November 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 3002: Upgrade to Routes 1.11
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/5a9b6c39d173 changeset: 3002:5a9b6c39d173 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 13:49:34 2009 -0500 description: Upgrade to Routes 1.11 diffstat: eggs.ini | 4 ++-- 1 files changed, 2 insertions(+), 2 deletions(-) diffs (21 lines): diff -r c146726d274f -r 5a9b6c39d173 eggs.ini --- a/eggs.ini Tue Nov 10 13:47:34 2009 -0500 +++ b/eggs.ini Tue Nov 10 13:49:34 2009 -0500 @@ -40,7 +40,7 @@ Paste = 1.5.1 PasteDeploy = 1.3.1 PasteScript = 1.3.6 -Routes = 1.6.3 +Routes = 1.11 simplejson = 1.5 SQLAlchemy = 0.5.6 sqlalchemy_migrate = 0.5.4 @@ -90,7 +90,7 @@ PasteDeploy = http://cheeseshop.python.org/packages/source/P/PasteDeploy/PasteDeploy-1.3.… PasteScript = http://cheeseshop.python.org/packages/source/P/PasteScript/PasteScript-1.3.… PSI = http://pypi.python.org/packages/source/P/PSI/PSI-0.3b1.1.tar.gz -Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.6.3.tar.gz +Routes = http://pypi.python.org/packages/source/R/Routes/Routes-1.11.tar.gz simplejson = http://cheeseshop.python.org/packages/source/s/simplejson/simplejson-1.5.ta… SQLAlchemy = http://pypi.python.org/packages/source/S/SQLAlchemy/SQLAlchemy-0.5.6.tar.gz sqlalchemy_migrate = http://pypi.python.org/packages/source/s/sqlalchemy-migrate/sqlalchemy-migr…

1 0

[hg] galaxy 2996: Don't display diff during tests if it contains...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/461407cd7013 changeset: 2996:461407cd7013 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 10:10:29 2009 -0500 description: Don't display diff during tests if it contains non-ascii characters diffstat: test/base/twilltestcase.py | 4 ++++ 1 files changed, 4 insertions(+), 0 deletions(-) diffs (14 lines): diff -r 9f485a539bfb -r 461407cd7013 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Mon Nov 09 23:00:55 2009 -0500 +++ b/test/base/twilltestcase.py Tue Nov 10 10:10:29 2009 -0500 @@ -59,6 +59,10 @@ diff_slice[6].startswith( '-/CreationDate' ) and diff_slice[7].startswith( '-/ModDate' ) \ and diff_slice[8].startswith( '+/CreationDate' ) and diff_slice[9].startswith( '+/ModDate' ): return True + for line in diff_slice: + for char in line: + if ord( char ) > 128: + raise AssertionError( "Binary data detected, not displaying diff" ) raise AssertionError( "".join( diff_slice ) ) return True

1 0

[hg] galaxy 2997: Add env var to set metadata externally during ...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ee382d1c63b7 changeset: 2997:ee382d1c63b7 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Nov 10 11:20:04 2009 -0500 description: Add env var to set metadata externally during tests diffstat: scripts/functional_tests.py | 4 ++++ 1 files changed, 4 insertions(+), 0 deletions(-) diffs (21 lines): diff -r 461407cd7013 -r ee382d1c63b7 scripts/functional_tests.py --- a/scripts/functional_tests.py Tue Nov 10 10:10:29 2009 -0500 +++ b/scripts/functional_tests.py Tue Nov 10 11:20:04 2009 -0500 @@ -71,6 +71,9 @@ default_cluster_job_runner = os.environ['GALAXY_TEST_DEF_RUNNER'] else: default_cluster_job_runner = 'local:///' + set_metadata_externally = False + if 'GALAXY_SET_METADATA_EXTERNALLY' in os.environ: + set_metadata_externally = True print "Database connection:", database_connection @@ -104,6 +107,7 @@ admin_users = 'test(a)bx.psu.edu', library_import_dir = galaxy_test_file_dir, user_library_import_dir = os.path.join( galaxy_test_file_dir, 'users' ), + set_metadata_externally = set_metadata_externally, global_conf = { "__file__": "universe_wsgi.ini.sample" } ) log.info( "Embedded Universe application started" );

1 0

[hg] galaxy 3000: More grid-page integation work. Cleaned up cla...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/facf315d9e0e changeset: 3000:facf315d9e0e user: jeremy goecks <jeremy.goecks at emory.edu> date: Tue Nov 10 13:46:53 2009 -0500 description: More grid-page integation work. Cleaned up clause generation in grid columns and finalized search for pages grid. diffstat: lib/galaxy/web/controllers/page.py | 19 ++++++++++--------- lib/galaxy/web/framework/helpers/grids.py | 32 ++++++++++++++++++-------------- templates/grid_common.mako | 17 +++++++++++++++-- 3 files changed, 43 insertions(+), 25 deletions(-) diffs (160 lines): diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/controllers/page.py --- a/lib/galaxy/web/controllers/page.py Tue Nov 10 13:06:20 2009 -0500 +++ b/lib/galaxy/web/controllers/page.py Tue Nov 10 13:46:53 2009 -0500 @@ -12,30 +12,31 @@ else: return "" -class PublicURLColumn( grids.GridColumn ): +class PublicURLColumn( grids.TextColumn ): def get_value( self, trans, grid, item ): - username = trans.user.username or "???" + username = item.user.username or "???" return username + "/" + item.slug def get_link( self, trans, grid, item ): - if trans.user.username: + if item.user.username: return dict( action='display_by_username_and_slug', username=item.user.username, slug=item.slug ) else: return None -class OwnerColumn( grids.GridColumn ): +class OwnerColumn( grids.TextColumn ): def get_value( self, trans, grid, item ): return item.user.username class PageListGrid( grids.Grid ): # Grid definition use_panels = True - title = "Your pages" + title = "Pages" model_class = model.Page + default_filter = { "published" : "All"} default_sort_key = "-create_time" columns = [ grids.TextColumn( "Title", key="title", model_class=model.Page, attach_popup=True, filterable="standard" ), PublicURLColumn( "Public URL" ), - grids.GridColumn( "Published", key="published", format=format_bool, filterable="advanced" ), + grids.GridColumn( "Published", key="published", format=format_bool, filterable="standard" ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), ] @@ -56,13 +57,13 @@ class PageAllPublishedGrid( grids.Grid ): # Grid definition use_panels = True - title = "Published pages from all users" + title = "Published Pages From All Users" model_class = model.Page default_sort_key = "-create_time" columns = [ - grids.GridColumn( "Title", key="title" ), + grids.TextColumn( "Title", model_class=model.Page, key="title", filterable="standard" ), PublicURLColumn( "Public URL" ), - OwnerColumn( "Published by" ), + OwnerColumn( "Published by", model_class=model.User, key="username" ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), ] diff -r 7698e2ecca3e -r facf315d9e0e lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:06:20 2009 -0500 +++ b/lib/galaxy/web/framework/helpers/grids.py Tue Nov 10 13:46:53 2009 -0500 @@ -21,6 +21,7 @@ columns = [] operations = [] standard_filters = [] + # Any columns that are filterable (either standard or advanced) should have a default value set in the default filter. default_filter = {} default_sort_key = None preserve_state = False @@ -320,10 +321,10 @@ if isinstance( column_filter, basestring ): return func.lower( model_class_key_field ).like( "%" + column_filter.lower() + "%" ) elif isinstance( column_filter, list ): - composite_filter = True + clause_list = [] for filter in column_filter: - composite_filter = and_( composite_filter, func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) ) - return composite_filter + clause_list.append( func.lower( model_class_key_field ).like( "%" + filter.lower() + "%" ) ) + return and_( *clause_list ) # Generic column that supports tagging. class TagsColumn( TextColumn ): @@ -353,15 +354,15 @@ # Collapse list of tags into a single string; this is redundant but effective. TODO: fix this by iterating over tags. column_filter = ",".join( column_filter ) raw_tags = tag_handler.parse_tags( column_filter.encode("utf-8") ) - filter = True + clause_list = [] for name, value in raw_tags.items(): if name: # Search for tag names. - filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) ) + clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_tname ).like( "%" + name.lower() + "%" ) ) ) if value: # Search for tag values. - filter = and_( filter, self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) ) - return filter + clause_list.append( self.model_class.tags.any( func.lower( self.model_tag_association_class.user_value ).like( "%" + value.lower() + "%" ) ) ) + return and_( *clause_list ) # Column that performs multicolumn filtering. class MulticolFilterColumn( TextColumn ): @@ -373,17 +374,20 @@ if column_filter == "All": return query if isinstance( column_filter, list): - composite_filter = True + clause_list = [] for filter in column_filter: - part_composite_filter = False + part_clause_list = [] for column in self.cols_to_filter: - part_composite_filter = or_( part_composite_filter, column.get_filter( filter ) ) - composite_filter = and_( composite_filter, part_composite_filter ) + part_clause_list.append( column.get_filter( filter ) ) + clause_list.append( or_( *part_clause_list ) ) + complete_filter = and_( *clause_list ) else: - composite_filter = False + clause_list = [] for column in self.cols_to_filter: - composite_filter = or_( composite_filter, column.get_filter( column_filter ) ) - return query.filter( composite_filter ) + clause_list.append( column.get_filter( column_filter ) ) + complete_filter = or_( *clause_list ) + + return query.filter( complete_filter ) class GridOperation( object ): def __init__( self, label, key=None, condition=None, allow_multiple=True, allow_popup=True, target=None, url_args=None ): diff -r 7698e2ecca3e -r facf315d9e0e templates/grid_common.mako --- a/templates/grid_common.mako Tue Nov 10 13:06:20 2009 -0500 +++ b/templates/grid_common.mako Tue Nov 10 13:46:53 2009 -0500 @@ -86,10 +86,23 @@ </table> </td> <td> + ## Clear the standard search. ##| ##<% filter_all = GridColumnFilter( "", { column.key : "All" } ) %> - ##<a href="${url( filter_all.get_url_args() )}">Clear All</a> - | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a> + ##<a href="${url( filter_all.get_url_args() )}">Clear All</a> + + ## Only show advanced search if there are filterable columns. + <% + show_advanced_search = False + for column in grid.columns: + if column.filterable == "advanced": + show_advanced_search = True + break + endif + %> + %if show_advanced_search: + | <a href="" onclick="javascript:$('#more-search-options').slideToggle('fast');return false;">Advanced Search</a> + %endif </td> </tr></table> </div>

1 0

[hg] galaxy 2998: Fixed a bug in the view requesttype page.
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e2420f742a0a changeset: 2998:e2420f742a0a user: rc date: Tue Nov 10 12:35:00 2009 -0500 description: Fixed a bug in the view requesttype page. Now barcodes are visible in the request details page itself. diffstat: lib/galaxy/web/controllers/requests_admin.py | 12 ++++++------ templates/admin/requests/show_request.mako | 8 ++++---- templates/admin/requests/view_request_type.mako | 2 +- test/functional/test_forms_and_requests.py | 5 +++-- 4 files changed, 14 insertions(+), 13 deletions(-) diffs (112 lines): diff -r ee382d1c63b7 -r e2420f742a0a lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 11:20:04 2009 -0500 +++ b/lib/galaxy/web/controllers/requests_admin.py Tue Nov 10 12:35:00 2009 -0500 @@ -1034,10 +1034,11 @@ event = trans.app.model.SampleEvent(s, new_state, 'Bar code added to this sample') event.flush() return trans.response.send_redirect( web.url_for( controller='requests_admin', - action='bar_codes', - request_id=request.id, - msg='Bar codes have been saved for this request', - messagetype='done')) + action='list', + operation='show_request', + id=trans.security.encode_id(request.id), + message='Bar codes have been saved for this request', + status='done')) def __set_request_state(self, request): # check if all the samples of the current request are in the final state @@ -1183,11 +1184,10 @@ messagetype='done') ) elif params.get('view', False): rt = trans.sa_session.query( trans.app.model.RequestType ).get( int( util.restore_text( params.id ) ) ) - ss_list = trans.sa_session.query( trans.app.model.SampleState ).filter( trans.app.model.SampleState.table.c.request_type_id == rt.id ) return trans.fill_template( '/admin/requests/view_request_type.mako', request_type=rt, forms=get_all_forms( trans ), - states_list=ss_list, + states_list=rt.states, deleted=False, show_deleted=False, msg=msg, diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Tue Nov 10 11:20:04 2009 -0500 +++ b/templates/admin/requests/show_request.mako Tue Nov 10 12:35:00 2009 -0500 @@ -1,12 +1,10 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> - %if msg: ${render_msg( msg, messagetype )} %endif - <div class="grid-header"> <h2>Sequencing Request "${request.name}"</h2> </div> @@ -44,6 +42,8 @@ </td> <td> </td> + <td> + </td> %else: <td> ${sample_name} @@ -80,11 +80,10 @@ ${sample.name} </td> %if grid_index == 0: + <td>${sample.bar_code}</td> <td> %if sample.request.unsubmitted(): Unsubmitted - %elif not sample.current_state(): - New %else: <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> %endif @@ -150,6 +149,7 @@ <th>No.</th> <th>Sample Name</th> %if grid_index == 0: + <th>Barcode</th> <th>State</th> %endif %for index, field in fields_dict.items(): diff -r ee382d1c63b7 -r e2420f742a0a templates/admin/requests/view_request_type.mako --- a/templates/admin/requests/view_request_type.mako Tue Nov 10 11:20:04 2009 -0500 +++ b/templates/admin/requests/view_request_type.mako Tue Nov 10 12:35:00 2009 -0500 @@ -36,7 +36,7 @@ <label> Possible states </label> - %for element_count, state in enumerate(states_list.all()): + %for element_count, state in enumerate(states_list): <div class="form-row"> <label>${1+element_count}. ${state.name}</label> ${state.desc} diff -r ee382d1c63b7 -r e2420f742a0a test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Tue Nov 10 11:20:04 2009 -0500 +++ b/test/functional/test_forms_and_requests.py Tue Nov 10 12:35:00 2009 -0500 @@ -245,7 +245,7 @@ self.check_page_for_string( request_one.name ) assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" \ % ( request_one.name, request_one.states.COMPLETE ) - def test_40_admin_create_request_on_behalf_of_regular_user( self ): + def test_040_admin_create_request_on_behalf_of_regular_user( self ): """Testing creating and submitting a request as an admin on behalf of a regular user""" self.logout() self.login( email='test(a)bx.psu.edu' ) @@ -288,7 +288,8 @@ self.visit_url( '%s/requests_admin/list?show_filter=All' % self.url ) self.check_page_for_string( request_one.name ) self.check_page_for_string( request_two.name ) - def test_45_reject_request( self ): + def test_045_reject_request( self ): + '''Testing rejecting a request''' self.logout() self.login( email='test(a)bx.psu.edu' ) self.reject_request( request_two.id, request_two.name )

1 0

[hg] galaxy 2999: Fixed megablast_wrapper test to use phiX datab...
by Greg Von Kuster 12 Nov '09

12 Nov '09

details: http://www.bx.psu.edu/hg/galaxy/rev/7698e2ecca3e changeset: 2999:7698e2ecca3e user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Tue Nov 10 13:06:20 2009 -0500 description: Fixed megablast_wrapper test to use phiX database and modified parameter passing to use named parameters diffstat: test-data/megablast_wrapper_test1.fa | 200 +++------------------------------ test-data/megablast_wrapper_test1.out | 123 +++----------------- tools/metag_tools/megablast_wrapper.py | 35 ++++- tools/metag_tools/megablast_wrapper.xml | 14 ++- 4 files changed, 78 insertions(+), 294 deletions(-) diffs (446 lines): diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.fa --- a/test-data/megablast_wrapper_test1.fa Tue Nov 10 12:35:00 2009 -0500 +++ b/test-data/megablast_wrapper_test1.fa Tue Nov 10 13:06:20 2009 -0500 @@ -1,200 +1,40 @@ >0_0.666667 -CGGACAGCGCCGCCACCAACAAAGCCACCA +GAGTTTTATCGCTTCCATGACGCAGAAGTT >1_0.600000 -AAAACACCGGATGCTCCGGCGCTGGCAGAT +AACACTTTCGGATATTTCTGATGAGTCGAA >2_0.400000 -TTTGCTTTTAGTACACCGGATTCAGAACCA +AGCAGGAATTACTACTGCTTGTTTACGAAT >3_0.566667 -CCGTCCCCATGAATACACCTTTCTGGACGG +TAAATCGAAGTGGACTGCTGGCGGAAAATG >4_0.766667 -CACGCTACGTGCGCCCCCGCCCAGAAGGCG +TCCTTGCGCAGCTCGAGAAGCTCTTACTTT >5_0.533333 -AAACAAAACCCGCCGAAGCGGGTTAAGTGC +GCGACCTTTCGCCATCAACTAACGATTCTG >6_0.533333 -TAAGCCGTTACTGGCAGCAAGTGCAGGCAA +TTGGATGAGGAGAAGTGGCTTAATATGCTT >7_0.400000 -TGAATTTACCGTTATCTATCTTGCCTGCCT +GGCACGTTCGTCAAGGACTGGTTTAGATAT >8_0.500000 -TTAGCGGGAATAAAACAGGCTGTCAGCCAG +CATGGTAGAGATTCTCTTGTTGACATTTTA >9_0.400000 -GCGTTTTGCTAAACTTCTGCCGGAATATAA +AAAGAGCGTGGATTACTATCTGAGTCCGAT >10_0.500000 -AAAGAGGCGAGCAGAGTAAAACGCAGGCAA +ATAGGTAAGAAATCATGAGTCAAGTTACTG >11_0.533333 -CAAAAGCAGAGTCTGTTGACCCATACGCGC +AACAATCCGTACGTTTCCAGACCGCTTTGG >12_0.700000 -GCGGACGATCTTCACGGTCGCCACGCGGAC +TTCAGGCTTCTGCCGTTTTGGATTTAACCG >13_0.533333 -TTCTTGTTGGATGGCATACTCCGGCAGCCA +AAGATGATTTCGATTTTCTGACGAGTAACA >14_0.666667 -ACCCCGATATCGTCGCAGGCGTTGCCGCAC +CTGACCGCTCTCGTGCTCGTCGCTGCGTTG >15_0.666667 -GGCTGCTGTCTCCGCTGGAAGAGGCGCTTC +AGGCTTGCGTTTATGGTACGCTGGACTTTG >16_0.566667 -ATGTCCTGATCGAGCGGCGTTTTACCGACC +TTCCTGCTCCTGTTGAGTTTATTGCTGCCG >17_0.533333 -GGTGTTGAGTGTCCAGGTAATACGCTCTCG +TCATTGCTTATTATGTTCATCCCGTCAACA >18_0.566667 -GTGGTCTCAAGCCCAAAGGAAGAGTGAGGC +TCATCATGGAAGGCGCTGAATTTACGGAAA >19_0.566667 -GTTGTAAGCGTCAGAACCGATGCGGTCGGT ->20_0.566667 -CGACATCCTGTAGGCTGGCTTCAATGCGAC ->21_0.733333 -GGGAAGGCTGACGGGCGTCCACACCACGGC ->22_0.566667 -CGGTATTCCTCAGTTCTCGCTGCATGCCTG ->23_0.600000 -TTGCCGTTACGCACCACGCCTTCAGTAGCG ->24_0.733333 -CGCGGGCGCACCACGTCGCTGCTGCTGTTC ->25_0.266667 -TTTTGGGAAAACTAAATACGCATCAAAAAT ->26_0.566667 -CAACGAGGCGCTACCGAGTTGTTCAATGCG ->27_0.600000 -TTACCGAGGCCAGAACCGATACCACGACCC ->28_0.666667 -CGCTCAATCTGCTCGCGCCTGGCTGGCGTT ->29_0.700000 -CTCGTCCGGCGGGCGGTTTTGCCGACAAGG ->30_0.233333 -GGAAATTGTACAATAGAAAAATTACTGTAT ->31_0.533333 -GTGCTGAACTGTTCCACGACCATGGAGATG ->32_0.600000 -TGAGGATGGTCCTCTGACTCTGCAGGCGCA ->33_0.300000 -TAGTAACCCTTTAATAAGATTGTCGATTAG ->34_0.533333 -TGATGTTAAATGCATGGCACCTGCCGGTGC ->35_0.466667 -ACTGCTTTGCCGAGATATTCGAGGTTAACC ->36_0.433333 -TGTTGGCAACATGGCGAGCGTAATCAATTA ->37_0.366667 -ACTTCGTCAGTAAGGATGAGATTAGCAAAT ->38_0.533333 -GCAGCAGGATCGGATCGAACTCTGGTTTCT ->39_0.400000 -TAATGCGGCATTCTCCTGATTTATTGTCAC ->40_0.400000 -AGCGTAATGATAATCGCTATCACTGCGATT ->41_0.566667 -AGCTGACGGTCAGCAGGGATACTTCCTGCA ->42_0.566667 -GCAGTGACTACATCCGCGAGGTGAATGTGG ->43_0.466667 -GCTTTTTCCAGCATCAACGCCACTGAACAA ->44_0.433333 -AAAGTGGTAGATAACGTGGTGCAGACTATG ->45_0.500000 -TTCCTGATACCGGATGACCTTATCGCGGAT ->46_0.466667 -ACCTGTACCCCAGGACCATGGTACATTTAT ->47_0.533333 -ACAATGCAACCAGACCAGCCCGGATCGATA ->48_0.500000 -GGGTAACCAGCTGATGATGGCCATTAACCT ->49_0.433333 -CGTTATACGGAACAACATTTAACTCCAGCG ->50_0.466667 -TTGCTGTTGCCATCGCTTTTCAGGACATAC ->51_0.533333 -CGACGGTATCGGTACGCAGATTGTGATGGA ->52_0.366667 -ATGAGCATCAACATCGAAATCTCAAACCAA ->53_0.533333 -CCAGGCACTCCGCCATATTTTTGCCATGAC ->54_0.400000 -GTATTCTTCATTGATTTGTAAGCGGGTACC ->55_0.466667 -AAGCGCTGTTCAACATAAATTGGCTGACGG ->56_0.433333 -AACCGTCAGCTCTTTACGCAATATTTTGCC ->57_0.566667 -CGCGAAATCCTCGACGTCCAGGCACGTATT ->58_0.300000 -GTTATCCATTAAAATAGATCGGATCGATAT ->59_0.300000 -AAAATCTGCATATCATGATAAGAGTGGTTA ->60_0.533333 -AATCTGGCGAATGCTGATAGCGTGACCGGT ->61_0.366667 -TCAGTTTGAAAGCTTTGTCAGCCGTTTTTT ->62_0.366667 -AATCCTAAACCTAGGAATGCCAGAATATCT ->63_0.566667 -TCACGCTCGCAGTCAAGCTGGCTTATGCCA ->64_0.500000 -GAGATGACGGTTGCAGAGTCATGCGTTTGA ->65_0.533333 -TCTGGATCACGCGCAAACACTGGCTATCGT ->66_0.466667 -TCTGCTTTAGCAAACAGAGTGTGGTCACGA ->67_0.400000 -GCCTTTTGTCTGATCATCCACAATAATGAC ->68_0.566667 -GAAGGATAGTTGGTCAGCAACACCAGCGGC ->69_0.733333 -GGCGCGCTGTCGGCCACGGCGAAATCGACC ->70_0.466667 -TGGTGTTCAGCATCTCAACGGTAATTCGCT ->71_0.533333 -CAGGATGCAAACTGCCGGGAGATCCAGTTA ->72_0.533333 -AACTGGAAGGGCTTGGGATGACACAACAGC ->73_0.500000 -TTTAAGCGCCAACCAGGCTTCTTTGGTTGC ->74_0.433333 -ACCCTTCTTTCGCCATATCAAACTGATGTC ->75_0.533333 -ATAACCCTCTGCAACCGCCGCTTCAGCAAA ->76_0.600000 -TGAAGCCGTACAACGGGCGCTGGAATTCGC ->77_0.700000 -GAGCTGCAACGCGGTCAGCCAGCTGGCGGT ->78_0.566667 -CGGAGTATCCGTTCCCCAACGACAAGCATC ->79_0.500000 -AATACCGGGAAGAGACAACGGGGTCTCTTT ->80_0.500000 -TAATGACAGGGTTGCGAAGCCCTGATTCTC ->81_0.433333 -ATTAATGTTGCCGGCACAACATAATAGGGC ->82_0.500000 -ACTGGGTTGCTCTGAACAAGAAAGGCGCTA ->83_0.533333 -CGCCAGGGACGTATCGCGTCGATATCTATT ->84_0.533333 -TGCTCGTTCCCGTCGTGATGAAGCTCGAAA ->85_0.500000 -AGGAAAGCAAACAACACGACCACCATCAGC ->86_0.566667 -GGCAACGCAGGCGCATGATTCTGCTTGGAA ->87_0.433333 -CGCTGGATGAAAANCGTGAATATCACACCA ->88_0.533333 -CGTACCGGGCTGAAAGTAGAAGAGCGTTTC ->89_0.466667 -ATTAAAAAACAGGCGGTGCGTTTTCCCTGG ->90_0.466667 -ATCACCGTTTCGCTAACCGGTACGTTTAAC ->91_0.566667 -TTCGCCCGGCAAGCTTACCCAACGCTTATC ->92_0.533333 -TTTTCCCCGCCGTTAGTAGCGACTGCAGTT ->93_0.400000 -TTATTTGCCCGATGAGTCAGTTTATTGCAG ->94_0.466667 -CCACGGTGATATCTGGTGCCATACTGATAA ->95_0.466667 -TCCCCCGTAAGGCCTTTCTTTTTCTTTCGT ->96_0.533333 -TTGCCGGGAAGAGAGATATCAATGGCAGGC ->97_0.566667 -TGCGCCGCCGGATTGTTGCTCAACATGCTT ->98_0.366667 -AACGCGCTAACCGCCAATAATAACAAAATT ->99_0.366667 -TAAGAGTTTATTCATGATGTCATCCTGCGA +ACATTATTAATGGCGTCGAGCGTCCGGTTA \ No newline at end of file diff -r e2420f742a0a -r 7698e2ecca3e test-data/megablast_wrapper_test1.out --- a/test-data/megablast_wrapper_test1.out Tue Nov 10 12:35:00 2009 -0500 +++ b/test-data/megablast_wrapper_test1.out Tue Nov 10 13:06:20 2009 -0500 @@ -1,103 +1,20 @@ -0_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5436010 5436039 8e-11 60.0 -1_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 696993 697022 8e-11 60.0 -2_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4100018 4100047 8e-11 60.0 -3_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2305873 2305844 8e-11 60.0 -4_0.766667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3457901 3457930 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1264160 1264131 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1636514 1636485 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2318694 2318723 8e-11 60.0 -5_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2777043 2777072 8e-11 60.0 -6_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1185124 1185153 8e-11 60.0 -7_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2458203 2458232 8e-11 60.0 -9_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5286666 5286695 8e-11 60.0 -10_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2787672 2787701 8e-11 60.0 -12_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4116145 4116174 8e-11 60.0 -13_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5442351 5442380 8e-11 60.0 -14_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4626492 4626521 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 346897 346926 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1466565 1466536 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1750132 1750161 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1908046 1908075 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2279107 2279136 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2813407 2813436 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3939162 3939191 8e-11 60.0 -15_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4656510 4656539 8e-11 60.0 -16_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2595157 2595186 8e-11 60.0 -17_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 717743 717772 8e-11 60.0 -19_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1237938 1237967 8e-11 60.0 -20_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4792054 4792083 8e-11 60.0 -21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 269757 269786 8e-11 60.0 -21_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 274007 274036 8e-11 60.0 -22_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2706426 2706455 8e-11 60.0 -23_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1512107 1512136 8e-11 60.0 -24_0.733333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2032108 2032137 8e-11 60.0 -25_0.266667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1343811 1343840 8e-11 60.0 -26_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3112551 3112580 8e-11 60.0 -28_0.666667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4405442 4405471 8e-11 60.0 -29_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3600547 3600576 8e-11 60.0 -32_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1435670 1435699 8e-11 60.0 -33_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3788178 3788207 8e-11 60.0 -34_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 484499 484528 8e-11 60.0 -35_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2250064 2250093 8e-11 60.0 -36_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3698178 3698207 8e-11 60.0 -38_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4242501 4242530 8e-11 60.0 -39_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3683151 3683180 8e-11 60.0 -41_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 789086 789115 8e-11 60.0 -42_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1714771 1714800 8e-11 60.0 -43_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4272582 4272611 8e-11 60.0 -44_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5481023 5481052 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1271858 1271829 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1357981 1357952 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2310674 2310703 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2769319 2769348 8e-11 60.0 -45_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2991293 2991322 8e-11 60.0 -46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1080570 1080599 8e-11 60.0 -46_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1476177 1476206 8e-11 60.0 -47_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2887871 2887900 8e-11 60.0 -49_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4152853 4152882 8e-11 60.0 -50_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3568677 3568706 8e-11 60.0 -51_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3739788 3739817 8e-11 60.0 -52_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3789407 3789436 8e-11 60.0 -54_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3161991 3162020 8e-11 60.0 -55_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4384753 4384782 8e-11 60.0 -56_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2915787 2915816 8e-11 60.0 -57_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 294604 294633 8e-11 60.0 -58_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1553483 1553512 8e-11 60.0 -59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1351506 1351535 8e-11 60.0 -59_0.300000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2997487 2997458 8e-11 60.0 -61_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1987157 1987186 8e-11 60.0 -62_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1667830 1667859 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 231447 231418 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3516862 3516891 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4226650 4226679 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4808486 4808457 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4904764 4904735 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5048944 5048915 8e-11 60.0 -63_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5089951 5089922 8e-11 60.0 -64_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5440369 5440398 8e-11 60.0 -65_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3963858 3963887 8e-11 60.0 -66_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4142497 4142526 8e-11 60.0 -67_0.400000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3532236 3532265 8e-11 60.0 -68_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 779994 780023 8e-11 60.0 -70_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1317239 1317268 8e-11 60.0 -71_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5080463 5080492 8e-11 60.0 -72_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3605409 3605438 8e-11 60.0 -73_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3280815 3280844 8e-11 60.0 -75_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2230266 2230295 8e-11 60.0 -76_0.600000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 462631 462660 8e-11 60.0 -77_0.700000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 2939076 2939105 8e-11 60.0 -78_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5422053 5422082 8e-11 60.0 -79_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4387420 4387449 8e-11 60.0 -81_0.433333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1037150 1037179 8e-11 60.0 -82_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1182188 1182217 8e-11 60.0 -83_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 5430210 5430239 8e-11 60.0 -84_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 310995 311024 8e-11 60.0 -85_0.500000 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4174173 4174202 8e-11 60.0 -86_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 163690 163719 8e-11 60.0 -88_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3071785 3071814 8e-11 60.0 -90_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 692131 692160 8e-11 60.0 -91_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3307050 3307079 8e-11 60.0 -94_0.466667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 1813009 1813038 8e-11 60.0 -96_0.533333 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 573782 573811 8e-11 60.0 -97_0.566667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 3570563 3570592 8e-11 60.0 -98_0.366667 /depot/data2/galaxy/microbes/eschColi_O157H7EDL933_1/seq/chr.nib:1-5528445 100.00 30 0 0 1 30 4545136 4545165 8e-11 60.0 +0_0.666667 PHIX174 100.00 30 0 0 1 30 1 30 1e-13 60.0 +1_0.600000 PHIX174 100.00 30 0 0 1 30 31 60 1e-13 60.0 +2_0.400000 PHIX174 100.00 30 0 0 1 30 76 105 1e-13 60.0 +3_0.566667 PHIX174 100.00 30 0 0 1 30 106 135 1e-13 60.0 +4_0.766667 PHIX174 100.00 30 0 0 1 30 151 180 1e-13 60.0 +5_0.533333 PHIX174 100.00 30 0 0 1 30 181 210 1e-13 60.0 +6_0.533333 PHIX174 100.00 30 0 0 1 30 226 255 1e-13 60.0 +7_0.400000 PHIX174 100.00 30 0 0 1 30 256 285 1e-13 60.0 +8_0.500000 PHIX174 100.00 30 0 0 1 30 301 330 1e-13 60.0 +9_0.400000 PHIX174 100.00 30 0 0 1 30 331 360 1e-13 60.0 +10_0.500000 PHIX174 100.00 30 0 0 1 30 376 405 1e-13 60.0 +11_0.533333 PHIX174 100.00 30 0 0 1 30 406 435 1e-13 60.0 +12_0.700000 PHIX174 100.00 30 0 0 1 30 451 480 1e-13 60.0 +13_0.533333 PHIX174 100.00 30 0 0 1 30 481 510 1e-13 60.0 +14_0.666667 PHIX174 100.00 30 0 0 1 30 526 555 1e-13 60.0 +15_0.666667 PHIX174 100.00 30 0 0 1 30 556 585 1e-13 60.0 +16_0.566667 PHIX174 100.00 30 0 0 1 30 601 630 1e-13 60.0 +17_0.533333 PHIX174 100.00 30 0 0 1 30 631 660 1e-13 60.0 +18_0.566667 PHIX174 100.00 30 0 0 1 30 676 705 1e-13 60.0 +19_0.566667 PHIX174 100.00 30 0 0 1 30 706 735 1e-13 60.0 diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.py --- a/tools/metag_tools/megablast_wrapper.py Tue Nov 10 12:35:00 2009 -0500 +++ b/tools/metag_tools/megablast_wrapper.py Tue Nov 10 13:06:20 2009 -0500 @@ -1,9 +1,24 @@ #! /usr/bin/python """ run megablast for metagenomics data + +usage: %prog [options] + -d, --db_build=d: The database to use + -i, --input=i: Input FASTQ candidate file + -w, --word_size=w: Size of best perfect match + -c, --identity_cutoff=c: Report hits at or above this identity + -e, --eval_cutoff=e: Expectation value cutoff + -f, --filter_query=f: Filter out low complexity regions + -x, --index_dir=x: Data index directory + -o, --output=o: Output file + +usage: %prog db_build input_file word_size identity_cutoff eval_cutoff filter_query index_dir output_file """ import sys, os, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse assert sys.version_info[:2] >= ( 2, 4 ) @@ -12,16 +27,18 @@ sys.exit() def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) - db_build = sys.argv[1] - query_filename = sys.argv[2].strip() - output_filename = sys.argv[3].strip() - mega_word_size = sys.argv[4] # -W - mega_iden_cutoff = sys.argv[5] # -p - mega_evalue_cutoff = sys.argv[6] # -e + db_build = options.db_build + query_filename = options.input.strip() + output_filename = options.output.strip() + mega_word_size = options.word_size # -W + mega_iden_cutoff = options.identity_cutoff # -p + mega_evalue_cutoff = options.eval_cutoff # -e mega_temp_output = tempfile.NamedTemporaryFile().name - mega_filter = sys.argv[7] # -F - GALAXY_DATA_INDEX_DIR = sys.argv[8] + mega_filter = options.filter_query # -F + GALAXY_DATA_INDEX_DIR = options.index_dir DB_LOC = "%s/blastdb.loc" % GALAXY_DATA_INDEX_DIR # megablast parameters @@ -81,7 +98,7 @@ output.write( "%s\n" % new_line ) output.close() - os.unlink( mega_temp_output ) #remove the tempfile that we just reformated the contents of + os.unlink( mega_temp_output ) #remove the tempfile that we just reformatted the contents of if invalid_lines: print "Unable to parse %d lines. Keep the default format." % invalid_lines diff -r e2420f742a0a -r 7698e2ecca3e tools/metag_tools/megablast_wrapper.xml --- a/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 12:35:00 2009 -0500 +++ b/tools/metag_tools/megablast_wrapper.xml Tue Nov 10 13:06:20 2009 -0500 @@ -1,6 +1,16 @@ <tool id="megablast_wrapper" name="Megablast" version="1.0.0"> <description> compare short reads against nt and wgs databases</description> - <command interpreter="python">megablast_wrapper.py $source_select $input_query $output1 $word_size $iden_cutoff $evalue_cutoff $filter_query ${GALAXY_DATA_INDEX_DIR}</command> + <command interpreter="python"> + megablast_wrapper.py + --db_build=$source_select + --input=$input_query + --word_size=$word_size + --identity_cutoff=$iden_cutoff + --eval_cutoff=$evalue_cutoff + --filter_query=$filter_query + --index_dir=${GALAXY_DATA_INDEX_DIR} + --output=$output1 + </command> <inputs> <param name="input_query" type="data" format="fasta" label="Compare these sequences"/> <param name="source_select" type="select" display="radio" label="against target database"> @@ -29,7 +39,7 @@ <tests> <test> <param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/> - <param name="source_select" value="test" /> + <param name="source_select" value="phiX" /> <param name="word_size" value="28" /> <param name="iden_cutoff" value="99.0" /> <param name="evalue_cutoff" value="10.0" />

1 0

getting an error message while running Generate pileup tool in NGS: SAM
by Vipin TS 11 Nov '09

11 Nov '09

Hi all, I am trying to run 'Generate pileup' tool from NGS: SAM Tool tracks in local galaxy instance. I am getting the desired output and the job status ends with and error message. Here is the error message: An error occurred running this job: *cp: cannot stat `/home/galaxy/galaxy-2.1.2009/database/files/_metadata_files/000/metadata_4.dat': No such file or directory* I compared the result from my local instance with main galaxy server and there is no difference at all. Please let me know anything wrong in my side. Many thanks in advance, Vipin T S

2 2

large files
by Juan Perin 10 Nov '09

10 Nov '09

Uploading files through the browser, in our case, is ultimately unnecessary or inefficient. The data we get will be on the same machine hosting Galaxy. I'd like to be able to move data into a users workspace within the browser without having to use the browser. This is especially the case for very large FASTQ files that we're getting from NGS experiments. Is there a way to do this? I'm not finding much documentation on this matter, and it would greatly increase the utility of Galaxy for us. Thanks! Juan Perin

2 1

Samtools configuration
by juan perin 10 Nov '09

10 Nov '09

Hi again, I'm now stuck trying to get the samtools app's to work. I've finally gotten the bwa and bowtie tools to run an alignment, but my attempts to convert the resulting sam file to bam, using sam_to_bam fails. The error I get in the browser is: An error occurred running this job: *No sequences are available for 'hg18', request them by reporting this error.* The error, (after searching through the output for the command), seemed to suggest that I was missing an 'egg': This was the output: python /home/perin/galaxy-dist/tools/samtools/sam_to_bam.py --input1=/home/perin/galaxy-dist/database/files/000/dataset_70.dat --dbkey=hg18 --ref_file="None" --output1=/home/perin/galaxy-dist/database/files/000/dataset_72.dat --index_dir=/home/perin/galaxy-dist/tool-data Traceback (most recent call last): File "/home/perin/galaxy-dist/tools/samtools/sam_to_bam.py", line 17, in ? from galaxy import eggs ImportError: No module named galaxy I'm guessing I'm either missing a config parameter that tells samtools how to work, or that I need to scramble another egg. Not sure, however, and was hoping for some help. I can't seem to find anything on the web. Thanks in advance. Juan Perin

5 9

RPy dependency and paths
by SHAUN WEBB 10 Nov '09

10 Nov '09

Hi, we are trying to install a local version of Galaxy on a computing cluster using sge but there are a few issues with dependencies and setting paths. For instance we can get gsummary.py to run on the command line by manually setting PYTHONPATH to the RPy area, however within Galaxy the following error is returned: File "/exports/work/biology_cell_galaxy/galaxy/tools/stats/gsummary.py", line 4, in ? from rpy import * ImportError: No module named rpy Is there a preferred way to set the PYTHONPATH environment variable? I see references to it in setup_paths.sh, but I'm not sure when/if this gets run. It appears that the PYTHONPATH is ignored by setup.sh and by run.sh. run.sh calls python with environment disabled (-E). Even with -E removed the PYTHONPATH appears not to get through. The error is the same on the command line with PYTHONPATH undefined. It is clear the problem is getting Galaxy to respect the PYTHONPATH. Any help would be greatly appreciated. Thanks Shaun Webb -- The University of Edinburgh is a charitable body, registered in Scotland, with registration number SC005336.

3 2