- galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: richard_burhans: add column names
by Bitbucket 10 Apr '12

10 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/639548ab15fd/ changeset: 639548ab15fd user: richard_burhans date: 2012-04-10 17:03:11 summary: add column names affected #: 1 file diff -r 04d40a6eca75a9585a874736d799b5bc9869b289 -r 639548ab15fdd83771abb5f1cf7282f7d1cddcad lib/galaxy/datatypes/tabular.py --- a/lib/galaxy/datatypes/tabular.py +++ b/lib/galaxy/datatypes/tabular.py @@ -23,6 +23,7 @@ MetadataElement( name="comment_lines", default=0, desc="Number of comment lines", readonly=False, optional=True, no_value=0 ) MetadataElement( name="columns", default=0, desc="Number of columns", readonly=True, visible=False, no_value=0 ) MetadataElement( name="column_types", default=[], desc="Column types", param=metadata.ColumnTypesParameter, readonly=True, visible=False, no_value=[] ) + MetadataElement( name="column_names", default=[], desc="Column names", readonly=True, visible=False, no_value=[] ) def init_meta( self, dataset, copy_from=None ): data.Text.init_meta( self, dataset, copy_from=copy_from ) @@ -179,6 +180,9 @@ def make_html_peek_header( self, dataset, skipchars=[], column_names=[], column_number_format='%s', column_parameter_alias={}, **kwargs ): out = [] try: + if not column_names and dataset.metadata.column_names: + column_names = dataset.metadata.column_names + column_headers = [None] * dataset.metadata.columns # fill in empty headers with data from column_names Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Small fixes for Trackster icons
by Bitbucket 10 Apr '12

10 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/04d40a6eca75/ changeset: 04d40a6eca75 user: jgoecks date: 2012-04-10 15:28:07 summary: Small fixes for Trackster icons affected #: 2 files diff -r e5182b8038e8618529594dea85bc3f304e51a11c -r 04d40a6eca75a9585a874736d799b5bc9869b289 static/june_2007_style/blue/trackster.css --- a/static/june_2007_style/blue/trackster.css +++ b/static/june_2007_style/blue/trackster.css @@ -80,6 +80,10 @@ .filters-icon:hover{background:transparent url(../images/fugue/ui-slider-050.png) no-repeat;} .remove-icon,.overview-close{background:transparent url(../images/fugue/cross-small-bw.png) no-repeat;} .icon-button.remove-icon:hover,.overview-close:hover{background:transparent url(../images/fugue/cross-circle.png) no-repeat;} +.icon-button.toggle{background:transparent url(../images/fugue/toggle-bw.png) no-repeat;margin-right:0px;} +.icon-button.toggle:hover{background:transparent url(../images/fugue/toggle.png) no-repeat;} +.icon-button.toggle-expand{background:transparent url(../images/fugue/toggle-expand-bw.png) no-repeat;margin-right:0px;} +.icon-button.toggle-expand:hover{background:transparent url(../images/fugue/toggle-expand.png) no-repeat;} .icon-button.cross-circle{background:transparent url(../images/fugue/cross-circle-bw.png) no-repeat;margin-right:0px;} .icon-button.cross-circle:hover{background:transparent url(../images/fugue/cross-circle.png) no-repeat;} .icon-button.plus-button{background:transparent url(../images/fugue/plus-button-bw.png) no-repeat;} diff -r e5182b8038e8618529594dea85bc3f304e51a11c -r 04d40a6eca75a9585a874736d799b5bc9869b289 static/june_2007_style/trackster.css.tmpl --- a/static/june_2007_style/trackster.css.tmpl +++ b/static/june_2007_style/trackster.css.tmpl @@ -393,6 +393,18 @@ .icon-button.remove-icon:hover, .overview-close:hover { background: transparent url(../images/fugue/cross-circle.png) no-repeat; } +.icon-button.toggle { + background: transparent url(../images/fugue/toggle-bw.png) no-repeat;margin-right:0px; +} +.icon-button.toggle:hover { + background: transparent url(../images/fugue/toggle.png) no-repeat; +} +.icon-button.toggle-expand { + background: transparent url(../images/fugue/toggle-expand-bw.png) no-repeat;margin-right:0px; +} +.icon-button.toggle-expand:hover { + background: transparent url(../images/fugue/toggle-expand.png) no-repeat; +} .icon-button.cross-circle { background: transparent url(../images/fugue/cross-circle-bw.png) no-repeat;margin-right:0px; } Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Fix for BWA -R option.
by Bitbucket 10 Apr '12

10 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/e5182b8038e8/ changeset: e5182b8038e8 user: dan date: 2012-04-10 15:24:25 summary: Fix for BWA -R option. affected #: 3 files diff -r 7f78b2bf339f24f57b686e7c4bdb1fe301e8ed12 -r e5182b8038e8618529594dea85bc3f304e51a11c tools/sr_mapping/bwa_color_wrapper.xml --- a/tools/sr_mapping/bwa_color_wrapper.xml +++ b/tools/sr_mapping/bwa_color_wrapper.xml @@ -1,4 +1,4 @@ -<tool id="bwa_color_wrapper" name="Map with BWA for SOLiD" version="1.0.1"> +<tool id="bwa_color_wrapper" name="Map with BWA for SOLiD" version="1.0.2"><description></description><parallelism method="basic"></parallelism><command interpreter="python"> @@ -42,7 +42,7 @@ --mismatchPenalty=$params.mismatchPenalty --gapOpenPenalty=$params.gapOpenPenalty --gapExtensPenalty=$params.gapExtensPenalty - --suboptAlign=$params.suboptAlign + --suboptAlign="${params.suboptAlign}" --noIterSearch=$params.noIterSearch --outputTopN=$params.outputTopN --outputTopNDisc=$params.outputTopNDisc @@ -125,7 +125,7 @@ <param name="mismatchPenalty" type="integer" value="3" label="Mismatch penalty (aln -M)" help="BWA will not search for suboptimal hits with a score lower than [value]" /><param name="gapOpenPenalty" type="integer" value="11" label="Gap open penalty (aln -O)" /><param name="gapExtensPenalty" type="integer" value="4" label="Gap extension penalty (aln -E)" /> - <param name="suboptAlign" type="boolean" truevalue="true" falsevalue="false" checked="no" label="Proceed with suboptimal alignments even if the top hit is a repeat (aln -R)" help="For paired-end reads only. By default, BWA only searches for suboptimal alignments if the top hit is unique. Using this option has no effect on accuracy for single-end reads. It is mainly designed for improving the alignment accuracy of paired-end reads. However, the pairing procedure will be slowed down, especially for very short reads (~32bp)" /> + <param name="suboptAlign" type="integer" optional="True" label="Proceed with suboptimal alignments if there are no more than INT equally best hits. (aln -R)" help="For paired-end reads only. By default, BWA only searches for suboptimal alignments if the top hit is unique. Using this option has no effect on accuracy for single-end reads. It is mainly designed for improving the alignment accuracy of paired-end reads. However, the pairing procedure will be slowed down, especially for very short reads (~32bp)" /><param name="noIterSearch" type="boolean" truevalue="true" falsevalue="false" checked="no" label="Disable iterative search (aln -N)" help="All hits with no more than maxDiff differences will be found. This mode is much slower than the default" /><param name="outputTopN" type="integer" value="3" label="Maximum number of alignments to output in the XA tag for reads paired properly (samse/sampe -n)" help="If a read has more than INT hits, the XA tag will not be written" /><param name="outputTopNDisc" type="integer" value="10" label="Maximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons) (sampe -N)" help="For paired-end reads only. If a read has more than INT hits, the XA tag will not be written" /> @@ -249,7 +249,7 @@ <param name="mismatchPenalty" value="3" /><param name="gapOpenPenalty" value="11" /><param name="gapExtensPenalty" value="4" /> - <param name="suboptAlign" value="true" /> + <param name="suboptAlign" value="" /><param name="noIterSearch" value="true" /><param name="outputTopN" value="3" /><param name="outputTopNDisc" value="10" /> @@ -300,7 +300,7 @@ <param name="mismatchPenalty" value="3" /><param name="gapOpenPenalty" value="11" /><param name="gapExtensPenalty" value="4" /> - <param name="suboptAlign" value="true" /> + <param name="suboptAlign" value="" /><param name="noIterSearch" value="true" /><param name="outputTopN" value="3" /><param name="outputTopNDisc" value="10" /> diff -r 7f78b2bf339f24f57b686e7c4bdb1fe301e8ed12 -r e5182b8038e8618529594dea85bc3f304e51a11c tools/sr_mapping/bwa_wrapper.py --- a/tools/sr_mapping/bwa_wrapper.py +++ b/tools/sr_mapping/bwa_wrapper.py @@ -54,7 +54,7 @@ parser.add_option( '-M', '--mismatchPenalty', dest='mismatchPenalty', help='Mismatch penalty' ) parser.add_option( '-O', '--gapOpenPenalty', dest='gapOpenPenalty', help='Gap open penalty' ) parser.add_option( '-E', '--gapExtensPenalty', dest='gapExtensPenalty', help='Gap extension penalty' ) - parser.add_option( '-R', '--suboptAlign', dest='suboptAlign', help='Proceed with suboptimal alignments even if the top hit is a repeat' ) + parser.add_option( '-R', '--suboptAlign', dest='suboptAlign', default=None, help='Proceed with suboptimal alignments even if the top hit is a repeat' ) parser.add_option( '-N', '--noIterSearch', dest='noIterSearch', help='Disable iterative search' ) parser.add_option( '-T', '--outputTopN', dest='outputTopN', help='Maximum number of alignments to output in the XA tag for reads paired properly' ) parser.add_option( '', '--outputTopNDisc', dest='outputTopNDisc', help='Maximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons)' ) @@ -182,8 +182,8 @@ seed = '-l %s' % options.seed else: seed = '' - if options.suboptAlign == 'true': - suboptAlign = '-R' + if options.suboptAlign: + suboptAlign = '-R "%s"' % ( options.suboptAlign ) else: suboptAlign = '' if options.noIterSearch == 'true': diff -r 7f78b2bf339f24f57b686e7c4bdb1fe301e8ed12 -r e5182b8038e8618529594dea85bc3f304e51a11c tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml +++ b/tools/sr_mapping/bwa_wrapper.xml @@ -1,4 +1,4 @@ -<tool id="bwa_wrapper" name="Map with BWA for Illumina" version="1.2.2"> +<tool id="bwa_wrapper" name="Map with BWA for Illumina" version="1.2.3"><description></description><parallelism method="basic"></parallelism><command interpreter="python"> @@ -45,7 +45,7 @@ --mismatchPenalty=$params.mismatchPenalty --gapOpenPenalty=$params.gapOpenPenalty --gapExtensPenalty=$params.gapExtensPenalty - --suboptAlign=$params.suboptAlign + --suboptAlign="${params.suboptAlign}" --noIterSearch=$params.noIterSearch --outputTopN=$params.outputTopN --outputTopNDisc=$params.outputTopNDisc @@ -122,7 +122,7 @@ <param name="mismatchPenalty" type="integer" value="3" label="Mismatch penalty (aln -M)" help="BWA will not search for suboptimal hits with a score lower than [value]" /><param name="gapOpenPenalty" type="integer" value="11" label="Gap open penalty (aln -O)" /><param name="gapExtensPenalty" type="integer" value="4" label="Gap extension penalty (aln -E)" /> - <param name="suboptAlign" type="boolean" truevalue="true" falsevalue="false" checked="no" label="Proceed with suboptimal alignments even if the top hit is a repeat (aln -R)" help="For paired-end reads only. By default, BWA only searches for suboptimal alignments if the top hit is unique. Using this option has no effect on accuracy for single-end reads. It is mainly designed for improving the alignment accuracy of paired-end reads. However, the pairing procedure will be slowed down, especially for very short reads (~32bp)" /> + <param name="suboptAlign" type="integer" optional="True" label="Proceed with suboptimal alignments if there are no more than INT equally best hits. (aln -R)" help="For paired-end reads only. By default, BWA only searches for suboptimal alignments if the top hit is unique. Using this option has no effect on accuracy for single-end reads. It is mainly designed for improving the alignment accuracy of paired-end reads. However, the pairing procedure will be slowed down, especially for very short reads (~32bp)" /><param name="noIterSearch" type="boolean" truevalue="true" falsevalue="false" checked="no" label="Disable iterative search (aln -N)" help="All hits with no more than maxDiff differences will be found. This mode is much slower than the default" /><param name="outputTopN" type="integer" value="3" label="Maximum number of alignments to output in the XA tag for reads paired properly (samse/sampe -n)" help="If a read has more than INT hits, the XA tag will not be written" /><param name="outputTopNDisc" type="integer" value="10" label="Maximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons) (sampe -N)" help="For paired-end reads only. If a read has more than INT hits, the XA tag will not be written" /> @@ -226,7 +226,7 @@ <param name="mismatchPenalty" value="3" /><param name="gapOpenPenalty" value="11" /><param name="gapExtensPenalty" value="4" /> - <param name="suboptAlign" value="true" /> + <param name="suboptAlign" value="" /><param name="noIterSearch" value="true" /><param name="outputTopN" value="3" /><param name="outputTopNDisc" value="10" /> @@ -263,7 +263,7 @@ <param name="mismatchPenalty" value="3" /><param name="gapOpenPenalty" value="11" /><param name="gapExtensPenalty" value="4" /> - <param name="suboptAlign" value="true" /> + <param name="suboptAlign" value="" /><param name="noIterSearch" value="true" /><param name="outputTopN" value="3" /><param name="outputTopNDisc" value="10" /> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Do not add hidden tools to the tool panel.
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/7f78b2bf339f/ changeset: 7f78b2bf339f user: dan date: 2012-04-10 05:24:31 summary: Do not add hidden tools to the tool panel. affected #: 1 file diff -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 -r 7f78b2bf339f24f57b686e7c4bdb1fe301e8ed12 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -490,52 +490,57 @@ def to_dict( self, trans, in_panel=True, trackster=False ): - def filter_for_trackster( item ): + def filter_for_panel( item, filters ): """ Filters tool panel elements so that only those that are compatible - with Trackster are kept. + with provided filters are kept. """ - + def _apply_filter( filter_item, filter_list ): + for filter_method in filter_list: + if not filter_method( filter_item ): + return False + return True if isinstance( item, Tool ): - # If tool has a trackster config, it can be used in Trackster. - if tool.trackster_conf: + if _apply_filter( item, filters[ 'tool' ] ): return item elif isinstance( item, ToolSectionLabel ): - # Tool label cannot be directly filtered. - return item + if _apply_filter( item, filters[ 'label' ] ): + return item elif isinstance( item, ToolSection ): # Filter section item-by-item. Only show a label if there are - # trackster-compatible tools below it. - cur_label_key = None - tools_under_label = False - filtered_elems = item.elems.copy() - for key, section_item in item.elems.items(): - if isinstance( section_item, Tool ): - # Filter tool. - if section_item.trackster_conf: - tools_under_label = True - else: - del filtered_elems[ key ] - elif isinstance( section_item, ToolSectionLabel ): - # If there is a label and it does not have tools, - # remove it. - if cur_label_key and not tools_under_label: - del filtered_elems[ cur_label_key ] + # non-filtered tools below it. + + if _apply_filter( item, filters[ 'section' ] ): + cur_label_key = None + tools_under_label = False + filtered_elems = item.elems.copy() + for key, section_item in item.elems.items(): + if isinstance( section_item, Tool ): + # Filter tool. + if _apply_filter( section_item, filters[ 'tool' ] ): + tools_under_label = True + else: + del filtered_elems[ key ] + elif isinstance( section_item, ToolSectionLabel ): + # If there is a label and it does not have tools, + # remove it. + if ( cur_label_key and not tools_under_label ) or not _apply_filter( section_item, filters[ 'label' ] ): + del filtered_elems[ cur_label_key ] - # Reset attributes for new label. - cur_label_key = key - tools_under_label = False - - - # Handle last label. - if cur_label_key and not tools_under_label: - del filtered_elems[ cur_label_key ] - - # Only return section if there are elements. - if len( filtered_elems ) != 0: - copy = item.copy() - copy.elems = filtered_elems - return copy + # Reset attributes for new label. + cur_label_key = key + tools_under_label = False + + + # Handle last label. + if cur_label_key and not tools_under_label: + del filtered_elems[ cur_label_key ] + + # Only return section if there are elements. + if len( filtered_elems ) != 0: + copy = item.copy() + copy.elems = filtered_elems + return copy return None @@ -547,13 +552,15 @@ panel_elts = [ val for val in self.tool_panel.itervalues() ] # Filter if necessary. + filters = dict( tool=[ lambda x: not x._is_hidden_for_user( trans.user ) ], section=[], label=[] ) #hidden tools filter if trackster: - filtered_panel_elts = [] - for index, elt in enumerate( panel_elts ): - elt = filter_for_trackster( elt ) - if elt: - filtered_panel_elts.append( elt ) - panel_elts = filtered_panel_elts + filters[ 'tool' ].append( lambda x: x.trackster_conf ) # If tool has a trackster config, it can be used in Trackster. + filtered_panel_elts = [] + for index, elt in enumerate( panel_elts ): + elt = filter_for_panel( elt, filters ) + if elt: + filtered_panel_elts.append( elt ) + panel_elts = filtered_panel_elts # Produce panel. rval = [] Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: richard_burhans: remove Genome Diversity {test, tool}-data from galaxy-central. this is now in the genome_diversity toolshed repository
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/0ffa2695e436/ changeset: 0ffa2695e436 user: richard_burhans date: 2012-04-09 22:34:51 summary: remove Genome Diversity {test,tool}-data from galaxy-central. this is now in the genome_diversity toolshed repository affected #: 10 files diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 test-data/gd.extract_flanking_dna.txt --- a/test-data/gd.extract_flanking_dna.txt +++ /dev/null @@ -1,40 +0,0 @@ -SEQUENCE_ID=chr18_57379354_57380496 315 C T -SEQUENCE_TEMPLATE=CTCTCTGATGAGCAAGGAGCAGCTCTGATTGGGATCGCCAAGGAGCTGGAATCGGCCCTGGGTGTCTGTGTCCACGTCCTGACCTGGCTTGTTGGTGGCCACTGGCAGACTAGGCTTGGGGGTCTTGTCTCTGAACCAGAAGCCGTAAGCTGGGGTGGTGGAACTCCATCCTCTGGAGGGGTAGAAGACAGAGCAGGGCACnACCACGCACAGGCCTTCTTGCACCATCACAAACTCCTGCATCTGCAGCTTGAATGAGTCCAGAGCCTGAGACCCTATGAGGGAGACAGAGGTTCAAGCTGCAAGCCCAGCCCAGACCACCCCCCCCAGCCCCCGGGCCCCTCCTGGCCACCCCCTTCCACTCACCGCCCCACAGCATGGCCAAGAACAGTGGCAGGAACA -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr18_48070585_48071386 514 C T -SEQUENCE_TEMPLATE=GCCCTCCCCTGCCCAGTCCCTCAGCCCCTGCCTCCTCGTGCAGGCAGGCCTCCAGGATCTGCAGGCCAGACCTCCAGAAGGCCTTGTTCATGGCATTTCTCTTCTCAGGCCGGTTTAGTTGCACATGCAGAACATGTTTCTGGGCAGCTGTCACCCGAAGGGACTCATAGCTGTGGCCTGGGGCTTCCTCTGGGGATGCTTnGGAGGCTTCCTCTTGTGCAGAGGCACTCATTGGGCGAAGGCTGAGACCCAGGTTGGTGGAGGCTGTCAGTCCTGGGGAGACAGAGGTAGGAAGTGCCTTTGATGACCCTGAATATGGGGCACAGCACCTTCAAGAGCAGAGGGTACACATCTCAGTTGACACTAGGTTGGGGGACACACGCCTATGAGAGGCCTTGGTTT -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr14_80021455_80022064 138 G A -SEQUENCE_TEMPLATE=ACCCAGGGATCAAACCCAGGTCTCCCGCATTGCAGGCGGATTCTTTACTGTCTGAGCCTCCAGGGAAGCCCTCGGGGCTGAAGGGATGGTTATGAAGGTGAGAAACAGGGGCCACCTGTCCCCAAGGTACCTTGCGACnTGCCATCTGCGCTCCACCAGTAAATGGACGTCTTCGATCCTTCTGTTGTTGGCGTAGTGCAAACGTTTGGGAAGGTGCTGTTTCAAGTAAGGCTTAAAGTGCTGGTCTGGTTTTTTACACTGAAATATAAATGGACATTGGATTTTGCAATGGAGAGTCTTCTAGAAGAGTCCAAGACATTCTCTCCAGAAAGCTGAAGG -SEQUENCE_TARGET=133,11 -= -SEQUENCE_ID=chr19_39866997_39874915 3117 C T -SEQUENCE_TEMPLATE=CCCAGCCAGAGAGGCCCTGGGGGCTGCGGCTACTCTGGCCCCCTTCCTTGCCTGAACAGTGCTTTGCTGGCCCCCGGGAGCCAGAGGGCACAGTCTCTTGGTGGTAGAGGAGGCCTGTGGCAAGGAAGCAGGCTCCGGGGGTGTCTCTTTCTCTTGAGTGGGAGTGACGGAAGGGCTGCTGTCCCCAGCCATGGGCACCCCnGGCAGCGGGGGCAGGTCTGTGAGGGTGGGCTGCGTCTCCACCCTCAGCTGGTGCTCCAGCAGGGCTGTCTGCTGCCTGAGCTCCCGGTGCTTGCTCATTTCCTGCTCCAGCTCCTTGAGGAAGCCTGTGAGGGGTGGGATGGTGGGTGGTGGATAGAGCCCCGGGCTTGGCAGAAGCACACTCTCCCCTACCATCCCTAG -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr15_64470252_64471048 89 G A -SEQUENCE_TEMPLATE=TGTGTGTGTGTGTGTGTGTGTGTGCCTGTGTCTGTACATGCACACCACGTGGCCTCACCCAGTGCCCTCAGCTCCATGGTGATGTCCACnTAGCCGTGCTCCGCGCTGTAGTACATGGCCTCCTGGAGGGCCTTGGTGCGCGTCCGGCTCAGGCGCATGGGCCCCTCGCTGCCGCTGCCCTGGCTGGATGCATCGCTCTCTTCCACGCCCTCAGCCAGGATCTCCTCCAGGGACAGCACATCTGCTTTGGCCTGCTGTGGCTGAGTCAGGAGCTTCCTCAGGACGTTCCT -SEQUENCE_TARGET=84,11 -= -SEQUENCE_ID=chr18_50154905_50155664 304 A G -SEQUENCE_TEMPLATE=GGTACCTTGGTTTCTCTGTCAAGAGACCTATGTGTTGACTGTCATCACTGTACCATGGTCGGGGGGTGGTCGGGAGGAGCCAGATGTGGGTCTGAATGAACATGTGGCGTTCTTGGTTTCTCTCTCCCCAGTACGCCCAGCAGTGGAACCAGTACTATCAGAACCAGGGCCAGTGGCCGCCGTACTACGGGAACTATGACTnCGGGAGCTACTCCGGGAACACACAGGGGGGCACAAGCGCACAGTAGCCACGTGCCCTGGAGGCCCCTGCCGGCTTCCTCCACCAGCGCCCGCCTCAGTCCTCCTCATCCATCCCTCCCGGGTCCCGTGGTGCTGGGGGATGGGTCCTCCCAGGCTGCCTCCCCTCTGAGGGGCTCTTCCCCCACACAGGGCCGGGCATTT -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr2_75111355_75112576 314 A C -SEQUENCE_TEMPLATE=TATCTTCATTTTTATTATAGACTCTCTGAACCAATTTGCCCTGAGGCAGACTTTTTAAAGTACTGTGTAATGTATGAAGTCCTTCTGCTCAAGCAAATCATTGGCATGAAAACAGTTGCAAACTTATTGTGAGAGAAGAGTCCAAGAGTTTTAACAGTCTGTAAGTATATAGCCTGTGAGTTTGATTTCCTTCTTGTTTTTnTTCCAGAAACATGATCAGGGGCAAGTTCTATTGGATATAGTCTTCAAGCATCTTGATTTGACTGAGCGTGACTATTTTGGTTTGCAGTTGACTGACGATTCCACTGATAACCCAGTAAGTTTAAGCTGTTGTCTTTCATTGTCATTGCAATTTTTCTGTCTTTATACTAGGTCCTTTCTGATTTACATTGTTCACTGATT -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr8_93901796_93905612 2471 A C -SEQUENCE_TEMPLATE=GCTGCCGCTGGATTTACTTCTGCTTGGGTCGAGAGCGGGCTGGATGGGTGAAGAGTGGGCTCCCCGGCCCCTGACCAGGCAGGTGCAGACAAGTCGGAAGAAGGCCCGCCGCATCTCCTTGCTGGCCAGCGTGTAGATGACGGGGTTCATGGCAGAGTTGAGCACGGCCAGCACGATGAACCACTGGGCCTTGAACAGGATnGCGCACTCCTTCACCTTGCAGGCCACATCCACAAGGAAAAGGATGAAGAGTGGGGACCAGCAGGCGATGAACACGCTCACCACGATCACCACGGTCCGCAGCAGGGCCATGGACCGCTCTGAGTTGTGCGGGCTGGCCACCCTGCGGCTGCTGGACTTCACCAGGAAGTAGATGCGTGCGTACAGGATCACGATGGTCAC -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr10_7434473_7435447 524 T C -SEQUENCE_TEMPLATE=ATTATTAACAGAAACATTTCTTTTTCATTACCCAGGGGTTACACTGGTCGTTGATGTTAATCAGTTTTTGGAGAAGGAGAAGCAAAGTGATATTTTGTCTGTTCTGAAGCCTGCCGTTGGTAATACAAATGACGTAATCCCTGAATGTGCTGACAGGTACCATGACGCCCTGGCAAAAGCAAAAGAGCAAAAATCTAGAAGnGGTAAGCATCTTCACTGTTTAGCACAAATTAAATAGCACTTTGAATATGATGATTTCTGTGGTATTGTGTTATCTTACTTTTGAGACAAATAATCGCTTTCAAATGAATATTTCTGAATGTTTGTCATCTCTGGCAAGGAAATTTTTTAGTGTTTCTTTTCCTTTTTTGTCTTTTGGAAATCTGTGATTAACTTGGTGGC -SEQUENCE_TARGET=196,11 -= -SEQUENCE_ID=chr19_14240610_14242055 232 C T -SEQUENCE_TEMPLATE=CAACATTGTAAAGTAATTATACTCCAATTAAAAAACACAGTGATATCAAAGATGATTTCCAATACTAAAATCTATCTCCAAGAATTTACAGCTTTGAAGAAAATTTTACAATCTCCGGAATTCATGTTAATATTGAAACAACATTTCTGTCCTAATTATTTATTGGAACCTCTTTCTGTCATTGTTTGTGACGCAGAAGGGnTGCTGATGTGGAAAGCCTCAAGATGGAGACGGAAATGCTTTATCCCGAGATAACCGTAGAAGTGGGCAGAGTCACTTTCGGAGAGGAAAACAGGAAGAGGATGACCAATAGCTATTTGAAAAGAGCTGAGAACTCTAGAATCACCCAAGCGACGTGTGCACTGTTAAATTCTGGAGGGGGTTTGATCAAAGCGGAGATTG -SEQUENCE_TARGET=196,11 -= diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 test-data/gd.extract_primers.txt --- a/test-data/gd.extract_primers.txt +++ /dev/null @@ -1,119 +0,0 @@ -> chr18_57379354_57380496 315 C T 0.014036 - BanI - 1 CAGACTAGGCTTGGGGGTCTTGTCTCTGAACCAGAAGCCGTAAGCTGGGGTGGTGGAACT - >>>>>>>>>>>>>>>>>>>> - - 61 CCATCCTCTGGAGGGGTAGAAGACAGAGCAGGGCACnACCACGCACAGGCCTTCTTGCAC - - -121 CATCACAAACTCCTGCATCTGCAGC - <<<<<<<<<<<<<<<<<<<< - -> chr18_48070585_48071386 514 C T 0.163186 - - 1 ATTTCTCTTCTCAGGCCGGTTTAGTTGCACATGCAGAACATGTTTCTGGGCAGCTGTCAC - >>>>>>>>>>>>>>>>>>>> - - 61 CCGAAGGGACTCATAGCTGTGGCCTGGGGCTTCCTCTGGGGATGCTTnGGAGGCTTCCTC - - -121 TTGTGCAGAGGCACTCATTGGGCGAAGGCTGAGACCCAGGTTGGTGGAGGCTGTCAGTCC - <<<<< - -181 TGGGGAGACAGAGGTAGG - <<<<<<<<<<<<<<< - -> chr14_80021455_80022064 138 G A 0.194886 - Hsp92II - 1 CGGGGCTGAAGGGATGGTTATGAAGGTGAGAAACAGGGGCCACCTGTCCCCAAGGTACCT - >>>>>>>>>>>>>>>>>>>> - - 61 TGCGACnTGCCATCTGCGCTCCACCAGTAAATGGACGTCTTCGATCCTTCTGTTGTTGGC - <<<<<<<<<<<<< - -121 GTAGTGCAAA - <<<<<<< - -> chr19_39866997_39874915 3117 C T 0.946156 - BstOI - 1 TTTCTCTTGAGTGGGAGTGACGGAAGGGCTGCTGTCCCCAGCCATGGGCACCCCnGGCAG - >>>>>>>>>>>>>>>>>>>> - - 61 CGGGGGCAGGTCTGTGAGGGTGGGCTGCGTCTCCACCCTCAGCTGGTGCTCCAGCAGGGC - - -121 TGTCTGCTGCCTGAGCTCCCGGTGCTTGCTCATTTCCTGCTCCAGCTCCTT - <<<<<<<<<<<<<<<<<<<< - -> chr15_64470252_64471048 89 G A 1.325099 - - 1 GTGTGTGTGTGTGTGCCTGTGTCTGTACATGCACACCACGTGGCCTCACCCAGTGCCCTC - >>>>>>>>>>>>>>>>>>>> - - 61 AGCTCCATGGTGATGTCCACnTAGCCGTGCTCCGCGCTGTAGTACATGGCCTCCTGGAGG - - -121 GCCTTGGTGCGCGTCCGGCTCAGGCGCATGGGCCCCTCGCTGCCGCTGCCCTGGCTGGAT - <<<<<< - -181 GCATCGCTCTCTTCCAC - <<<<<<<<<<<<<< - -> chr18_50154905_50155664 304 A G 0.578070 - - 1 TGGTTTCTCTCTCCCCAGTACGCCCAGCAGTGGAACCAGTACTATCAGAACCAGGGCCAG - >>>>>>>>>>>>>>>>>>>> - - 61 TGGCCGCCGTACTACGGGAACTATGACTnCGGGAGCTACTCCGGGAACACACAGGGGGGC - - -121 ACAAGCGCACAGTAGCCACGTGCCCTGGAGGCCCCTGCCGGCTTCCTCCACCAGCGCCCG - - -181 CCTCAGTCCTCCTCATCCATCCCTC - <<<<<<<<<<<<<<<<<<<< - -> chr2_75111355_75112576 314 A C 0.613831 - - 1 TTTGCCCTGAGGCAGACTTTTTAAAGTACTGTGTAATGTATGAAGTCCTTCTGCTCAAGC - >>>>>>>>>>>>>>>>>>>> - - 61 AAATCATTGGCATGAAAACAGTTGCAAACTTATTGTGAGAGAAGAGTCCAAGAGTTTTAA - - -121 CAGTCTGTAAGTATATAGCCTGTGAGTTTGATTTCCTTCTTGTTTTTnTTCCAGAAACAT - - -181 GATCAGGGGCAAGTTCTATTGGATA - <<<<<<<<<<<<<<<<<<<< - -> chr8_93901796_93905612 2471 A C 0.322555 - MboI,Sau3AI - 1 GGGTTCATGGCAGAGTTGAGCACGGCCAGCACGATGAACCACTGGGCCTTGAACAGGATn - >>>>>>>>>>>>>>>>>>>> - - 61 GCGCACTCCTTCACCTTGCAGGCCACATCCACAAGGAAAAGGATGAAGAGTGGGGACCAG - <<<<<<<<<<<<<<<<<<<< - -121 C - - -> chr10_7434473_7435447 524 T C 1.119264 - - 1 CCTGGCAAAAGCAAAAGAGCAAAAATCTAGAAGnGGTAAGCATCTTCACTGTTTAGCACA - >>>>>>>>>>>>>>>>>>>> - - 61 AATTAAATAGCACTTTGAATATGATGATTTCTGTGGTATTGTGTTATCTTACTTTTGAGA - - -121 CAAATAATCGCTTTCAAATGAATATTTCTGAATGTTTGTCATCTCTGGCAAGGAAAT - <<<<<<<<<<<<<<<<<<<< - -> chr19_14240610_14242055 232 C T 0.835026 - - 1 TTTCTGTCATTGTTTGTGACGCAGAAGGGnTGCTGATGTGGAAAGCCTCAAGATGGAGAC - >>>>>>>>>>>>>>>>>>>> - - 61 GGAAATGCTTTATCCCGAGATAACCGTAGAAGTGGGCAGAGTCACT - <<<<<<<<<<<<<<<<<<<< - diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 test-data/gd.sample.wsf --- a/test-data/gd.sample.wsf +++ /dev/null @@ -1,12 +0,0 @@ -#species=bighorn -#scaffold pos A B aa1 aa2 ref rPos rNuc rAA #desA #desB desQ #mtA #mtB mtQ pair sep Fst cons prim #RFLP -chr18_57379354_57380496 315 C T V V chr18 57379669 G V 11 0 60 9 6 62 Y 726 0.118 0.048 0.014 1 -chr18_48070585_48071386 514 C T E K chr18 48071100 T K 7 7 46 14 0 69 Y 2 0.200 0.032 0.163 0 -chr14_80021455_80022064 138 G A H H chr14 80021593 G H 14 0 69 9 6 124 Y 377 0.118 0.997 0.195 1 -chr19_39866997_39874915 3117 C T P P chr19 39870110 C P 3 7 65 14 2 32 Y 6 0.321 0.911 0.462 4 -chr15_64470252_64471048 89 G A Y Y chr15 64470341 G Y 5 6 109 14 0 69 Y 312 0.247 0.998 0.393 0 -chr18_50154905_50155664 304 A G Y C chr18 50155208 A Y 4 2 17 5 1 22 Y 8 0.022 0.996 0.128 0 -chr2_75111355_75112576 314 A C L F chr2 75111676 C F 15 4 53 2 9 48 Y 96 0.369 0.355 0.396 0 -chr8_93901796_93905612 2471 A C A A chr8 93904264 A A 8 0 51 10 2 14 Y 961 0.016 0.534 0.114 2 -chr10_7434473_7435447 524 T C S S chr10 7435005 T S 11 5 90 14 0 69 Y 626 0.066 0.406 0.727 0 -chr19_14240610_14242055 232 C T A V chr19 14240840 C A 18 8 56 15 5 42 Y 73 0.003 0.153 0.835 0 diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 test-data/gd.select_restriction_enzymes.wsf --- a/test-data/gd.select_restriction_enzymes.wsf +++ /dev/null @@ -1,5 +0,0 @@ -#species=bighorn -#scaffold pos A B aa1 aa2 ref rPos rNuc rAA #desA #desB desQ #mtA #mtB mtQ pair sep Fst cons prim #RFLP -chr18_57379354_57380496 315 C T V V chr18 57379669 G V 11 0 60 9 6 62 Y 726 0.118 0.048 0.014 1 -chr14_80021455_80022064 138 G A H H chr14 80021593 G H 14 0 69 9 6 124 Y 377 0.118 0.997 0.195 1 -chr19_39866997_39874915 3117 C T P P chr19 39870110 C P 3 7 65 14 2 32 Y 6 0.321 0.911 0.462 4 diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 test-data/gd.select_snps.wsf --- a/test-data/gd.select_snps.wsf +++ /dev/null @@ -1,7 +0,0 @@ -#species=bighorn -#scaffold pos A B aa1 aa2 ref rPos rNuc rAA #desA #desB desQ #mtA #mtB mtQ pair sep Fst cons prim #RFLP -chr18_48070585_48071386 514 C T E K chr18 48071100 T K 7 7 46 14 0 69 Y 2 0.200 0.032 0.163 0 -chr15_64470252_64471048 89 G A Y Y chr15 64470341 G Y 5 6 109 14 0 69 Y 312 0.247 0.998 0.393 0 -chr8_93901796_93905612 2471 A C A A chr8 93904264 A A 8 0 51 10 2 14 Y 961 0.016 0.534 0.114 2 -chr10_7434473_7435447 524 T C S S chr10 7435005 T S 11 5 90 14 0 69 Y 626 0.066 0.406 0.727 0 -chr19_14240610_14242055 232 C T A V chr19 14240840 C A 18 8 56 15 5 42 Y 73 0.003 0.153 0.835 0 diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 tool-data/gd.chrlens.loc.sample --- a/tool-data/gd.chrlens.loc.sample +++ /dev/null @@ -1,22 +0,0 @@ -# This is a sample file distributed with Galaxy that enables tools to -# use a directory of sequence length files. You will need to create these -# sequence length files and then create a gd.chrlens.loc file similar to -# this one (store it in this directory) that points to the directories -# in which these sequence length files are stored. The gd.chrlens.loc -# file has the following format (white space characters are TAB -# characters): -# -#<species><reference_species_file_path> -# -# So, for example, if you used Monodelphis domestica as the reference -# species for a collection of Sarcophilus harrisii SNPs, then the -# gd.chrlens.loc entry would look like this: -# -#tasmanian_devil /galaxy/data/location/gd/chrlens/mondom_chr_lengths.txt -# -# Your gd.chrlens.loc file should include an entry for each pair of -# species SNPs and reference species. For example: -# -#bighorn /galaxy/data/location/gd/chrlens/cow_chr_lengths.txt -#tasmanian_devil /galaxy/data/location/gd/chrlens/mondom_chr_lengths.txt -#...etc... diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 tool-data/gd.primers.loc.sample --- a/tool-data/gd.primers.loc.sample +++ /dev/null @@ -1,22 +0,0 @@ -# This is a sample file distributed with Galaxy that enables tools to -# use a directory of primers files. You will need to create these primers -# files and then create a gd.primers.loc file similar to this one (store -# it in this directory) that points to the directories in which these -# primers files are stored. The gd.primers.loc file has the following -# format (white space characters are TAB characters): -# -#<species><primers_file_path> -# -# So, for example, if you had a primers file located at -# /galaxy/data/location/gd/primers/bighorn_primers.txt for a collection of -# Ovis canadensis SNPs, then the gd.primers.loc entry would look like -# this: -# -#bighorn /galaxy/data/location/gd/primers/bighorn_primers.txt -# -# Your gd.primers.loc file should include an entry for each pair of -# species SNPs and primers file. For example: -# -#bighorn /galaxy/data/location/gd/primers/bighorn_primers.txt -#tasmanian_devil /galaxy/data/location/gd/primers/tasmanian_devil_primers.txt -#...etc... diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 tool-data/gd.restriction_enzymes.txt.sample --- a/tool-data/gd.restriction_enzymes.txt.sample +++ /dev/null @@ -1,99 +0,0 @@ -Acc65I - GGTACC Acc65I -AccB7I - CCANNNNNTGG AccB7I -AccI - GT(A/C)(G/T)AC AccI -AccIII - TCCGGA AccIII -AcyI - G(A/G)CG(C/T)C AcyI -AgeI - ACCGGT AgeI -AluI - AGCT AluI -Alw44I - GTGCAC Alw44I -ApaI - GGGCCC ApaI -AvaI - C(C/T)CG(A/G)G AvaI -AvaII - GG(A/T)CC AvaII -BalI - TGGCCA BalI -BamHI - GGATCC BamHI -BanI - GG(C/T)(A/G)CC BanI -BanII - G(A/G)GC(C/T)C BanII -BbuI - GCATGC BbuI -BclI - TGATCA BclI -BglI - GCCNNNNNGGC BglI -BglII - AGATCT BglII -BsaMI - GAATGC BsaMI -BsaOI - CG(A/G)(C/T)CG BsaOI -Bsp1286I - G(A/G/T)GC(A/C/T)C Bsp1286I -BsrBRI - GATNNNNATC BsrBRI -BsrSI - ACTGG BsrSI -BssHII - GCGCGC BssHII -Bst98I - CTTAAG Bst98I -BstEII - GGTNACC BstEII -BstOI - CC(A/T)GG BstOI -BstXI - CCANNNNNNTGG BstXI -BstZI - CGGCCG BstZI -Bsu36I - CCTNAGG Bsu36I -CfoI - GCGC CfoI -ClaI - ATCGAT ClaI -Csp45I - TTCGAA Csp45I -CspI - CGG(A/T)CCG CspI -DdeI - CTNAG DdeI -DpnI - GATC DpnI -DraI - TTTAAA DraI -EclHKI - GACNNNNNGTC EclHKI -Eco47III - AGCGCT Eco47III -Eco52I - CGGCCG Eco52I -Eco72I - CACGTG Eco72I -EcoRI - GAATTC EcoRI -EcoRV - GATATC EcoRV -HaeII - (A/G)GCGC(C/T) HaeII -HaeIII - GGCC HaeIII -HhaI - GCGC HhaI -HincII - GT(C/T)(A/G)AC HincII -HindIII - AAGCTT HindIII -HinfI - GANTC HinfI -HpaI - GTTAAC HpaI -HpaII - CCGG HpaII -Hsp92I - G(A/G)CG(C/T)C Hsp92I -Hsp92II - CATG Hsp92II -I-PpoI - TAACTATGACTCTCTTAAGGTAGCCAAAT I-PpoI -KpnI - GGTACC KpnI -MboI - GATC MboI -MluI - ACGCGT MluI -MspA1I - C(A/C)GC(G/T)G MspA1I -MspI - CCGG MspI -NaeI - GCCGGC NaeI -NarI - GGCGCC NarI -NciI - CC(C/G)GG NciI -NcoI - CCATGG NcoI -NdeI - CATATG NdeI -NgoMIV - GCCGGC NgoMIV -NheI - GCTAGC NheI -NotI - GCGGCCGC NotI -NruI - TCGCGA NruI -NsiI - ATGCAT NsiI -PstI - CTGCAG PstI -PvuI - CGATCG PvuI -PvuII - CAGCTG PvuII -RsaI - GTAC RsaI -SacI - GAGCTC SacI -SacII - CCGCGG SacII -SalI - GTCGAC SalI -Sau3AI - GATC Sau3AI -Sau96I - GGNCC Sau96I -ScaI - AGTACT ScaI -SfiI - GGCCNNNNNGGCC SfiI -SgfI - GCGATCGC SgfI -SinI - GG(A/T)CC SinI -SmaI - CCCGGG SmaI -SnaBI - TACGTA SnaBI -SpeI - ACTAGT SpeI -SphI - GCATGC SphI -SspI - AATATT SspI -StuI - AGGCCT StuI -StyI - CC(A/T)(A/T)GG StyI -TaqI - TCGA TaqI -Tru9I - TTAA Tru9I -Tth111I - GACNNNGTC Tth111I -VspI - ATTAAT VspI -XbaI - TCTAGA XbaI -XhoI - CTCGAG XhoI -XhoII - (A/G)GATC(C/T) XhoII -XmaI - CCCGGG XmaI -XmnI - GAANNNNTTC XmnI diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 tool-data/gd.snps.loc.sample --- a/tool-data/gd.snps.loc.sample +++ /dev/null @@ -1,21 +0,0 @@ -# This is a sample file distributed with Galaxy that enables tools to -# use a directory of SNP call files. You will need to create these SNP -# call files and then create a gd.snps.loc file similar to this one (store -# it in this directory) that points to the directories in which these -# SNP call files are stored. The gd.snps.loc file has the following -# format (white space characters are TAB characters): -# -#<species><SNP_call_file_path> -# -# So, for example, if you had a SNP call file located at -# /galaxy/data/location/gd/snps/bighorn_snps.txt for a collection of -# Ovis canadensis SNPs, then the gd.snps.loc entry would look like this: -# -#bighorn /galaxy/data/location/gd/snps/bighorn_snps.txt -# -# Your gd.snps.loc file should include an entry for each pair of species -# SNPs and SNP call file. For example: -# -#bighorn /galaxy/data/location/gd/snps/bighorn_snps.txt -#tasmanian_devil /galaxy/data/location/gd/snps/tasmanian_devil_snps.txt -#...etc... diff -r 0edea146c96436e63076550c595bcc444ba2cdb0 -r 0ffa2695e436501aa55546de6c4643743fe0d2f4 tool-data/gd.species.txt.sample --- a/tool-data/gd.species.txt.sample +++ /dev/null @@ -1,3 +0,0 @@ -# genome diversity species -tasmanian_devil Tasmanian devil -bighorn bighorn Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Comment out recently used tool update for now because it is not implemented yet.
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/0edea146c964/ changeset: 0edea146c964 user: jgoecks date: 2012-04-09 22:17:46 summary: Comment out recently used tool update for now because it is not implemented yet. affected #: 1 file diff -r 507135da0b2c15ddbb05759c5d38a0ed0f429d0a -r 0edea146c96436e63076550c595bcc444ba2cdb0 templates/tool_executed.mako --- a/templates/tool_executed.mako +++ b/templates/tool_executed.mako @@ -16,7 +16,7 @@ %if trans.user: if (inside_galaxy_frameset) { - parent.frames.galaxy_tools.update_recently_used(); + //parent.frames.galaxy_tools.update_recently_used(); } %endif Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 09 Apr '12

09 Apr '12

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/fe54618dbd31/ changeset: fe54618dbd31 user: jgoecks date: 2012-04-09 21:58:25 summary: Tool menu changes: (a) enable Toolbox to be directly dictified; and (b) enable Toolbox to return only tools compatible with Trackster. affected #: 3 files diff -r 7274516136812ee0a84aa69f420348848d1b5b08 -r fe54618dbd317fc1c8e9d8fd2f1650717878eade lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -487,18 +487,106 @@ Returns a SQLAlchemy session """ return self.app.model.context + + def to_dict( self, trans, in_panel=True, trackster=False ): + + def filter_for_trackster( item ): + """ + Filters tool panel elements so that only those that are compatible + with Trackster are kept. + """ + + if isinstance( item, Tool ): + # If tool has a trackster config, it can be used in Trackster. + if tool.trackster_conf: + return item + elif isinstance( item, ToolSectionLabel ): + # Tool label cannot be directly filtered. + return item + elif isinstance( item, ToolSection ): + # Filter section item-by-item. Only show a label if there are + # trackster-compatible tools below it. + cur_label_key = None + tools_under_label = False + filtered_elems = item.elems.copy() + for key, section_item in item.elems.items(): + if isinstance( section_item, Tool ): + # Filter tool. + if section_item.trackster_conf: + tools_under_label = True + else: + del filtered_elems[ key ] + elif isinstance( section_item, ToolSectionLabel ): + # If there is a label and it does not have tools, + # remove it. + if cur_label_key and not tools_under_label: + del filtered_elems[ cur_label_key ] + + # Reset attributes for new label. + cur_label_key = key + tools_under_label = False + + + # Handle last label. + if cur_label_key and not tools_under_label: + del filtered_elems[ cur_label_key ] + + # Only return section if there are elements. + if len( filtered_elems ) != 0: + copy = item.copy() + copy.elems = filtered_elems + return copy + + return None + + # + # Dictify toolbox. + # + + if in_panel: + panel_elts = [ val for val in self.tool_panel.itervalues() ] + + # Filter if necessary. + if trackster: + filtered_panel_elts = [] + for index, elt in enumerate( panel_elts ): + elt = filter_for_trackster( elt ) + if elt: + filtered_panel_elts.append( elt ) + panel_elts = filtered_panel_elts + + # Produce panel. + rval = [] + for elt in panel_elts: + rval.append( elt.to_dict( trans ) ) + else: + tools = [] + for id, tool in self.app.toolbox.tools_by_id.items(): + tools.append( tool.to_dict( trans ) ) + rval = tools + + return rval class ToolSection( object ): """ A group of tools with similar type/purpose that will be displayed as a group in the user interface. """ - def __init__( self, elem ): - self.name = elem.get( "name" ) - self.id = elem.get( "id" ) - self.version = elem.get( "version" ) or '' + def __init__( self, elem=None ): + f = lambda elem, val: elem is not None and elem.get( val ) or '' + self.name = f( elem, 'name' ) + self.id = f( elem, 'id' ) + self.version = f( elem, 'version' ) self.elems = odict() + def copy( self ): + copy = ToolSection() + copy.name = self.name + copy.id = self.id + copy.version = self.version + copy.elems = self.elems.copy() + return copy + def to_dict( self, trans ): """ Return a dict that includes section's attributes. """ section_elts = [] @@ -880,7 +968,7 @@ self.is_workflow_compatible = self.check_workflow_compatible() # Trackster configuration. trackster_conf = root.find( "trackster_conf" ) - if trackster_conf: + if trackster_conf is not None: self.trackster_conf = TracksterConfig.parse( trackster_conf ) else: self.trackster_conf = None diff -r 7274516136812ee0a84aa69f420348848d1b5b08 -r fe54618dbd317fc1c8e9d8fd2f1650717878eade lib/galaxy/web/controllers/tools.py --- a/lib/galaxy/web/controllers/tools.py +++ b/lib/galaxy/web/controllers/tools.py @@ -14,18 +14,13 @@ GET /api/tools: returns a list of tools defined by parameters parameters: in_panel - if true, tools are returned in panel structure, including sections and labels + trackster - if true, only tools that are compatible with Trackster are returned """ + + # Read params. in_panel = util.string_as_bool( kwds.get( 'in_panel', 'True' ) ) - if in_panel: - panel_elts = [] - for key, val in self.app.toolbox.tool_panel.items(): - panel_elts.append( val.to_dict( trans ) ) - rval = panel_elts - else: - tools = [] - for id, tool in self.app.toolbox.tools_by_id.items(): - tools.append( tool.to_dict( trans ) ) - rval = tools - - return rval + trackster = util.string_as_bool( kwds.get( 'trackster', 'False' ) ) + + # Create return value. + return self.app.toolbox.to_dict( trans, in_panel=in_panel, trackster=trackster ) \ No newline at end of file diff -r 7274516136812ee0a84aa69f420348848d1b5b08 -r fe54618dbd317fc1c8e9d8fd2f1650717878eade templates/root/tool_menu.mako --- a/templates/root/tool_menu.mako +++ b/templates/root/tool_menu.mako @@ -25,9 +25,7 @@ if trans.user and trans.user.preferences.get( "show_tool_search", "False" ) == "False": tool_search_hidden = "true" - dictified_panel = [] - for key, val in trans.app.toolbox.tool_panel.items(): - dictified_panel.append( val.to_dict( trans ) ) + dictified_panel = trans.app.toolbox.to_dict( trans ) %><script type="text/javascript"> https://bitbucket.org/galaxy/galaxy-central/changeset/507135da0b2c/ changeset: 507135da0b2c user: jgoecks date: 2012-04-09 21:59:45 summary: Merge affected #: 1 file diff -r fe54618dbd317fc1c8e9d8fd2f1650717878eade -r 507135da0b2c15ddbb05759c5d38a0ed0f429d0a lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -141,7 +141,7 @@ if hasattr( imported_module, datatype_class_name ): datatype_class = getattr( imported_module, datatype_class_name ) except Exception, e: - full_path = os.path.join( full_path, proprietary_datatype_module ) + full_path = os.path.join( proprietary_path, proprietary_datatype_module ) self.log.debug( "Exception importing proprietary code file %s: %s" % ( str( full_path ), str( e ) ) ) finally: lock.release() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: richard_burhans: fix path to proprietary_datatype_module so that we get the correct error message when an import fails
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/2dd7d2162a34/ changeset: 2dd7d2162a34 user: richard_burhans date: 2012-04-09 21:38:05 summary: fix path to proprietary_datatype_module so that we get the correct error message when an import fails affected #: 1 file diff -r 7274516136812ee0a84aa69f420348848d1b5b08 -r 2dd7d2162a34d2cdabe0f93a31b6f640621ce5e1 lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -141,7 +141,7 @@ if hasattr( imported_module, datatype_class_name ): datatype_class = getattr( imported_module, datatype_class_name ) except Exception, e: - full_path = os.path.join( full_path, proprietary_datatype_module ) + full_path = os.path.join( proprietary_path, proprietary_datatype_module ) self.log.debug( "Exception importing proprietary code file %s: %s" % ( str( full_path ), str( e ) ) ) finally: lock.release() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Fold tool panel styles back into base.css and include new style for tool panel in panel (w/o iframe).
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/727451613681/ changeset: 727451613681 user: jgoecks date: 2012-04-09 21:20:15 summary: Fold tool panel styles back into base.css and include new style for tool panel in panel (w/o iframe). affected #: 4 files diff -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c -r 7274516136812ee0a84aa69f420348848d1b5b08 static/june_2007_style/base.less --- a/static/june_2007_style/base.less +++ b/static/june_2007_style/base.less @@ -1632,6 +1632,10 @@ margin-top: 5px; } +.unified-panel-body > .toolMenu { + padding: 10px; +} + div.toolSectionPad { margin: 0; @@ -1641,7 +1645,7 @@ } div.toolSectionWrapper { - // margin-bottom: 5px; + margin-bottom: 5px; } div.toolSectionDetailsInner @@ -1657,8 +1661,8 @@ div.toolPanelLabel { - //padding-top: 10px; - //padding-bottom: 5px; + padding-top: 10px; + padding-bottom: 5px; font-weight: bold; color: gray; text-transform: uppercase; @@ -1686,8 +1690,15 @@ div.toolTitleNoSection { - padding-bottom: 0px; + padding-bottom: 5px; font-weight: bold; } +#tool-search { + padding-top: 5px; + padding-bottom: 10px; + position: relative; +} + + @import "base_sprites"; diff -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c -r 7274516136812ee0a84aa69f420348848d1b5b08 static/june_2007_style/blue/base.css --- a/static/june_2007_style/blue/base.css +++ b/static/june_2007_style/blue/base.css @@ -713,13 +713,16 @@ pre.peek{background:white;color:black;width:100%;font-size:10px;overflow:auto;}pre.peek th{color:white;background:#023858;} pre.peek table,pre.peek th,pre.peek tr,pre.peek td{font-family:Menlo,Monaco,"Courier New",monospace;font-size:10px;} .toolMenuContainer{color:#303030;background:#dfe5f9;margin-top:5px;} +.unified-panel-body>.toolMenu{padding:10px;} div.toolSectionPad{margin:0;padding:0;height:5px;font-size:0px;} +div.toolSectionWrapper{margin-bottom:5px;} div.toolSectionDetailsInner{margin-left:5px;margin-right:5px;} div.toolSectionTitle{font-weight:bold;} -div.toolPanelLabel{font-weight:bold;color:gray;text-transform:uppercase;} +div.toolPanelLabel{padding-top:10px;padding-bottom:5px;font-weight:bold;color:gray;text-transform:uppercase;} div.toolTitle{padding-top:5px;padding-bottom:5px;margin-left:16px;margin-right:10px;display:list-item;list-style:square outside;} div.toolSectionBody div.toolPanelLabel{padding-top:5px;padding-bottom:5px;margin-left:16px;margin-right:10px;display:list-item;list-style:none outside;} -div.toolTitleNoSection{padding-bottom:0px;font-weight:bold;} +div.toolTitleNoSection{padding-bottom:5px;font-weight:bold;} +#tool-search{padding-top:5px;padding-bottom:10px;position:relative;} .icon-button.display{background:url(history-buttons.png) no-repeat 0px 0px;} .icon-button.display:hover{background:url(history-buttons.png) no-repeat 0px -26px;} .icon-button.display_disabled{background:url(history-buttons.png) no-repeat 0px -52px;} diff -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c -r 7274516136812ee0a84aa69f420348848d1b5b08 static/june_2007_style/blue/tool_menu.css --- a/static/june_2007_style/blue/tool_menu.css +++ b/static/june_2007_style/blue/tool_menu.css @@ -1,4 +0,0 @@ -#tool-search{padding-top:5px;padding-bottom:10px;position:relative;} -div.toolSectionWrapper{margin-bottom:5px;} -div.toolPanelLabel{padding-top:10px;padding-bottom:5px;font-weight:bold;color:gray;text-transform:uppercase;} -div.toolTitleNoSection{padding-bottom:5px;font-weight:bold;} diff -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c -r 7274516136812ee0a84aa69f420348848d1b5b08 static/june_2007_style/tool_menu.css.tmpl --- a/static/june_2007_style/tool_menu.css.tmpl +++ b/static/june_2007_style/tool_menu.css.tmpl @@ -1,23 +0,0 @@ -#tool-search { - padding-top: 5px; - padding-bottom: 10px; - position: relative; -} - -div.toolSectionWrapper { - margin-bottom: 5px; -} - -div.toolPanelLabel { - padding-top: 10px; - padding-bottom: 5px; - font-weight: bold; - color: gray; - text-transform: uppercase; -} - -div.toolTitleNoSection -{ - padding-bottom: 5px; - font-weight: bold; -} \ No newline at end of file Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Fix for not showing hidden tools in tool panel.
by Bitbucket 09 Apr '12

09 Apr '12

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/changeset/2514a9fe8d40/ changeset: 2514a9fe8d40 user: dan date: 2012-04-09 20:26:11 summary: Fix for not showing hidden tools in tool panel. affected #: 3 files diff -r fb2f063768ee4aa59cff90680baa5ad9195f17cf -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -2292,6 +2292,11 @@ self.sa_session.flush() return primary_datasets + def _is_hidden_for_user( self, user ): + if self.hidden or ( not user and self.require_login ): + return True + return False + def to_dict( self, trans ): """ Return dict of tool attributes. """ @@ -2304,7 +2309,8 @@ return { 'type': 'tool', 'id': self.id, 'name': self.name, 'link': link, 'version': self.version, 'description': self.description, 'min_width': self.uihints.get( 'minwidth', -1 ), - 'target': self.target } + 'target': self.target, + 'hidden': self._is_hidden_for_user( trans.user ) } class DataSourceTool( Tool ): """ diff -r fb2f063768ee4aa59cff90680baa5ad9195f17cf -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c static/scripts/backbone/tools.js --- a/static/scripts/backbone/tools.js +++ b/static/scripts/backbone/tools.js @@ -230,6 +230,7 @@ var BaseView = Backbone.View.extend({ initialize: function() { this.model.on("change:hidden", this.update_visible, this); + this.update_visible(); }, update_visible: function() { ( this.model.attributes.hidden ? this.$el.hide() : this.$el.show() ); diff -r fb2f063768ee4aa59cff90680baa5ad9195f17cf -r 2514a9fe8d40e188f8964c5b838e6f46bdc4f66c static/scripts/packed/backbone/tools.js --- a/static/scripts/packed/backbone/tools.js +++ b/static/scripts/packed/backbone/tools.js @@ -1,1 +1,1 @@ -var BaseModel=Backbone.Model.extend({defaults:{name:null,hidden:false},show:function(){this.set("hidden",false)},hide:function(){this.set("hidden",true)},is_visible:function(){return !this.attributes.hidden}});var Tool=BaseModel.extend({defaults:{description:null,target:null,params:[]},apply_search_results:function(a){(_.indexOf(a,this.attributes.id)!==-1?this.show():this.hide());return this.is_visible()}});var ToolPanelLabel=BaseModel.extend({});var ToolPanelSection=BaseModel.extend({defaults:{elems:[],open:false},clear_search_results:function(){_.each(this.attributes.elems,function(a){a.show()});this.show();this.set("open",false)},apply_search_results:function(b){var c=true,a;_.each(this.attributes.elems,function(d){if(d instanceof ToolPanelLabel){a=d;a.hide()}else{if(d instanceof Tool){if(d.apply_search_results(b)){c=false;if(a){a.show()}}}}});if(c){this.hide()}else{this.show();this.set("open",true)}}});var ToolSearch=BaseModel.extend({defaults:{spinner_url:"",search_url:"",visible:true,query:"",results:null},initialize:function(){this.on("change:query",this.do_search)},do_search:function(){var c=this.attributes.query;if(c.length<3){this.set("results",null);return}var b=c+"*";if(this.timer){clearTimeout(this.timer)}$("#search-spinner").show();var a=this;this.timer=setTimeout(function(){$.get(a.attributes.search_url,{query:b},function(d){a.set("results",d);$("#search-spinner").hide()},"json")},200)}});var ToolPanel=Backbone.Collection.extend({url:"/tools",parse:function(a){var b=function(e){var d=e.type;if(d==="tool"){return new Tool(e)}else{if(d==="section"){var c=_.map(e.elems,b);e.elems=c;return new ToolPanelSection(e)}else{if(d==="label"){return new ToolPanelLabel(e)}}}};return _.map(a,b)},initialize:function(a){this.tool_search=a.tool_search;this.tool_search.on("change:results",this.apply_search_results,this)},clear_search_results:function(){this.each(function(a){if(a instanceof ToolPanelSection){a.clear_search_results()}else{a.show()}})},apply_search_results:function(){var b=this.tool_search.attributes.results;if(b===null){this.clear_search_results();return}var a=null;this.each(function(c){if(c instanceof ToolPanelLabel){a=c;a.hide()}else{if(c instanceof Tool){if(c.apply_search_results(b)){if(a){a.show()}}}else{a=null;c.apply_search_results(b)}}})}});var BaseView=Backbone.View.extend({initialize:function(){this.model.on("change:hidden",this.update_visible,this)},update_visible:function(){(this.model.attributes.hidden?this.$el.hide():this.$el.show())}});var ToolLinkView=BaseView.extend({tagName:"div",template:Handlebars.templates.tool_link,render:function(){this.$el.append(this.template(this.model.toJSON()));return this}});var ToolPanelLabelView=BaseView.extend({tagName:"div",className:"toolPanelLabel",template:Handlebars.templates.panel_label,render:function(){this.$el.append(this.template(this.model.toJSON()));return this},});var ToolPanelSectionView=BaseView.extend({tagName:"div",className:"toolSectionWrapper",template:Handlebars.templates.panel_section,initialize:function(){BaseView.prototype.initialize.call(this);this.model.on("change:open",this.update_open,this)},render:function(){this.$el.append(this.template(this.model.toJSON()));var a=this.$el.find(".toolSectionBody");_.each(this.model.attributes.elems,function(b){if(b instanceof Tool){var c=new ToolLinkView({model:b,className:"toolTitle"});c.render();a.append(c.$el)}else{if(b instanceof ToolPanelLabel){var d=new ToolPanelLabelView({model:b});d.render();a.append(d.$el)}else{}}});return this},events:{"click .toolSectionTitle > a":"toggle"},toggle:function(){this.model.set("open",!this.model.attributes.open)},update_open:function(){(this.model.attributes.open?this.$el.children(".toolSectionBody").slideDown("fast"):this.$el.children(".toolSectionBody").slideUp("fast"))}});var ToolSearchView=Backbone.View.extend({tagName:"div",id:"tool-search",className:"bar",template:Handlebars.templates.tool_search,events:{click:"focus_and_select","keyup :input":"query_changed"},render:function(){this.$el.append(this.template(this.model.toJSON()));if(!this.model.is_visible()){this.$el.hide()}return this},focus_and_select:function(){this.$el.find(":input").focus().select()},query_changed:function(){this.model.set("query",this.$el.find(":input").val())}});var ToolPanelView=Backbone.View.extend({tagName:"div",className:"toolMenu",initialize:function(a){this.collection.tool_search.on("change:results",this.handle_search_results,this)},render:function(){var b=this.$el;var a=new ToolSearchView({model:this.collection.tool_search});a.render();b.append(a.$el);this.collection.each(function(d){if(d instanceof ToolPanelSection){var c=new ToolPanelSectionView({model:d});c.render();b.append(c.$el)}else{if(d instanceof Tool){var e=new ToolLinkView({model:d,className:"toolTitleNoSection"});e.render();b.append(e.$el)}else{if(d instanceof ToolPanelLabel){var f=new ToolPanelLabelView({model:d});f.render();b.append(f.$el)}}}});return this},handle_search_results:function(){var a=this.collection.tool_search.attributes.results;if(a&&a.length===0){$("#search-no-results").show()}else{$("#search-no-results").hide()}}}); \ No newline at end of file +var BaseModel=Backbone.Model.extend({defaults:{name:null,hidden:false},show:function(){this.set("hidden",false)},hide:function(){this.set("hidden",true)},is_visible:function(){return !this.attributes.hidden}});var Tool=BaseModel.extend({defaults:{description:null,target:null,params:[]},apply_search_results:function(a){(_.indexOf(a,this.attributes.id)!==-1?this.show():this.hide());return this.is_visible()}});var ToolPanelLabel=BaseModel.extend({});var ToolPanelSection=BaseModel.extend({defaults:{elems:[],open:false},clear_search_results:function(){_.each(this.attributes.elems,function(a){a.show()});this.show();this.set("open",false)},apply_search_results:function(b){var c=true,a;_.each(this.attributes.elems,function(d){if(d instanceof ToolPanelLabel){a=d;a.hide()}else{if(d instanceof Tool){if(d.apply_search_results(b)){c=false;if(a){a.show()}}}}});if(c){this.hide()}else{this.show();this.set("open",true)}}});var ToolSearch=BaseModel.extend({defaults:{spinner_url:"",search_url:"",visible:true,query:"",results:null},initialize:function(){this.on("change:query",this.do_search)},do_search:function(){var c=this.attributes.query;if(c.length<3){this.set("results",null);return}var b=c+"*";if(this.timer){clearTimeout(this.timer)}$("#search-spinner").show();var a=this;this.timer=setTimeout(function(){$.get(a.attributes.search_url,{query:b},function(d){a.set("results",d);$("#search-spinner").hide()},"json")},200)}});var ToolPanel=Backbone.Collection.extend({url:"/tools",parse:function(a){var b=function(e){var d=e.type;if(d==="tool"){return new Tool(e)}else{if(d==="section"){var c=_.map(e.elems,b);e.elems=c;return new ToolPanelSection(e)}else{if(d==="label"){return new ToolPanelLabel(e)}}}};return _.map(a,b)},initialize:function(a){this.tool_search=a.tool_search;this.tool_search.on("change:results",this.apply_search_results,this)},clear_search_results:function(){this.each(function(a){if(a instanceof ToolPanelSection){a.clear_search_results()}else{a.show()}})},apply_search_results:function(){var b=this.tool_search.attributes.results;if(b===null){this.clear_search_results();return}var a=null;this.each(function(c){if(c instanceof ToolPanelLabel){a=c;a.hide()}else{if(c instanceof Tool){if(c.apply_search_results(b)){if(a){a.show()}}}else{a=null;c.apply_search_results(b)}}})}});var BaseView=Backbone.View.extend({initialize:function(){this.model.on("change:hidden",this.update_visible,this);this.update_visible()},update_visible:function(){(this.model.attributes.hidden?this.$el.hide():this.$el.show())}});var ToolLinkView=BaseView.extend({tagName:"div",template:Handlebars.templates.tool_link,render:function(){this.$el.append(this.template(this.model.toJSON()));return this}});var ToolPanelLabelView=BaseView.extend({tagName:"div",className:"toolPanelLabel",template:Handlebars.templates.panel_label,render:function(){this.$el.append(this.template(this.model.toJSON()));return this},});var ToolPanelSectionView=BaseView.extend({tagName:"div",className:"toolSectionWrapper",template:Handlebars.templates.panel_section,initialize:function(){BaseView.prototype.initialize.call(this);this.model.on("change:open",this.update_open,this)},render:function(){this.$el.append(this.template(this.model.toJSON()));var a=this.$el.find(".toolSectionBody");_.each(this.model.attributes.elems,function(b){if(b instanceof Tool){var c=new ToolLinkView({model:b,className:"toolTitle"});c.render();a.append(c.$el)}else{if(b instanceof ToolPanelLabel){var d=new ToolPanelLabelView({model:b});d.render();a.append(d.$el)}else{}}});return this},events:{"click .toolSectionTitle > a":"toggle"},toggle:function(){this.model.set("open",!this.model.attributes.open)},update_open:function(){(this.model.attributes.open?this.$el.children(".toolSectionBody").slideDown("fast"):this.$el.children(".toolSectionBody").slideUp("fast"))}});var ToolSearchView=Backbone.View.extend({tagName:"div",id:"tool-search",className:"bar",template:Handlebars.templates.tool_search,events:{click:"focus_and_select","keyup :input":"query_changed"},render:function(){this.$el.append(this.template(this.model.toJSON()));if(!this.model.is_visible()){this.$el.hide()}return this},focus_and_select:function(){this.$el.find(":input").focus().select()},query_changed:function(){this.model.set("query",this.$el.find(":input").val())}});var ToolPanelView=Backbone.View.extend({tagName:"div",className:"toolMenu",initialize:function(a){this.collection.tool_search.on("change:results",this.handle_search_results,this)},render:function(){var b=this.$el;var a=new ToolSearchView({model:this.collection.tool_search});a.render();b.append(a.$el);this.collection.each(function(d){if(d instanceof ToolPanelSection){var c=new ToolPanelSectionView({model:d});c.render();b.append(c.$el)}else{if(d instanceof Tool){var e=new ToolLinkView({model:d,className:"toolTitleNoSection"});e.render();b.append(e.$el)}else{if(d instanceof ToolPanelLabel){var f=new ToolPanelLabelView({model:d});f.render();b.append(f.$el)}}}});return this},handle_search_results:function(){var a=this.collection.tool_search.attributes.results;if(a&&a.length===0){$("#search-no-results").show()}else{$("#search-no-results").hide()}}}); \ No newline at end of file Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0