller.py +++ b/lib/galaxy/web/base/controller.py @@ -340,7 +340,7 @@ "dataset_id": trans.security.encode_id( dataset.id ), "prefs": prefs, "mode": track_dict.get( 'mode', 'Auto' ), - "filters": track_data_provider.get_filters(), + "filters": track_dict.get( 'filters', { 'filters' : track_data_provider.get_filters() } ), "tool": get_tool_def( trans, dataset ) } diff -r da8591377954b8d2472c1fff3d8e13845ea90fd3 -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 lib/galaxy/web/controllers/tracks.py --- a/lib/galaxy/web/controllers/tracks.py +++ b/lib/galaxy/web/controllers/tracks.py @@ -653,7 +653,8 @@ "name": track_json['name'], "track_type": track_json['track_type'], "prefs": track_json['prefs'], - "mode": track_json['mode'] + "mode": track_json['mode'], + "filters": track_json['filters'] } def unpack_collection( collection_json ): diff -r da8591377954b8d2472c1fff3d8e13845ea90fd3 -r abae2caf3da253353fbdcc077a7ce3cd64a38e54 static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -927,7 +927,7 @@ prefs: this.prefs, obj_type: this.obj_type, drawables: dictified_drawables - }; + }; }, /** * Restore object from a dictionary created by to_dict() @@ -1206,8 +1206,12 @@ for (var filter_name in shared_filters) { filters = shared_filters[filter_name]; if (filters.length === num_feature_tracks) { - // Add new filter to represent shared filters. - new_filter = new NumberFilter(filters[0].name, filters[0].index); + // Add new filter. + // FIXME: can filter.copy() be used? + new_filter = new NumberFilter( { + name: filters[0].name, + index: filters[0].index + } ); this.filters_manager.add_filter(new_filter); } } @@ -2087,30 +2091,44 @@ /** * Filters that enable users to show/hide data points dynamically. */ -var Filter = function(name, index, tool_id, tool_exp_name) { +var Filter = function(obj_dict) { this.manager = null; - this.name = name; + this.name = obj_dict.name; // Index into payload to filter. - this.index = index; - this.tool_id = tool_id; + this.index = obj_dict.index; + this.tool_id = obj_dict.tool_id; // Name to use for filter when building expression for tool. - this.tool_exp_name = tool_exp_name; + this.tool_exp_name = obj_dict.tool_exp_name; }; +extend(Filter.prototype, { + /** + * Convert filter to dictionary. + */ + to_dict: function() { + return { + name: this.name, + index: this.index, + tool_id: this.tool_id, + tool_exp_name: this.tool_exp_name + }; + } +}); + /** * Number filters have a min, max as well as a low, high; low and high are used */ -var NumberFilter = function(name, index, tool_id, tool_exp_name) { +var NumberFilter = function(obj_dict) { // // Attribute init. // - Filter.call(this, name, index, tool_id, tool_exp_name); + Filter.call(this, obj_dict); // Filter low/high. These values are used to filter elements. - this.low = -Number.MAX_VALUE; - this.high = Number.MAX_VALUE; + this.low = ('low' in obj_dict ? obj_dict.low : -Number.MAX_VALUE); + this.high = ('high' in obj_dict ? obj_dict.high : Number.MAX_VALUE); // Slide min/max. These values are used to set/update slider. - this.min = Number.MAX_VALUE; - this.max = -Number.MAX_VALUE; + this.min = ('min' in obj_dict ? obj_dict.min : Number.MAX_VALUE); + this.max = ('max' in obj_dict ? obj_dict.max : -Number.MAX_VALUE) // UI elements associated with filter. this.container = null; this.slider = null; @@ -2195,7 +2213,7 @@ // Set up filter label (name, values). var filter_label = $("<div/>").addClass("elt-label").appendTo(filter.parent_div), name_span = $("<span/>").addClass("slider-name").text(filter.name + " ").appendTo(filter_label), - values_span = $("<span/>"), + values_span = $("<span/>").text(this.low + "-" + this.high), values_span_container = $("<span/>").addClass("slider-value").appendTo(filter_label).append("[").append(values_span).append("]"); filter.values_span = values_span; @@ -2205,9 +2223,10 @@ var prev_values = [0,0]; filter.control_element.slider({ range: true, - min: Number.MAX_VALUE, - max: -Number.MIN_VALUE, - values: [0, 0], + min: this.min, + max: this.max, + step: this.get_slider_step(this.min, this.max), + values: [this.low, this.high], slide: function(event, ui) { filter.slide(event, ui); }, @@ -2222,52 +2241,51 @@ edit_slider_values(values_span_container, values_span, filter.control_element); // Set up filter display controls. - var - display_controls_div = $("<div/>").addClass("display-controls").appendTo(filter.parent_div), - transparency_icon = create_action_icon("Use filter for data transparency", "layer-transparent", + var display_controls_div = $("<div/>").addClass("display-controls").appendTo(filter.parent_div); + this.transparency_icon = create_action_icon("Use filter for data transparency", "layer-transparent", function() { if (filter.manager.alpha_filter !== filter) { // Setting this filter as the alpha filter. filter.manager.alpha_filter = filter; // Update UI for new filter. filter.manager.parent_div.find(".layer-transparent").removeClass("active").hide(); - transparency_icon.addClass("active").show(); + filter.transparency_icon.addClass("active").show(); } else { // Clearing filter as alpha filter. filter.manager.alpha_filter = null; - transparency_icon.removeClass("active"); + filter.transparency_icon.removeClass("active"); } filter.manager.track.request_draw(true, true); } ) - .appendTo(display_controls_div).hide(), - height_icon = create_action_icon("Use filter for data height", "arrow-resize-090", + .appendTo(display_controls_div).hide(); + this.height_icon = create_action_icon("Use filter for data height", "arrow-resize-090", function() { if (filter.manager.height_filter !== filter) { // Setting this filter as the height filter. filter.manager.height_filter = filter; // Update UI for new filter. filter.manager.parent_div.find(".arrow-resize-090").removeClass("active").hide(); - height_icon.addClass("active").show(); + filter.height_icon.addClass("active").show(); } else { // Clearing filter as alpha filter. filter.manager.height_filter = null; - height_icon.removeClass("active"); + filter.height_icon.removeClass("active"); } filter.manager.track.request_draw(true, true); } ) .appendTo(display_controls_div).hide(); filter.parent_div.hover( function() { - transparency_icon.show(); - height_icon.show(); + filter.transparency_icon.show(); + filter.height_icon.show(); }, function() { if (filter.manager.alpha_filter !== filter) { - transparency_icon.hide(); + filter.transparency_icon.hide(); } if (filter.manager.height_filter !== filter) { - height_icon.hide(); + filter.height_icon.hide(); } } ); @@ -2276,10 +2294,29 @@ }; extend(NumberFilter.prototype, { /** + * Convert filter to dictionary. + */ + to_dict: function() { + var obj_dict = Filter.prototype.to_dict.call(this); + return extend(obj_dict, { + type: 'number', + min: this.min, + max: this.max, + low: this.low, + high: this.high + }); + }, + /** * Return a copy of filter. */ copy: function() { - return new NumberFilter(this.name, this.index, this.tool_id, this.tool_exp_name); + return new NumberFilter( + { + name: this.name, + index: this.index, + tool_id: this.tool_id, + tool_exp_name: this.tool_exp_name + }); }, /** * Get step for slider. @@ -2380,8 +2417,12 @@ /** * Manages a set of filters. */ -var FiltersManager = function(track, filters_dict) { +var FiltersManager = function(track, obj_dict) { this.track = track; + this.alpha_filter = null; + this.height_filter = null; + this.visible = false; + this.filters = []; // // Create HTML. @@ -2403,24 +2444,36 @@ }); // - // Unpack filters from dict. + // Restore state from dict. // - this.filters = []; - if (filters_dict) { + if (obj_dict) { + var + alpha_filter_name = ('alpha_filter' in obj_dict ? obj_dict.alpha_filter : null), + height_filter_name = ('height_filter' in obj_dict ? obj_dict.height_filter : null), + filters_dict = obj_dict.filters, + filter; for (var i = 0; i < filters_dict.length; i++) { - var - filter_dict = filters_dict[i], - name = filter_dict.name, - type = filter_dict.type, - index = filter_dict.index, - tool_id = filter_dict.tool_id, - tool_exp_name = filter_dict.tool_exp_name; - if (type === 'int' || type === 'float') { - this.add_filter( new NumberFilter(name, index, tool_id, tool_exp_name) ); - } else { + if (filters_dict[i].type === 'number') { + filter = new NumberFilter(filters_dict[i]); + this.add_filter(filter); + if (filter.name === alpha_filter_name) { + this.alpha_filter = filter; + filter.transparency_icon.addClass("active").show(); + } + if (filter.name === height_filter_name) { + this.height_filter = filter; + filter.height_icon.addClass("active").show(); + } + } + else { console.log("ERROR: unsupported filter: ", name, type) } } + + + if ('visible' in obj_dict && obj_dict.visible) { + this.parent_div.show(); + } } // Add button to filter complete dataset. @@ -2437,6 +2490,30 @@ extend(FiltersManager.prototype, { /** + * Returns dictionary for manager. + */ + to_dict: function() { + var obj_dict = {}, + filter_dicts = [], + filter; + + // Include individual filter states. + for (var i = 0; i < this.filters.length; i++) { + filter = this.filters[i]; + filter_dicts.push(filter.to_dict()); + } + obj_dict['filters'] = filter_dicts; + + // Include transparency, height filters. + obj_dict['alpha_filter'] = (this.alpha_filter ? this.alpha_filter.name : null); + obj_dict['height_filter'] = (this.height_filter ? this.height_filter.name : null); + + // Include visibility. + obj_dict['visible'] = this.parent_div.is(":visible"); + + return obj_dict; + }, + /** * Return a copy of the manager. */ copy: function(new_track) { @@ -3275,6 +3352,7 @@ "dataset_id": this.dataset_id, "prefs": this.prefs, "mode": this.mode, + "filters": this.filters_manager.to_dict() }; }, /** Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Make set_user_disk_usage.py object store-aware.
by Bitbucket 09 Feb '12

09 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/da8591377954/ changeset: da8591377954 user: natefoo date: 2012-02-09 19:26:14 summary: Make set_user_disk_usage.py object store-aware. affected #: 1 file diff -r f465995c107ebb5e932404c07bb8e7f878214cc6 -r da8591377954b8d2472c1fff3d8e13845ea90fd3 scripts/set_user_disk_usage.py --- a/scripts/set_user_disk_usage.py +++ b/scripts/set_user_disk_usage.py @@ -27,13 +27,23 @@ from galaxy import eggs import pkg_resources - config = ConfigParser( dict( file_path = 'database/files', - database_connection = 'sqlite:///database/universe.sqlite?isolation_level=IMMEDIATE' ) ) - config.read( os.path.basename( options.config ) ) + import galaxy.config + from galaxy.objectstore import build_object_store_from_config + + config_parser = ConfigParser( dict( here = os.getcwd(), + database_connection = 'sqlite:///database/universe.sqlite?isolation_level=IMMEDIATE' ) ) + config_parser.read( os.path.basename( options.config ) ) + + config_dict = {} + for key, value in config_parser.items( "app:main" ): + config_dict[key] = value + + config = galaxy.config.Configuration( **config_dict ) + object_store = build_object_store_from_config( config ) from galaxy.model import mapping - return mapping.init( config.get( 'app:main', 'file_path' ), config.get( 'app:main', 'database_connection' ), create_tables = False ) + return mapping.init( config.file_path, config.database_connection, create_tables = False, object_store = object_store ), object_store def quotacheck( sa_session, users ): sa_session.refresh( user ) @@ -57,7 +67,7 @@ if __name__ == '__main__': print 'Loading Galaxy model...' - model = init() + model, object_store = init() sa_session = model.context.current if not options.username and not options.email: @@ -67,6 +77,7 @@ print '%3i%%' % int( float(i) / user_count * 100 ), quotacheck( sa_session, user ) print '100% complete' + object_store.shutdown() sys.exit( 0 ) elif options.username: user = sa_session.query( model.User ).enable_eagerloads( False ).filter_by( username=options.username ).first() @@ -75,4 +86,5 @@ if not user: print 'User not found' sys.exit( 1 ) + object_store.shutdown() quotacheck( sa_session, user ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Handle multiple relationships in the tool lineage chain at the time of repository installation.
by Bitbucket 09 Feb '12

09 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/f465995c107e/ changeset: f465995c107e user: greg date: 2012-02-09 17:43:03 summary: Handle multiple relationships in the tool lineage chain at the time of repository installation. affected #: 4 files diff -r 981551e6caca70574a3ccf4f633fb4302e855dad -r f465995c107ebb5e932404c07bb8e7f878214cc6 lib/galaxy/tool_shed/install_manager.py --- a/lib/galaxy/tool_shed/install_manager.py +++ b/lib/galaxy/tool_shed/install_manager.py @@ -106,10 +106,11 @@ text = response.read() response.close() if text: - tool_versions_dict = from_json_string( text ) - handle_tool_versions( self.app, tool_versions_dict, tool_shed_repository ) + tool_version_dicts = from_json_string( text ) + handle_tool_versions( self.app, tool_version_dicts, tool_shed_repository ) else: # Set the tool versions since they seem to be missing for this repository in the tool shed. + # CRITICAL NOTE: These default settings may not properly handle all parent/child associations. for tool_dict in metadata_dict[ 'tools' ]: flush_needed = False tool_id = tool_dict[ 'guid' ] diff -r 981551e6caca70574a3ccf4f633fb4302e855dad -r f465995c107ebb5e932404c07bb8e7f878214cc6 lib/galaxy/util/shed_util.py --- a/lib/galaxy/util/shed_util.py +++ b/lib/galaxy/util/shed_util.py @@ -477,33 +477,35 @@ error = tmp_stderr.read() tmp_stderr.close() log.debug( 'Problem installing dependencies for tool "%s"\n%s' % ( repository_tool.name, error ) ) -def handle_tool_versions( app, tool_versions, tool_shed_repository ): +def handle_tool_versions( app, tool_version_dicts, tool_shed_repository ): """ - This method is used by the InstallManager, which does not have access to trans. Using - the tool_versions dictionary retrieved from the tool shed, create the parent / child pairs - of tool versions. The tool_versions dictionary contains { tool id : parent tool id } pairs. + This method is used by the InstallManager, which does not have access to trans. Using the list + of tool_version_dicts retrieved from the tool shed (one per chngeset revison up to the currently + installed changeset revision), create the parent / child pairs of tool versions. Each dictionary + contains { tool id : parent tool id } pairs. """ sa_session = app.model.context.current - for tool_guid, parent_id in tool_versions.items(): - tool_version_using_tool_guid = get_tool_version( app, tool_guid ) - tool_version_using_parent_id = get_tool_version( app, parent_id ) - if not tool_version_using_tool_guid: - tool_version_using_tool_guid = app.model.ToolVersion( tool_id=tool_guid, tool_shed_repository=tool_shed_repository ) - sa_session.add( tool_version_using_tool_guid ) - sa_session.flush() - if not tool_version_using_parent_id: - tool_version_using_parent_id = app.model.ToolVersion( tool_id=parent_id, tool_shed_repository=tool_shed_repository ) - sa_session.add( tool_version_using_parent_id ) - sa_session.flush() - # Associate the two versions as parent / child. - tool_version_association = get_tool_version_association( app, - tool_version_using_parent_id, - tool_version_using_tool_guid ) - if not tool_version_association: - tool_version_association = app.model.ToolVersionAssociation( tool_id=tool_version_using_tool_guid.id, - parent_id=tool_version_using_parent_id.id ) - sa_session.add( tool_version_association ) - sa_session.flush() + for tool_version_dict in tool_version_dicts: + for tool_guid, parent_id in tool_version_dict.items(): + tool_version_using_tool_guid = get_tool_version( app, tool_guid ) + tool_version_using_parent_id = get_tool_version( app, parent_id ) + if not tool_version_using_tool_guid: + tool_version_using_tool_guid = app.model.ToolVersion( tool_id=tool_guid, tool_shed_repository=tool_shed_repository ) + sa_session.add( tool_version_using_tool_guid ) + sa_session.flush() + if not tool_version_using_parent_id: + tool_version_using_parent_id = app.model.ToolVersion( tool_id=parent_id, tool_shed_repository=tool_shed_repository ) + sa_session.add( tool_version_using_parent_id ) + sa_session.flush() + tool_version_association = get_tool_version_association( app, + tool_version_using_parent_id, + tool_version_using_tool_guid ) + if not tool_version_association: + # Associate the two versions as parent / child. + tool_version_association = app.model.ToolVersionAssociation( tool_id=tool_version_using_tool_guid.id, + parent_id=tool_version_using_parent_id.id ) + sa_session.add( tool_version_association ) + sa_session.flush() def load_datatype_items( app, repository, relative_install_dir, deactivate=False ): # Load proprietary datatypes. metadata = repository.metadata diff -r 981551e6caca70574a3ccf4f633fb4302e855dad -r f465995c107ebb5e932404c07bb8e7f878214cc6 lib/galaxy/web/controllers/admin_toolshed.py --- a/lib/galaxy/web/controllers/admin_toolshed.py +++ b/lib/galaxy/web/controllers/admin_toolshed.py @@ -242,8 +242,8 @@ text = response.read() response.close() if text: - tool_versions_dict = from_json_string( text ) - handle_tool_versions( trans.app, tool_versions_dict, tool_shed_repository ) + tool_version_dicts = from_json_string( text ) + handle_tool_versions( trans.app, tool_version_dicts, tool_shed_repository ) else: message += "Version information for the tools included in the <b>%s</b> repository is missing. " % name message += "Reset all of this repository's metadata in the tool shed, then set the installed tool versions " @@ -309,8 +309,8 @@ text = response.read() response.close() if text: - tool_versions_dict = from_json_string( text ) - handle_tool_versions( trans.app, tool_versions_dict, repository ) + tool_version_dicts = from_json_string( text ) + handle_tool_versions( trans.app, tool_version_dicts, repository ) message = "Tool versions have been set for all included tools." status = 'done' else: diff -r 981551e6caca70574a3ccf4f633fb4302e855dad -r f465995c107ebb5e932404c07bb8e7f878214cc6 lib/galaxy/webapps/community/controllers/repository.py --- a/lib/galaxy/webapps/community/controllers/repository.py +++ b/lib/galaxy/webapps/community/controllers/repository.py @@ -774,13 +774,27 @@ return trans.response.send_redirect( url ) @web.expose def get_tool_versions( self, trans, **kwd ): + """ + For each valid /downloadable change set (up to the received changeset_revision) in the + repository's change log, append the change set's tool_versions dictionary to the list + that will be returned. + """ name = kwd[ 'name' ] owner = kwd[ 'owner' ] changeset_revision = kwd[ 'changeset_revision' ] repository = get_repository_by_name_and_owner( trans, name, owner ) - repository_metadata = get_repository_metadata_by_changeset_revision( trans, trans.security.encode_id( repository.id ), changeset_revision ) + repo_dir = repository.repo_path + repo = hg.repository( get_configured_ui(), repo_dir ) + tool_version_dicts = [] + for changeset in repo.changelog: + current_changeset_revision = str( repo.changectx( changeset ) ) + repository_metadata = get_repository_metadata_by_changeset_revision( trans, trans.security.encode_id( repository.id ), current_changeset_revision ) + if repository_metadata and repository_metadata.tool_versions: + tool_version_dicts.append( repository_metadata.tool_versions ) + if current_changeset_revision == changeset_revision: + break if repository_metadata.tool_versions: - return to_json_string( repository_metadata.tool_versions ) + return to_json_string( tool_version_dicts ) return '' @web.expose def check_for_updates( self, trans, **kwd ): Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Remove maximum value for Tophat parameter initial_read_mismatches.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/981551e6caca/ changeset: 981551e6caca user: jgoecks date: 2012-02-09 04:56:50 summary: Remove maximum value for Tophat parameter initial_read_mismatches. affected #: 1 file diff -r c06d7cef9125577820006c607c0628b4940ca57d -r 981551e6caca70574a3ccf4f633fb4302e855dad tools/ngs_rna/tophat_wrapper.xml --- a/tools/ngs_rna/tophat_wrapper.xml +++ b/tools/ngs_rna/tophat_wrapper.xml @@ -207,7 +207,7 @@ <param name="max_multihits" type="integer" value="40" label="Maximum number of alignments to be allowed" /><param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /><param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /> - <param name="initial_read_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in the initial read mapping" /> + <param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /><param name="seg_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /><param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> @@ -314,7 +314,7 @@ <param name="max_multihits" type="integer" value="40" label="Maximum number of alignments to be allowed" /><param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /><param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /> - <param name="initial_read_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in the initial read mapping" /> + <param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /><param name="seg_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /><param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: When handling datatype conflicts always override previously loaded datatypes with the datatype currently being loaded. Use the same behavior for sniffers.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/c06d7cef9125/ changeset: c06d7cef9125 user: greg date: 2012-02-08 19:46:14 summary: When handling datatype conflicts always override previously loaded datatypes with the datatype currently being loaded. Use the same behavior for sniffers. affected #: 2 files diff -r 7c7b3f6ebbdbef5e9101c09037905a01511e9b9c -r c06d7cef9125577820006c607c0628b4940ca57d lib/galaxy/app.py --- a/lib/galaxy/app.py +++ b/lib/galaxy/app.py @@ -57,7 +57,7 @@ # This will also load proprietary datatype converters and display applications. self.installed_repository_manager.load_proprietary_datatypes() # Load the data types in the Galaxy distribution, which are defined in self.config.datatypes_config. - self.datatypes_registry.load_datatypes( self.config.root, self.config.datatypes_config, override_conflicts=True ) + self.datatypes_registry.load_datatypes( self.config.root, self.config.datatypes_config ) galaxy.model.set_datatypes_registry( self.datatypes_registry ) # Security helper self.security = security.SecurityHelper( id_secret=self.config.id_secret ) diff -r 7c7b3f6ebbdbef5e9101c09037905a01511e9b9c -r c06d7cef9125577820006c607c0628b4940ca57d lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -26,8 +26,6 @@ self.converter_deps = {} self.available_tracks = [] self.set_external_metadata_tool = None - # Keep a list of datatypes with loaded sniffers for handling potential conflicts. - self.datatype_sniffers = [] self.sniff_order = [] self.upload_file_formats = [] # Datatype elements defined in local datatypes_conf.xml that contain display applications. @@ -49,7 +47,7 @@ self.datatype_elems = [] self.sniffer_elems = [] self.xml_filename = None - def load_datatypes( self, root_dir=None, config=None, imported_modules=None, deactivate=False, override_conflicts=False ): + def load_datatypes( self, root_dir=None, config=None, imported_modules=None, deactivate=False ): """ Parse a datatypes XML file located at root_dir/config. If imported_modules is received, it is a list of imported datatypes class files included in an installed tool shed repository. @@ -100,13 +98,10 @@ else: # Keep an in-memory list of datatype elems to enable persistence. self.datatype_elems.append( elem ) - if extension and extension in self.datatypes_by_extension and not override_conflicts: - if deactivate: - # We are deactivating an installed tool shed repository, so eliminate the datatype from the registry. - self.log.debug( "Removing datatype with extension '%s' from the registry." % extension ) - del self.datatypes_by_extension[ extension ] - else: - self.log.debug( "Ignoring datatype with extension '%s' from %s because the registry already contains a datatype with that extension." % ( extension, config ) ) + if extension and extension in self.datatypes_by_extension and deactivate: + # We are deactivating an installed tool shed repository, so eliminate the datatype from the registry. + self.log.debug( "Removing datatype with extension '%s' from the registry." % extension ) + del self.datatypes_by_extension[ extension ] elif extension and ( dtype or type_extension ): if dtype: fields = dtype.split( ':' ) @@ -120,8 +115,7 @@ datatype_class = getattr( imported_module, datatype_class_name ) break if datatype_class is None: - # The datatype class name must be contained in one of the datatype - # modules in the Galaxy distribution. + # The datatype class name must be contained in one of the datatype modules in the Galaxy distribution. fields = datatype_module.split( '.' ) module = __import__( fields.pop(0) ) for mod in fields: @@ -131,52 +125,48 @@ datatype_class = self.datatypes_by_extension[type_extension].__class__ if make_subclass: datatype_class = type( datatype_class_name, (datatype_class,), {} ) - if extension not in self.datatypes_by_extension or override_conflicts: - if extension in self.datatypes_by_extension: - self.log.warning( "Overriding conflicting extension '%s', using datatype with same extension from %s." % ( extension, config ) ) - self.datatypes_by_extension[ extension ] = datatype_class() - if mimetype is None: - # Use default mime type as per datatype spec - mimetype = self.datatypes_by_extension[extension].get_mime() - self.mimetypes_by_extension[extension] = mimetype - if hasattr( datatype_class, "get_track_type" ): - self.available_tracks.append( extension ) - if display_in_upload: - self.upload_file_formats.append( extension ) - # Max file size cut off for setting optional metadata - self.datatypes_by_extension[extension].max_optional_metadata_filesize = elem.get( 'max_optional_metadata_filesize', None ) - for converter in elem.findall( 'converter' ): - # Build the list of datatype converters which will later be loaded - # into the calling app's toolbox. - converter_config = converter.get( 'file', None ) - target_datatype = converter.get( 'target_datatype', None ) - depends_on = converter.get( 'depends_on', None ) - if depends_on and target_datatype: - if extension not in self.converter_deps: - self.converter_deps[extension] = {} - self.converter_deps[extension][target_datatype] = depends_on.split(',') - if converter_config and target_datatype: - if imported_modules: - self.proprietary_converters.append( ( converter_config, extension, target_datatype ) ) - else: - self.converters.append( ( converter_config, extension, target_datatype ) ) - for composite_file in elem.findall( 'composite_file' ): - # add composite files - name = composite_file.get( 'name', None ) - if name is None: - self.log.warning( "You must provide a name for your composite_file (%s)." % composite_file ) - optional = composite_file.get( 'optional', False ) - mimetype = composite_file.get( 'mimetype', None ) - self.datatypes_by_extension[extension].add_composite_file( name, optional=optional, mimetype=mimetype ) - for display_app in elem.findall( 'display' ): + if extension in self.datatypes_by_extension: + self.log.warning( "Overriding conflicting datatype with extension '%s', using datatype from %s." % ( extension, config ) ) + self.datatypes_by_extension[ extension ] = datatype_class() + if mimetype is None: + # Use default mime type as per datatype spec + mimetype = self.datatypes_by_extension[extension].get_mime() + self.mimetypes_by_extension[extension] = mimetype + if hasattr( datatype_class, "get_track_type" ): + self.available_tracks.append( extension ) + if display_in_upload: + self.upload_file_formats.append( extension ) + # Max file size cut off for setting optional metadata + self.datatypes_by_extension[extension].max_optional_metadata_filesize = elem.get( 'max_optional_metadata_filesize', None ) + for converter in elem.findall( 'converter' ): + # Build the list of datatype converters which will later be loaded into the calling app's toolbox. + converter_config = converter.get( 'file', None ) + target_datatype = converter.get( 'target_datatype', None ) + depends_on = converter.get( 'depends_on', None ) + if depends_on and target_datatype: + if extension not in self.converter_deps: + self.converter_deps[extension] = {} + self.converter_deps[extension][target_datatype] = depends_on.split(',') + if converter_config and target_datatype: if imported_modules: - if elem not in self.proprietary_display_app_containers: - self.proprietary_display_app_containers.append( elem ) + self.proprietary_converters.append( ( converter_config, extension, target_datatype ) ) else: - if elem not in self.display_app_containers: - self.display_app_containers.append( elem ) - else: - self.log.debug( "Ignoring datatype with extension '%s' from %s because the registry already contains a datatype with that extension." % ( extension, config ) ) + self.converters.append( ( converter_config, extension, target_datatype ) ) + for composite_file in elem.findall( 'composite_file' ): + # add composite files + name = composite_file.get( 'name', None ) + if name is None: + self.log.warning( "You must provide a name for your composite_file (%s)." % composite_file ) + optional = composite_file.get( 'optional', False ) + mimetype = composite_file.get( 'mimetype', None ) + self.datatypes_by_extension[extension].add_composite_file( name, optional=optional, mimetype=mimetype ) + for display_app in elem.findall( 'display' ): + if imported_modules: + if elem not in self.proprietary_display_app_containers: + self.proprietary_display_app_containers.append( elem ) + else: + if elem not in self.display_app_containers: + self.display_app_containers.append( elem ) except Exception, e: if deactivate: self.log.warning( "Error deactivating datatype with extension '%s': %s" % ( extension, str( e ) ) ) @@ -202,26 +192,33 @@ module = imported_module break if module is None: - # The datatype class name must be contained in one of the datatype - # modules in the Galaxy distribution. + # The datatype class name must be contained in one of the datatype modules in the Galaxy distribution. module = __import__( datatype_module ) for comp in datatype_module.split( '.' )[ 1: ]: module = getattr( module, comp ) aclass = getattr( module, datatype_class_name )() + # See if we have a conflicting sniffer already loaded. + conflict_loc = None + conflict = False + for conflict_loc, sniffer_class in enumerate( self.sniff_order ): + if sniffer_class.__class__ == aclass.__class__: + conflict = True + break if deactivate: - self.sniff_order.remove( aclass ) - self.datatype_sniffers.remove( dtype ) + for sniffer_class in self.sniff_order: + if sniffer_class.__class__ == aclass.__class__: + self.sniff_order.remove( sniffer_class ) + break self.log.debug( "Deactivated sniffer for datatype '%s'" % dtype ) else: - if override_conflicts and dtype in self.datatype_sniffers: + if conflict: + # We have a conflicting sniffer, so replace the one previously loaded. + del self.sniff_order[ conflict_loc ] self.sniff_order.append( aclass ) - self.log.debug( "Loaded additional sniffer for datatype '%s'" % dtype ) - elif dtype not in self.datatype_sniffers: - self.datatype_sniffers.append( dtype ) + self.log.debug( "Replaced conflicting sniffer for datatype '%s'" % dtype ) + else: self.sniff_order.append( aclass ) self.log.debug( "Loaded sniffer for datatype '%s'" % dtype ) - else: - self.log.debug( "Ignoring sniffer for datatype '%s' because the registry already contains one." % dtype ) except Exception, exc: if deactivate: self.log.warning( "Error deactivating sniffer for datatype '%s': %s" % ( dtype, str( exc ) ) ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Fix bug in GFFDataProvider's data iterator.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/7c7b3f6ebbdb/ changeset: 7c7b3f6ebbdb user: jgoecks date: 2012-02-08 17:55:49 summary: Fix bug in GFFDataProvider's data iterator. affected #: 1 file diff -r 865d998a693de676c01daea4128d20124d2015c0 -r 7c7b3f6ebbdbef5e9101c09037905a01511e9b9c lib/galaxy/visualization/tracks/data_providers.py --- a/lib/galaxy/visualization/tracks/data_providers.py +++ b/lib/galaxy/visualization/tracks/data_providers.py @@ -927,18 +927,20 @@ def get_iterator( self, chrom, start, end ): """ - Returns an iterator that provides data in the region chrom:start-end + Returns an iterator that provides data in the region chrom:start-end as well as + a file offset. """ start, end = int( start ), int( end ) source = open( self.original_dataset.file_name ) def features_in_region_iter(): + offset = 0 for feature in GFFReaderWrapper( source, fix_strand=True ): # Only provide features that are in region. feature_start, feature_end = convert_gff_coords_to_bed( [ feature.start, feature.end ] ) - if feature.chrom != chrom or feature_end < start or feature_start > end: - continue - yield feature + if feature.chrom == chrom and feature_end > start and feature_start < end: + yield feature, offset + offset += feature.raw_size return features_in_region_iter() def process_data( self, iterator, start_val=0, max_vals=None, **kwargs ): @@ -949,9 +951,8 @@ no_detail = ( "no_detail" in kwargs ) results = [] message = None - offset = 0 - - for count, feature in enumerate( iterator ): + + for count, ( feature, offset ) in enumerate( iterator ): if count < start_val: continue if count-start_val >= max_vals: @@ -961,7 +962,7 @@ payload = package_gff_feature( feature, no_detail=no_detail, filter_cols=filter_cols ) payload.insert( 0, offset ) results.append( payload ) - offset += feature.raw_size + return { 'data': results, 'message': message } Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Load proprietary datatypes from installed tool shed repositories before the datatypes in the Galaxy distribution are loaded. We do this because the distribution includes some extremely generic sniffers (eg text, xml) which will catch pretty much anything, making it impossible for proprietary sniffers to be used. Proprietary datatypes contained in installed repositories are loaded in order of oldest installation first, followed by next olderst installation, etc.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/865d998a693d/ changeset: 865d998a693d user: greg date: 2012-02-08 17:30:58 summary: Load proprietary datatypes from installed tool shed repositories before the datatypes in the Galaxy distribution are loaded. We do this because the distribution includes some extremely generic sniffers (eg text,xml) which will catch pretty much anything, making it impossible for proprietary sniffers to be used. Proprietary datatypes contained in installed repositories are loaded in order of oldest installation first, followed by next olderst installation, etc. affected #: 3 files diff -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 -r 865d998a693de676c01daea4128d20124d2015c0 lib/galaxy/app.py --- a/lib/galaxy/app.py +++ b/lib/galaxy/app.py @@ -22,15 +22,6 @@ self.config = config.Configuration( **kwargs ) self.config.check() config.configure_logging( self.config ) - # Initialize the datatypes registry to the default data types included in self.config.datatypes_config. - self.datatypes_registry = galaxy.datatypes.registry.Registry() - self.datatypes_registry.load_datatypes( self.config.root, self.config.datatypes_config ) - galaxy.model.set_datatypes_registry( self.datatypes_registry ) - # Set up the tool sheds registry - if os.path.isfile( self.config.tool_sheds_config ): - self.tool_shed_registry = galaxy.tool_shed.tool_shed_registry.Registry( self.config.root, self.config.tool_sheds_config ) - else: - self.tool_shed_registry = None # Determine the database url if self.config.database_connection: db_url = self.config.database_connection @@ -48,6 +39,26 @@ self.config.database_engine_options, database_query_profiling_proxy = self.config.database_query_profiling_proxy, object_store = self.object_store ) + # Set up the tool sheds registry + if os.path.isfile( self.config.tool_sheds_config ): + self.tool_shed_registry = galaxy.tool_shed.tool_shed_registry.Registry( self.config.root, self.config.tool_sheds_config ) + else: + self.tool_shed_registry = None + # Manage installed tool shed repositories. + self.installed_repository_manager = galaxy.tool_shed.InstalledRepositoryManager( self ) + # Create an empty datatypes registry. + self.datatypes_registry = galaxy.datatypes.registry.Registry() + # Load proprietary datatypes defined in datatypes_conf.xml files in all installed tool shed repositories. We + # load proprietary datatypes before datatypes in the distribution because Galaxy's default sniffers include some + # generic sniffers (eg text,xml) which catch anything, so it's impossible for proprietary sniffers to be used. + # However, if there is a conflict (2 datatypes with the same extension) between a proprietary datatype and a datatype + # in the Galaxy distribution, the datatype in the Galaxy distribution will take precedence. If there is a conflict + # between 2 proprietary datatypes, the datatype from the repository that was installed earliest will take precedence. + # This will also load proprietary datatype converters and display applications. + self.installed_repository_manager.load_proprietary_datatypes() + # Load the data types in the Galaxy distribution, which are defined in self.config.datatypes_config. + self.datatypes_registry.load_datatypes( self.config.root, self.config.datatypes_config, override_conflicts=True ) + galaxy.model.set_datatypes_registry( self.datatypes_registry ) # Security helper self.security = security.SecurityHelper( id_secret=self.config.id_secret ) # Tag handler @@ -63,28 +74,22 @@ if self.config.get_bool( 'enable_tool_shed_install', False ): from tool_shed import install_manager self.install_manager = install_manager.InstallManager( self, self.config.tool_shed_install_config, self.config.install_tool_config ) - # If enabled, poll respective tool sheds to see if updates are - # available for any installed tool shed repositories. + # If enabled, poll respective tool sheds to see if updates are available for any installed tool shed repositories. if self.config.get_bool( 'enable_tool_shed_check', False ): from tool_shed import update_manager self.update_manager = update_manager.UpdateManager( self ) - # Manage installed tool shed repositories - self.installed_repository_manager = galaxy.tool_shed.InstalledRepositoryManager( self ) # Load datatype display applications defined in local datatypes_conf.xml self.datatypes_registry.load_display_applications() # Load datatype converters defined in local datatypes_conf.xml self.datatypes_registry.load_datatype_converters( self.toolbox ) - # Load history import/export tools - load_history_imp_exp_tools( self.toolbox ) # Load external metadata tool self.datatypes_registry.load_external_metadata_tool( self.toolbox ) - # Load proprietary datatypes defined in datatypes_conf.xml files in all installed tool shed - # repositories. This will also load all proprietary datatype converters and display_applications. - self.installed_repository_manager.load_proprietary_datatypes() - # Load security policy + # Load history import/export tools. + load_history_imp_exp_tools( self.toolbox ) + # Load security policy. self.security_agent = self.model.security_agent self.host_security_agent = galaxy.security.HostAgent( model=self.security_agent.model, permitted_actions=self.security_agent.permitted_actions ) - # Load quota management + # Load quota management. if self.config.enable_quotas: self.quota_agent = galaxy.quota.QuotaAgent( self.model ) else: diff -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 -r 865d998a693de676c01daea4128d20124d2015c0 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -26,13 +26,14 @@ self.converter_deps = {} self.available_tracks = [] self.set_external_metadata_tool = None + # Keep a list of datatypes with loaded sniffers for handling potential conflicts. + self.datatype_sniffers = [] self.sniff_order = [] self.upload_file_formats = [] - # Datatype elements defined in local datatypes_conf.xml - # that contain display applications + # Datatype elements defined in local datatypes_conf.xml that contain display applications. self.display_app_containers = [] # Datatype elements in datatypes_conf.xml included in installed - # tool shed repositories that contain display applications + # tool shed repositories that contain display applications. self.proprietary_display_app_containers = [] # Map a display application id to a display application self.display_applications = odict() @@ -48,7 +49,7 @@ self.datatype_elems = [] self.sniffer_elems = [] self.xml_filename = None - def load_datatypes( self, root_dir=None, config=None, imported_modules=None, deactivate=False ): + def load_datatypes( self, root_dir=None, config=None, imported_modules=None, deactivate=False, override_conflicts=False ): """ Parse a datatypes XML file located at root_dir/config. If imported_modules is received, it is a list of imported datatypes class files included in an installed tool shed repository. @@ -99,13 +100,13 @@ else: # Keep an in-memory list of datatype elems to enable persistence. self.datatype_elems.append( elem ) - if extension and extension in self.datatypes_by_extension: + if extension and extension in self.datatypes_by_extension and not override_conflicts: if deactivate: # We are deactivating an installed tool shed repository, so eliminate the datatype from the registry. self.log.debug( "Removing datatype with extension '%s' from the registry." % extension ) del self.datatypes_by_extension[ extension ] else: - self.log.debug( "Ignoring datatype with extension '%s' from '%s' because the registry already contains a datatype with that extension." % ( extension, config ) ) + self.log.debug( "Ignoring datatype with extension '%s' from %s because the registry already contains a datatype with that extension." % ( extension, config ) ) elif extension and ( dtype or type_extension ): if dtype: fields = dtype.split( ':' ) @@ -130,52 +131,57 @@ datatype_class = self.datatypes_by_extension[type_extension].__class__ if make_subclass: datatype_class = type( datatype_class_name, (datatype_class,), {} ) - self.datatypes_by_extension[extension] = datatype_class() - if mimetype is None: - # Use default mime type as per datatype spec - mimetype = self.datatypes_by_extension[extension].get_mime() - self.mimetypes_by_extension[extension] = mimetype - if hasattr( datatype_class, "get_track_type" ): - self.available_tracks.append( extension ) - if display_in_upload: - self.upload_file_formats.append( extension ) - # Max file size cut off for setting optional metadata - self.datatypes_by_extension[extension].max_optional_metadata_filesize = elem.get( 'max_optional_metadata_filesize', None ) - for converter in elem.findall( 'converter' ): - # Build the list of datatype converters which will later be loaded - # into the calling app's toolbox. - converter_config = converter.get( 'file', None ) - target_datatype = converter.get( 'target_datatype', None ) - depends_on = converter.get( 'depends_on', None ) - if depends_on and target_datatype: - if extension not in self.converter_deps: - self.converter_deps[extension] = {} - self.converter_deps[extension][target_datatype] = depends_on.split(',') - if converter_config and target_datatype: + if extension not in self.datatypes_by_extension or override_conflicts: + if extension in self.datatypes_by_extension: + self.log.warning( "Overriding conflicting extension '%s', using datatype with same extension from %s." % ( extension, config ) ) + self.datatypes_by_extension[ extension ] = datatype_class() + if mimetype is None: + # Use default mime type as per datatype spec + mimetype = self.datatypes_by_extension[extension].get_mime() + self.mimetypes_by_extension[extension] = mimetype + if hasattr( datatype_class, "get_track_type" ): + self.available_tracks.append( extension ) + if display_in_upload: + self.upload_file_formats.append( extension ) + # Max file size cut off for setting optional metadata + self.datatypes_by_extension[extension].max_optional_metadata_filesize = elem.get( 'max_optional_metadata_filesize', None ) + for converter in elem.findall( 'converter' ): + # Build the list of datatype converters which will later be loaded + # into the calling app's toolbox. + converter_config = converter.get( 'file', None ) + target_datatype = converter.get( 'target_datatype', None ) + depends_on = converter.get( 'depends_on', None ) + if depends_on and target_datatype: + if extension not in self.converter_deps: + self.converter_deps[extension] = {} + self.converter_deps[extension][target_datatype] = depends_on.split(',') + if converter_config and target_datatype: + if imported_modules: + self.proprietary_converters.append( ( converter_config, extension, target_datatype ) ) + else: + self.converters.append( ( converter_config, extension, target_datatype ) ) + for composite_file in elem.findall( 'composite_file' ): + # add composite files + name = composite_file.get( 'name', None ) + if name is None: + self.log.warning( "You must provide a name for your composite_file (%s)." % composite_file ) + optional = composite_file.get( 'optional', False ) + mimetype = composite_file.get( 'mimetype', None ) + self.datatypes_by_extension[extension].add_composite_file( name, optional=optional, mimetype=mimetype ) + for display_app in elem.findall( 'display' ): if imported_modules: - self.proprietary_converters.append( ( converter_config, extension, target_datatype ) ) + if elem not in self.proprietary_display_app_containers: + self.proprietary_display_app_containers.append( elem ) else: - self.converters.append( ( converter_config, extension, target_datatype ) ) - for composite_file in elem.findall( 'composite_file' ): - # add composite files - name = composite_file.get( 'name', None ) - if name is None: - self.log.warning( "You must provide a name for your composite_file (%s)." % composite_file ) - optional = composite_file.get( 'optional', False ) - mimetype = composite_file.get( 'mimetype', None ) - self.datatypes_by_extension[extension].add_composite_file( name, optional=optional, mimetype=mimetype ) - for display_app in elem.findall( 'display' ): - if imported_modules: - if elem not in self.proprietary_display_app_containers: - self.proprietary_display_app_containers.append( elem ) - else: - if elem not in self.display_app_containers: - self.display_app_containers.append( elem ) + if elem not in self.display_app_containers: + self.display_app_containers.append( elem ) + else: + self.log.debug( "Ignoring datatype with extension '%s' from %s because the registry already contains a datatype with that extension." % ( extension, config ) ) except Exception, e: if deactivate: - self.log.warning( 'Error deactivating datatype "%s": %s' % ( extension, str( e ) ) ) + self.log.warning( "Error deactivating datatype with extension '%s': %s" % ( extension, str( e ) ) ) else: - self.log.warning( 'Error loading datatype "%s": %s' % ( extension, str( e ) ) ) + self.log.warning( "Error loading datatype with extension '%s': %s" % ( extension, str( e ) ) ) # Load datatype sniffers from the config sniffers = root.find( 'sniffers' ) if sniffers: @@ -204,15 +210,23 @@ aclass = getattr( module, datatype_class_name )() if deactivate: self.sniff_order.remove( aclass ) - self.log.debug( 'Deactivated sniffer for datatype: %s' % dtype ) + self.datatype_sniffers.remove( dtype ) + self.log.debug( "Deactivated sniffer for datatype '%s'" % dtype ) else: - self.sniff_order.append( aclass ) - self.log.debug( 'Loaded sniffer for datatype: %s' % dtype ) + if override_conflicts and dtype in self.datatype_sniffers: + self.sniff_order.append( aclass ) + self.log.debug( "Loaded additional sniffer for datatype '%s'" % dtype ) + elif dtype not in self.datatype_sniffers: + self.datatype_sniffers.append( dtype ) + self.sniff_order.append( aclass ) + self.log.debug( "Loaded sniffer for datatype '%s'" % dtype ) + else: + self.log.debug( "Ignoring sniffer for datatype '%s' because the registry already contains one." % dtype ) except Exception, exc: if deactivate: - self.log.warning( 'Error deactivating sniffer for datatype %s: %s' % ( dtype, str( exc ) ) ) + self.log.warning( "Error deactivating sniffer for datatype '%s': %s" % ( dtype, str( exc ) ) ) else: - self.log.warning( 'Error appending sniffer for datatype %s to sniff_order: %s' % ( dtype, str( exc ) ) ) + self.log.warning( "Error appending sniffer for datatype '%s' to sniff_order: %s" % ( dtype, str( exc ) ) ) # Persist the xml form of the registry into a temporary file so that it # can be loaded from the command line by tools and set_metadata processing. self.to_xml_file() diff -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 -r 865d998a693de676c01daea4128d20124d2015c0 lib/galaxy/tools/data/__init__.py --- a/lib/galaxy/tools/data/__init__.py +++ b/lib/galaxy/tools/data/__init__.py @@ -32,7 +32,7 @@ table = tool_data_table_types[ type ]( table_elem ) if table.name not in self.data_tables: self.data_tables[ table.name ] = table - log.debug( "Loaded tool data table '%s", table.name ) + log.debug( "Loaded tool data table '%s'", table.name ) return table_elems def add_new_entries_from_config_file( self, config_filename ): """ Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Pass the config file name to set_metadata.py rather than relying on a hardcoded value.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/d0e5fa20e491/ changeset: d0e5fa20e491 user: natefoo date: 2012-02-08 17:12:10 summary: Pass the config file name to set_metadata.py rather than relying on a hardcoded value. affected #: 5 files diff -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 lib/galaxy/config.py --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -172,8 +172,10 @@ # Parse global_conf and save the parser global_conf = kwargs.get( 'global_conf', None ) global_conf_parser = ConfigParser.ConfigParser() + self.config_file = None self.global_conf_parser = global_conf_parser if global_conf and "__file__" in global_conf: + self.config_file = global_conf['__file__'] global_conf_parser.read(global_conf['__file__']) # Heartbeat log file name override if global_conf is not None: diff -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 lib/galaxy/datatypes/metadata.py --- a/lib/galaxy/datatypes/metadata.py +++ b/lib/galaxy/datatypes/metadata.py @@ -529,7 +529,7 @@ # need to make different keys for them, since ids can overlap return "%s_%d" % ( dataset.__class__.__name__, dataset.id ) def setup_external_metadata( self, datasets, sa_session, exec_dir=None, tmp_dir=None, dataset_files_path=None, - output_fnames=None, config_root=None, datatypes_config=None, job_metadata=None, kwds={} ): + output_fnames=None, config_root=None, config_file=None, datatypes_config=None, job_metadata=None, kwds={} ): #fill in metadata_files_dict and return the command with args required to set metadata def __metadata_files_list_to_cmd_line( metadata_files ): def __get_filename_override(): @@ -604,7 +604,7 @@ sa_session.flush() metadata_files_list.append( metadata_files ) #return command required to build - return "%s %s %s %s %s %s %s" % ( os.path.join( exec_dir, 'set_metadata.sh' ), dataset_files_path, tmp_dir, config_root, datatypes_config, job_metadata, " ".join( map( __metadata_files_list_to_cmd_line, metadata_files_list ) ) ) + return "%s %s %s %s %s %s %s %s" % ( os.path.join( exec_dir, 'set_metadata.sh' ), dataset_files_path, tmp_dir, config_root, config_file, datatypes_config, job_metadata, " ".join( map( __metadata_files_list_to_cmd_line, metadata_files_list ) ) ) def external_metadata_set_successfully( self, dataset, sa_session ): metadata_files = self.get_output_filenames_by_dataset( dataset, sa_session ) diff -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py +++ b/lib/galaxy/jobs/__init__.py @@ -863,7 +863,7 @@ sizes.append( ( outfile, 0 ) ) return sizes - def setup_external_metadata( self, exec_dir = None, tmp_dir = None, dataset_files_path = None, config_root = None, datatypes_config = None, set_extension = True, **kwds ): + def setup_external_metadata( self, exec_dir=None, tmp_dir=None, dataset_files_path=None, config_root=None, config_file=None, datatypes_config=None, set_extension=True, **kwds ): # extension could still be 'auto' if this is the upload tool. job = self.get_job() if set_extension: @@ -879,6 +879,8 @@ dataset_files_path = self.app.model.Dataset.file_path if config_root is None: config_root = self.app.config.root + if config_file is None: + config_file = self.app.config.config_file if datatypes_config is None: datatypes_config = self.app.datatypes_registry.integrated_datatypes_configs return self.external_output_metadata.setup_external_metadata( [ output_dataset_assoc.dataset for output_dataset_assoc in job.output_datasets ], @@ -887,6 +889,7 @@ tmp_dir = tmp_dir, dataset_files_path = dataset_files_path, config_root = config_root, + config_file = config_file, datatypes_config = datatypes_config, job_metadata = os.path.join( self.working_directory, TOOL_PROVIDED_JOB_METADATA_FILE ), **kwds ) @@ -1165,7 +1168,7 @@ sizes.append( ( outfile, 0 ) ) return sizes - def setup_external_metadata( self, exec_dir = None, tmp_dir = None, dataset_files_path = None, config_root = None, datatypes_config = None, set_extension = True, **kwds ): + def setup_external_metadata( self, exec_dir=None, tmp_dir=None, dataset_files_path=None, config_root=None, config_file=None, datatypes_config=None, set_extension=True, **kwds ): # There is no metadata setting for tasks. This is handled after the merge, at the job level. return "" diff -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 lib/galaxy/tools/actions/metadata.py --- a/lib/galaxy/tools/actions/metadata.py +++ b/lib/galaxy/tools/actions/metadata.py @@ -50,7 +50,8 @@ tmp_dir = trans.app.config.new_file_path, dataset_files_path = trans.app.model.Dataset.file_path, output_fnames = None, - config_root = None, + config_root = trans.app.config.root, + config_file = trans.app.config.config_file, datatypes_config = trans.app.datatypes_registry.integrated_datatypes_configs, job_metadata = None, kwds = { 'overwrite' : overwrite } ) diff -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea -r d0e5fa20e4917aac9d058413dcf07b06f0dfec92 scripts/set_metadata.py --- a/scripts/set_metadata.py +++ b/scripts/set_metadata.py @@ -36,12 +36,16 @@ tmp_dir = sys.argv.pop( 1 ) galaxy.model.Dataset.file_path = file_path galaxy.datatypes.metadata.MetadataTempFile.tmp_dir = tmp_dir + + config_root = sys.argv.pop( 1 ) + config_file_name = sys.argv.pop( 1 ) + if not os.path.isabs( config_file_name ): + config_file_name = os.path.join( config_root, config_file_name ) # Set up reference to object store # First, read in the main config file for Galaxy; this is required because # the object store configuration is stored there conf = ConfigParser.ConfigParser() - config_file_name = 'universe_wsgi.ini' # Safe assumption? conf.read(config_file_name) conf_dict = {} for section in conf.sections(): @@ -59,7 +63,6 @@ galaxy.model.Dataset.object_store = object_store # Set up datatypes registry - config_root = sys.argv.pop( 1 ) datatypes_config = sys.argv.pop( 1 ) datatypes_registry = galaxy.datatypes.registry.Registry() datatypes_registry.load_datatypes( root_dir=config_root, config=datatypes_config ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for getting updates for an installed tool shed repository change set revision.
by Bitbucket 08 Feb '12

08 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/c9bdeba75bd1/ changeset: c9bdeba75bd1 user: greg date: 2012-02-08 15:11:19 summary: Fix for getting updates for an installed tool shed repository change set revision. affected #: 2 files diff -r e23be4cf5276a0570d784b3ade9fbad9f9fb351c -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea lib/galaxy/util/shed_util.py --- a/lib/galaxy/util/shed_util.py +++ b/lib/galaxy/util/shed_util.py @@ -338,6 +338,7 @@ sa_session = app.model.context.current if tool_shed.find( '//' ) > 0: tool_shed = tool_shed.split( '//' )[1] + tool_shed = tool_shed.rstrip( '/' ) return sa_session.query( app.model.ToolShedRepository ) \ .filter( and_( app.model.ToolShedRepository.table.c.tool_shed == tool_shed, app.model.ToolShedRepository.table.c.name == name, diff -r e23be4cf5276a0570d784b3ade9fbad9f9fb351c -r c9bdeba75bd18157ea4bf8e64d7278f6c8891eea lib/galaxy/web/controllers/admin_toolshed.py --- a/lib/galaxy/web/controllers/admin_toolshed.py +++ b/lib/galaxy/web/controllers/admin_toolshed.py @@ -699,7 +699,7 @@ # Send a request to the relevant tool shed to see if there are any updates. repository = get_repository( trans, kwd[ 'id' ] ) tool_shed_url = get_url_from_repository_tool_shed( trans.app, repository ) - url = '%/srepository/check_for_updates?galaxy_url=%s&name=%s&owner=%s&changeset_revision=%s&webapp=galaxy' % \ + url = '%s/repository/check_for_updates?galaxy_url=%s&name=%s&owner=%s&changeset_revision=%s&webapp=galaxy' % \ ( tool_shed_url, url_for( '/', qualified=True ), repository.name, repository.owner, repository.changeset_revision ) return trans.response.send_redirect( url ) @web.expose @@ -731,7 +731,7 @@ repository_clone_url = os.path.join( tool_shed_url, 'repos', owner, name ) tool_shed = clean_tool_shed_url( tool_shed_url ) tool_shed_repository, metadata_dict = load_repository_contents( app=trans.app, - name=name, + repository_name=name, description=repository.description, owner=owner, changeset_revision=changeset_revision, @@ -743,7 +743,8 @@ tool_shed=tool_shed, tool_section=None, shed_tool_conf=None, - new_install=False ) + new_install=False, + dist_to_shed=False ) # Update the repository changeset_revision in the database. repository.changeset_revision = latest_changeset_revision repository.update_available = False Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: do not subset data with a message.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/e23be4cf5276/ changeset: e23be4cf5276 user: jgoecks date: 2012-02-07 23:29:31 summary: Trackster: do not subset data with a message. affected #: 1 file diff -r 63319bc07b56127bcd3c44ec6e950541c2c4aa0c -r e23be4cf5276a0570d784b3ade9fbad9f9fb351c static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -520,8 +520,7 @@ // Look in cache for data that can be used. Data can be reused if it // has the requested data and is not summary tree and has details. // TODO: this logic could be improved if the visualization knew whether - // the data was "index" or "data." Also could slice the data so that - // only data points in request are returned. + // the data was "index" or "data." // // TODO: can using resolution in the key enable LineTrack data to be subsetted appropriately? @@ -534,9 +533,12 @@ entry_high = split_key[1]; if (low >= entry_low && high <= entry_high) { - // This entry has requested data; return if compatible. + // This entry has requested data; return if compatible and if entry does not + // have a message. If entry has a message, then not all data available and it + // is better to fetch anew. entry = this.obj_cache[key]; - if ( is_deferred(entry) || this.track.data_and_mode_compatible(entry, mode) ) { + if ( is_deferred(entry) || + ( this.track.data_and_mode_compatible(entry, mode) && !entry.message ) ) { // TODO: for fast lookup and processing, create new entry with only data subset? // Entry is usable. this.move_key_to_end(key, i); Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: bug fixes for 36d36384704b
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/63319bc07b56/ changeset: 63319bc07b56 user: jgoecks date: 2012-02-07 23:07:35 summary: Trackster: bug fixes for 36d36384704b affected #: 1 file diff -r 23b173247757c383e9f1c4fb736008a6623e7327 -r 63319bc07b56127bcd3c44ec6e950541c2c4aa0c static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -1738,7 +1738,7 @@ // Calculate resolution in both pixels/base and bases/pixel; round bases/pixels for tile calculations. // TODO: require minimum difference in new resolution to update? - this.resolution_b_px = Math.round( (this.high - this.low) / this.viewport_container.width() ); + this.resolution_b_px = (this.high - this.low) / this.viewport_container.width(); this.resolution_px_b = this.viewport_container.width() / (this.high - this.low); // Overview @@ -3590,8 +3590,8 @@ * with values tile_low and tile_high. */ _get_tile_bounds: function(tile_index, resolution) { - var tile_low = tile_index * TILE_SIZE * resolution, - tile_length = TILE_SIZE * resolution, + var tile_low = Math.floor( tile_index * TILE_SIZE * resolution ), + tile_length = Math.ceil( TILE_SIZE * resolution ), // Tile high cannot be larger than view.max_high, which the chromosome length. tile_high = (tile_low + tile_length <= this.view.max_high ? tile_low + tile_length : this.view.max_high); return [tile_low, tile_high]; Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for loading tools from an installed tool shed repository into the tool panel outside of any sections.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/23b173247757/ changeset: 23b173247757 user: greg date: 2012-02-07 22:20:48 summary: Fix for loading tools from an installed tool shed repository into the tool panel outside of any sections. affected #: 4 files diff -r 60231c4aab751817fc3937c1974e3fc11632df2e -r 23b173247757c383e9f1c4fb736008a6623e7327 lib/galaxy/util/shed_util.py --- a/lib/galaxy/util/shed_util.py +++ b/lib/galaxy/util/shed_util.py @@ -317,10 +317,10 @@ id_elem.text = tool.id version_elem = SubElement( tool_elem, 'version' ) version_elem.text = tool.version + if not tool_section: + elem_list.append( tool_elem ) if tool_section: elem_list.append( root_elem ) - elif tool_elem: - elem_list.append( tool_elem ) return elem_list def generate_workflow_metadata( relative_path, exported_workflow_dict, metadata_dict ): """ diff -r 60231c4aab751817fc3937c1974e3fc11632df2e -r 23b173247757c383e9f1c4fb736008a6623e7327 lib/galaxy/web/controllers/admin_toolshed.py --- a/lib/galaxy/web/controllers/admin_toolshed.py +++ b/lib/galaxy/web/controllers/admin_toolshed.py @@ -435,9 +435,14 @@ original_section_name = tool_panel_section[ 'name' ] tool_panel_section_select_field = build_tool_panel_section_select_field( trans ) no_changes_check_box = CheckboxField( 'no_changes', checked=True ) - message = "The tools contained in your <b>%s</b> repository were last loaded into the tool panel section <b>%s</b>. " % ( repository.name, original_section_name ) - message += "Uncheck the <b>No changes</b> check box and select a different tool panel section to load the tools in a " - message += "different section in the tool panel." + if original_section_name: + message = "The tools contained in your <b>%s</b> repository were last loaded into the tool panel section <b>%s</b>. " \ + % ( repository.name, original_section_name ) + message += "Uncheck the <b>No changes</b> check box and select a different tool panel section to load the tools in a " + message += "different section in the tool panel." + else: + message = "The tools contained in your <b>%s</b> repository were last loaded into the tool panel outside of any sections. " % repository.name + message += "Uncheck the <b>No changes</b> check box and select a tool panel section to load the tools into that section." status = 'done' return trans.fill_template( '/admin/tool_shed_repository/reselect_tool_panel_section.mako', repository=repository, diff -r 60231c4aab751817fc3937c1974e3fc11632df2e -r 23b173247757c383e9f1c4fb736008a6623e7327 templates/admin/tool_shed_repository/reselect_tool_panel_section.mako --- a/templates/admin/tool_shed_repository/reselect_tool_panel_section.mako +++ b/templates/admin/tool_shed_repository/reselect_tool_panel_section.mako @@ -20,7 +20,7 @@ <label>Add new tool panel section:</label><input name="new_tool_panel_section" type="textfield" value="" size="40"/><div class="toolParamHelp" style="clear: both;"> - Add a new tool panel section contain the installed tools (optional). + Add a new tool panel section to contain the installed tools (optional). </div></div><div class="form-row"> diff -r 60231c4aab751817fc3937c1974e3fc11632df2e -r 23b173247757c383e9f1c4fb736008a6623e7327 templates/admin/tool_shed_repository/select_tool_panel_section.mako --- a/templates/admin/tool_shed_repository/select_tool_panel_section.mako +++ b/templates/admin/tool_shed_repository/select_tool_panel_section.mako @@ -43,7 +43,7 @@ <label>Add new tool panel section:</label><input name="new_tool_panel_section" type="textfield" value="${new_tool_panel_section}" size="40"/><div class="toolParamHelp" style="clear: both;"> - Add a new tool panel section contain the installed tools (optional). + Add a new tool panel section to contain the installed tools (optional). </div></div><div class="form-row"> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: When an installed tool shed repository that includes tools is being reinstalled, allow the admin to select a different section in the tool panel (than was originally selected when the repository was last installed) to contain the included tools.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/60231c4aab75/ changeset: 60231c4aab75 user: greg date: 2012-02-07 21:10:03 summary: When an installed tool shed repository that includes tools is being reinstalled, allow the admin to select a different section in the tool panel (than was originally selected when the repository was last installed) to contain the included tools. affected #: 3 files diff -r 31c0b88bb4eba817cebf3987565d471c64146b48 -r 60231c4aab751817fc3937c1974e3fc11632df2e lib/galaxy/web/controllers/admin_toolshed.py --- a/lib/galaxy/web/controllers/admin_toolshed.py +++ b/lib/galaxy/web/controllers/admin_toolshed.py @@ -95,6 +95,10 @@ if operation == "get updates": return self.check_for_updates( trans, **kwd ) if operation == "activate or reinstall": + repository = get_repository( trans, kwd[ 'id' ] ) + if repository.uninstalled and repository.includes_tools: + # Only allow selecting a different section in the tool panel if the repository was uninstalled. + return self.reselect_tool_panel_section( trans, **kwd ) return self.activate_or_reinstall_repository( trans, **kwd ) if operation == "deactivate or uninstall": return self.deactivate_or_uninstall_repository( trans, **kwd ) @@ -423,8 +427,31 @@ del trans.app.toolbox.tool_panel[ item_id ] @web.expose @web.require_admin + def reselect_tool_panel_section( self, trans, **kwd ): + repository = get_repository( trans, kwd[ 'id' ] ) + # Get the location in the tool panel in which the tool was originally loaded. + metadata = repository.metadata + tool_panel_section = metadata[ 'tool_panel_section' ] + original_section_name = tool_panel_section[ 'name' ] + tool_panel_section_select_field = build_tool_panel_section_select_field( trans ) + no_changes_check_box = CheckboxField( 'no_changes', checked=True ) + message = "The tools contained in your <b>%s</b> repository were last loaded into the tool panel section <b>%s</b>. " % ( repository.name, original_section_name ) + message += "Uncheck the <b>No changes</b> check box and select a different tool panel section to load the tools in a " + message += "different section in the tool panel." + status = 'done' + return trans.fill_template( '/admin/tool_shed_repository/reselect_tool_panel_section.mako', + repository=repository, + no_changes_check_box=no_changes_check_box, + original_section_name=original_section_name, + tool_panel_section_select_field=tool_panel_section_select_field, + message=message, + status=status ) + @web.expose + @web.require_admin def activate_or_reinstall_repository( self, trans, **kwd ): repository = get_repository( trans, kwd[ 'id' ] ) + no_changes = kwd.get( 'no_changes', '' ) + no_changes_checked = CheckboxField.is_checked( no_changes ) shed_tool_conf, tool_path, relative_install_dir = self.__get_tool_path_and_relative_install_dir( trans, repository ) uninstalled = repository.uninstalled if uninstalled: @@ -457,20 +484,46 @@ tool_panel_section = metadata[ 'tool_panel_section' ] original_section_id = tool_panel_section[ 'id' ] original_section_name = tool_panel_section[ 'name' ] - if original_section_id in [ '' ]: - tool_section = None + if no_changes_checked: + if original_section_id in [ '' ]: + tool_section = None + else: + section_key = 'section_%s' % str( original_section_id ) + if section_key in trans.app.toolbox.tool_panel: + tool_section = trans.app.toolbox.tool_panel[ section_key ] + else: + # The section in which the tool was originally loaded used to be in the tool panel, but no longer is. + elem = Element( 'section' ) + elem.attrib[ 'name' ] = original_section_name + elem.attrib[ 'id' ] = original_section_id + elem.attrib[ 'version' ] = '' + tool_section = tools.ToolSection( elem ) + trans.app.toolbox.tool_panel[ section_key ] = tool_section else: - section_key = 'section_%s' % str( original_section_id ) - if section_key in trans.app.toolbox.tool_panel: + # The user elected to change the tool panel section to contain the tools. + new_tool_panel_section = kwd.get( 'new_tool_panel_section', '' ) + tool_panel_section = kwd.get( 'tool_panel_section', '' ) + if new_tool_panel_section: + section_id = new_tool_panel_section.lower().replace( ' ', '_' ) + new_section_key = 'section_%s' % str( section_id ) + if new_section_key in trans.app.toolbox.tool_panel: + # Appending a tool to an existing section in trans.app.toolbox.tool_panel + log.debug( "Appending to tool panel section: %s" % new_tool_panel_section ) + tool_section = trans.app.toolbox.tool_panel[ new_section_key ] + else: + # Appending a new section to trans.app.toolbox.tool_panel + log.debug( "Loading new tool panel section: %s" % new_tool_panel_section ) + elem = Element( 'section' ) + elem.attrib[ 'name' ] = new_tool_panel_section + elem.attrib[ 'id' ] = section_id + elem.attrib[ 'version' ] = '' + tool_section = tools.ToolSection( elem ) + trans.app.toolbox.tool_panel[ new_section_key ] = tool_section + elif tool_panel_section: + section_key = 'section_%s' % tool_panel_section tool_section = trans.app.toolbox.tool_panel[ section_key ] else: - # The section in which the tool was originally loaded used to be in the tool panel, but no longer is. - elem = Element( 'section' ) - elem.attrib[ 'name' ] = original_section_name - elem.attrib[ 'id' ] = original_section_id - elem.attrib[ 'version' ] = '' - tool_section = tools.ToolSection( elem ) - trans.app.toolbox.tool_panel[ section_key ] = tool_section + tool_section = None tool_shed_repository, metadata_dict = load_repository_contents( app=trans.app, repository_name=repository.name, description=repository.description, diff -r 31c0b88bb4eba817cebf3987565d471c64146b48 -r 60231c4aab751817fc3937c1974e3fc11632df2e templates/admin/tool_shed_repository/reselect_tool_panel_section.mako --- /dev/null +++ b/templates/admin/tool_shed_repository/reselect_tool_panel_section.mako @@ -0,0 +1,38 @@ +<%inherit file="/base.mako"/> +<%namespace file="/message.mako" import="render_msg" /> + +%if message: + ${render_msg( message, status )} +%endif + +<div class="toolForm"> + <div class="toolFormTitle">Choose the tool panel section to contain the installed tools (optional)</div> + <div class="toolFormBody"> + <form name="reselect_tool_panel_section" id="reselect_tool_panel_section" action="${h.url_for( controller='admin_toolshed', action='activate_or_reinstall_repository', id=trans.security.encode_id( repository.id ) )}" method="post" > + <div class="form-row"> + ${no_changes_check_box.get_html()} + <label style="display: inline;">No changes</label> + <div class="toolParamHelp" style="clear: both;"> + Uncheck and select a different tool panel section to load the tools into a different section in the tool panel. + </div> + </div> + <div class="form-row"> + <label>Add new tool panel section:</label> + <input name="new_tool_panel_section" type="textfield" value="" size="40"/> + <div class="toolParamHelp" style="clear: both;"> + Add a new tool panel section contain the installed tools (optional). + </div> + </div> + <div class="form-row"> + <label>Select existing tool panel section:</label> + ${tool_panel_section_select_field.get_html()} + <div class="toolParamHelp" style="clear: both;"> + Choose an existing section in your tool panel to contain the installed tools (optional). + </div> + </div> + <div class="form-row"> + <input type="submit" name="select_tool_panel_section_button" value="Install"/> + </div> + </form> + </div> +</div> diff -r 31c0b88bb4eba817cebf3987565d471c64146b48 -r 60231c4aab751817fc3937c1974e3fc11632df2e templates/admin/tool_shed_repository/select_tool_panel_section.mako --- a/templates/admin/tool_shed_repository/select_tool_panel_section.mako +++ b/templates/admin/tool_shed_repository/select_tool_panel_section.mako @@ -23,7 +23,7 @@ <br/><div class="toolForm"> - <div class="toolFormTitle">Choose tool panel section to contain installed tools (optional)</div> + <div class="toolFormTitle">Choose the tool panel section to contain the installed tools (optional)</div><div class="toolFormBody"><form name="select_tool_panel_section" id="select_tool_panel_section" action="${h.url_for( controller='admin_toolshed', action='install_repository', tool_shed_url=tool_shed_url, repo_info_dict=repo_info_dict, includes_tools=includes_tools )}" method="post" > %if shed_tool_conf_select_field: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Tool version grid cleanup.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/31c0b88bb4eb/ changeset: 31c0b88bb4eb user: greg date: 2012-02-07 19:04:52 summary: Tool version grid cleanup. affected #: 1 file diff -r 9ba4435bfd4ee6111c511c003f1ba6a54b6cb91d -r 31c0b88bb4eba817cebf3987565d471c64146b48 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py +++ b/lib/galaxy/web/controllers/admin.py @@ -402,11 +402,6 @@ else: tool_ids_str += '%s<br/>' % tool_id return tool_ids_str - class ToolShedRepositoryColumn( grids.TextColumn ): - def get_value( self, trans, grid, tool_version ): - if tool_version.tool_shed_repository: - return tool_version.tool_shed_repository.name - return '' # Grid definition title = "Tool versions" model_class = model.ToolVersion @@ -416,10 +411,9 @@ ToolIdColumn( "Tool id", key='tool_id', attach_popup=False ), - ToolVersionsColumn( "Version lineage by tool id (parent/child ordered)" ), - ToolShedRepositoryColumn( "Tool shed repository" ), + ToolVersionsColumn( "Version lineage by tool id (parent/child ordered)" ) ] - columns.append( grids.MulticolFilterColumn( "Search repository name", + columns.append( grids.MulticolFilterColumn( "Search tool id", cols_to_filter=[ columns[0] ], key="free-text-search", visible=False, Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 07 Feb '12

07 Feb '12

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/5c57dfac1e31/ changeset: 5c57dfac1e31 user: jgoecks date: 2012-02-07 17:30:45 summary: Trackster: small variable reference fix. affected #: 1 file diff -r b4ba8b20d78d5ae92ebab85afeb6662ca602d427 -r 5c57dfac1e3143e3931bb5d5cc774248f8060113 static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -833,10 +833,11 @@ this.changed(); this.container.remove_drawable(this); + var view = this.view; this.container_div.hide(0, function() { $(this).remove(); // HACK: is there a better way to update the view? - drawable.view.update_intro_div(); + view.update_intro_div(); }); }, /** https://bitbucket.org/galaxy/galaxy-central/changeset/9ba4435bfd4e/ changeset: 9ba4435bfd4e user: jgoecks date: 2012-02-07 17:35:48 summary: Fix bug in GFFDataProvider iterator. affected #: 1 file diff -r 5c57dfac1e3143e3931bb5d5cc774248f8060113 -r 9ba4435bfd4ee6111c511c003f1ba6a54b6cb91d lib/galaxy/visualization/tracks/data_providers.py --- a/lib/galaxy/visualization/tracks/data_providers.py +++ b/lib/galaxy/visualization/tracks/data_providers.py @@ -936,7 +936,7 @@ for feature in GFFReaderWrapper( source, fix_strand=True ): # Only provide features that are in region. feature_start, feature_end = convert_gff_coords_to_bed( [ feature.start, feature.end ] ) - if feature.chrom != chrom or feature_start < start or feature_end > end: + if feature.chrom != chrom or feature_end < start or feature_start > end: continue yield feature return features_in_region_iter() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for loading proprietary datatype sniffers that are included in installed tool shed repositories.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/b4ba8b20d78d/ changeset: b4ba8b20d78d user: greg date: 2012-02-07 17:15:20 summary: Fix for loading proprietary datatype sniffers that are included in installed tool shed repositories. affected #: 1 file diff -r 271ccd09bc2367c7e20d59afb0a7307d4016a1f5 -r b4ba8b20d78d5ae92ebab85afeb6662ca602d427 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -187,11 +187,21 @@ try: fields = dtype.split( ":" ) datatype_module = fields[0] - datatype_class = fields[1] - module = __import__( datatype_module ) - for comp in datatype_module.split( '.' )[ 1: ]: - module = getattr( module, comp ) - aclass = getattr( module, datatype_class )() + datatype_class_name = fields[1] + module = None + if imported_modules: + # See if one of the imported modules contains the datatype class name. + for imported_module in imported_modules: + if hasattr( imported_module, datatype_class_name ): + module = imported_module + break + if module is None: + # The datatype class name must be contained in one of the datatype + # modules in the Galaxy distribution. + module = __import__( datatype_module ) + for comp in datatype_module.split( '.' )[ 1: ]: + module = getattr( module, comp ) + aclass = getattr( module, datatype_class_name )() if deactivate: self.sniff_order.remove( aclass ) self.log.debug( 'Deactivated sniffer for datatype: %s' % dtype ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for 39e03997f78f - change buffer to string so older postgres versions work.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/271ccd09bc23/ changeset: 271ccd09bc23 user: greg date: 2012-02-07 17:06:17 summary: Fix for 39e03997f78f - change buffer to string so older postgres versions work. affected #: 1 file diff -r 39e03997f78f7dcea23915cffe5f924e7b6bd957 -r 271ccd09bc2367c7e20d59afb0a7307d4016a1f5 lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py --- a/lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py +++ b/lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py @@ -76,7 +76,7 @@ for row in result: if row[1]: tool_shed_repository_id = row[0] - repository_metadata = from_json_string( _sniffnfix_pg9_hex( row[1] ) ) + repository_metadata = from_json_string( _sniffnfix_pg9_hex( str( row[1] ) ) ) # Create a new row in the tool table for each tool included in repository. We will NOT # handle tool_version_associaions because we do not have the information we need to do so. tools = repository_metadata.get( 'tools', [] ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Use PG9 hex bytea fix to decode tool shed repository metadata in migration script 91.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/39e03997f78f/ changeset: 39e03997f78f user: natefoo date: 2012-02-07 16:41:22 summary: Use PG9 hex bytea fix to decode tool shed repository metadata in migration script 91. affected #: 1 file diff -r f2ed09e52dfd51fb1e95dec0ec1379edefe6d56a -r 39e03997f78f7dcea23915cffe5f924e7b6bd957 lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py --- a/lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py +++ b/lib/galaxy/model/migrate/versions/0091_add_tool_version_tables.py @@ -11,6 +11,7 @@ now = datetime.datetime.utcnow # Need our custom types, but don't import anything else from model from galaxy.model.custom_types import * +from galaxy.model.custom_types import _sniffnfix_pg9_hex from galaxy.util.json import from_json_string, to_json_string import sys, logging @@ -75,7 +76,7 @@ for row in result: if row[1]: tool_shed_repository_id = row[0] - repository_metadata = from_json_string( str( row[1] ) ) + repository_metadata = from_json_string( _sniffnfix_pg9_hex( row[1] ) ) # Create a new row in the tool table for each tool included in repository. We will NOT # handle tool_version_associaions because we do not have the information we need to do so. tools = repository_metadata.get( 'tools', [] ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: renable data subsetting for all non-LineTracks.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/f2ed09e52dfd/ changeset: f2ed09e52dfd user: jgoecks date: 2012-02-07 16:17:44 summary: Trackster: renable data subsetting for all non-LineTracks. affected #: 1 file diff -r 5e1534bae3f22cb00382d4b5fe8143a2a3a70be7 -r f2ed09e52dfd51fb1e95dec0ec1379edefe6d56a static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -524,8 +524,7 @@ // only data points in request are returned. // - /* Disabling for now, more detailed data is never loaded for line tracks - TODO: can using resolution in the key solve this problem? + // TODO: can using resolution in the key enable LineTrack data to be subsetted appropriately? if (this.subset) { var key, split_key, entry_low, entry_high, mode, entry; for (var i = 0; i < this.key_ary.length; i++) { @@ -535,20 +534,20 @@ entry_high = split_key[1]; if (low >= entry_low && high <= entry_high) { - // This track has the range of data needed; check other attributes. + // This entry has requested data; return if compatible. entry = this.obj_cache[key]; - if (entry.dataset_type !== "summary_tree" && entry.extra_info !== "no_detail") { - // Data is usable. + if ( is_deferred(entry) || this.track.data_and_mode_compatible(entry, mode) ) { + // TODO: for fast lookup and processing, create new entry with only data subset? + // Entry is usable. this.move_key_to_end(key, i); return entry; } } } } - */ // Load data from server. The deferred is immediately saved until the - // data is ready, it then replaces itself with the actual data + // data is ready, it then replaces itself with the actual data. entry = this.load_data(low, high, mode, resolution, extra_params); this.set_data(low, high, entry); return entry; @@ -4042,6 +4041,10 @@ this.display_modes = ["Histogram", "Line", "Filled", "Intensity"]; this.mode = "Histogram"; TiledTrack.call(this, name, view, container, prefs, filters, tool, data_manager); + + // Cannot subset LineTrack data right now; see note in DataManager about using resolution in key + // to address this issue. + this.data_manager.subset = false; this.min_height_px = 16; this.max_height_px = 400; Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dannon: Multiple-run workflows: When run into separate new histories, naming is now based on the varied input dataset instead of the execution number, so "<workflowname> on <varied_input>".
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/5e1534bae3f2/ changeset: 5e1534bae3f2 user: dannon date: 2012-02-07 15:45:19 summary: Multiple-run workflows: When run into separate new histories, naming is now based on the varied input dataset instead of the execution number, so "<workflowname> on <varied_input>". affected #: 1 file diff -r b45af710a58bbe64a2d98faee53e8baf6d6314a8 -r 5e1534bae3f22cb00382d4b5fe8143a2a3a70be7 lib/galaxy/web/controllers/workflow.py --- a/lib/galaxy/web/controllers/workflow.py +++ b/lib/galaxy/web/controllers/workflow.py @@ -1489,7 +1489,8 @@ else: nh_name = "History from %s workflow" % workflow.name if multiple_input_key: - nh_name = '%s %d' % (nh_name, input_number + 1) + mx_ds_name = trans.sa_session.query(trans.app.model.HistoryDatasetAssociation).get( single_input ).name + nh_name = '%s on %s' % (nh_name, mx_ds_name) new_history = trans.app.model.History( user=trans.user, name=nh_name ) trans.sa_session.add( new_history ) # Run each step, connecting outputs to inputs Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: simple framework for notifying view of changes; use framework to indicate changes when (a) config values are changed and (b) items are reordered or grouped.
by Bitbucket 07 Feb '12

07 Feb '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/b45af710a58b/ changeset: b45af710a58b user: jgoecks date: 2012-02-07 15:41:59 summary: Trackster: simple framework for notifying view of changes; use framework to indicate changes when (a) config values are changed and (b) items are reordered or grouped. affected #: 1 file diff -r 97950a7e567d10884d0220f34b7612b88569fa80 -r b45af710a58bbe64a2d98faee53e8baf6d6314a8 static/scripts/trackster.js --- a/static/scripts/trackster.js +++ b/static/scripts/trackster.js @@ -790,6 +790,9 @@ extend(Drawable.prototype, { init: function() {}, + changed: function() { + this.view.changed(); + }, can_draw: function() { if (this.enabled && this.content_visible) { return true; @@ -828,13 +831,13 @@ * Remove drawable (a) from its container and (b) from the HTML. */ remove: function() { + this.changed(); + this.container.remove_drawable(this); - this.container_div.hide(0, function() { $(this).remove(); // HACK: is there a better way to update the view? - view.update_intro_div(); - view.has_changes = true; + drawable.view.update_intro_div(); }); }, /** @@ -952,11 +955,13 @@ add_drawable: function(drawable) { this.drawables.push(drawable); drawable.container = this; + this.changed(); }, /** * Add a drawable before another drawable. */ add_drawable_before: function(drawable, other) { + this.changed(); var index = this.drawables.indexOf(other); if (index !== -1) { this.drawables.splice(index, 0, drawable); @@ -974,6 +979,7 @@ if (update_html) { old_drawable.container_div.replaceWith(new_drawable.container_div); } + this.changed(); } return index; }, @@ -986,6 +992,7 @@ // Found drawable to remove. this.drawables.splice(index, 1); drawable.container = null; + this.changed(); return true; } return false; @@ -1000,6 +1007,7 @@ this.drawables.splice(index, 1); // insert into new position: this.drawables.splice(new_position, 0, drawable); + this.changed(); return true; } return false; @@ -1465,6 +1473,9 @@ this.reset(); $(window).trigger("resize"); }, + changed: function() { + this.has_changes = true; + }, /** Add or remove intro div depending on view state. */ update_intro_div: function() { if (this.drawables.length === 0) { @@ -1636,7 +1647,7 @@ add_drawable: function(drawable) { DrawableCollection.prototype.add_drawable.call(this, drawable); drawable.init(); - this.has_changes = true; + this.changed(); this.update_intro_div(); }, add_label_track: function (label_track) { @@ -1655,7 +1666,6 @@ $(this).remove(); view.update_intro_div(); }); - this.has_changes = true; } }, reset: function() { @@ -1773,6 +1783,7 @@ } this.low = Math.round(cur_center - new_half); this.high = Math.round(cur_center + new_half); + this.changed(); this.request_redraw(); }, zoom_out: function () { @@ -1784,6 +1795,7 @@ new_half = (span * this.zoom_factor) / 2; this.low = Math.round(cur_center - new_half); this.high = Math.round(cur_center + new_half); + this.changed(); this.request_redraw(); }, resize_window: function() { @@ -1815,7 +1827,7 @@ view.resize_window(); }; view.overview_drawable.request_draw(); - view.has_changes = true; + this.changed(); }, /** Close and reset overview. */ reset_overview: function() { @@ -2717,6 +2729,7 @@ }); if ( changed ) { this.onchange(); + this.track.changed(); } } }); Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0