August 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2646: add autocomplete_tagging.css.tmpl to templates...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/817c183aa633 changeset: 2646:817c183aa633 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:38:46 2009 -0400 description: add autocomplete_tagging.css.tmpl to templates list 1 file(s) affected in this change: static/june_2007_style/make_style.py diffs (13 lines): diff -r 6f43113ab087 -r 817c183aa633 static/june_2007_style/make_style.py --- a/static/june_2007_style/make_style.py Fri Aug 28 15:36:41 2009 -0400 +++ b/static/june_2007_style/make_style.py Fri Aug 28 15:38:46 2009 -0400 @@ -27,7 +27,8 @@ ( "history.css.tmpl", "history.css" ), ( "tool_menu.css.tmpl", "tool_menu.css" ), ( "iphone.css.tmpl", "iphone.css" ), - ( "reset.css.tmpl", "reset.css" ) ] + ( "reset.css.tmpl", "reset.css" ), + ( "autocomplete_tagging.css.tmpl", "autocomplete_tagging.css") ] images = [ ( "./gradient.py 9 30 $panel_header_bg_top - $panel_header_bg_bottom 0 0 $panel_header_bg_bottom 1 1", "panel_header_bg.png" ),

1 0

[hg] galaxy 2647: add tagging to histories
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/77dfb7834a94 changeset: 2647:77dfb7834a94 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:40:32 2009 -0400 description: add tagging to histories 1 file(s) affected in this change: templates/root/history.mako diffs (118 lines): diff -r 817c183aa633 -r 77dfb7834a94 templates/root/history.mako --- a/templates/root/history.mako Fri Aug 28 15:38:46 2009 -0400 +++ b/templates/root/history.mako Fri Aug 28 15:40:32 2009 -0400 @@ -14,8 +14,8 @@ <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <meta http-equiv="Pragma" content="no-cache"> -${h.css( "base", "history" )} -${h.js( "jquery", "json2", "jquery.jstore-all" )} +${h.css( "base", "history", "autocomplete_tagging" )} +${h.js( "jquery", "json2", "jquery.jstore-all", "jquery.autocomplete", "autocomplete_tagging" )} <script type="text/javascript"> $(function() { @@ -83,6 +83,93 @@ %endif %endfor }); + + // + // Set up autocomplete tagger. + // +<% + ## Build string of tag name, values. + tag_names_and_values = list() + for tag in history.tags: + tag_name = tag.user_tname + tag_value = "" + if tag.value is not None: + tag_value = tag.user_value + tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"") +%> + // + // Returns the number of keys (elements) in an array/dictionary. + // + var array_length = function(an_array) + { + if (an_array.length) + return an_array.length; + + var count = 0; + for (element in an_array) + count++; + return count; + }; + + // + // Function get text to display on the toggle link. + // + var get_toggle_link_text = function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + { + text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); + /* + // Show first N tags; hide the rest. + var max_to_show = 1; + + // Build tag string. + var tag_strs = new Array(); + var count = 0; + for (tag_name in tags) + { + tag_value = tags[tag_name]; + tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value); + if (++count == max_to_show) + break; + } + tag_str = tag_strs.join(", "); + + // Finalize text. + var num_tags_hiding = num_tags - max_to_show; + text = "Tags: " + tag_str + + (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : ""); + */ + } + else + { + // No tags. + text = "Add tags to this history"; + } + return text; + }; + + var options = + { + tags : {${", ".join(tag_names_and_values)}}, + get_toggle_link_text_fn: get_toggle_link_text, + input_size: 15, + tag_click_fn: function(tag) { /* Do nothing. */ }, + <% encoded_history_id = trans.security.encode_id(history.id) %> + ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_history_id, item_type="history" )}", + ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_history_id, item_type="history" )}", + ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_history_id, item_type="history" )}", + delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", + delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", + add_tag_img: "${h.url_for('/static/images/add_icon.png')}", + add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", + }; +% if trans.get_user() is not None: + $("#history-tag-area").autocomplete_tagging(options); +% endif + }); // Functionized so AJAX'd datasets can call them // Get shown/hidden state from cookie @@ -290,6 +377,9 @@ <p></p> %endif +<div id="history-tag-area" style="margin-bottom: 1em"> +</div> + <%namespace file="history_common.mako" import="render_dataset" /> %if not datasets:

1 0

[hg] galaxy 2639: Added samtools-based tools (sam_to_bam, sam_me...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/36f438ce1f82 changeset: 2639:36f438ce1f82 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Fri Aug 28 15:59:16 2009 -0400 description: Added samtools-based tools (sam_to_bam, sam_merge, sam_pileup) with their supporting files and modified Bam datatype so temp files are properly cleaned up 15 file(s) affected in this change: lib/galaxy/datatypes/images.py test-data/chrM.fa test-data/sam_to_bam_in1.sam test-data/sam_to_bam_in2.sam test-data/sam_to_bam_out1.bam test-data/sam_to_bam_out2.bam tool-data/sam_fa_indices.loc.sample tool_conf.xml.sample tools/samtools/sam_merge.py tools/samtools/sam_merge.xml tools/samtools/sam_merge_code.py tools/samtools/sam_pileup.py tools/samtools/sam_pileup.xml tools/samtools/sam_to_bam.py tools/samtools/sam_to_bam.xml diffs (843 lines): diff -r d261f41a2a03 -r 36f438ce1f82 lib/galaxy/datatypes/images.py --- a/lib/galaxy/datatypes/images.py Fri Aug 28 15:29:53 2009 -0400 +++ b/lib/galaxy/datatypes/images.py Fri Aug 28 15:59:16 2009 -0400 @@ -252,14 +252,17 @@ index_file = dataset.metadata.spec['bam_index'].param.new_file( dataset = dataset ) tmp_dir = tempfile.gettempdir() tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1bai = '%s.bai' % tmpf1.name try: subprocess.check_call(['cd', tmp_dir], shell=True) subprocess.check_call('cp %s %s' % (dataset.file_name, tmpf1.name), shell=True) subprocess.check_call('samtools index %s' % tmpf1.name, shell=True) - subprocess.check_call('cp %s.bai %s' % (tmpf1.name, index_file.file_name), shell=True) + subprocess.check_call('cp %s %s' % (tmpf1bai, index_file.file_name), shell=True) except subprocess.CalledProcessError: sys.stderr.write('There was a problem creating the index for the BAM file\n') tmpf1.close() + if os.path.exists(tmpf1bai): + os.remove(tmpf1bai) dataset.metadata.bam_index = index_file def set_peek( self, dataset ): if not dataset.dataset.purged: diff -r d261f41a2a03 -r 36f438ce1f82 test-data/chrM.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/chrM.fa Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,335 @@ +>chrM +GTTAATGTAGCTTAATAATATAAAGCAAGGCACTGAAAATGCCTAGATGA +GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT +TATTAATAGAATTACACATGCAAGTATCCGCACCCCAGTGAGAATGCCCT +CTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATCAAGCACACTAGAA +AGTAGCTCATAACACCTTGCTCAGCCACACCCCCACGGGACACAGCAGTG +ATAAAAATTAAGCTATGAACGAAAGTTCGACTAAGTCATATTAAATAAGG +GTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTA +ATAAATCTCCGGCGTAAAGCGTGTCAAAGACTAATACCAAAATAAAGTTA +AAACCCAGTTAAGCCGTAAAAAGCTACAACCAAAGTAAAATAGACTACGA +AAGTGACTTTAATACCTCTGACTACACGATAGCTAAGACCCAAACTGGGA +TTAGATACCCCACTATGCTTAGCCCTAAACTAAAATAGCTTACCACAACA +AAGCTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTT +GGCGGTGCTTTACATCCCTCTAGAGGAGCCTGTTCCATAATCGATAAACC +CCGATAAACCCCACCATCCCTTGCTAATTCAGCCTATATACCGCCATCTT +CAGCAAACCCTAAACAAGGTACCGAAGTAAGCACAAATATCCAACATAAA +AACGTTAGGTCAAGGTGTAGCCCATGGGATGGAGAGAAATGGGCTACATT +TTCTACCCTAAGAACAAGAACTTTAACCCGGACGAAAGTCTCCATGAAAC +TGGAGACTAAAGGAGGATTTAGCAGTAAATTAAGAATAGAGAGCTTAATT +GAATCAGGCCATGAAGCGCGCACACACCGCCCGTCACCCTCCTTAAATAT +CACAAATCATAACATAACATAAAACCGTGACCCAAACATATGAAAGGAGA +CAAGTCGTAACAAGGTAAGTATACCGGAAGGTGTACTTGGATAACCAAAG +TGTAGCTTAAACAAAGCATCCAGCTTACACCTAGAAGATTTCACTCAAAA +TGAACACTTTGAACTAAAGCTAGCCCAAACAATACCTAATTCAATTACCC +TTAGTCACTTAACTAAAACATTCACCAAACCATTAAAGTATAGGAGATAG +AAATTTTAACTTGGCGCTATAGAGAAAGTACCGTAAGGGAACGATGAAAG +ATGCATTAAAAGTACTAAACAGCAAAGCTTACCCCTTTTACCTTTTGCAT +AATGATTTAACTAGAATAAACTTAGCAAAGAGAACTTAAGCTAAGCACCC +CGAAACCAGACGAGCTACCTATGAACAGTTACAAATGAACCAACTCATCT +ATGTCGCAAAATAGTGAGAAGATTCGTAGGTAGAGGTGAAAAGCCCAACG +AGCCTGGTGATAGCTGGTTGTCCAGAAACAGAATTTCAGTTCAAATTTAA +ATTTACCTAAAAACTACTCAATTCTAATGTAAATTTAAATTATAGTCTAA +AAAGGTACAGCTTTTTAGATACAGGTTACAACCTTCATTAGAGAGTAAGA +ACAAGATAAACCCATAGTTGGCTTAAAAGCAGCCATCAATTAAGAAAGCG +TTCAAGCTCAACGACACATCTATCTTAATCCCAACAATCAACCCAAACTA +ACTCCTAATCTCATACTGGACTATTCTATCAACACATAGAAGCAATAATG +TTAATATGAGTAACAAGAATTATTTCTCCTTGCATAAGCTTATATCAGAA +CGAATACTCACTGATAGTTAACAACAAGATAGGGATAATCCAAAAACTAA +TCATCTATTTAAACCATTGTTAACCCAACACAGGCATGCATCTATAAGGA +AAGATTAAAAGAAGTAAAAGGAACTCGGCAAACACAAACCCCGCCTGTTT +ACCAAAAACATCACCTCTAGCATTTCCAGTATTAGAGGCACTGCCTGCCC +AGTGACATCTGTTtaaacggccgcggtatcctaaccgtgcaaaggtagca +taatcacttgttccctaaatagggacttgtatgaatggccacacgagggt +tttactgtctcttacttccaatcagtgaaattgaccttcccgtgaagagg +cgggaatgactaaataagacgagaagaccctatggagcttTAATTAACTG +ATTCACAAAAAACAACACACAAACCTTAACCTTCAGGGACAACAAAACTT +TTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAAC +CTCCGAGTGATTTAAATCCAGACTAACCAGTCAAAATATATAATCACTTA +TTGATCCAAACCATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCG +CAATCCTATTCCAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATG +TTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTT +CAACGATTAAAGTCTTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGT +CGGTTTCTATCTATTCTATACTTTTCCCAGTACGAAAGGACAAGAAAAGT +AGGGCCCACTTTACAAGAAGCGCCCTCAAACTAATAGATGACATAATCTA +AATCTAACTAATTTATAACTTCTACCGCCCTAGAACAGGGCTCgttaggg +tggcagagcccggaaattgcataaaacttaaacctttacactcagaggtt +caactcctctccctaacaacaTGTTCATAATTAACGTCCTCCTCCTAATT +GTCCCAATCTTGCTCGCCGTAGCATTCCTCACACTAGTTGAACGAAAAGT +CTTAGGCTATATGCAACTTCGCAAAGGACCCAACATCGTAGGCCCCTATG +GCCTACTACAACCTATTGCCGATGCCCTCAAACTATTTATCAAAGAGCCA +CTACAACCACTAACATCATCGACATCCATATTCATCATCGCACCAATCCT +AGCCCTAACCCTGGCCTTAACCATATGAATCCCTCTGCCCATACCATACC +CACTAATCAACATAAACCTAGGAATTCTATTCATACTAGCCATGTCCAGC +CTAGCTGTCTACTCAATCCTTTGATCAGGATGGGCCTCAAACTCAAAATA +CGCCCTAATTGGAGCTCTACGAGCAGTAGCACAAACCATCTCATACGAAG +TAACTCTAGCAATCATCCTACTCTCAGTCCTCCTAATAAGCGGATCATTC +ACATTATCAACACTTATTATTACCCAAGAATACCTCTGATTAATCTTCCC +ATCATGACCCTTAGCCATAATGTGATTCATCTCAACATTAGCCGAAACCA +ACCGAGCTCCATTTGACCTAACAGAAGGAGAATCAGAACTCGTCTCTGGA +TTCAACGTTGAATACGCAGCCGGCCCATTTGCTCTATTCTTCCTAGCAGA +ATACGCAAACATCATCATGATAAACATCTTCACAACAACCCTATTTCTAG +GAGCATTTCACAACCCCTACCTGCCAGAACTCTACTCAATTAATTTCACC +ATTAAAGCTCTCCTTCTAACATGTTCCTTCCTATGAATCCGAGCATCCTA +CCCACGATTCCGATATGACCAACTTATACACCTCCTATGAAAGAACTTCC +TACCACTCACACTAGCCCTCTGCATATGACACGTCTCACTTCCAATCATA +CTATCCAGCATCCCACCACAAACATAGGAAATATGTCTGACAAAAGAGTT +ACTTTGATAGAGTAAAACATAGAGGCTCAAACCCTCTTATTTctagaact +acaggaattgaacctgctcctgagaattcaaaatcctccgtgctaccgaa +ttacaccatgtcctaCAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCAT +ACCCCGAAAATGTTGGATTACACCCTTCCCGTACTAATAAATCCCCTTAT +CTTCACAACTATTCTAATAACAGTTCTTCTAGGAACTATAATCGTTATAA +TAAGCTCACACTGACTAATAATCTGAATCGGATTTGAAATAAATCTACTA +GCCATTATCCCTATCCTAATAAAAAAGTACAATCCCCGAACCATAGAAGC +CTCCACCAAATATTTTCTAACCCAAGCCACCGCATCAATACTCCTCATAA +TAGCGATCATCATTAACCTCATACACTCAGGCCAATGAACAATCACAAAA +GTCTTCAACCCCACAGCGTCCATCATTATAACTTCAGCTCTCGCCATAAA +ACTTGGACTCACACCATTCCACTTCTGAGTACCCGAAGTCACACAGGGCA +TCTCATTAACATCAGGTCTCATCCTACTTACATGACAAAAACTAGCCCCA +ATATCAATCCTATATCAAATCTCACCCTCAATTAACCTAAATATCTTATT +AACTATAGCCGTACTGTCAATCCTAGTAGGAGGCTGAGGCGGTCTCAACC +AAACCCAACTACGAAAAATCATAGCATACTCGTCAATCGCGCATATAGGA +TGAATAACAGCTGTCCTAGTATATAACCCAACACTAACAATACTAAACAT +ATTAATTTACATTATAATAACACTCACAATATTCATACTATTTATCCACA +GCTCCTCTACTACAACACTATCACTCTCCCACACATGAAACAAAATACCT +CTAACCACTACACTAATCTTAATTACCTTACTATCCATAGGAGGCCTCCC +CCCACTATCAGGATTCATACCCAAATGAATAATCATTCAAGAGCTCACCA +AAAATAGCAGCATCATCCTCCCCACACTAATAGCCATTATAGCACTACTC +AACCTCTACTTCTACATACGACTAACCTATTCCACCTCACTGACCATATT +CCCATCCACAAACAACATAAAAATAAAATGACAATTCGAAACCAAACGAA +TTACTCTCTTACCCCCGTTAATTGTTATATCCTCCCTACTCCTCCCCCTA +ACCCCCATACTATCAATTTTGGACTAGGAATTTAGGTTAACATCCCAGAC +CAAGAGCCTTCAAAGCTCTAAGCAAGTGAATCCACTTAATTCCTGCATAC +TAAGGACTGCGAGACTCTATCTCACATCAATTGAACGCAAATCAAACTCT +TTTATTAAGCTAAGCCCTTACTAGATTGGTGGGCTACCATCCCACGAAAT +TTTAGTTAACAGCTAAATACCCTAATCAACTGGCTTCAATCTACTTCTCC +CGCCGCCTAGAAAAAAAGGCGGGAGAAGCCCCGGCAGAAATTGAAGCTGC +TCCTTTGAATTTGCAATTCAATGTGAAAATTCACCACGGGACTTGATAAG +AAGAGGATTCCAACCCCTGTCTTTAGATTTACAGTCTAATGCTTACTCAG +CCATCTTACCTATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAA +GACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGG +AACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCC +TACTAGGAGATGATCAGATCTACAATGTCATTGTAACCGCCCATGCATTC +GTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAA +CTGATTAGTCCCCCTGATAATTGGAGCACCTGATATAGCTTTCCCCCGAA +TAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTC +GCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCC +TCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCA +TTTTCTCTCTCCACCTAGCTGGGGTGTCCTCGATTTTAGGTGCCATCAAC +TTTATTACCACAATCATTAACATAAAACCACCAGCCCTATCCCAATATCA +AACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCC +TAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGT +AACCTGAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCT +TTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTA +TCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGT +AAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCAT +TGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGA +TAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCT +ATCCCTACTGGTGTAAAAGTATTCAGCTGACTAGCCACCCTGCACGGAGG +AAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCT +TATTCACAGTAGGAGGTCTAACAGGAATCGTCCTAGCTAACTCATCCCTA +GATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGT +CCTGTCTATAGGAGCAGTCTTCGCCATTATGGGGGGATTTGTACACTGAT +TCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCAC +TTTACAATTATATTCGTAGGGGTAAATATAACCTTCTTCCCACAACATTT +CCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTATCCAGACGCAT +ATACAACATGAAATACCATCTCATCCATAGGATCTTTTATCTCACTTACA +GCAGTGATACTAATAATTTTCATAATTTGAGAAGCGTTCGCATCCAAACG +AGAAGTGTCTACAGTAGAATTAACCTCAACTAATCTGGAATGACTACACG +GATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTA +AAAtaagaaaggaaggaatcgaaccccctctaactggtttcaagccaata +tcataaccactatgtctttctcCATCAATTGAGGTATTAGTAAAAATTAC +ATGACTTTGTCAAAGTTAAATTATAGGTTAAACCCCTATATACCTCTATG +GCCTACCCCTTCCAACTAGGATTCCAAGACGCAACATCCCCTATTATAGA +AGAACTCCTACACTTCCACGACCACACACTAATAATCGTATTCCTAATTA +GCTCTCTAGTATTATATATTATCTCATCAATACTAACAACTAAATTAACC +CATACCAGCACCATAGATGCTCAAGAAGTAGAGACAATTTGAACGATTTT +ACCAGCCATCATCCTTATTCTAATCGCCCTCCCATCCCTACGAATTCTAT +ATATAATAGATGAAATCAATAATCCGTCCCTCACAGTCAAAACAATAGGC +CACCAATGATACTGAAGCTACGAGTATACCGATTACGAAGACTTGACCTT +TGACTCCTACATGATCCCCACATCAGACCTAAAACCAGGAGAATTACGTC +TTCTAGAAGTCGACAATCGAGTGGTTCTCCCCATAGAAATAACCATCCGA +ATGCTAATTTCATCCGAAGACGTCCTACACTCATGAGCTGTGCCCTCCCT +AGGCCTAAAAACAGACGCTATCCCTGGGCGCCTAAATCAGACAACTCTCG +TGGCCTCTCGACCAGGACTTTACTACGGTCAATGCTCAGAGATCTGCGGA +TCAAACCACAGCTTTATACCAATTGTCCTTGAACTAGTTCCACTGAAACA +CTTCGAAGAATGATCTGCATCAATATTATAAAGTCACTAAGAAGCTATTA +TAGCATTAACCTTTTAAGTTAAAGATTGAGGGTTCAACCCCCTCCCTAGT +GATATGCCACAGTTGGATACATCAACATGATTTATTAATATCGTCTCAAT +AATCCTAACTCTATTTATTGTATTTCAACTAAAAATCTCAAAGCACTCCT +ATCCGACACACCCAGAAGTAAAGACAACCAAAATAACAAAACACTCTGCC +CCTTGAGAATCAAAATGAACGAAAATCTATTCGCCTCTTTCGCTACCCCA +ACAATAGTAGGCCTCCCTATTGTAATTCTGATCATCATATTTCCCAGCAT +CCTATTCCCCTCACCCAACCGACTAATCAACAATCGCCTAATCTCAATTC +AACAATGGCTAGTCCAACTTACATCAAAACAAATAATAGCTATCCATAAC +AGCAAAGGACAAACCTGAACTCTTATACTCATATCACTGATCCTATTCAT +TGGCTCAACAAACTTATTAGGCCTACTACCTCACTCATTTACACCAACAA +CACAACTATCAATAAACCTAGGCATAGCTATTCCCCTATGGGCAGGGACA +GTATTCATAGGCTTTCGTCACAAAACAAAAGCAGCCCTAGCCCACTTTCT +ACCTCAAGGGACGCCCATTTTCCTCATCCCCATACTAGTAATTATCGAGA +CTATCAGCCTATTTATTCAACCTGTAGCCCTAGCCGTGCGGCTAACCGCT +AACATTACCGCCGGACACCTCCTAATACACCTCATCGGAGGGGCAACACT +AGCCCTCATAAGCATCAGCCCCTCAACAGCCCTTATTACGTTTATCATCC +TAATTCTACTAACTATCCTCGAATTCGCAGTAGCTATAATCCAAGCCTAC +GTATTCACTCTCCTGGTAAGCCTTTACTTACACGACAACACCTAATGACC +CACCAAACCCACGCTTACCACATAGTAAACCCCAGCCCATGACCACTTAC +AGGAGCCCTATCAGCCCTCCTGATAACATCAGGACTAGCCATGTGATTTC +ACTTTAACTCAACCTTACTTCTAGCTATAGGGCTATTAACTAACATCCTT +ACCATATATCAATGATGACGAGACATCATCCGAGAAAGCACATTCCAAGG +CCATCACACATCAATCGTTCAAAAGGGACTCCGATATGGCATAATCCTTT +TTATTATCTCAGAAGTCTTCTTCTTCTCTGGCTTCTTCTGAGCCTTTTAC +CACTCAAGCCTAGCCCCCACACCCGAACTAGGCGGCTGCTGACCACCCAC +AGGTATCCACCCCTTAAACCCCCTAGAAGTCCCCTTACTCAACACCTCAG +TGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCACCATAGCCTAATA +GAAGGAAACCGTAAAAATATGCTCCAAGGCCTATTCATCACAATTTCACT +AGGCGTATACTTCACCCTTCTCCAAGCCTCAGAATACTATGAAGCCTCAT +TTACTATTTCAGATGGAGTATACGGATCAACATTTTTCGTAGCAACAGGG +TTCCACGGACTACACGTAATTATCGGATCTACCTTCCTCATTGTATGTTT +CCTACGCCAACTAAAATTCCACTTTACATCCAGCCACCACTTCGGATTCG +AAGCAGCCGCTTGATACTGACACTTCGTCGACGTAGTCTGACTATTCTTG +TACGTCTCTATTTATTGATGAGGATCCTATTCTTTTAGTATTGACCAGTA +CAATTGACTTCCAATCAATCAGCTTCGGTATAACCCGAAAAAGAATAATA +AACCTCATACTGACACTCCTCACTAACACATTACTAGCCTCGCTACTCGT +ACTCATCGCATTCTGACTACCACAACTAAACATCTATGCAGAAAAAACCA +GCCCATATGAATGCGGATTTGACCCTATAGGGTCAGCACGCCTCCCCTTC +TCAATAAAATTTTTCTTAGTGGCCATTACATTTCTGCTATTCGACTTAGA +AATTGCCCTCCTATTACCCCTTCCATGAGCATCCCAAACAACTAACCTAA +ACACTATACTTATCATAGCACTAGTCCTAATCTCTCTTCTAGCCATCAGC +CTAGCCTACGAATGAACCCAAAAAGGACTAGAATGAACTGAGTATGGTAA +TTAGTTTAAACCAAAACAAATGATTTCGACTCATTAAACTATGATTAACT +TCATAATTACCAACATGTCACTAGTCCATATTAATATCTTCCTAGCATTC +ACAGTATCCCTCGTAGGCCTACTAATGTACCGATCCCACCTAATATCCTC +ACTCCTATGCCTAGAAGGAATAATACTATCACTATTCGTCATAGCAACCA +TAATAGTCCTAAACACCCACTTCACACTAGCTAGTATAATACCTATCATC +TTACTAGTATTTGCTGCCTGCGAACGAGCTCTAGGATTATCCCTACTAGT +CATAGTCTCCAATACTTATGGAGTAGACCACGTACAAAACCTTAACCTCC +TCCAATGCTAAAAATTATCATTCCCACAATCATACTTATGCCCCTTACAT +GACTATCAAAAAAGAATATAATCTGAATCAACACTACAACCTATAGTCTA +TTAATCAGCCTTATCAGCCTATCCCTCCTAAACCAACCTAGCAACAATAG +CCTAAACTTCTCACTAATATTCTTCTCCGATCCCCTATCAGCCCCACTTC +TGGTGTTGACAACATGACTACTGCCACTAATACTCATAGCCAGCCAACAC +CATCTATCTAAGGAACCACTAATCCGAAAAAAACTCTACATCACCATGCT +AACCATACTTCAAACTTTCCTAATCATGACTTTTACCGCCACAGAACTAA +TCTCCTTCTACATCCTATTTGAAGCCACATTAGTTCCAACACTAATTATC +ATCACCCGCTGAGGCAACCAAACAGAACGCCTGAACGCAGGCCTCTACTT +CCTATTCTACACACTAATAGGTTCCCTCCCACTCTTAGTTGCACTAATCT +CTATCCAAAACCTAACAGGCTCACTAAACTTCCTATTAATTCAATACTGA +AACCAAGCACTACCCGACTCTTGATCCAATATTTTCCTATGACTAGCATG +TATAATAGCATTCATAGTCAAAATACCGGTATATGGTCTTCACCTCTGAC +TCCCAAAAGCCCATGTAGAAGCCCCAATTGCCGGATCCATAGTGCTAGCA +GCCATTCTACTAAAACTAGGAGGCTACGGAATACTACGAATTACAACAAT +ACTAAACCCCCAAACTAGCTTTATAGCCTACCCCTTCCTCATACTATCCC +TGTGAGGAATAATCATAACTAGTTCCATCTGCTTGCGACAAACCGATCTA +AAATCACTTATTGCATACTCCTCTGTCAGCCACATAGCCCTAGTAATCGT +AGCCGTCCTCATCCAAACACCATGAAGTTATATAGGAGCTACAGCCCTAA +TAATCGCTCACGGCCTTACATCATCAATACTATTCTGCCTGGCAAACTCA +AATTACGAACGTACCCATAGCCGAACTATAATCCTAGCCCGCGGGCTTCA +AACACTTCTTCCCCTTATAGCAGCCTGATGACTATTAGCCAGCCTAACCA +ACCTGGCCCTCCCTCCCAGCATTAACCTAATTGGAGAGCTATTCGTAGTA +ATATCATCATTCTCATGATCAAATATTACCATTATCCTAATAGGAGCCAA +TATCACCATCACCGCCCTCTACTCCCTATACATACTAATCACAACACAAC +GAGGGAAATACACACACCATATCAACAGCATTAAACCTTCATTTACACGA +GAAAACGCACTCATGGCCCTCCACATGACTCCCCTACTACTCCTATCACT +TAACCCTAAAATTATCCTAGGCTTTACGTACTGTAAATATAGTTTAACAA +AAACACTAGATTGTGGATCTAGAAACAGAAACTTAATATTTCTTATTTAC +CGAGAAAGTATGCAAGAACTGCTAATTCATGCCCCCATGTCCAACAAACA +TGGCTCTCTCAAACTTTTAAAGGATAGGAGCTATCCGTTGGTCTTAGGAA +CCAAAAAATTGGTGCAACTCCAAATAAAAGTAATCAACATGTTCTCCTCC +CTCATACTAGTTTCACTATTAGTACTAACCCTCCCAATCATATTATCAAT +CTTCAATACCTACAAAAACAGCACGTTCCCGCATCATGTAAAAAACACTA +TCTCATATGCCTTCATTACTAGCCTAATTCCCACTATAATATTTATTCAC +TCTGGACAAGAAACAATTATCTCAAACTGACACTGAATAACCATACAAAC +CCTCAAACTATCCCTAAGCTTCAAACTAGATTACTTCTCAATAATTTTCG +TACCAGTAGCCCTATTCGTAACATGATCTATTATGGAATTCTCCCTATGA +TACATGCACTCAGATCCTTACATTACTCGATTTTTTAAATACTTACTTAC +ATTCCTCATCACTATAATAATTCTAGTCACAGCTAACAACCTTTTCCAAC +TGTTCATCGGATGGGAGGGAGTAGGCATCATGTCATTCTTACTAATCGGA +TGATGATACGGCCGAACAGATGCCAACACCGCGGCCCTTCAAGCAATCCT +TTATAACCGCATCGGGGATATCGGCTTCATCATGGCCATAGCCTGATTCC +TATTCAACACCAACACATGAGACCTCCAACAAATCTTCATACTCGACCCC +AACCTTACCAACCTCCCGCTCCTAGGCCTCCTCCTAGCCGCAACTGGCAA +ATCCGCTCAATTTGGACTCCACCCATGACTTCCTTCAGCCATAGAGGGCC +CTACACCAGTCTCAGCCCTACTCCACTCCAGCACAATAGTTGTAGCAGGC +GTCTTCCTGCTAATCCGCTTCCATCCACTAATAGAAAACAACAAAACAAT +CCAGTCACTTACCCTATGCCTAGGAGCCATCACCACACTATTCACAGCAA +TCTGCGCACTCACTCAAAACGATATCAAAAAAATCATTGCTTTCTCCACC +TCCAGCCAACTAGGCCTGATAATCGTAACCATCGGTATCAATCAACCCTA +CCTAGCATTCCTCCACATTTGCACTCACGCATTCTTCAAAGCTATACTAT +TTATATGTTCCGGATCCATTATCCACAGCCTAAATGACGAGCAAGATATC +CGAAAAATAGGCGGACTATTTAATGCAATACCCTTCACCACCACATCTCT +AATTATTGGCAGCCTTGCACTCACCGGAATTCCTTTCCTCACAGGCTTCT +ACTCCAAAGACCTCATCATCGAAACCGCCAACACATCGTACACCAACGCC +TGAGCCCTACTAATAACTCTCATTGCCACATCCCTCACAGCTGTCTACAG +TACCCGAATCATCTTCTTTGCACTCCTAGGGCAACCCCGCTTCCTCCCTC +TGACCTCAATCAACGAAAATAACCCCTTTCTAATTAACTCCATCAAACGC +CTCTTAATTGGCAGCATTTTTGCCGGATTCTTCATCTCCAACAATATCTA +CCCCACAACCGTCCCAGAAATAACCATACCTACTTACATAAAACTCACCG +CCCTCGCAGTAACCATCCTAGGATTTACACTAGCCCTAGAACTAAGCTTG +ATAACCCATAACTTAAAACTAGAACACTCCACCAACGTATTCAAATTCTC +CAACCTCCTAGGATACTACCCAACAATTATACACCGACTCCCACCGCTCG +CTAACCTATCAATAAGCCAAAAATCAGCATCACTTCTACTAGACTCAATC +TGACTAGAAAACATCCTGCCAAAATCTATCTCCCAGTTCCAAATAAAAAC +CTCGATCCTAATTTCCACCCAAAAAGGACAAATCAAATTATATTTCCTCT +CATTCCTCATCACCCTTACCCTAAGCATACTACTTTTTAATCTCCACGAG +TAACCTCTAAAATTACCAAGACCCCAACAAGCAACGATCAACCAGTCACA +ATCACAACCCAAGCCCCATAACTATACAATGCAGCAGCCCCTATAATTTC +CTCACTAAACGCCCCAGAATCTCCAGTATCATAAATAGCTCAAGCCCCCA +CACCACTAAACTTAAACACTACCCCCACTTCCTCACTCTTCAGAACATAT +AAAACCAACATAACCTCCATCAACAACCCTAAAAGAAATACCCCCATAAC +AGTCGTATTAGACACCCATACCTCAGGATACTGCTCAGTAGCCATAGCCG +TTGTATAACCAAAAACAACCAACATTCCTCCCAAATAAATCAAAAACACC +ATCAACCCCAAAAAGGACCCTCCAAAATTCATAATAATACCACAACCTAC +CCCTCCACTTACAATCAGCACTAAACCCCCATAAATAGGTGAAGGTTTTG +AAGAAAACCCCACAAAACTAACAACAAAAATAACACTCAAAATAAACACA +ATATATGTCATCATTATTCCCACGTGGAATCTAACCACGACCAATGACAT +GAAAAATCATCGTTGTATTTCAACTATAAGAACACCAATGACAAACATCC +GGAAATCTCACCCACTAATTAAAATCATCAATCACTCTTTTATTGACCTA +CCAGCCCCCTCAAACATTTCATCATGATGAAACTTCGGCTCCCTCCTAGG +AATCTGCCTAATCCTCCAAATCTTAACAGGCCTATTCCTAGCCATACACT +ACACATCAGACACGACAACTGCCTTCTCATCCGTCACTCACATCTGCCGA +GACGTTAACTACGGATGAATTATTCGCTACCTCCATGCCAACGGAGCATC +AATATTTTTTATCTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTACG +GCTCTTACACATTCCTAGAGACATGAAACATTGGAATCATCCTACTTTTC +ACAGTTATAGCTACAGCATTCATGGGCTATGTCCTACCATGAGGCCAAAT +ATCCTTTTGAGGAGCAACAGTCATCACGAACCTCCTATCAGCAATTCCCT +ACATCGGTACTACCCTCGTCGAGTGAATCTGAGGTGGATTCTCAGTAGAC +AAAGCCACCCTTACCCGATTTTTTGCTTTCCACTTCATCCTACCCTTCAT +CATCACAGCCCTGGTAGTCGTACATTTACTATTTCTTCACGAAACAGGAT +CTAATAACCCCTCAGGAATCCCATCCGATATGGACAAAATCCCATTCCAC +CCATATTATACAATTAAAGACATCCTAGGACTCCTCCTCCTGATCTTGCT +CCTACTAACTCTAGTATTATTCTCCCCCGACCTCCTAGGAGACCCAGACA +ACTACACCCCAGCTAACCCTCTCAGCACTCCCCCTCATATTAAACCAGAA +TGGTACTTCCTGTTTGCCTACGCCATCCTACGCTCCATTCCCAACAAACT +AGGCGGCGTATTAGCCCTAATCCTCTCCATCCTGATCCTAGCACTCATCC +CCACCCTCCACATATCAAAACAACGAAGCATAATATTCCGGCCTCTCAGC +CAATGCGTATTCTGACTCTTAGTGGCAGACTTACTGACACTAACATGAAT +CGGCGGACAGCCAGTGGAACACCCATACGTAATTATCGGCCAACTGGCCT +CAATCCTCTACTTCTCCCTAATTCTCATTTTTATACCACTCGCAAGCACC +ATCGAAAACAATCTTCTAAAATGAAGAGTCCCTGTAGTATATCGCACATT +ACCCTGGTCTTGTAAACCAGAAAAGGGGGAAAACGTTTCCTCCCAAGGAC +TATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTC +TACTTAAACTATTCCTTGATTTCTTCCCCTAAACGACAACAATTTACCCT +CATGTGCTATGTCAGTATCAGATTATACCCCCACATAACACCATACCCAC +CTGACATGCAATATCTTATGAATGGCCTATGTACGTCGTGCATTAAATTG +TCTGCCCCATGAATAATAAGCATGTACATAATATCATTTATCTTACATAA +GTACATTATATTATTGATCGTGCATACCCCATCCAAGTCAAATCATTTCC +AGTCAACACGCATATCACAGCCCATGTTCCACGAGCTTAATCACCAAGCC +GCGGGAAATCAGCAACCCTCCCAACTACGTGTCCCAATCCTCGCTCCGGG +CCCATCCAAACGTGGGGGTTTCTACAATGAAACTATACCTGGCATCTGGT +TCTTTCTTCAGGGCCATTCCCACCCAACCTCGCCCATTCTTTCCCCTTAA +ATAAGACATCTCGATGGACTAATGACTAATCAGCCCATGCTCACACATAA +CTGTGATTTCATGCATTTGGTATCTTTTTATATTTGGGGATGCTATGACT +CAGCTATGGCCGTCAAAGGCCTCGACGCAGTCAATTAAATTGAAGCTGGA +CTTAAATTGAACGTTATTCCTCCGCATCAGCAACCATAAGGTGTTATTCA +GTCCATGGTAGCGGGACATAGGAAACAAgtgcacctgtgcacctgtgcac +ctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacct +gtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgt +gcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgc +acctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcac +ctgtgcacctACCCGCGCAGTAAGCAAGTAATATAGCTTTCTTAATCAAA +CCCCCCCTACCCCCCATTAAACTCCACATATGTACATTCAACACAATCTT +GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT +AACCCTCGCATGCCAACCATAATAACTCAACACACCTAACAATCTTAACA +GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT +TTCCATAGACAGGCATCCCCCTAGATCTAATTTTCTAAATCTGTCAACCC +TTCTTCCCCC diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_in1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_to_bam_in1.sam Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,10 @@ +HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1698:516 16 chrM 2735 25 36M * 0 0 TTTACACTCAGAGGTTCAACTCCTCTCNNTAACAAC I9IIIII5IIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1491:637 16 chrM 10864 25 36M * 0 0 TGTAGAAGCCCCAATTGCCGGATCCATNNTGCTAGC DBAIIIIIIIIIIIFIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1711:249 16 chrM 10617 25 36M * 0 0 ACCAAACAGAACGCCTGAACGCAGGCCNNTACTTCC IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1634:211 0 chrM 9350 25 36M * 0 0 GAAGCAGNNGCTTGATACTGACACTTCGTCGACGTA IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1218:141 16 chrM 14062 25 36M * 0 0 ACAAAACTAACAACAAAAATAACACTCNNAATAAAC I+IIII1IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1398:854 16 chrM 3921 25 36M * 0 0 CACCCTTCCCGTACTAATAAATCCCCTNNTCTTCAC IIIII=AIIIIIIIIIIIIIIBIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1310:991 16 chrM 10002 25 36M * 0 0 CTCCTATGCCTAGAAGGAATAATACTANNACTATTC I:2IEI:IIDIIIIII4IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1716:413 0 chrM 6040 25 36M * 0 0 GATCCAANNCTTTATCAACACCTATTCTGATTCTTC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1630:59 16 chrM 12387 25 36M * 0 0 TCATACTCGACCCCAACCTTACCAACCNNCCGCTCC FIIHII;IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_in2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_to_bam_in2.sam Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,10 @@ +HWI-EAS91_1_30788AAXX:1:1:1095:605 0 chrM 23 25 36M * 0 0 AAGCAAGNNACTGAAAATGCCTAGATGAGTATTCTT IIIIIII""IIIIIIIIIIIIIIIEIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1650:1185 0 chrM 14956 25 36M * 0 0 ACCCCAGNNAACCCTCTCAGCACTCCCCCTCATATT IIIIIII""IIIIIIIIIIII6IIIIIIIII5I-II NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:799:192 16 chrM 8421 25 36M * 0 0 CCTGTAGCCCTAGCCGTGCGGCTAACCNNTAACATT II%::I<IIIIIEIII8IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1082:719 16 chrM 7191 25 36M * 0 0 TAAATTAACCCATACCAGCACCATAGANNCTCAAGA <III0EII3+3I29I>III8AIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1746:1180 16 chrM 12013 25 36M * 0 0 CCTAAGCTTCAAACTAGATTACTTCTCNNTAATTTT IIIIIIIIFIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:606:460 0 chrM 4552 25 36M * 0 0 TTAATTTNNATTATAATAACACTCACAATATTCATA IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1059:362 16 chrM 7348 25 36M * 0 0 GGCCACCAATGATACTGAAGCTACGAGNNTACCGAT II/<)2IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1483:1161 16 chrM 15080 25 36M * 0 0 TCCTGATCCTAGCACTCATCCCCACCCNNCACATAT HIIIIIFIIAIHIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1273:600 16 chrM 13855 25 36M * 0 0 GTATTAGACACCCATACCTCAGGATACNNCTCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 +HWI-EAS91_1_30788AAXX:1:1:1190:1283 16 chrM 15338 25 36M * 0 0 TATATCGCACATTACCCTGGTCTTGTANNCCAGAAA EIII?-IIIIIAIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_out1.bam Binary file test-data/sam_to_bam_out1.bam has changed diff -r d261f41a2a03 -r 36f438ce1f82 test-data/sam_to_bam_out2.bam Binary file test-data/sam_to_bam_out2.bam has changed diff -r d261f41a2a03 -r 36f438ce1f82 tool-data/sam_fa_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/sam_fa_indices.loc.sample Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a sam_fa_indices.loc file +#similar to this one (store it in this directory ) that points to +#the directories in which those files are stored. The sam_fa_indices.loc +#file has this format (white space characters are TAB characters): +# +#<index> <seq> <location> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/sam/, +#then the sam_fa_indices.loc entry would look like this: +# +#hg18 /depot/data2/galaxy/sam/hg18.fa +# +#and your /depot/data2/galaxy/sam/ directory +#would contain hg18.fa and hg18.fa.fai files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai +# +#Your sam_fa_indices.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18 /depot/data2/galaxy/sam/hg18.fa diff -r d261f41a2a03 -r 36f438ce1f82 tool_conf.xml.sample --- a/tool_conf.xml.sample Fri Aug 28 15:29:53 2009 -0400 +++ b/tool_conf.xml.sample Fri Aug 28 15:59:16 2009 -0400 @@ -331,9 +331,13 @@ <tool file="metag_tools/megablast_xml_parser.xml" /> <tool file="metag_tools/blat_wrapper.xml" /> <tool file="metag_tools/mapping_to_ucsc.xml" /> - <tool file="sr_mapping/bwa_wrapper.xml" /> </section> <section name="Tracks" id="tracks"> <tool file="visualization/genetrack.xml" /> </section> + <section name="SAM Tools" id="samtools"> + <tool file="samtools/sam_to_bam.xml" /> + <tool file="samtools/sam_merge.xml" /> + <tool file="samtools/sam_pileup.xml" /> + </section> </toolbox> diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,21 @@ +#! /usr/bin/python + +import os, sys + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def __main__(): + infile = sys.argv[1] + outfile = sys.argv[2] + if len( sys.argv ) < 3: + stop_err( 'No files to merge' ) + filenames = sys.argv[3:] + cmd1 = 'samtools merge %s %s %s' % (outfile, infile, ' '.join(filenames)) + try: + os.system(cmd1) + except Exception, eq: + stop_err('Error running SAMtools merge tool\n' + str(eq)) + +if __name__ == "__main__" : __main__() \ No newline at end of file diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,32 @@ +<tool id="sam_merge" name="Merge BAM Files" version="1.0.0"> + <description>merges BAM files together</description> + <command interpreter="python"> + sam_merge.py + $input1 + $output1 + $input2 + #for $i in $inputs + ${i.input} + #end for + </command> + <inputs> + <param name="input1" label="First file" type="data" format="bam" /> + <param name="input2" label="with file" type="data" format="bam" help="Need to add more files? Use controls below." /> + <repeat name="inputs" title="Input Files"> + <param name="input" label="Add file" type="data" format="bam" /> + </repeat> + </inputs> + <outputs> + <data name="output1" format="bam" /> + </outputs> +  + <help> + +**What it does** + +This tool uses SAMTools_' merge command to merge any number of BAM files together into one BAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool> diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_merge_code.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_merge_code.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,35 @@ +import sets +from galaxy.tools.parameters import DataToolParameter + +def validate_input( trans, error_map, param_values, page_param_map ): + dbkeys = sets.Set() + data_param_names = sets.Set() + data_params = 0 + for name, param in page_param_map.iteritems(): + if isinstance( param, DataToolParameter ): + # for each dataset parameter + if param_values.get(name, None) != None: + dbkeys.add( param_values[name].dbkey ) + data_params += 1 + # check meta data +# try: +# param = param_values[name] +# startCol = int( param.metadata.startCol ) +# endCol = int( param.metadata.endCol ) +# chromCol = int( param.metadata.chromCol ) +# if param.metadata.strandCol is not None: +# strandCol = int ( param.metadata.strandCol ) +# else: +# strandCol = 0 +# except: +# error_msg = "The attributes of this dataset are not properly set. " + \ +# "Click the pencil icon in the history item to set the chrom, start, end and strand columns." +# error_map[name] = error_msg + data_param_names.add( name ) + if len( dbkeys ) > 1: + for name in data_param_names: + error_map[name] = "All datasets must belong to same genomic build, " \ + "this dataset is linked to build '%s'" % param_values[name].dbkey + if data_params != len(data_param_names): + for name in data_param_names: + error_map[name] = "A dataset of the appropriate type is required" \ No newline at end of file diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_pileup.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_pileup.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,89 @@ +#! /usr/bin/python + +""" +Creates a pileup file from a bam file and a reference. + +usage: %prog [options] + -i, --input1=i: bam file + -o, --output1=o: Output pileup + -r, --ref=r: Reference file type + -n, --ownFile=n: User-supplied fasta reference file + -d, --dbkey=d: dbkey of user-supplied file + -x, --indexDir=x: Index directory + -b, --bamIndex=b: BAM index file + +usage: %prog input1 output1 ref_type refFile ownFile dbkey index_dir bam_index +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seq_file = "%s/sam_fa_indices.loc" % GALAXY_DATA_INDEX_DIR + seq_path = '' + for line in open( seq_file ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( "#" ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seq_path = fields[2].strip() + break + return seq_path + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + seq_path = check_seq_file( options.dbkey, options.indexDir ) + tmp_dir = tempfile.gettempdir() + os.chdir(tmp_dir) + tmpf0 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf0bam = '%s.bam' % tmpf0.name + tmpf0bambai = '%s.bam.bai' % tmpf0.name + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1fai = '%s.fai' % tmpf1.name + cmd1 = None + cmd2 = 'cp %s %s; cp %s %s' % (options.input1, tmpf0bam, options.bamIndex, tmpf0bambai) + cmd3 = 'samtools pileup -f %s %s > %s 2> /dev/null' + if options.ref =='indexed': + full_path = "%s.fai" % seq_path + if not os.path.exists( full_path ): + stop_err( "No sequences are available for '%s', request them by reporting this error." % options.dbkey ) + cmd3 = cmd3 % (seq_path, tmpf0bam, options.output1) + elif options.ref == 'history': + cmd1 = 'cp %s %s; cp %s.fai %s' % (options.ownFile, tmpf1.name, options.ownFile, tmpf1fai) + cmd3 = cmd3 % (tmpf1.name, tmpf0bam, options.output1) + # index reference if necessary + if cmd1: + try: + os.system(cmd1) + except Exception, eq: + stop_err('Error moving reference sequence\n' + str(eq)) + # copy bam index to working directory + try: + os.system(cmd2) + except Exception, eq: + stop_err('Error moving files to temp directory\n' + str(eq)) + # perform pileup command + try: + os.system(cmd3) + except Exception, eq: + stop_err('Error running SAMtools merge tool\n' + str(eq)) + # clean up temp files + tmpf1.close() + tmpf0.close() + if os.path.exists(tmpf0bam): + os.remove(tmpf0bam) + if os.path.exists(tmpf0bambai): + os.remove(tmpf0bambai) + if os.path.exists(tmpf1fai): + os.remove(tmpf0bambai) + +if __name__ == "__main__" : __main__() diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_pileup.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_pileup.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,50 @@ +<tool id="sam_pileup" name="SAM Pileup Format" version="1.0.0"> + <description>generates the pileup format for a provided BAM file</description> + <command interpreter="python"> + sam_pileup.py + --input1=$input1 + --output=$output1 + --ref=$refOrHistory.reference + #if $refOrHistory.reference == "history": + --ownFile=$refOrHistory.ownFile + #else: + --ownFile="None" + #end if + --dbkey=${input1.metadata.dbkey} + --indexDir=${GALAXY_DATA_INDEX_DIR} + --bamIndex=${input1.metadata.bam_index} + </command> + <inputs> + <conditional name="refOrHistory"> + <param name="reference" type="select" label="Will you select a reference genome from your history or use a built-in index?"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="input1" type="data" format="bam" label="Select the BAM file to generate the pileup file for"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="sam, bam" label="Select the BAM file to generate the pileup file for" /> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="tabular" name="output1" /> + </outputs> +  + <help> + +**What it does** + +Uses SAMTools_' pileup command to produce a file in the pileup format based on the provided BAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool> + + diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_to_bam.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_to_bam.py Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,85 @@ +#! /usr/bin/python + +""" +Converts SAM data to BAM format. + +usage: %prog [options] + -i, --input1=i: SAM file to be converted + -d, --dbkey=d: dbkey value + -r, --ref_file=r: Reference file if choosing from history + -o, --output1=o: BAM output + -x, --index_dir=x: Index directory + +usage: %prog input_file dbkey ref_list output_file +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def check_seq_file( dbkey, GALAXY_DATA_INDEX_DIR ): + seq_file = "%s/sam_fa_indices.loc" % GALAXY_DATA_INDEX_DIR + seq_path = '' + for line in open( seq_file ): + line = line.rstrip( '\r\n' ) + if line and not line.startswith( "#" ) and line.startswith( 'index' ): + fields = line.split( '\t' ) + if len( fields ) < 3: + continue + if fields[1] == dbkey: + seq_path = fields[2].strip() + break + return seq_path + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + seq_path = check_seq_file( options.dbkey, options.index_dir ) + tmp_dir = tempfile.gettempdir() + os.chdir(tmp_dir) + tmpf1 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf1fai = '%s.fai' % tmpf1.name + tmpf2 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf3 = tempfile.NamedTemporaryFile(dir=tmp_dir) + tmpf3bam = '%s.bam' % tmpf3.name + if options.ref_file == "None": + full_path = "%s.fai" % seq_path + if not os.path.exists( full_path ): + stop_err( "No sequences are available for '%s', request them by reporting this error." % options.dbkey ) + cmd1 = "cp %s %s; cp %s %s" % (seq_path, tmpf1.name, full_path, tmpf1fai) + else: + cmd1 = "cp %s %s; samtools faidx %s 2>/dev/null" % (options.ref_file, tmpf1.name, tmpf1.name) + cmd2 = "samtools view -bt %s -o %s %s 2>/dev/null" % (tmpf1fai, tmpf2.name, options.input1) + cmd3 = "samtools sort %s %s 2>/dev/null" % (tmpf2.name, tmpf3.name) + cmd4 = "cp %s %s" % (tmpf3bam, options.output1) + # either create index based on fa file or copy provided index to temp directory + try: + os.system(cmd1) + except Exception, eq: + stop_err("Error creating the reference list index.\n" + str(eq)) + # create original bam file + try: + os.system(cmd2) + except Exception, eq: + stop_err("Error running view command.\n" + str(eq)) + # sort original bam file to produce sorted output bam file + try: + os.system(cmd3) + os.system(cmd4) + except Exception, eq: + stop_err("Error sorting data and creating output file.\n" + str(eq)) + # cleanup temp files + tmpf1.close() + tmpf2.close() + tmpf3.close() + if os.path.exists(tmpf1fai): + os.remove(tmpf1fai) + if os.path.exists(tmpf3bam): + os.remove(tmpf3bam) + +if __name__=="__main__": __main__() diff -r d261f41a2a03 -r 36f438ce1f82 tools/samtools/sam_to_bam.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/samtools/sam_to_bam.xml Fri Aug 28 15:59:16 2009 -0400 @@ -0,0 +1,59 @@ +<tool id="sam_to_bam" name="SAM-to-BAM" version="1.0.0"> + <description>converts SAM format to BAM format</description> + <command interpreter="python"> + sam_to_bam.py + --input1=$source.input1 + --dbkey=${input1.metadata.dbkey} + #if $source.indexSource == "history": + --ref_file=$ref_file + #else + --ref_file="None" + #end if + --output1=$output1 + --index_dir=${GALAXY_DATA_INDEX_DIR} + </command> + <inputs> + <conditional name="source"> + <param name="indexSource" type="select" label="Choose the source for the reference list"> + <option value="built_in">Built-in</option> + <option value="history">History</option> + </param> + <when value="built_in"> + <param name="input1" type="data" format="sam" label="SAM File to Convert"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_file" filename="sam_fa_indices.loc" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." line_startswith="index" /> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="sam" label="SAM File to Convert" /> + <param name="ref_file" type="data" format="fasta" label="Choose the reference file" /> + </when> + </conditional> + </inputs> + <outputs> + <data name="output1" format="bam"/> + </outputs> + <tests> + <test> + <param name="indexSource" value="history" /> + <param name="input1" value="sam_to_bam_in1.sam" ftype="sam" /> + <param name="ref_file" value="chrM.fa" ftype="fasta" /> + <output name="output1" file="sam_to_bam_out1.bam" /> + </test> + <test> + <param name="indexSource" value="built_in" /> + <param name="input1" value="sam_to_bam_in2.sam" ftype="sam" dbkey="chrM" /> + <param name="ref_file" value="chrM.fa" ftype="fasta" /> + <output name="output1" file="sam_to_bam_out2.bam" /> + </test> + </tests> + <help> + +**What it does** + +This tool uses the SAMTools_ toolkit to produce a BAM file based on a sorted input SAM file. + +.. _SAMTools: http://samtools.sourceforge.net/samtools.shtml + + </help> +</tool>

1 0

[hg] galaxy 2641: web controller to handle tagging (add/remove/a...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/6b66a5e142ab changeset: 2641:6b66a5e142ab user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:27:01 2009 -0400 description: web controller to handle tagging (add/remove/autocomplete) 1 file(s) affected in this change: lib/galaxy/web/controllers/tag.py diffs (151 lines): diff -r b85cb0a65f46 -r 6b66a5e142ab lib/galaxy/web/controllers/tag.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/web/controllers/tag.py Fri Aug 28 15:27:01 2009 -0400 @@ -0,0 +1,147 @@ +""" +Tags Controller: handles tagging/untagging of entities and provides autocomplete support. +""" + +from galaxy.web.base.controller import * +from galaxy.tags.tag_handler import * +from sqlalchemy.sql.expression import func, and_ +from sqlalchemy.sql import select + +class TagsController ( BaseController ): + + def __init__(self, app): + BaseController.__init__(self, app) + + # Set up dict for mapping from short-hand to full item class. + self.shorthand_to_item_class_dict = dict() + self.shorthand_to_item_class_dict["history"] = History + self.shorthand_to_item_class_dict["hda"] = HistoryDatasetAssociation + + # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, ... + self.tag_handler = TagHandler() + self.tag_handler.add_tag_assoc_class(History, HistoryTagAssociation) + self.tag_handler.add_tag_assoc_class(HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation) + + @web.expose + def add_tag_async( self, trans, id=None, item_type=None, new_tag=None ): + """ Add tag to an item. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + trans.sa_session.flush() + + @web.expose + def remove_tag_async( self, trans, id=None, item_type=None, tag_name=None ): + """ Remove tag from an item. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + self.tag_handler.remove_item_tag(item, tag_name) + trans.sa_session.flush() + + # Retag an item. All previous tags are deleted and new tags are applied. + @web.expose + def retag_async( self, trans, id=None, item_type=None, new_tags=None ): + """ Apply a new set of tags to an item; previous tags are deleted. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + tag_handler.delete_item_tags(item) + self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + trans.sa_session.flush() + + tag_handler.delete_item_tags(history) + tag_handler.apply_item_tags(trans.sa_session, history, new_tags) + # Flush to complete changes. + trans.sa_session.flush() + + @web.expose + @web.require_login( "get autocomplete data for an item's tags" ) + def tag_autocomplete_data(self, trans, id=None, item_type=None, q=None, limit=None, timestamp=None): + """ Get autocomplete data for an item's tags. """ + item = self._get_item(trans, item_type, trans.security.decode_id(id)) + + self._do_security_check(trans, item) + + # + # Get user's item tags and usage counts. + # + + # Get item-tag association class. + item_tag_assoc_class = self.tag_handler.get_tag_assoc_class(item.__class__) + + # Build select statement. + cols_to_select = [ item_tag_assoc_class.table.c.tag_id, item_tag_assoc_class.table.c.user_tname, item_tag_assoc_class.table.c.user_value, func.count('*') ] + from_obj = item_tag_assoc_class.table.join(item.table).join(Tag) + where_clause = self._get_column_for_filtering_item_by_user_id(item)==trans.get_user().id + order_by = [ func.count("*").desc() ] + ac_for_names = not q.endswith(":") + if ac_for_names: + # Autocomplete for tag names. + where_clause = and_(where_clause, Tag.table.c.name.like(q + "%")) + group_by = item_tag_assoc_class.table.c.tag_id + else: + # Autocomplete for tag values. + tag_name_and_value = q.split(":") + tag_name = tag_name_and_value[0] + tag_value = tag_name_and_value[1] + where_clause = and_(where_clause, Tag.table.c.name==tag_name) + where_clause = and_(where_clause, item_tag_assoc_class.table.c.value.like(tag_value + "%")) + group_by = item_tag_assoc_class.table.c.value + + # Do query and get result set. + query = select(columns=cols_to_select, from_obj=from_obj, + whereclause=where_clause, group_by=group_by, order_by=order_by) + result_set = trans.sa_session.execute(query) + + # Create and return autocomplete data. + if ac_for_names: + # Autocomplete for tag names. + ac_data = "#Header|Your Tags\n" + for row in result_set: + # Exclude tags that are already applied to the history. + if self.tag_handler.item_has_tag(item, row[1]): + continue + # Add tag to autocomplete data. + ac_data += row[1] + "|" + row[1] + "\n" + else: + # Autocomplete for tag values. + ac_data = "#Header|Your Values for '%s'\n" % (tag_name) + for row in result_set: + ac_data += tag_name + ":" + row[2] + "|" + row[2] + "\n" + + return ac_data + + def _get_column_for_filtering_item_by_user_id(self, item): + """ Returns the column to use when filtering by user id. """ + if isinstance(item, History): + return item.table.c.user_id + elif isinstance(item, HistoryDatasetAssociation): + # Use the user_id associated with the HDA's history. + history = item.history + return history.table.c.user_id + + def _get_item(self, trans, item_type, id): + """ Get an item based on type and id. """ + item_class = self.shorthand_to_item_class_dict[item_type] + item = trans.sa_session.query(item_class).filter("id=" + str(id))[0] + return item; + + def _do_security_check(self, trans, item): + """ Do security check on an item. """ + if isinstance(item, History): + history = item; + # Check that the history exists, and is either owned by the current + # user (if logged in) or the current history + assert history is not None + if history.user is None: + assert history == trans.get_history() + else: + assert history.user == trans.user + elif isinstance(item, HistoryDatasetAssociation): + # TODO. + pass

1 0

[hg] galaxy 2640: Performance improvements in the GalaxyRBACAgen...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/cc4944a62b66 changeset: 2640:cc4944a62b66 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Aug 28 16:52:58 2009 -0400 description: Performance improvements in the GalaxyRBACAgent for checking access permissions on libraries. Also added information to main config regarding mysql timeouts ( resolves ticket # 132 ). 27 file(s) affected in this change: lib/galaxy/model/__init__.py lib/galaxy/model/mapping.py lib/galaxy/security/__init__.py lib/galaxy/tools/actions/__init__.py lib/galaxy/tools/parameters/basic.py lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/dataset.py lib/galaxy/web/controllers/history.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/root.py templates/admin/library/browse_library.mako templates/dataset/edit_attributes.mako templates/library/browse_library.mako templates/library/common.mako templates/library/folder_info.mako templates/library/folder_permissions.mako templates/library/ldda_edit_info.mako templates/library/ldda_info.mako templates/library/library_dataset_info.mako templates/library/library_dataset_permissions.mako templates/library/library_info.mako templates/library/library_permissions.mako templates/mobile/history/detail.mako templates/mobile/manage_library.mako templates/root/history_common.mako test/base/twilltestcase.py universe_wsgi.ini.sample diffs (1463 lines): diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/model/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -723,15 +723,19 @@ return None @property def active_components( self ): - return list( self.active_folders ) + list( self.active_datasets ) + return list( self.active_folders ) + list( self.active_library_datasets ) + @property + def active_library_datasets( self ): + # This needs to be a list + return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] + @property + def activatable_library_datasets( self ): + # This needs to be a list + return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.dataset.deleted ] @property def active_datasets( self ): # This needs to be a list - return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] - @property - def activatable_datasets( self ): - # This needs to be a list - return [ ld for ld in self.datasets if not ld.library_dataset_dataset_association.dataset.deleted ] + return [ ld.library_dataset_dataset_association.dataset for ld in self.datasets if not ld.library_dataset_dataset_association.deleted ] @property #make this a relation def activatable_folders( self ): # This needs to be a list diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/model/mapping.py Fri Aug 28 16:52:58 2009 -0400 @@ -740,7 +740,7 @@ assign_mapper( context, DatasetPermissions, DatasetPermissions.table, properties=dict( dataset=relation( Dataset, backref="actions" ), - role=relation( Role, backref="actions" ) + role=relation( Role, backref="dataset_actions" ) ) ) diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/security/__init__.py --- a/lib/galaxy/security/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/security/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -33,8 +33,10 @@ def get_actions( self ): """Get all permitted actions as a list of Action objects""" return self.permitted_actions.__dict__.values() - def allow_action( self, user, action, **kwd ): + def allow_action( self, user, roles, action, **kwd ): raise 'No valid method of checking action (%s) on %s for user %s.' % ( action, kwd, user ) + def get_item_action( self, action, item ): + raise 'No valid method of retrieving action (%s) for item %s.' % ( action, item ) def guess_derived_permissions_for_datasets( self, datasets = [] ): raise "Unimplemented Method" def associate_components( self, **kwd ): @@ -79,40 +81,48 @@ ( self.model.LibraryFolder, self.model.LibraryFolderPermissions ), ( self.model.LibraryDataset, self.model.LibraryDatasetPermissions ), ( self.model.LibraryDatasetDatasetAssociation, self.model.LibraryDatasetDatasetAssociationPermissions ) ) - def allow_action( self, user, action, **kwd ): + @property + def sa_session( self ): + """ + Returns a SQLAlchemy session -- currently just gets the current + session from the threadlocal session context, but this is provided + to allow migration toward a more SQLAlchemy 0.4 style of use. + """ + return self.model.context.current + def allow_action( self, user, roles, action, **kwd ): if 'dataset' in kwd: - return self.allow_dataset_action( user, action, kwd[ 'dataset' ] ) + return self.allow_dataset_action( user, roles, action, kwd[ 'dataset' ] ) elif 'library_item' in kwd: - return self.allow_library_item_action( user, action, kwd[ 'library_item' ] ) + return self.allow_library_item_action( user, roles, action, kwd[ 'library_item' ] ) raise 'No valid method of checking action (%s) for user %s using kwd %s' % ( action, str( user ), str( kwd ) ) - def allow_dataset_action( self, user, action, dataset ): + def allow_dataset_action( self, user, roles, action, dataset ): """Returns true when user has permission to perform an action""" - if not isinstance( dataset, self.model.Dataset ): - dataset = dataset.dataset if not user: if action == self.permitted_actions.DATASET_ACCESS and action.action not in [ dp.action for dp in dataset.actions ]: - return True # anons only get access, and only if there are no roles required for the access action - # other actions (or if the dataset has roles defined for the access action) fall through to the false below + # anons only get access, and only if there are no roles required for the access action + # Other actions (or if the dataset has roles defined for the access action) fall through + # to the false below + return True elif action.action not in [ dp.action for dp in dataset.actions ]: if action.model == 'restrict': - return True # implicit access to restrict-style actions if the dataset does not have the action - # grant-style actions fall through to the false below + # Implicit access to restrict-style actions if the dataset does not have the action + # Grant style actions fall through to the false below + return True else: - user_role_ids = sorted( [ r.id for r in user.all_roles() ] ) perms = self.get_dataset_permissions( dataset ) if action in perms.keys(): # The filter() returns a list of the dataset's role ids of which the user is not a member, # so an empty list means the user has all of the required roles. - if not filter( lambda x: x not in user_role_ids, [ r.id for r in perms[ action ] ] ): - return True # user has all of the roles required to perform the action - # Fall through to the false because the user is missing at least one required role - return False # default is to reject - def allow_library_item_action( self, user, action, library_item ): + if not filter( lambda x: x not in roles, [ r for r in perms[ action ] ] ): + # User has all of the roles required to perform the action + return True + # The user is missing at least one required role + return False + def allow_library_item_action( self, user, roles, action, library_item ): if user is None: # All permissions are granted, so non-users cannot have permissions return False if action.model == 'grant': - user_role_ids = [ r.id for r in user.all_roles() ] # Check to see if user has access to any of the roles allowed_role_assocs = [] for item_class, permission_class in self.library_item_assocs: @@ -126,11 +136,17 @@ elif permission_class == self.model.LibraryDatasetDatasetAssociationPermissions: allowed_role_assocs = permission_class.filter_by( action=action.action, library_dataset_dataset_association_id=library_item.id ).all() for allowed_role_assoc in allowed_role_assocs: - if allowed_role_assoc.role_id in user_role_ids: + if allowed_role_assoc.role in roles: return True return False else: raise 'Unimplemented model (%s) specified for action (%s)' % ( action.model, action.action ) + def get_item_action( self, action, item ): + # item must be one of: Dataset, Library, LibraryFolder, LibraryDataset, LibraryDatasetDatasetAssociation + for permission in item.actions: + if permission.action == action: + return permission + return None def guess_derived_permissions_for_datasets( self, datasets=[] ): """Returns a dict of { action : [ role, role, ... ] } for the output dataset based upon provided datasets""" perms = {} @@ -260,7 +276,10 @@ if [ assoc for assoc in dataset.history_associations if assoc.history not in user.histories ]: # Don't change permissions on a dataset associated with a history not owned by the user continue - if bypass_manage_permission or self.allow_action( user, self.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=dataset ): + if bypass_manage_permission or self.allow_action( user, + user.all_roles(), + self.permitted_actions.DATASET_MANAGE_PERMISSIONS, + dataset=dataset ): self.set_all_dataset_permissions( dataset, permissions ) def history_get_default_permissions( self, history ): permissions = {} @@ -402,17 +421,18 @@ lp = permission_class( action.action, target_library_item, private_role ) lp.flush() else: - raise 'Invalid class (%s) specified for target_library_item (%s)' % ( target_library_item.__class__, target_library_item.__class__.__name__ ) - def show_library_item( self, user, library_item ): - if self.allow_action( user, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \ - self.allow_action( user, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \ - self.allow_action( user, self.permitted_actions.LIBRARY_ADD, library_item=library_item ): + raise 'Invalid class (%s) specified for target_library_item (%s)' % \ + ( target_library_item.__class__, target_library_item.__class__.__name__ ) + def show_library_item( self, user, roles, library_item ): + if self.allow_action( user, roles, self.permitted_actions.LIBRARY_MODIFY, library_item=library_item ) or \ + self.allow_action( user, roles, self.permitted_actions.LIBRARY_MANAGE, library_item=library_item ) or \ + self.allow_action( user, roles, self.permitted_actions.LIBRARY_ADD, library_item=library_item ): return True if isinstance( library_item, self.model.Library ): - return self.show_library_item( user, library_item.root_folder ) + return self.show_library_item( user, roles, library_item.root_folder ) elif isinstance( library_item, self.model.LibraryFolder ): for folder in library_item.folders: - if self.show_library_item( user, folder ): + if self.show_library_item( user, roles, folder ): return True return False def set_entity_user_associations( self, users=[], roles=[], groups=[], delete_existing_assocs=True ): @@ -462,26 +482,30 @@ if 'role' in kwd: return self.model.GroupRoleAssociation.filter_by( role_id = kwd['role'].id, group_id = kwd['group'].id ).first() raise 'No valid method of associating provided components: %s' % kwd - def check_folder_contents( self, user, entry ): + def check_folder_contents( self, user, roles, folder ): """ - Return true if there are any datasets under 'folder' that the - user has access permission on. We do this a lot and it's a - pretty inefficient method, optimizations are welcomed. + Return true if there are any datasets under 'folder' that are public or that the + user has access permission on. """ - if isinstance( entry, self.model.Library ): - return self.check_folder_contents( user, entry.root_folder ) - elif isinstance( entry, self.model.LibraryFolder ): - for library_dataset in entry.active_datasets: - if self.allow_action( user, self.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): - return True - for folder in entry.active_folders: - if self.check_folder_contents( user, folder ): - return True - return False - elif isinstance( entry, self.model.LibraryDatasetDatasetAssociation ): - return self.allow_action( user, self.permitted_actions.DATASET_ACCESS, dataset=entry.dataset ) - else: - raise 'Passed an illegal object to check_folder_contents: %s' % type( entry ) + action = self.permitted_actions.DATASET_ACCESS.action + lddas = self.sa_session.query( self.model.LibraryDatasetDatasetAssociation ) \ + .join( "library_dataset" ) \ + .filter( self.model.LibraryDataset.folder == folder ) \ + .join( "dataset" ) \ + .options( eagerload_all( "dataset.actions" ) ) \ + .all() + for ldda in lddas: + ldda_access = self.get_item_action( action, ldda.dataset ) + if ldda_access is None: + # Dataset is public + return True + if ldda_access.role in roles: + # The current user has access permission on the dataset + return True + for sub_folder in folder.active_folders: + if self.check_folder_contents( user, roles, sub_folder ): + return True + return False class HostAgent( RBACAgent ): """ diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/tools/actions/__init__.py --- a/lib/galaxy/tools/actions/__init__.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/tools/actions/__init__.py Fri Aug 28 16:52:58 2009 -0400 @@ -47,8 +47,15 @@ assoc.dataset = new_data assoc.flush() data = new_data - # TODO, Nate: Make sure the permitted actions here are appropriate. - if data and not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset=data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if data and not trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id return data if isinstance( input, DataToolParameter ): @@ -261,10 +268,17 @@ # parameters to the command as a special case. for name, value in tool.params_to_strings( incoming, trans.app ).iteritems(): job.add_parameter( name, value ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for name, dataset in inp_data.iteritems(): if dataset: - # TODO, Nate: Make sure the permitted actions here are appropriate. - if not trans.app.security_agent.allow_action( trans.user, dataset.permitted_actions.DATASET_ACCESS, dataset=dataset ): + if not trans.app.security_agent.allow_action( user, + roles, + dataset.permitted_actions.DATASET_ACCESS, + dataset=dataset.dataset ): raise "User does not have permission to use a dataset (%s) provided for input." % data.id job.add_input_dataset( name, dataset ) else: diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/tools/parameters/basic.py --- a/lib/galaxy/tools/parameters/basic.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/tools/parameters/basic.py Fri Aug 28 16:52:58 2009 -0400 @@ -1137,6 +1137,11 @@ field = form_builder.SelectField( self.name, self.multiple, None, self.refresh_on_change, refresh_on_change_values = self.refresh_on_change_values ) # CRUCIAL: the dataset_collector function needs to be local to DataToolParameter.get_html_field() def dataset_collector( hdas, parent_hid ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for i, hda in enumerate( hdas ): if len( hda.name ) > 30: hda_name = '%s..%s' % ( hda.name[:17], hda.name[-11:] ) @@ -1148,12 +1153,18 @@ hid = str( hda.hid ) if not hda.dataset.state in [galaxy.model.Dataset.states.ERROR, galaxy.model.Dataset.states.DISCARDED] and \ hda.visible and \ - trans.app.security_agent.allow_action( trans.user, hda.permitted_actions.DATASET_ACCESS, dataset=hda ): + trans.app.security_agent.allow_action( user, + roles, + hda.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): # If we are sending data to an external application, then we need to make sure there are no roles # associated with the dataset that restrict it's access from "public". We determine this by sending # None as the user to the allow_action method. if self.tool and self.tool.tool_type == 'data_destination': - if not trans.app.security_agent.allow_action( None, hda.permitted_actions.DATASET_ACCESS, dataset=hda ): + if not trans.app.security_agent.allow_action( None, + None, + hda.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): continue if self.options and hda.get_dbkey() != filter_value: continue @@ -1165,7 +1176,10 @@ if target_ext: if converted_dataset: hda = converted_dataset - if not trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=hda.dataset ): + if not trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.DATASET_ACCESS, + dataset=hda.dataset ): continue selected = ( value and ( hda in value ) ) field.add_option( "%s: (as %s) %s" % ( hid, target_ext, hda_name ), hda.id, selected ) diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Fri Aug 28 16:52:58 2009 -0400 @@ -269,7 +269,7 @@ gra.delete() gra.flush() # Delete DatasetPermissionss - for dp in role.actions: + for dp in role.dataset_actions: dp.delete() dp.flush() msg = "The following have been purged from the database for role '%s': " % role.name @@ -997,16 +997,8 @@ msg=msg, messagetype=messagetype ) elif action == 'delete': - def delete_folder( folder ): - folder.refresh() - for subfolder in folder.active_folders: - delete_folder( subfolder ) - for ldda in folder.active_datasets: - ldda.deleted = True - ldda.flush() - folder.deleted = True - folder.flush() - delete_folder( folder ) + folder.deleted = True + folder.flush() msg = "Folder '%s' and all of its contents have been marked deleted" % folder.name return trans.response.send_redirect( web.url_for( action='browse_library', id=library_id, diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Fri Aug 28 16:52:58 2009 -0400 @@ -108,7 +108,15 @@ data = trans.app.model.HistoryDatasetAssociation.get( dataset_id ) if not data: raise paste.httpexceptions.HTTPRequestRangeNotSatisfiable( "Invalid reference dataset id: %s." % str( dataset_id ) ) - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to view it." ) if filename is None or filename.lower() == "index": @@ -142,9 +150,17 @@ if 'display_url' not in kwd or 'redirect_url' not in kwd: return trans.show_error_message( 'Invalid parameters specified for "display at" link, please contact a Galaxy administrator' ) redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] ) - if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( None, None, data.permitted_actions.DATASET_ACCESS, dataset=data.dataset ): return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site ) return trans.response.send_redirect( redirect_url ) else: diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Aug 28 16:52:58 2009 -0400 @@ -411,6 +411,7 @@ err_msg=err_msg, share_button=True ) ) user = trans.get_user() + user_roles = user.all_roles() histories, send_to_users, send_to_err = self._get_histories_and_users( trans, user, id, email ) send_to_err = '' # The user has made a choice, so dictionaries will be built for sharing @@ -442,13 +443,15 @@ for hda in history.activatable_datasets: # If the current dataset is not public, we may need to perform an action on it to # make it accessible by the other user. - if not trans.app.security_agent.allow_action( send_to_user, + if not trans.app.security_agent.allow_action( send_to_user, + send_to_user.all_roles(), trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda ): + dataset=hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, + if trans.app.security_agent.allow_action( user, + user_roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda ) and not hda.dataset.library_associations: + dataset=hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. @@ -525,6 +528,7 @@ cannot_change = {} no_change_needed = {} unique_no_change_needed = {} + user_roles = user.all_roles() for history in histories: for send_to_user in send_to_users: # Make sure the current history has not already been shared with the current send_to_user @@ -552,13 +556,15 @@ no_change_needed[ send_to_user ][ history ] = [ hda ] else: no_change_needed[ send_to_user ][ history ].append( hda ) - elif not trans.app.security_agent.allow_action( send_to_user, + elif not trans.app.security_agent.allow_action( send_to_user, + send_to_user.all_roles(), trans.app.security_agent.permitted_actions.DATASET_ACCESS, - dataset=hda ): + dataset=hda.dataset ): # The user with which we are sharing the history does not have access permission on the current dataset - if trans.app.security_agent.allow_action( user, + if trans.app.security_agent.allow_action( user, + user_roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, - dataset=hda ) and not hda.dataset.library_associations: + dataset=hda.dataset ) and not hda.dataset.library_associations: # The current user has authority to change permissions on the current dataset because # they have permission to manage permissions on the dataset and the dataset is not associated # with a library. diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Fri Aug 28 16:52:58 2009 -0400 @@ -62,14 +62,29 @@ params = util.Params( kwd ) msg = util.restore_text( params.get( 'msg', '' ) ) messagetype = params.get( 'messagetype', 'done' ) - all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ).order_by( trans.app.model.Library.name ).all() + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted==False ) \ + .order_by( trans.app.model.Library.name ).all() authorized_libraries = [] for library in all_libraries: - if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ) or \ - trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ) or \ - trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ) or \ - trans.app.security_agent.check_folder_contents( trans.user, library ) or \ - trans.app.security_agent.show_library_item( trans.user, library ): + if trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_ADD, + library_item=library ) or \ + trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + library_item=library ) or \ + trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, + library_item=library ) or \ + trans.app.security_agent.check_folder_contents( user, roles, library.root_folder ) or \ + trans.app.security_agent.show_library_item( user, roles, library ): authorized_libraries.append( library ) return trans.fill_template( '/library/browse_libraries.mako', libraries=authorized_libraries, @@ -264,9 +279,15 @@ msg=util.sanitize_text( msg ), messagetype='error' ) ) seen = [] + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None for id in ldda_ids: ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( id ) - if not ldda or not trans.app.security_agent.allow_action( trans.user, + if not ldda or not trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset = ldda.dataset ): continue @@ -363,9 +384,15 @@ id=library_id, msg=util.sanitize_text( msg ), messagetype='error' ) ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None if action == 'information': if params.get( 'edit_attributes_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): if params.get( 'edit_attributes_button', False ): @@ -391,7 +418,8 @@ messagetype=messagetype ) elif action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library_dataset ): # The user clicked the Save button on the 'Associate With Roles' form @@ -436,6 +464,11 @@ last_used_build = replace_dataset.library_dataset_dataset_association.dbkey else: replace_dataset = None + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] @@ -479,10 +512,12 @@ if action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): permissions = {} @@ -523,7 +558,8 @@ elif action == 'edit_info': if params.get( 'change', False ): # The user clicked the Save button on the 'Change data type' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: @@ -546,7 +582,8 @@ messagetype=messagetype ) elif params.get( 'save', False ): # The user clicked the Save button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): old_name = ldda.name @@ -587,7 +624,8 @@ messagetype=messagetype ) elif params.get( 'detect', False ): # The user clicked the Auto-detect button on the 'Edit Attributes' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): for name, spec in ldda.datatype.metadata_spec.items(): @@ -611,7 +649,8 @@ msg=msg, messagetype=messagetype ) elif params.get( 'delete', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): ldda.deleted = True @@ -628,7 +667,8 @@ widgets=widgets, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): ldda.datatype.before_edit( ldda ) @@ -668,10 +708,12 @@ messagetype='error' ) ) if action == 'permissions': if params.get( 'update_roles_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): permissions = {} @@ -704,10 +746,12 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda ) and \ - trans.app.security_agent.allow_action( trans.user, + trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ): # Ensure that the permissions across all library items are identical, otherwise we can't update them together. @@ -741,10 +785,12 @@ library_id=library_id, msg=msg, messagetype=messagetype ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ) or \ - ( replace_dataset and trans.app.security_agent.allow_action( trans.user, + ( replace_dataset and trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=replace_dataset ) ): if params.get( 'new_dataset_button', False ): @@ -769,7 +815,8 @@ # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=check_ldda ): if replace_dataset: @@ -892,7 +939,13 @@ # Since permissions on all LibraryDatasetDatasetAssociations must be the same at this point, we only need # to check one of them to see if the current user can manage permissions on them. check_ldda = trans.app.model.LibraryDatasetDatasetAssociation.get( ldda_id_list[0] ) - if trans.app.security_agent.allow_action( trans.user, + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=check_ldda ): if replace_dataset: @@ -957,6 +1010,11 @@ id=library_id, msg=util.sanitize_text( msg ), messagetype='error' ) ) + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None if action == 'new': if params.new == 'submitted': new_folder = trans.app.model.LibraryFolder( name=util.restore_text( params.name ), @@ -994,7 +1052,8 @@ else: widgets = [] if params.get( 'rename_folder_button', False ): - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): old_name = folder.name @@ -1037,7 +1096,8 @@ elif action == 'permissions': if params.get( 'update_roles_button', False ): # The user clicked the Save button on the 'Associate With Roles' form - if trans.app.security_agent.allow_action( trans.user, + if trans.app.security_agent.allow_action( user, + roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): permissions = {} @@ -1162,12 +1222,24 @@ msg=util.sanitize_text( msg ), messagetype='done' ) ) - -def get_authorized_libs(trans, user): - all_libraries = trans.app.model.Library.filter(trans.app.model.Library.table.c.deleted == False).order_by(trans.app.model.Library.name).all() +def get_authorized_libs( trans, user ): + # TODO: this is a mis-named function - the name should reflect the authorization policy + # If user is not authenticated, this method should not even be called. Also, it looks + # like all that is using this is the new request stuff, so it should be placed there. + if not user: + return [] + roles = user.all_roles() + all_libraries = trans.app.model.Library.filter( trans.app.model.Library.table.c.deleted == False ) \ + .order_by( trans.app.model.Library.name ).all() authorized_libraries = [] for library in all_libraries: - if trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library) \ - or trans.app.security_agent.allow_action(user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library): - authorized_libraries.append(library) - return authorized_libraries \ No newline at end of file + if trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_ADD, + library_item=library ) \ + or trans.app.security_agent.allow_action( user, + roles, + trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, + library_item=library ): + authorized_libraries.append( library ) + return authorized_libraries diff -r 36f438ce1f82 -r cc4944a62b66 lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Fri Aug 28 15:59:16 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Fri Aug 28 16:52:58 2009 -0400 @@ -152,7 +152,15 @@ except: return "Dataset id '%s' is invalid" %str( id ) if data: - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset = data.dataset ): mime = trans.app.datatypes_registry.get_mimetype_by_extension( data.extension.lower() ) trans.response.set_content_type(mime) if tofile: @@ -184,7 +192,15 @@ if data: child = data.get_child_by_designation( designation ) if child: - if trans.app.security_agent.allow_action( trans.user, child.permitted_actions.DATASET_ACCESS, dataset = child ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + child.permitted_actions.DATASET_ACCESS, + dataset = child ): return self.display( trans, id=child.id, tofile=tofile, toext=toext ) else: return "You are not privileged to access this dataset." @@ -200,11 +216,21 @@ if 'authz_method' in kwd: authz_method = kwd['authz_method'] if data: - if authz_method == 'rbac' and trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): + user = trans.user + if user: + roles = user.all_roles + else: + roles = None + if authz_method == 'rbac' and trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset = data ): trans.response.set_content_type( data.get_mime() ) trans.log_event( "Formatted dataset id %s for display at %s" % ( str( id ), display_app ) ) return data.as_display_type( display_app, **kwd ) - elif authz_method == 'display_at' and trans.app.host_security_agent.allow_action( trans.request.remote_addr, data.permitted_actions.DATASET_ACCESS, dataset = data ): + elif authz_method == 'display_at' and trans.app.host_security_agent.allow_action( trans.request.remote_addr, + data.permitted_actions.DATASET_ACCESS, + dataset = data ): trans.response.set_content_type( data.get_mime() ) return data.as_display_type( display_app, **kwd ) else: @@ -247,7 +273,15 @@ return trans.show_error_message( "Problem retrieving dataset." ) if id is not None and data.history.user is not None and data.history.user != trans.user: return trans.show_error_message( "This instance of a dataset (%s) in a history does not belong to you." % ( data.id ) ) - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset=data ): + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + if trans.app.security_agent.allow_action( user, + roles, + data.permitted_actions.DATASET_ACCESS, + dataset=data.dataset ): if data.state == trans.model.Dataset.states.UPLOAD: return trans.show_error_message( "Please wait until this dataset finishes uploading before attempting to edit its metadata." ) params = util.Params( kwd, safe=False ) @@ -313,7 +347,10 @@ elif params.update_roles_button: if not trans.user: return trans.show_error_message( "You must be logged in if you want to change permissions." ) - if trans.app.security_agent.allow_action( trans.user, data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data.dataset ): + if trans.app.security_agent.allow_action( user, + roles, + data.dataset.permitted_actions.DATASET_MANAGE_PERMISSIONS, + dataset = data.dataset ): permissions = {} for k, v in trans.app.model.Dataset.permitted_actions.items(): in_roles = params.get( k + '_in', [] ) diff -r 36f438ce1f82 -r cc4944a62b66 templates/admin/library/browse_library.mako --- a/templates/admin/library/browse_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/admin/library/browse_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -138,12 +138,12 @@ %if show_deleted: <% parent_folders = folder.activatable_folders - parent_datasets = folder.activatable_datasets + parent_datasets = folder.activatable_library_datasets %> %else: <% parent_folders = folder.active_folders - parent_datasets = folder.active_datasets + parent_datasets = folder.active_library_datasets %> %endif %for folder in name_sorted( parent_folders ): diff -r 36f438ce1f82 -r cc4944a62b66 templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Fri Aug 28 16:52:58 2009 -0400 @@ -3,6 +3,13 @@ <%def name="title()">${_('Edit Dataset Attributes')}</%def> +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> <%def name="datatype( dataset, datatypes )"> <select name="datatype"> @@ -134,9 +141,9 @@ </div> <p /> -%if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ): +%if trans.app.security_agent.allow_action( user, user_roles, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=data.dataset ): <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> - ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), trans.user.all_roles() )} + ${render_permission_form( data.dataset, data.name, h.url_for( controller='root', action='edit', id=data.id ), user_roles )} %elif trans.user: <div class="toolForm"> <div class="toolFormTitle">View Permissions</div> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/browse_library.mako --- a/templates/library/browse_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/browse_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,15 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<% from galaxy import util %> +<% + from galaxy import util + from time import strftime + + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <%def name="title()">Browse data library</%def> <%def name="stylesheets()"> @@ -110,14 +119,14 @@ <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> %endif %endif @@ -126,24 +135,26 @@ <a class="action-button" href="${h.url_for( controller='library', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> %endif </div> - </td> <td>${ldda.message}</td> <td>${uploaded_by}</td> <td>${ldda.create_time.strftime( "%Y-%m-%d" )}</td> - </tr> - + </tr> <% my_row = row_counter.count row_counter.increment() %> </%def> - <%def name="render_folder( folder, folder_pad, created_ldda_ids, library_id, parent=None, row_counter=None )"> <% def show_folder(): - if trans.app.security_agent.check_folder_contents( trans.user, folder ) or trans.app.security_agent.show_library_item( trans.user, folder ): + ## TODO: instead of calling check_folder_contents(), which we've already done prior to getting here, + ## add a new method that will itself call check_folder_contents() and build a list of accessible folders + ## for each library - this should improve performance dor large libraries where the current user can only + ## access a small number of folders. + if trans.app.security_agent.check_folder_contents( user, roles, folder ) or \ + trans.app.security_agent.show_library_item( user, roles, folder ): return True return False if not show_folder: @@ -179,21 +190,21 @@ %endif <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="folder_img-${folder.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=folder.id )}">Add datasets to this folder</a> <a class="action-button" href="${h.url_for( controller='library', action='folder', new=True, id=folder.id, library_id=library_id )}">Create a new sub-folder in this folder</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">Edit this folder's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='folder', information=True, id=folder.id, library_id=library_id )}">View this folder's information</a> %endif %if forms and not folder.info_association: - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this folder</a> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): <a class="action-button" href="${h.url_for( controller='library', action='folder', permissions=True, id=folder.id, library_id=library_id )}">Edit this folder's permissions</a> %endif </div> @@ -208,11 +219,11 @@ %for child_folder in name_sorted( folder.active_folders ): ${render_folder( child_folder, pad, created_ldda_ids, library_id, my_row, row_counter )} %endfor - %for library_dataset in name_sorted( folder.active_datasets ): + %for library_dataset in name_sorted( folder.active_library_datasets ): <% selected = created_ldda_ids and library_dataset.library_dataset_dataset_association.id in created_ldda_ids %> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_ACCESS, dataset=library_dataset.library_dataset_dataset_association.dataset ): ${render_dataset( library_dataset, selected, library, pad, my_row, row_counter )} %endif %endfor @@ -221,7 +232,7 @@ <h2>Data Library “${library.name}”</h2> <ul class="manage-table-actions"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): %if not deleted: <li> <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library.root_folder.id )}"><span>Add datasets to this library</span></a> @@ -231,17 +242,17 @@ </li> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">Edit this library's information</a></li> %else: <li><a class="action-button" href="${h.url_for( controller='library', action='library', information=True, id=library.id )}">View this library's information</a></li> %endif %if forms and not library.info_association: - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=library ): <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, add=True )}">Add an information template to this library</a> %endif %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <li><a class="action-button" href="${h.url_for( controller='library', action='library', permissions=True, id=library.id )}">Edit this library's permissions</a></li> %endif </ul> @@ -265,7 +276,7 @@ </thead> </tr> <% row_counter = RowCounter() %> - ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, Nonw, row_counter )} + ${render_folder( library.root_folder, 0, created_ldda_ids, library.id, None, row_counter )} <tfoot> <tr> <td colspan="4" style="padding-left: 42px;"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/common.mako --- a/templates/library/common.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/common.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,65 +1,3 @@ -<% from time import strftime %> - -<%def name="render_dataset( library_dataset, selected, library )"> - <% - ## The received data must always be a LibraryDataset object, but the object id passed to methods from the drop down menu - ## should be the underlying ldda id to prevent id collision ( which could happen when displaying children, which are always - ## lddas ). We also need to make sure we're displaying the latest version of this library_dataset, so we display the attributes - ## from the ldda. - ldda = library_dataset.library_dataset_dataset_association - if ldda.user: - uploaded_by = ldda.user.email - else: - uploaded_by = 'anonymous' - if ldda == ldda.library_dataset.library_dataset_dataset_association: - current_version = True - else: - current_version = False - %> - <div class="historyItemWrapper historyItem historyItem-${ldda.state}" id="libraryItem-${ldda.id}"> - ## Header row for library items (name, state, action buttons) - <div class="historyItemTitleBar"> - <table cellspacing="0" cellpadding="0" border="0" width="100%"> - <tr> - <td width="*"> - %if selected: - <input type="checkbox" name="ldda_ids" value="${ldda.id}" checked/> - %else: - <input type="checkbox" name="ldda_ids" value="${ldda.id}"/> - %endif - <a href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, info=True )}"><b>${ldda.name[:60]}</b></a> - <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> - <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> - %else: - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> - %endif - ## We're disabling the ability to add templates at the LDDA and LibraryDataset level, but will leave this here for possible future use - ##%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_ADD, library_item=ldda.library_dataset ): - ## <a class="action-button" href="${h.url_for( controller='library', action='info_template', library_id=library.id, library_dataset_id=library_dataset.id, new_template=True )}">Add an information template to this dataset</a> - ##%endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): - <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library.id, folder_id=library_dataset.folder.id, replace_id=library_dataset.id )}">Upload a new version of this dataset</a> - %endif - %endif - %if ldda.has_data: - <a class="action-button" href="${h.url_for( controller='library', action='datasets', library_id=library.id, ldda_ids=str( ldda.id ), do_action='add' )}">Import this dataset into your current history</a> - <a class="action-button" href="${h.url_for( controller='library', action='download_dataset_from_folder', id=ldda.id, library_id=library.id )}">Download this dataset</a> - %endif - </div> - </td> - <td width="500">${ldda.message}</td> - <td width="150">${uploaded_by}</td> - <td width="60">${ldda.create_time.strftime( "%Y-%m-%d" )}</td> - </tr> - </table> - </div> - </div> -</%def> - <%def name="render_template_info( library_item, library_id, widgets, editable=True )"> <% library_item_type = 'unknown type' @@ -76,13 +14,18 @@ elif isinstance( library_item, trans.app.model.LibraryDatasetDatasetAssociation ): library_item_type = 'library_dataset_dataset_association' library_item_desc = 'library dataset' + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> %if widgets: <p/> <div class="toolForm"> <div class="toolFormTitle">Other information about ${library_item_desc} ${library_item.name}</div> <div class="toolFormBody"> - %if editable and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ): + %if editable and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_item ): <form name="edit_info" action="${h.url_for( controller='library', action='edit_template_info', library_id=library_id, num_widgets=len( widgets ) )}" method="post"> <input type="hidden" name="library_item_id" value="${library_item.id}"/> <input type="hidden" name="library_item_type" value="${library_item_type}"/> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/folder_info.mako --- a/templates/library/folder_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/folder_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -16,7 +24,7 @@ <div class="toolForm"> <div class="toolFormTitle">Edit folder name and description</div> <div class="toolFormBody"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=folder ): <form name="folder" action="${h.url_for( controller='library', action='folder', rename=True, id=folder.id, library_id=library_id )}" method="post" > <div class="form-row"> <label>Name:</label> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/folder_permissions.mako --- a/templates/library/folder_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/folder_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,6 +21,6 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=folder ): ${render_permission_form( folder, folder.name, h.url_for( controller='library', action='folder', id=folder.id, library_id=library_id, permissions=True ), trans.user.all_roles() )} %endif diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -2,6 +2,14 @@ <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> <% from galaxy import util %> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> %if ldda == ldda.library_dataset.library_dataset_dataset_association: <b><i>This is the latest version of this library dataset</i></b> @@ -32,7 +40,7 @@ </select> </%def> -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${ldda.name}</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/ldda_info.mako --- a/templates/library/ldda_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/ldda_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -8,6 +8,11 @@ current_version = True else: current_version = False + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> %if current_version: @@ -39,15 +44,15 @@ Information about ${ldda.name} <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> <div popupmenu="dataset-${ldda.id}-popup"> - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, edit_info=True )}">Edit this dataset's information</a> %else: <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, information=True )}">View this dataset's information</a> %endif - %if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): + %if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset=ldda.dataset ) and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, id=ldda.id, permissions=True )}">Edit this dataset's permissions</a> %endif - %if current_version and trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): + %if current_version and trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda.library_dataset ): <a class="action-button" href="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, replace_id=ldda.library_dataset.id )}">Upload a new version of this dataset</a> %endif %if ldda.has_data: @@ -92,6 +97,8 @@ <div><pre id="peek${ldda.id}" class="peek">${ldda.display_peek()}</pre></div> %endif ## Recurse for child datasets + ## TODO: eliminate this - child datasets are deprecated, and where does + ## render_dataset() come from anyway - it's not imported! %if len( ldda.visible_children ) > 0: <div> There are ${len( ldda.visible_children )} secondary datasets. diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_dataset_info.mako --- a/templates/library/library_dataset_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_dataset_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> %if library_dataset == library_dataset.library_dataset_dataset_association.library_dataset: <b><i>This is the latest version of this library dataset</i></b> @@ -19,7 +27,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library_dataset ): <div class="toolForm"> <div class="toolFormTitle">Edit attributes of ${library_dataset.name}</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_dataset_permissions.mako --- a/templates/library/library_dataset_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_dataset_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" />> + +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> %if library_dataset == library_dataset.library_dataset_dataset_association.library_dataset: <b><i>This is the latest version of this library dataset</i></b> @@ -19,7 +27,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ): +%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_manage, library_item=library_dataset ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_info.mako --- a/templates/library/library_info.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_info.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/library/common.mako" import="render_template_info" /> + +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> diff -r 36f438ce1f82 -r cc4944a62b66 templates/library/library_permissions.mako --- a/templates/library/library_permissions.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/library/library_permissions.mako Fri Aug 28 16:52:58 2009 -0400 @@ -1,6 +1,14 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> + +<% + user = trans.user + if user: + user_roles = user.all_roles() + else: + user_roles = None +%> <br/><br/> <ul class="manage-table-actions"> @@ -13,7 +21,7 @@ ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.allow_action( user, user_roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/mobile/history/detail.mako --- a/templates/mobile/history/detail.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/mobile/history/detail.mako Fri Aug 28 16:52:58 2009 -0400 @@ -36,8 +36,14 @@ <div class="secondary"> ## Body for history items, extra info and actions, data "peek" - - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + <% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None + %> + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "queued": <div>Job is waiting to run</div> diff -r 36f438ce1f82 -r cc4944a62b66 templates/mobile/manage_library.mako --- a/templates/mobile/manage_library.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/mobile/manage_library.mako Fri Aug 28 16:52:58 2009 -0400 @@ -3,11 +3,19 @@ <%namespace file="/dataset/security_common.mako" import="render_permission_form" /> <%namespace file="/library/common.mako" import="render_template_info" /> +<% + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None +%> + %if msg: ${render_msg( msg, messagetype )} %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=library ): <div class="toolForm"> <div class="toolFormTitle">Change library name and description</div> <div class="toolFormBody"> @@ -53,7 +61,7 @@ </div> </div> %endif -%if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): +%if trans.app.security_agent.allow_action( user, roles, trans.app.security_agent.permitted_actions.LIBRARY_MANAGE, library_item=library ): <% roles = trans.app.model.Role.filter( trans.app.model.Role.table.c.deleted==False ).order_by( trans.app.model.Role.table.c.name ).all() %> diff -r 36f438ce1f82 -r cc4944a62b66 templates/root/history_common.mako --- a/templates/root/history_common.mako Fri Aug 28 15:59:16 2009 -0400 +++ b/templates/root/history_common.mako Fri Aug 28 16:52:58 2009 -0400 @@ -2,12 +2,17 @@ ## Render the dataset `data` as history item, using `hid` as the displayed id <%def name="render_dataset( data, hid, show_deleted_on_refresh = False )"> <% - if data.state in ['no state','',None]: - data_state = "queued" - else: - data_state = data.state + if data.state in ['no state','',None]: + data_state = "queued" + else: + data_state = data.state + user = trans.user + if user: + roles = user.all_roles() + else: + roles = None %> - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div class="historyItemWrapper historyItem historyItem-${data_state} historyItem-noPermission" id="historyItem-${data.id}"> %else: <div class="historyItemWrapper historyItem historyItem-${data_state}" id="historyItem-${data.id}"> @@ -41,7 +46,7 @@ ## Body for history items, extra info and actions, data "peek" <div id="info${data.id}" class="historyItemBody"> - %if not trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): + %if not trans.app.security_agent.allow_action( user, roles, data.permitted_actions.DATASET_ACCESS, dataset = data.dataset ): <div>You do not have permission to view this dataset.</div> %elif data_state == "upload": <div>Dataset is uploading</div> diff -r 36f438ce1f82 -r cc4944a62b66 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Fri Aug 28 15:59:16 2009 -0400 +++ b/test/base/twilltestcase.py Fri Aug 28 16:52:58 2009 -0400 @@ -1229,7 +1229,7 @@ tc.fv( '1', 'new_element_description_1', ele_help_1.replace( '+', ' ' ) ) tc.submit( 'new_info_template_button' ) self.home() - def add_folder( self, library_id, folder_id, name='Folder One', description='NThis is Folder One' ): + def add_folder( self, library_id, folder_id, name='Folder One', description='This is Folder One' ): """Create a new folder""" self.home() self.visit_url( "%s/admin/folder?library_id=%s&id=%s&new=True" % ( self.url, library_id, folder_id ) ) diff -r 36f438ce1f82 -r cc4944a62b66 universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample Fri Aug 28 15:59:16 2009 -0400 +++ b/universe_wsgi.ini.sample Fri Aug 28 16:52:58 2009 -0400 @@ -25,6 +25,11 @@ #database_engine_option_echo_pool = true #database_engine_option_pool_size = 10 #database_engine_option_max_overflow = 20 + +# If using MySQL, see: +# http://rapd.wordpress.com/2008/03/02/sqlalchemy-sqlerror-operationalerror-2… +# To handle this issue, try the following setting: +#database_engine_option_pool_recycle = 7200 # Where dataset files are saved file_path = database/files

1 0

[hg] galaxy 2642: CSS code for tagging
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/116e79410240 changeset: 2642:116e79410240 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:29:47 2009 -0400 description: CSS code for tagging 2 file(s) affected in this change: static/june_2007_style/autocomplete_tagging.css.tmpl static/june_2007_style/blue/autocomplete_tagging.css diffs (276 lines): diff -r 6b66a5e142ab -r 116e79410240 static/june_2007_style/autocomplete_tagging.css.tmpl --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/june_2007_style/autocomplete_tagging.css.tmpl Fri Aug 28 15:29:47 2009 -0400 @@ -0,0 +1,133 @@ +/****************************************************************************/ +/* JQuery autocomplete code */ +/****************************************************************************/ + +.ac_results { + padding: 0px; + border: 1px solid black; + background-color: white; + overflow: hidden; + z-index: 99999; +} + +.ac_results ul { + width: 100%; + list-style-position: outside; + list-style: none; + padding: 0; + margin: 0; +} + +.ac_results li { + padding: 2px 5px; + cursor: default; + display: block; + /* + if width will be 100% horizontal scrollbar will apear + when scroll mode will be used + */ + /*width: 100%;*/ + /* font: menu; */ + font-size: 12px; + /* + it is very important, if line-height not setted or setted + in relative units scroll will be broken in firefox + */ + line-height: 16px; + overflow: hidden; +} + +.ac_loading { + background: white url('indicator.gif') right center no-repeat; +} + +.ac_odd { + background-color: #fff; /* #eee */ + margin-left: 0.3em; +} + +.ac_even { + margin-left: 0.3em; +} + +.ac_over { + background-color: #0A246A; + color: white; +} + +.ac_header { + font-style: normal; + color: gray; + border-bottom: 0.1em solid gray; +} + +/****************************************************************************/ +/* Custom code for supporting tags */ +/****************************************************************************/ +.tag-area { + width: 100%; + cursor: pointer; + border: solid 1px #eee; +} + +.active-tag-area { + background-color: white; +} + +.toggle-link +{ + font-weight: bold; + padding: 0.3em; + margin-bottom: 1em; + width: 100%; + padding: 0.2em 0em 0.2em 0em; +} + +.tag-button { + width: auto; + color: #444; + text-decoration: none; + display: inline-block; + cursor: pointer; + margin: 0.2em; + border: 0; + padding: 0.1em 0.5em 0.1em 0.5em; + -moz-border-radius: .5em; + -webkit-border-radius: .5em; + border-radius: .5em; + background:#bbb; +} + +.tag-button img +{ + padding-left: 0.4em; +} + +.tag-button .tag-name:hover +{ + color: white; +} + +.add-tag-button +{ + margin-bottom: 0.3em; + vertical-align: middle; + padding: 0.3em; +} + +.add-tag-button:hover +{ + cursor: pointer; +} + +.tag-input { + vertical-align: bottom; + border: none; + outline: none; +} + +.delete-tag-img +{ + + margin-left: 0.3em +} \ No newline at end of file diff -r 6b66a5e142ab -r 116e79410240 static/june_2007_style/blue/autocomplete_tagging.css --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/june_2007_style/blue/autocomplete_tagging.css Fri Aug 28 15:29:47 2009 -0400 @@ -0,0 +1,133 @@ +/****************************************************************************/ +/* JQuery autocomplete code */ +/****************************************************************************/ + +.ac_results { + padding: 0px; + border: 1px solid black; + background-color: white; + overflow: hidden; + z-index: 99999; +} + +.ac_results ul { + width: 100%; + list-style-position: outside; + list-style: none; + padding: 0; + margin: 0; +} + +.ac_results li { + padding: 2px 5px; + cursor: default; + display: block; + /* + if width will be 100% horizontal scrollbar will apear + when scroll mode will be used + */ + /*width: 100%;*/ + /* font: menu; */ + font-size: 12px; + /* + it is very important, if line-height not setted or setted + in relative units scroll will be broken in firefox + */ + line-height: 16px; + overflow: hidden; +} + +.ac_loading { + background: white url('indicator.gif') right center no-repeat; +} + +.ac_odd { + background-color: #fff; /* #eee */ + margin-left: 0.3em; +} + +.ac_even { + margin-left: 0.3em; +} + +.ac_over { + background-color: #0A246A; + color: white; +} + +.ac_header { + font-style: normal; + color: gray; + border-bottom: 0.1em solid gray; +} + +/****************************************************************************/ +/* Custom code for supporting tags */ +/****************************************************************************/ +.tag-area { + width: 100%; + cursor: pointer; + border: solid 1px #eee; +} + +.active-tag-area { + background-color: white; +} + +.toggle-link +{ + font-weight: bold; + padding: 0.3em; + margin-bottom: 1em; + width: 100%; + padding: 0.2em 0em 0.2em 0em; +} + +.tag-button { + width: auto; + color: #444; + text-decoration: none; + display: inline-block; + cursor: pointer; + margin: 0.2em; + border: 0; + padding: 0.1em 0.5em 0.1em 0.5em; + -moz-border-radius: .5em; + -webkit-border-radius: .5em; + border-radius: .5em; + background:#bbb; +} + +.tag-button img +{ + padding-left: 0.4em; +} + +.tag-button .tag-name:hover +{ + color: white; +} + +.add-tag-button +{ + margin-bottom: 0.3em; + vertical-align: middle; + padding: 0.3em; +} + +.add-tag-button:hover +{ + cursor: pointer; +} + +.tag-input { + vertical-align: bottom; + border: none; + outline: none; +} + +.delete-tag-img +{ + + margin-left: 0.3em +} \ No newline at end of file

1 0

[hg] galaxy 2643: JS files for tagging
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/1835c027763a changeset: 2643:1835c027763a user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:31:06 2009 -0400 description: JS files for tagging 2 file(s) affected in this change: static/scripts/autocomplete_tagging.js static/scripts/jquery.autocomplete.js diffs (1285 lines): diff -r 116e79410240 -r 1835c027763a static/scripts/autocomplete_tagging.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/autocomplete_tagging.js Fri Aug 28 15:31:06 2009 -0400 @@ -0,0 +1,453 @@ +/** + * JQuery extension for tagging with autocomplete. + * @author: Jeremy Goecks + * @require: jquery.autocomplete plugin + */ +var ac_tag_area_id_gen = 1; + +jQuery.fn.autocomplete_tagging = function(options) { + + // + // Set up function defaults. + // + var defaults = + { + get_toggle_link_text_fn: function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + text = num_tags + (num_tags != 0 ? " Tags" : " Tag"); + else + // No tags. + text = "Add tags"; + return text; + }, + tag_click_fn : function (tag) { }, + input_size: 20, + in_form: false, + tags : {}, + use_toggle_link: true, + item_id: "", + add_tag_img: "", + add_tag_img_rollover: "", + delete_tag_img: "", + ajax_autocomplete_tag_url: "", + ajax_retag_url: "", + ajax_delete_tag_url: "", + ajax_add_tag_url: "" + }; + + // + // Extend object. + // + var settings = jQuery.extend(defaults, options); + + // + // Create core elements: tag area and TODO. + // + + // Tag area. + var area_id = "tag-area-" + (ac_tag_area_id_gen)++; + var tag_area = $("<div></div>").attr("id", area_id).addClass("tag-area"); + this.append(tag_area); + + // + // Returns the number of keys (elements) in an array/dictionary. + // + var array_length = function(an_array) + { + if (an_array.length) + return an_array.length; + + var count = 0; + for (element in an_array) + count++; + return count; + }; + + // + // Function to build toggle link. + // + var build_toggle_link = function() + { + var link_text = settings.get_toggle_link_text_fn(settings.tags); + var toggle_link = $("<a href='/history/tags'>" + link_text + "</a>").addClass("toggle-link"); + // Link toggles the display state of the tag area. + toggle_link.click( function() + { + // Take special actions depending on whether toggle is showing or hiding link. + var showing_tag_area = (tag_area.css("display") == "none"); + var after_toggle_fn; + if (showing_tag_area) + { + after_toggle_fn = function() + { + // If there are no tags, go right to editing mode by generating a + // click on the area. + var num_tags = array_length(settings.tags); + if (num_tags == 0) + tag_area.click(); + }; + } + else // Hiding area. + { + after_toggle_fn = function() + { + tag_area.blur(); + }; + } + tag_area.slideToggle("fast", after_toggle_fn); + + return false; + }); + + return toggle_link; + }; + + // Add toggle link. + var toggle_link = build_toggle_link(); + if (settings.use_toggle_link) + { + this.prepend(toggle_link); + } + + // + // Function to build other elements. + // + + // + // Return a string that contains the contents of an associative array. This is + // a debugging method. + // + var assoc_array_to_str = function(an_array) + { + // Convert associative array to simple array and then join array elements. + var array_str_list = new Array(); + for (key in an_array) + array_str_list[array_str_list.length] = key + "-->" + an_array[key]; + + return "{" + array_str_list.join(",") + "}" + }; + + // + // Collapse tag name + value into a single string. + // + var build_tag_str = function(tag_name, tag_value) + { + return tag_name + ( (tag_value != "" && tag_value) ? ":" + tag_value : ""); + }; + + // + // Get tag name and value from a string. + // + var get_tag_name_and_value = function(tag_str) + { + return tag_str.split(":"); + }; + + // + // Add "add tag" button. + // + var build_add_tag_button = function(tag_input_field) + { + var add_tag_button = $("<img src='" + settings.add_tag_img + "' rollover='" + settings.add_tag_img_rollover + "'/>").addClass("add-tag-button"); + + add_tag_button.click( function() + { + // Hide button. + $(this).hide(); + + // Clicking on button is the same as clicking on the tag area. + tag_area.click(); + + return false; + }); + + return add_tag_button; + }; + + // + // Function that builds a tag button. + // + var build_tag_button = function(tag_str) + { + // Build "delete tag" image and handler. + var delete_img = $("<img src='" + settings.delete_tag_img + "'/>").addClass("delete-tag-img"); + delete_img.mouseenter( function () + { + $(this).attr("src", settings.delete_tag_img_rollover); + }); + delete_img.mouseleave( function () + { + $(this).attr("src", settings.delete_tag_img); + }); + delete_img.click( function () + { + // Tag button is image's parent. + var tag_button = $(this).parent(); + + // Get tag name. + var tag_name_elt = tag_button.find(".tag-name").eq(0); + var tag_str = tag_name_elt.text(); + var tag_name = get_tag_name_and_value(tag_str)[0]; + + // TODO: should remove succeed if tag is not already applied to + // history? + tag_button.remove(); + + // Remove tag from local list for consistency. + delete settings.tags[tag_name]; + + // Update toggle link text. + var new_text = settings.get_toggle_link_text_fn(settings.tags); + toggle_link.text(new_text); + + // Delete tag. + $.ajax({ + url: settings.ajax_delete_tag_url, + data: { tag_name: tag_name }, + error: function() + { + // Failed. + alert( "Remove tag failed" ); + }, + success: function() + { + } + }); + + return true; + }); + + // Build tag button. + var tag_name_elt = $("<span>" + tag_str + "</span>").addClass("tag-name"); + tag_name_elt.click( function() + { + settings.tag_click_fn(tag_str); + return true; + }); + + var tag_button = $("<span></span>").addClass("tag-button"); + tag_button.append(tag_name_elt); + tag_button.append(delete_img); + + return tag_button; + }; + + // + // Build input + autocompete for tag. + // + var build_tag_input = function(tag_text) + { + // If element is in form, tag input is a textarea; otherwise element is a input type=text. + var t; + if (settings.in_form) + t = $( "<textarea id='history-tag-input' rows='1' cols='" + + settings.input_size + "' value='" + tag_text + "'></textarea>" ); + else // element not in form. + t = $( "<input id='history-tag-input' type='text' size='" + + settings.input_size + "' value='" + tag_text + "'></input>" ); + t.keyup( function( e ) + { + if ( e.keyCode == 27 ) + { + // Escape key + $(this).trigger( "blur" ); + } else if ( + ( e.keyCode == 13 ) || // Return Key + ( e.keyCode == 188 ) || // Comma + ( e.keyCode == 32 ) // Space + ) + { + // + // Check input. + // + + new_value = this.value; + + // Do nothing if return key was used to autocomplete. + if (return_key_pressed_for_autocomplete == true) + { + return_key_pressed_for_autocomplete = false; + return false; + } + + // Suppress space after a ":" + if ( new_value.indexOf(": ", new_value.length - 2) != -1) + { + this.value = new_value.substring(0, new_value.length-1); + return false; + } + + // Remove trigger keys from input. + if ( (e.keyCode == 188) || (e.keyCode == 32) ) + new_value = new_value.substring( 0 , new_value.length - 1 ); + + // Trim whitespace. + new_value = new_value.replace(/^\s+|\s+$/g,""); + + // Too short? + if (new_value.length < 3) + return false; + + // + // New tag OK - apply it. + // + + this.value = ""; + + // Add button for tag after all other tag buttons. + var new_tag_button = build_tag_button(new_value); + var tag_buttons = tag_area.children(".tag-button"); + if (tag_buttons.length != 0) + { + var last_tag_button = tag_buttons.slice(tag_buttons.length-1); + last_tag_button.after(new_tag_button); + } + else + tag_area.prepend(new_tag_button); + + // Add tag to internal list. + var tag_name_and_value = new_value.split(":"); + settings.tags[tag_name_and_value[0]] = tag_name_and_value[1]; + + // Update toggle link text. + var new_text = settings.get_toggle_link_text_fn(settings.tags); + toggle_link.text(new_text); + + // Commit tag to server. + var $this = $(this); + $.ajax({ + url: settings.ajax_add_tag_url, + data: { new_tag: new_value }, + error: function() + { + // Remove tag and show alert. + new_tag_button.remove(); + var new_text = settings.get_toggle_link_text_fn(settings.tags); + toggle_link.text(new_text); + alert( "Add tag failed" ); + }, + success: function() + { + // Flush autocomplete cache because it's not out of date. + // TODO: in the future, we could remove the particular item + // that was chosen from the cache rather than flush it. + $this.flushCache(); + } + }); + + return false; + } + }); + + // Add autocomplete to input. + var format_item_func = function(key, row_position, num_rows, value, search_term) { + tag_name_and_value = value.split(":"); + return (tag_name_and_value.length == 1 ? tag_name_and_value[0] :tag_name_and_value[1]); + //var array = new Array(key, value, row_position, num_rows, + //search_term ); return "\"" + array.join("*") + "\""; + } + var autocomplete_options = + { selectFirst: false, formatItem : format_item_func, autoFill: false, highlight: false }; + + t.autocomplete(settings.ajax_autocomplete_tag_url, autocomplete_options); + + t.addClass("tag-input"); + + return t; + }; + + // + // Build tag area. + // + + // Add tag buttons for each current tag to the tag area. + for (tag_name in settings.tags) + { + var tag_value = settings.tags[tag_name]; + var tag_str = build_tag_str(tag_name, tag_value); + var tag_button = build_tag_button(tag_str, toggle_link, settings.tags); + tag_area.append(tag_button); + } + + // Add tag input field and "add tag" button. + var tag_input_field = build_tag_input(""); + var add_tag_button = build_add_tag_button(tag_input_field); + + // When the tag area blurs, go to "view tag" mode. + tag_area.blur( function(e) + { + add_tag_button.show(); + tag_input_field.hide(); + tag_area.removeClass("active-tag-area"); + }); + + tag_area.append(add_tag_button); + tag_area.append(tag_input_field); + tag_input_field.hide(); + + // On click, enable user to add tags. + tag_area.click( function(e) + { + var is_active = $(this).hasClass("active-tag-area"); + + // If a "delete image" object was pressed and area is inactive, do nothing. + if ($(e.target).hasClass("delete-tag-img") && !is_active) + return false; + + // If a "tag name" object was pressed and area is inactive, do nothing. + if ($(e.target).hasClass("tag-name") && !is_active) + return false; + + // Hide add tag button, show tag_input field. Change background to show + // area is active. + $(this).addClass("active-tag-area"); + add_tag_button.hide(); + tag_input_field.show(); + tag_input_field.focus(); + + // Add handler to document that will call blur when the tag area is blurred; + // a tag area is blurred when a user clicks on an element outside the area. + var handle_document_click = function(e) + { + var tag_area_id = tag_area.attr("id"); + // Blur the tag area if the element clicked on is not in the tag area. + if ( + ($(e.target).attr("id") != tag_area_id) && + ($(e.target).parents().filter(tag_area_id).length == 0) + ) + { + tag_area.blur(); + $(document).unbind("click", handle_document_click); + } + }; + // TODO: we should attach the click handler to all frames in order to capture + // clicks outside the frame that this element is in. + //window.parent.document.onclick = handle_document_click; + //var temp = $(window.parent.document.body).contents().find("iframe").html(); + //alert(temp); + //$(document).parent().click(handle_document_click); + $(window).click(handle_document_click); + + return false; + }); + + // If using toggle link, hide the tag area. Otherwise, if there are no tags, + // hide the "add tags" button and show the input field. + if (settings.use_toggle_link) + tag_area.hide(); + else + { + var num_tags = array_length(settings.tags); + if (num_tags == 0) + { + add_tag_button.hide(); + tag_input_field.show(); + } + } + + + return this.addClass("tag-element"); +} diff -r 116e79410240 -r 1835c027763a static/scripts/jquery.autocomplete.js --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/static/scripts/jquery.autocomplete.js Fri Aug 28 15:31:06 2009 -0400 @@ -0,0 +1,824 @@ +/* + * Autocomplete - jQuery plugin 1.0.2 + * + * Copyright (c) 2007 Dylan Verheul, Dan G. Switzer, Anjesh Tuladhar, Jörn Zaefferer + * + * Dual licensed under the MIT and GPL licenses: + * http://www.opensource.org/licenses/mit-license.php + * http://www.gnu.org/licenses/gpl.html + * + * Revision: $Id: jquery.autocomplete.js 5747 2008-06-25 18:30:55Z joern.zaefferer $ + * + */ + +String.prototype.endsWith = function(str) {return (this.match(str+"$")==str)} + + +var return_key_pressed_for_autocomplete = false; + +;(function($) { + +$.fn.extend({ + autocomplete: function(urlOrData, options) { + var isUrl = typeof urlOrData == "string"; + options = $.extend({}, $.Autocompleter.defaults, { + url: isUrl ? urlOrData : null, + data: isUrl ? null : urlOrData, + delay: isUrl ? $.Autocompleter.defaults.delay : 10, + max: options && !options.scroll ? 10 : 150 + }, options); + + // if highlight is set to false, replace it with a do-nothing function + options.highlight = options.highlight || function(value) { return value; }; + + // if the formatMatch option is not specified, then use formatItem for backwards compatibility + options.formatMatch = options.formatMatch || options.formatItem; + + return this.each(function() { + new $.Autocompleter(this, options); + }); + }, + result: function(handler) { + return this.bind("result", handler); + }, + search: function(handler) { + return this.trigger("search", [handler]); + }, + flushCache: function() { + return this.trigger("flushCache"); + }, + setOptions: function(options){ + return this.trigger("setOptions", [options]); + }, + unautocomplete: function() { + return this.trigger("unautocomplete"); + } +}); + +$.Autocompleter = function(input, options) { + + var KEY = { + UP: 38, + DOWN: 40, + DEL: 46, + TAB: 9, + RETURN: 13, + ESC: 27, + COMMA: 188, + PAGEUP: 33, + PAGEDOWN: 34, + BACKSPACE: 8, + COLON: 16 + }; + + // Create $ object for input element + var $input = $(input).attr("autocomplete", "off").addClass(options.inputClass); + + var timeout; + var previousValue = ""; + var cache = $.Autocompleter.Cache(options); + var hasFocus = 0; + var lastKeyPressCode; + var config = { + mouseDownOnSelect: false + }; + var select = $.Autocompleter.Select(options, input, selectCurrent, config); + + var blockSubmit; + + // prevent form submit in opera when selecting with return key + $.browser.opera && $(input.form).bind("submit.autocomplete", function() { + if (blockSubmit) { + blockSubmit = false; + return false; + } + }); + + // only opera doesn't trigger keydown multiple times while pressed, others don't work with keypress at all + $input.bind(($.browser.opera ? "keypress" : "keydown") + ".autocomplete", function(event) { + // track last key pressed + lastKeyPressCode = event.keyCode; + switch(event.keyCode) { + + case KEY.UP: + event.preventDefault(); + if ( select.visible() ) { + select.prev(); + } else { + onChange(0, true); + } + break; + + case KEY.DOWN: + event.preventDefault(); + if ( select.visible() ) { + select.next(); + } else { + onChange(0, true); + } + break; + + case KEY.PAGEUP: + event.preventDefault(); + if ( select.visible() ) { + select.pageUp(); + } else { + onChange(0, true); + } + break; + + case KEY.PAGEDOWN: + event.preventDefault(); + if ( select.visible() ) { + select.pageDown(); + } else { + onChange(0, true); + } + break; + + // matches also semicolon + case options.multiple && $.trim(options.multipleSeparator) == "," && KEY.COMMA: + case KEY.TAB: + case KEY.RETURN: + if (event.keyCode == KEY.RETURN) + return_key_pressed_for_autocomplete = false; + if( selectCurrent() ) { + // stop default to prevent a form submit, Opera needs special handling + event.preventDefault(); + blockSubmit = true; + + // JG: set flag to indicate that a selection just occurred using the return key. FYI: + // event.stopPropagation() does not work. + if (event.keyCode == KEY.RETURN) + return_key_pressed_for_autocomplete = true; + + return false; + } + + case KEY.ESC: + select.hide(); + break; + case KEY.COLON: + break; + + default: + clearTimeout(timeout); + timeout = setTimeout(onChange, options.delay); + break; + } + }).focus(function(){ + // track whether the field has focus, we shouldn't process any + // results if the field no longer has focus + hasFocus++; + }).blur(function() { + hasFocus = 0; + if (!config.mouseDownOnSelect) { + // JG: if blur and user is not selecting with mouse, hide + // object. + select.hide(); + } + return this; + }).click(function() { + // show select when clicking in a focused field + if ( hasFocus++ > 1 && !select.visible() ) { + onChange(0, true); + } + return this; + }).bind("search", function() { + // TODO why not just specifying both arguments? + var fn = (arguments.length > 1) ? arguments[1] : null; + function findValueCallback(q, data) { + var result; + if( data && data.length ) { + for (var i=0; i < data.length; i++) { + if( data[i].result.toLowerCase() == q.toLowerCase() ) { + result = data[i]; + break; + } + } + } + if( typeof fn == "function" ) fn(result); + else $input.trigger("result", result && [result.data, result.value]); + } + $.each(trimWords($input.val()), function(i, value) { + request(value, findValueCallback, findValueCallback); + }); + + return this; + }).bind("flushCache", function() { + cache.flush(); + }).bind("setOptions", function() { + $.extend(options, arguments[1]); + // if we've updated the data, repopulate + if ( "data" in arguments[1] ) + cache.populate(); + }).bind("unautocomplete", function() { + select.unbind(); + $input.unbind(); + $(input.form).unbind(".autocomplete"); + }); + + + function selectCurrent() { + var selected = select.selected(); + if( !selected ) + return false; + + var v = selected.result; + previousValue = v; + + if ( options.multiple ) { + var words = trimWords($input.val()); + if ( words.length > 1 ) { + v = words.slice(0, words.length - 1).join( options.multipleSeparator ) + options.multipleSeparator + v; + } + v += options.multipleSeparator; + } + + $input.val(v); + hideResultsNow(); + $input.trigger("result", [selected.data, selected.value]); + return true; + } + + function onChange(crap, skipPrevCheck) { + if( lastKeyPressCode == KEY.DEL ) { + select.hide(); + return; + } + + var currentValue = $input.val(); + + if ( !skipPrevCheck && currentValue == previousValue ) + return; + + previousValue = currentValue; + + currentValue = lastWord(currentValue); + if ( currentValue.length >= options.minChars) { + $input.addClass(options.loadingClass); + if (!options.matchCase) + currentValue = currentValue.toLowerCase(); + request(currentValue, receiveData, hideResultsNow); + } else { + stopLoading(); + select.hide(); + } + }; + + function trimWords(value) { + if ( !value ) { + return [""]; + } + var words = value.split( options.multipleSeparator ); + var result = []; + $.each(words, function(i, value) { + if ( $.trim(value) ) + result[i] = $.trim(value); + }); + return result; + } + + function lastWord(value) { + if ( !options.multiple ) + return value; + var words = trimWords(value); + return words[words.length - 1]; + } + + // fills in the input box w/the first match (assumed to be the best match) + // q: the term entered + // sValue: the first matching result + function autoFill(q, sValue){ + // autofill in the complete box w/the first match as long as the user hasn't entered in more data + // if the last user key pressed was backspace, don't autofill + if( options.autoFill && (lastWord($input.val()).toLowerCase() == q.toLowerCase()) && lastKeyPressCode != KEY.BACKSPACE ) { + // fill in the value (keep the case the user has typed) + $input.val($input.val() + sValue.substring(lastWord(previousValue).length)); + // select the portion of the value not typed by the user (so the next character will erase) + $.Autocompleter.Selection(input, previousValue.length, previousValue.length + sValue.length); + } + }; + + function hideResults() { + clearTimeout(timeout); + timeout = setTimeout(hideResultsNow, 200); + }; + + function hideResultsNow() { + var wasVisible = select.visible(); + select.hide(); + clearTimeout(timeout); + stopLoading(); + if (options.mustMatch) { + // call search and run callback + $input.search( + function (result){ + // if no value found, clear the input box + if( !result ) { + if (options.multiple) { + var words = trimWords($input.val()).slice(0, -1); + $input.val( words.join(options.multipleSeparator) + (words.length ? options.multipleSeparator : "") ); + } + else + $input.val( "" ); + } + } + ); + } + if (wasVisible) + // position cursor at end of input field + $.Autocompleter.Selection(input, input.value.length, input.value.length); + }; + + function receiveData(q, data) { + if ( data && data.length && hasFocus ) { + stopLoading(); + select.display(data, q); + autoFill(q, data[0].value); + select.show(); + } else { + hideResultsNow(); + } + }; + + function request(term, success, failure) { + if (!options.matchCase) + term = term.toLowerCase(); + var data = cache.load(term); + + // JG: hack: if term ends with ':', kill data to force an ajax request. + if (term.endsWith(":")) + data = null; + + // recieve the cached data + if (data && data.length) { + success(term, data); + // if an AJAX url has been supplied, try loading the data now + } else if( (typeof options.url == "string") && (options.url.length > 0) ){ + var extraParams = { + timestamp: +new Date() + }; + $.each(options.extraParams, function(key, param) { + extraParams[key] = typeof param == "function" ? param() : param; + }); + + $.ajax({ + // try to leverage ajaxQueue plugin to abort previous requests + mode: "abort", + // limit abortion to this input + port: "autocomplete" + input.name, + dataType: options.dataType, + url: options.url, + data: $.extend({ + q: lastWord(term), + limit: options.max + }, extraParams), + success: function(data) { + var parsed = options.parse && options.parse(data) || parse(data); + cache.add(term, parsed); + success(term, parsed); + } + }); + } else { + // if we have a failure, we need to empty the list -- this prevents the the [TAB] key from selecting the last successful match + select.emptyList(); + failure(term); + } + }; + + function parse(data) { + var parsed = []; + var rows = data.split("\n"); + for (var i=0; i < rows.length; i++) { + var row = $.trim(rows[i]); + if (row) { + row = row.split("|"); + parsed[parsed.length] = { + data: row, + value: row[0], + result: options.formatResult && options.formatResult(row, row[0]) || row[0] + }; + } + } + return parsed; + }; + + function stopLoading() { + $input.removeClass(options.loadingClass); + }; + +}; + +$.Autocompleter.defaults = { + inputClass: "ac_input", + resultsClass: "ac_results", + loadingClass: "ac_loading", + minChars: 1, + delay: 400, + matchCase: false, + matchSubset: true, + matchContains: false, + cacheLength: 10, + max: 100, + mustMatch: false, + extraParams: {}, + selectFirst: true, + formatItem: function(row) { return row[0]; }, + formatMatch: null, + autoFill: false, + width: 0, + multiple: false, + multipleSeparator: ", ", + highlight: function(value, term) { + return value.replace(new RegExp("(?![^&;]+;)(?!<[^<>]*)(" + term.replace(/([\^\$\[\]\{\}\*\.\+\?\|\\])/gi, "\\$1") + ")(?![^<>]*>)(?![^&;]+;)", "gi"), "<strong>$1</strong>"); + }, + scroll: true, + scrollHeight: 180 +}; + +$.Autocompleter.Cache = function(options) { + + var data = {}; + var length = 0; + + function matchSubset(s, sub) { + if (!options.matchCase) + s = s.toLowerCase(); + var i = s.indexOf(sub); + if (i == -1) return false; + return i == 0 || options.matchContains; + }; + + function add(q, value) { + if (length > options.cacheLength){ + flush(); + } + if (!data[q]){ + length++; + } + data[q] = value; + } + + function populate(){ + if( !options.data ) return false; + // track the matches + var stMatchSets = {}, + nullData = 0; + + // no url was specified, we need to adjust the cache length to make sure it fits the local data store + if( !options.url ) options.cacheLength = 1; + + // track all options for minChars = 0 + stMatchSets[""] = []; + + // loop through the array and create a lookup structure + for ( var i = 0, ol = options.data.length; i < ol; i++ ) { + var rawValue = options.data[i]; + // if rawValue is a string, make an array otherwise just reference the array + rawValue = (typeof rawValue == "string") ? [rawValue] : rawValue; + + var value = options.formatMatch(rawValue, i+1, options.data.length); + if ( value === false ) + continue; + + var firstChar = value.charAt(0).toLowerCase(); + // if no lookup array for this character exists, look it up now + if( !stMatchSets[firstChar] ) + stMatchSets[firstChar] = []; + + // if the match is a string + var row = { + value: value, + data: rawValue, + result: options.formatResult && options.formatResult(rawValue) || value + }; + + // push the current match into the set list + stMatchSets[firstChar].push(row); + + // keep track of minChars zero items + if ( nullData++ < options.max ) { + stMatchSets[""].push(row); + } + }; + + // add the data items to the cache + $.each(stMatchSets, function(i, value) { + // increase the cache size + options.cacheLength++; + // add to the cache + add(i, value); + }); + } + + // populate any existing data + setTimeout(populate, 25); + + function flush(){ + data = {}; + length = 0; + } + + return { + flush: flush, + add: add, + populate: populate, + load: function(q) { + if (!options.cacheLength || !length) + return null; + + /* + * if dealing w/local data and matchContains than we must make sure + * to loop through all the data collections looking for matches + */ + if( !options.url && options.matchContains ){ + // track all matches + var csub = []; + // loop through all the data grids for matches + for( var k in data ){ + // don't search through the stMatchSets[""] (minChars: 0) cache + // this prevents duplicates + if( k.length > 0 ){ + var c = data[k]; + $.each(c, function(i, x) { + // if we've got a match, add it to the array + if (matchSubset(x.value, q)) { + csub.push(x); + } + }); + } + } + return csub; + } else + // if the exact item exists, use it + if (data[q]){ + return data[q]; + } else + if (options.matchSubset) { + for (var i = q.length - 1; i >= options.minChars; i--) { + var c = data[q.substr(0, i)]; + if (c) { + var csub = []; + $.each(c, function(i, x) { + if ( (x.data.indexOf("#Header") == 0) || + (matchSubset(x.value, q)) ) { + csub[csub.length] = x; + } + }); + return csub; + } + } + + } + return null; + } + }; +}; + +$.Autocompleter.Select = function (options, input, select, config) { + var CLASSES = { + ACTIVE: "ac_over" + }; + + var listItems, + active = -1, + data, + term = "", + needsInit = true, + element, + list; + + // Create results + function init() { + if (!needsInit) + return; + element = $("<div/>") + .hide() + .addClass(options.resultsClass) + .css("position", "absolute") + .appendTo(document.body); + + list = $("<ul/>").appendTo(element).mouseover( function(event) { + if(target(event).nodeName && target(event).nodeName.toUpperCase() == 'LI') { + active = $("li", list).removeClass(CLASSES.ACTIVE).index(target(event)); + // JG: Only add active class if target is not a header. + if (!headerAtPosition(active)) + $(target(event)).addClass(CLASSES.ACTIVE); + } + }).click(function(event) { + // JG: Ignore click on header. + active = $("li", list).index(target(event)); + if (headerAtPosition(active)) + return; + + // Handle click on autocomplete options. + $(target(event)).addClass(CLASSES.ACTIVE); + select(); + // TODO provide option to avoid setting focus again after selection? useful for cleanup-on-focus + input.focus(); + return false; + }).mousedown(function() { + config.mouseDownOnSelect = true; + }).mouseup(function() { + config.mouseDownOnSelect = false; + }); + + if( options.width > 0 ) + element.css("width", options.width); + + needsInit = false; + } + + function target(event) { + var element = event.target; + while(element && element.tagName != "LI") + element = element.parentNode; + // more fun with IE, sometimes event.target is empty, just ignore it then + if(!element) + return []; + return element; + } + + // JG: Returns true iff there is a header element at the given position. + function headerAtPosition(position) + { + dataAtPosition = data[position].data; + return (dataAtPosition.indexOf("#Header") == 0); + } + + function moveSelect(step) { + listItems.slice(active, active + 1).removeClass(CLASSES.ACTIVE); + // JG: while active item is a header, continue stepping. + var isHeader = false; + do + { + movePosition(step); + isHeader = headerAtPosition(active); + } + while (isHeader); + var activeItem = listItems.slice(active, active + 1).addClass(CLASSES.ACTIVE); + + + if(options.scroll) { + var offset = 0; + listItems.slice(0, active).each(function() { + offset += this.offsetHeight; + }); + if((offset + activeItem[0].offsetHeight - list.scrollTop()) > list[0].clientHeight) { + list.scrollTop(offset + activeItem[0].offsetHeight - list.innerHeight()); + } else if(offset < list.scrollTop()) { + list.scrollTop(offset); + } + } + }; + + function movePosition(step) { + active += step; + if (active < 0) { + active = listItems.size() - 1; + } else if (active >= listItems.size()) { + active = 0; + } + } + + function limitNumberOfItems(available) { + return options.max && options.max < available + ? options.max + : available; + } + + function fillList() { + list.empty(); + var max = limitNumberOfItems(data.length); + for (var i=0; i < max; i++) { + if (!data[i]) + continue; + var formatted = options.formatItem(data[i].data, i+1, max, data[i].value, term); + if ( formatted === false ) + continue; + + // JG: Build list item by formatting the item and choosing a CSS class. + if (headerAtPosition(i)) + { + // Found header element; only add header if there are subsequent elements. + if (i != max-1) + var li = $("<li/>").html(data[i].data[1]).addClass("ac_header").appendTo(list)[0]; + } + else + { + // Found completion element. + var li = $("<li/>").html(options.highlight(formatted, term)).addClass(i%2 == 0 ? "ac_even" : "ac_odd").appendTo(list)[0]; + } + + $.data(li, "ac_data", data[i]); + } + listItems = list.find("li"); + if ( options.selectFirst ) { + listItems.slice(0, 1).addClass(CLASSES.ACTIVE); + active = 0; + } + // apply bgiframe if available + if ( $.fn.bgiframe ) + list.bgiframe(); + } + + return { + display: function(d, q) { + init(); + data = d; + term = q; + fillList(); + }, + next: function() { + moveSelect(1); + }, + prev: function() { + moveSelect(-1); + }, + pageUp: function() { + if (active != 0 && active - 8 < 0) { + moveSelect( -active ); + } else { + moveSelect(-8); + } + }, + pageDown: function() { + if (active != listItems.size() - 1 && active + 8 > listItems.size()) { + moveSelect( listItems.size() - 1 - active ); + } else { + moveSelect(8); + } + }, + hide: function() { + element && element.hide(); + listItems && listItems.removeClass(CLASSES.ACTIVE); + active = -1; + }, + visible : function() { + return element && element.is(":visible"); + }, + current: function() { + return this.visible() && (listItems.filter("." + CLASSES.ACTIVE)[0] || options.selectFirst && listItems[0]); + }, + show: function() { + var offset = $(input).offset(); + element.css({ + width: typeof options.width == "string" || options.width > 0 ? options.width : $(input).width(), + top: offset.top + input.offsetHeight, + left: offset.left + }).show(); + if(options.scroll) { + list.scrollTop(0); + list.css({ + maxHeight: options.scrollHeight, + overflow: 'auto' + }); + + if($.browser.msie && typeof document.body.style.maxHeight === "undefined") { + var listHeight = 0; + listItems.each(function() { + listHeight += this.offsetHeight; + }); + var scrollbarsVisible = listHeight > options.scrollHeight; + list.css('height', scrollbarsVisible ? options.scrollHeight : listHeight ); + if (!scrollbarsVisible) { + // IE doesn't recalculate width when scrollbar disappears + listItems.width( list.width() - parseInt(listItems.css("padding-left")) - parseInt(listItems.css("padding-right")) ); + } + } + + } + }, + selected: function() { + var selected = listItems && listItems.filter("." + CLASSES.ACTIVE).removeClass(CLASSES.ACTIVE); + return selected && selected.length && $.data(selected[0], "ac_data"); + }, + emptyList: function (){ + list && list.empty(); + }, + unbind: function() { + element && element.remove(); + } + }; +}; + +$.Autocompleter.Selection = function(field, start, end) { + if( field.createTextRange ){ + var selRange = field.createTextRange(); + selRange.collapse(true); + selRange.moveStart("character", start); + selRange.moveEnd("character", end); + selRange.select(); + } else if( field.setSelectionRange ){ + field.setSelectionRange(start, end); + } else { + if( field.selectionStart ){ + field.selectionStart = start; + field.selectionEnd = end; + } + } + field.focus(); +}; + +})(jQuery);

1 0

[hg] galaxy 2644: changes to the model to support tags
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/b6b4d07ad087 changeset: 2644:b6b4d07ad087 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 15:35:27 2009 -0400 description: changes to the model to support tags 1 file(s) affected in this change: lib/galaxy/model/__init__.py diffs (41 lines): diff -r 1835c027763a -r b6b4d07ad087 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Fri Aug 28 15:31:06 2009 -0400 +++ b/lib/galaxy/model/__init__.py Fri Aug 28 15:35:27 2009 -0400 @@ -1142,6 +1142,37 @@ self.user = None self.title = None self.content = None + +class Tag ( object ): + def __init__( self, id=None, type=None, parent_id=None, name=None ): + self.id = id + self.type = type + self.parent_id = parent_id + self.name = name + + def __str__ ( self ): + return "Tag(id=%s, type=%s, parent_id=%s, name=%s)" % ( self.id, self.type, self.parent_id, self.name ) + +class ItemTagAssociation ( object ): + def __init__( self, item_id=None, tag_id=None, user_tname=None, value=None ): + self.item_id = item_id + self.tag_id = tag_id + self.user_tname = user_tname + self.value = None + self.user_value = None + + def __str__ ( self ): + return "%s(item_id=%s, item_tag=%s, user_tname=%s, value=%s, user_value=%s)" % (self.__class__.__name__, self.item_id, self.tag_id, self.user_tname, self.value. self.user_value ) + + +class HistoryTagAssociation ( ItemTagAssociation ): + pass + +class DatasetTagAssociation ( ItemTagAssociation ): + pass + +class HistoryDatasetAssociationTagAssociation ( ItemTagAssociation ): + pass

1 0

[hg] galaxy 2633: Migration script to handle mysql index error i...
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/b85cb0a65f46 changeset: 2633:b85cb0a65f46 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Aug 28 13:13:18 2009 -0400 description: Migration script to handle mysql index error in previous migration script ( 0015_tagging.py ) 1 file(s) affected in this change: lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py diffs (56 lines): diff -r 31150f0b216d -r b85cb0a65f46 lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0016_v0015_mysql_index_fix.py Fri Aug 28 13:13:18 2009 -0400 @@ -0,0 +1,51 @@ +""" +This script fixes a problem introduced in 0015_tagging.py. MySQL has a name length +limit and thus the index "ix_hda_ta_history_dataset_association_id" has to be +manually created. +""" + +from sqlalchemy import * +from migrate import * + +import datetime +now = datetime.datetime.utcnow + +# Need our custom types, but don't import anything else from model +from galaxy.model.custom_types import * + +import logging +log = logging.getLogger( __name__ ) + +metadata = MetaData( migrate_engine ) + +def display_migration_details(): + print "" + print "This script fixes a problem introduced in 0015_tagging.py. MySQL has a" + print "name length limit and thus the index 'ix_hda_ta_history_dataset_association_id'" + print "has to be manually created." + +HistoryDatasetAssociationTagAssociation_table = Table( "history_dataset_association_tag_association", metadata, + Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +def upgrade(): + display_migration_details() + metadata.reflect() + i = Index( "ix_hda_ta_history_dataset_association_id", HistoryDatasetAssociationTagAssociation_table.c.history_dataset_association_id ) + try: + i.create() + except Exception, e: + print str(e) + log.debug( "Adding index 'ix_hdata_history_dataset_association_id' to table 'history_dataset_association_tag_association' table failed: %s" % str( e ) ) + +def downgrade(): + metadata.reflect() + i = Index( "ix_hda_ta_history_dataset_association_id", HistoryDatasetAssociationTagAssociation_table.c.history_dataset_association_id ) + try: + i.drop() + except Exception, e: + print str(e) + log.debug( "Removing index 'ix_hdata_history_dataset_association_id' to table 'history_dataset_association_tag_association' table failed: %s" % str( e ) ) \ No newline at end of file

1 0

[hg] galaxy 2634: Fix for unicode filenames in upload.
by Greg Von Kuster 29 Aug '09

29 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e87013fd0716 changeset: 2634:e87013fd0716 user: James Taylor <james(a)jamestaylor.org> date: Fri Aug 28 14:53:51 2009 -0400 description: Fix for unicode filenames in upload. 3 file(s) affected in this change: eggs.ini lib/galaxy/web/framework/__init__.py templates/root/history_common.mako diffs (55 lines): diff -r b85cb0a65f46 -r e87013fd0716 eggs.ini --- a/eggs.ini Fri Aug 28 13:13:18 2009 -0400 +++ b/eggs.ini Fri Aug 28 14:53:51 2009 -0400 @@ -32,7 +32,7 @@ flup = 0.5 lrucache = 0.2 ;lsprof - james -Mako = 0.1.10 +Mako = 0.2.4 MyghtyUtils = 0.52 nose = 0.9.1 NoseHTML = 0.2 @@ -81,7 +81,7 @@ elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz flup = http://www.saddi.com/software/flup/dist/archive/flup-r2311.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz -Mako = http://www.makotemplates.org/downloads/Mako-0.1.10.tar.gz +Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2 diff -r b85cb0a65f46 -r e87013fd0716 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Fri Aug 28 13:13:18 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Fri Aug 28 14:53:51 2009 -0400 @@ -583,12 +583,12 @@ data.update( kwargs ) ## return template.render( **data ) def render( environ, start_response ): - response_write = start_response( self.response.wsgi_status(), - self.response.wsgi_headeritems() ) - class C: - def write( self, *args, **kwargs ): - response_write( *args, **kwargs ) - context = mako.runtime.Context( C(), **data ) + response_write = start_response( self.response.wsgi_status(), self.response.wsgi_headeritems() ) + class StreamBuffer( object ): + def write( self, d ): + response_write( d.encode( 'utf-8' ) ) + buffer = StreamBuffer() + context = mako.runtime.Context( buffer, **data ) template.render_context( context ) return [] return render diff -r b85cb0a65f46 -r e87013fd0716 templates/root/history_common.mako --- a/templates/root/history_common.mako Fri Aug 28 13:13:18 2009 -0400 +++ b/templates/root/history_common.mako Fri Aug 28 14:53:51 2009 -0400 @@ -35,7 +35,7 @@ <a class="icon-button delete" title="delete" href="${h.url_for( action='delete', id=data.id, show_deleted_on_refresh=show_deleted_on_refresh )}" id="historyItemDeleter-${data.id}"></a> </div> <span class="state-icon"></span> - <span class="historyItemTitle"><b>${hid}: ${data.display_name()}</b></span> + <span class="historyItemTitle"><b>${hid}: ${data.display_name().decode('utf-8')}</b></span> </div> ## Body for history items, extra info and actions, data "peek"

1 0