details: http://www.bx.psu.edu/hg/galaxy/rev/e58e140b89f7
changeset: 2689:e58e140b89f7
user: Kelly Vincent <kpvincent(a)bx.psu.edu>
date: Mon Sep 14 14:54:11 2009 -0400
description:
Updated Bowtie wrapper tool to add a number of threads parameter and remove two unnecessary options
2 file(s) affected in this change:
tools/sr_mapping/bowtie_wrapper.py
tools/sr_mapping/bowtie_wrapper.xml
diffs (198 lines):
diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.py
--- a/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 12:23:16 2009 -0400
+++ b/tools/sr_mapping/bowtie_wrapper.py Mon Sep 14 14:54:11 2009 -0400
@@ -13,6 +13,7 @@
def __main__():
#Parse Command Line
parser = optparse.OptionParser()
+ parser.add_option('', '--threads', dest='threads', help='The number of threads to run')
parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format')
parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format')
parser.add_option('', '--output', dest='output', help='The output file')
@@ -35,7 +36,6 @@
parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments')
parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions")
parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read')
- parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode')
parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable')
parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments')
parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments')
@@ -45,7 +45,6 @@
parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand')
parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time')
parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n')
- parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index')
parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator')
parser.add_option('', '--dbkey', dest='dbkey', help='')
parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters')
@@ -70,10 +69,10 @@
if options.genomeSource == 'history':
# set up commands
if options.index_settings =='index_pre_set':
- indexing_cmds = ''
+ indexing_cmds = '--quiet'
else:
try:
- indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s --quiet' % \
(('','--noauto')[options.iauto_b=='set'],
('','--packed')[options.ipacked=='packed'],
('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1],
@@ -88,7 +87,7 @@
('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0],
('','--oldpmap')[options.ioldpmap=='yes'])
except ValueError:
- indexing_cmds = ''
+ indexing_cmds = '--quiet'
# make temp directory for placement of indices and copy reference file there
tmp_dir = tempfile.gettempdir()
@@ -97,7 +96,7 @@
except Exception, erf:
stop_err('Error creating temp directory for indexing purposes\n' + str(erf))
options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1])
- cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref)
+ cmd1 = 'cd %s; bowtie-build %s -f %s %s' % (tmp_dir, indexing_cmds, options.ref, options.ref)
try:
os.system(cmd1)
except Exception, erf:
@@ -106,11 +105,11 @@
# set up aligning and generate aligning command options
# automatically set threads to 8 in both cases
if options.params == 'pre_set':
- aligning_cmds = '-p 8'
+ aligning_cmds = '-p %s --quiet' % options.threads
else:
try:
aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \
- '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \
+ '%s %s %s %s %s %s %s %s %s %s %s %s -p %s --quiet' % \
(('','-s %s'%options.skip)[options.skip!='None'],
('','-u %s'%options.alignLimit)[int(options.alignLimit)>0],
('','-5 %s'%options.trimH)[int(options.trimH)>=0],
@@ -128,7 +127,6 @@
('','--norc')[options.reverseAlign=='noReverse'],
('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')],
('','-y')[options.tryHard=='doTryHard'],
- ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0],
('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0],
('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0],
('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0],
@@ -137,18 +135,18 @@
('','-B %s'%options.offbase)[int(options.offbase)>=0],
('','-z %s'%options.phased)[options.phased!='None'],
('','-o %s'%options.offrate)[int(options.offrate)>=0],
- ('','--mm')[options.mm=='doMm'],
- ('','--seed %s'%options.seed)[int(options.seed)>=0])
+ ('','--seed %s'%options.seed)[int(options.seed)>=0],
+ options.threads)
except ValueError:
- aligning_cmds = '-p 8'
+ aligning_cmds = '-p %s --quiet' % options.threads
tmp_out = tempfile.NamedTemporaryFile()
# prepare actual aligning commands
if options.paired == 'paired':
- cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
else:
- cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
+ cmd2 = 'bowtie %s %s %s > %s' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
# prepare command to convert bowtie output to sam and alternative
cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output)
cmd4 = 'cp %s %s' % (tmp_out.name, options.output)
diff -r 7f4c8fee3b39 -r e58e140b89f7 tools/sr_mapping/bowtie_wrapper.xml
--- a/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 12:23:16 2009 -0400
+++ b/tools/sr_mapping/bowtie_wrapper.xml Mon Sep 14 14:54:11 2009 -0400
@@ -2,6 +2,7 @@
<description> fast alignment of reads against reference sequence </description>
<command interpreter="python">
bowtie_wrapper.py
+ --threads="8"
--input1=$singlePaired.input1
#if $singlePaired.sPaired == "paired":
--input2=$singlePaired.input2
@@ -33,17 +34,14 @@
--suppressAlign=$singlePaired.params.suppressAlign
--offbase=$singlePaired.params.offbase
--offrate=$singlePaired.params.offrate
- --mm=$singlePaired.params.mm
--seed=$singlePaired.params.seed
--best=$singlePaired.params.bestOption.best
#if $singlePaired.params.bestOption.best == "doBest":
--maxBacktracks=$singlePaired.params.bestOption.maxBacktracks
- --threadMem=$singlePaired.params.bestOption.threadMem
--strata=$singlePaired.params.bestOption.strata
--phased="None"
#else:
--maxBacktracks="None"
- --threadMem="None"
--strata="None"
#if $singlePaired.sPaired =="single":
--phased=$singlePaired.params.bestOption.phased
@@ -83,7 +81,6 @@
--offbase="None"
--best="None"
--maxBacktracks="None"
- --threadMem="None"
--strata="None"
--minInsert="None"
--maxInsert="None"
@@ -93,7 +90,6 @@
--reverseAlign="None"
--phased="None"
--offrate="None"
- --mm="None"
--seed="None"
#end if
#if $refGenomeSource.genomeSource == "history":
@@ -264,7 +260,6 @@
</when>
<when value="doBest">
<param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
- <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
<param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
<option value="noStrata">Do not use strata option</option>
<option value="doStrata">Use strata option</option>
@@ -272,10 +267,6 @@
</when>
</conditional> <!-- bestOption -->
<param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" />
- <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)">
- <option value="noMm">Use POSIX/C file I/O</option>
- <option value="doMm">Use memory-mapped I/O</option>
- </param>
<param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
</when> <!-- full -->
</conditional> <!-- params -->
@@ -339,7 +330,6 @@
</when>
<when value="doBest">
<param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
- <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
<param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
<option value="noStrata">Do not use strata option</option>
<option value="doStrata">Use strata option</option>
@@ -347,10 +337,6 @@
</when>
</conditional>
<param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" />
- <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)">
- <option value="noMm">Use POSIX/C file I/O</option>
- <option value="doMm">Use memory-mapped I/O</option>
- </param>
<param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
</when> <!-- full -->
</conditional> <!-- params -->
@@ -431,10 +417,8 @@
<param name="offbase" value="0" />
<param name="best" value="doBest" />
<param name="maxBacktracks" value="800" />
- <param name="threadMem" value="32" />
<param name="strata" value="noStrata" />
<param name="offrate" value="-1" />
- <param name="mm" value="noMm" />
<param name="seed" value="403" />
<output name="output" ftype="sam" file="bowtie_out2.sam" />
</test>
details: http://www.bx.psu.edu/hg/galaxy/rev/355b6844b123
changeset: 2684:355b6844b123
user: jeremy goecks <jeremy.goecks(a)emory.edu>
date: Fri Sep 11 15:04:53 2009 -0400
description:
Merge
0 file(s) affected in this change:
diffs (878 lines):
diff -r 032478337b82 -r 355b6844b123 eggs.ini
--- a/eggs.ini Fri Sep 11 14:57:02 2009 -0400
+++ b/eggs.ini Fri Sep 11 15:04:53 2009 -0400
@@ -31,7 +31,7 @@
elementtree = 1.2.6_20050316
lrucache = 0.2
;lsprof - james
-Mako = 0.2.4
+Mako = 0.2.5
MyghtyUtils = 0.52
nose = 0.9.1
NoseHTML = 0.2
@@ -79,7 +79,7 @@
docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz
elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz
lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz
-Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz
+Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz
MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52…
nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz
NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2
diff -r 032478337b82 -r 355b6844b123 scripts/cleanup_datasets/cleanup_datasets.py
--- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 14:57:02 2009 -0400
+++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 15:04:53 2009 -0400
@@ -1,4 +1,8 @@
#!/usr/bin/env python
+
+from galaxy import eggs
+import pkg_resources
+pkg_resources.require( "SQLAlchemy >= 0.4" )
import sys, os, time, ConfigParser, shutil
from datetime import datetime, timedelta
@@ -9,12 +13,7 @@
new_path.extend( sys.path[1:] ) # remove scripts/ from the path
sys.path = new_path
-from galaxy import eggs
import galaxy.model.mapping
-import pkg_resources
-
-pkg_resources.require( "SQLAlchemy >= 0.4" )
-
from galaxy.model.orm import and_, eagerload
assert sys.version_info[:2] >= ( 2, 4 )
diff -r 032478337b82 -r 355b6844b123 templates/workflow/run.mako
--- a/templates/workflow/run.mako Fri Sep 11 14:57:02 2009 -0400
+++ b/templates/workflow/run.mako Fri Sep 11 15:04:53 2009 -0400
@@ -87,8 +87,7 @@
${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )}
<input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" />
%endif
- %elif isinstance( value, RuntimeValue ) or \
- ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
+ %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming:
## On the first load we may see a RuntimeValue, so we write
## an input field using the initial value for the param.
## Subsequents posts will no longer have the runtime value
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in1.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,5 @@
+@HWI-EAS91_1_30788AAXX:1:1:1513:715/1
+GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG
++/1
+IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I
+
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in2.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/1
+TAGACTACGAAAGTGACTTTAATACCTCTGACTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_in3.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_in3.fastq Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,4 @@
+@HWI-EAS91_1_30788AAXX:1:2:618:346/2
+ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG
++
+IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2)
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out1.sam Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,1 @@
+HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27
diff -r 032478337b82 -r 355b6844b123 test-data/bowtie_out2.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie_out2.sam Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,2 @@
+HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36
+HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18
diff -r 032478337b82 -r 355b6844b123 tool-data/bowtie_indices.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/bowtie_indices.loc.sample Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,28 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Bowtie indexed sequences data files. You will need
+#to create these data files and then create a bowtie_indices.loc file
+#similar to this one (store it in this directory ) that points to
+#the directories in which those files are stored. The bowtie_indices.loc
+#file has this format (white space characters are TAB characters):
+#
+#<build> <file_base>
+#
+#So, for example, if you had hg18 indexed stored in
+#/depot/data2/galaxy/bowtie/hg18/,
+#then the bowtie_indices.loc entry would look like this:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
+#
+#and your /depot/data2/galaxy/bowtie/hg18/ directory
+#would contain hg18.*.ebwt files:
+#
+#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt
+#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt
+#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt
+#...etc...
+#
+#Your bowtie_indices.loc file should include an entry per line for
+#each index set you have stored. The "file" in the path does not actually
+#exist, but it is the prefix for the actual index files. For example:
+#
+#hg18 /depot/data2/galaxy/bowtie/hg18/hg18
diff -r 032478337b82 -r 355b6844b123 tool_conf.xml.sample
--- a/tool_conf.xml.sample Fri Sep 11 14:57:02 2009 -0400
+++ b/tool_conf.xml.sample Fri Sep 11 15:04:53 2009 -0400
@@ -332,7 +332,8 @@
<tool file="metag_tools/megablast_xml_parser.xml" />
<tool file="metag_tools/blat_wrapper.xml" />
<tool file="metag_tools/mapping_to_ucsc.xml" />
- </section>
+ <tool file="sr_mapping/bowtie_wrapper.xml" />
+ </section>
<section name="Tracks" id="tracks">
<tool file="visualization/genetrack.xml" />
</section>
diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.py Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,174 @@
+#! /usr/bin/python
+
+"""
+Runs Bowtie on single-end or paired-end data.
+"""
+
+import optparse, os, sys, tempfile
+
+def stop_err( msg ):
+ sys.stderr.write( "%s\n" % msg )
+ sys.exit()
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format')
+ parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format')
+ parser.add_option('', '--output', dest='output', help='The output file')
+ parser.add_option('', '--paired', dest='paired', help='Whether the data is single- or paired-end')
+ parser.add_option('', '--genomeSource', dest='genomeSource', help='The type of reference provided')
+ parser.add_option('', '--ref', dest='ref', help='The reference genome to use or index')
+ parser.add_option('', '--skip', dest='skip', help='Skip the first n reads')
+ parser.add_option('', '--alignLimit', dest='alignLimit', help='Only align the first n reads')
+ parser.add_option('', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment')
+ parser.add_option('', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment')
+ parser.add_option('', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed')
+ parser.add_option('', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions')
+ parser.add_option('', '--seedLen', dest='seedLen', help='Seed length')
+ parser.add_option('', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30')
+ parser.add_option('', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy')
+ parser.add_option('', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist')
+ parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read')
+ parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read')
+ parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist')
+ parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments')
+ parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions")
+ parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read')
+ parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode')
+ parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable')
+ parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments')
+ parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments')
+ parser.add_option('', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand')
+ parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate')
+ parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand')
+ parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand')
+ parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time')
+ parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n')
+ parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index')
+ parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator')
+ parser.add_option('', '--dbkey', dest='dbkey', help='')
+ parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters')
+ parser.add_option('', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior')
+ parser.add_option('', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings')
+ parser.add_option('', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block')
+ parser.add_option('', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference')
+ parser.add_option('', '--idcv', dest='idcv', help='The period for the difference-cover sample')
+ parser.add_option('', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample')
+ parser.add_option('', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paried-end alignment')
+ parser.add_option('', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows')
+ parser.add_option('', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query')
+ parser.add_option('', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As')
+ parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file')
+ parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator')
+ parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index')
+ parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8')
+ parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set')
+ (options, args) = parser.parse_args()
+
+ # index if necessary
+ if options.genomeSource == 'history':
+ # set up commands
+ if options.index_settings =='index_pre_set':
+ indexing_cmds = ''
+ else:
+ try:
+ indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \
+ (('','--noauto')[options.iauto_b=='set'],
+ ('','--packed')[options.ipacked=='packed'],
+ ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1],
+ ('','--bmaxdivn %s'%options.ibmaxdivn)[options.ibmaxdivn!='None'],
+ ('','--dcv %s'%options.idcv)[options.idcv!='None'],
+ ('','--nodc')[options.inodc=='nodc'],
+ ('','--noref')[options.inoref=='noref'], options.ioffrate,
+ ('','--ftabchars %s'%options.iftab)[int(options.iftab)>=0],
+ ('','--ntoa')[options.intoa=='yes'],
+ ('--little','--big')[options.iendian=='big'],
+ ('','--seed %s'%options.iseed)[int(options.iseed)>0],
+ ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0],
+ ('','--oldpmap')[options.ioldpmap=='yes'])
+ except ValueError:
+ indexing_cmds = ''
+
+ # make temp directory for placement of indices and copy reference file there
+ tmp_dir = tempfile.gettempdir()
+ try:
+ os.system('cp %s %s' % (options.ref, tmp_dir))
+ except Exception, erf:
+ stop_err('Error creating temp directory for indexing purposes\n' + str(erf))
+ options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1])
+ cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref)
+ try:
+ os.system(cmd1)
+ except Exception, erf:
+ stop_err('Error indexing reference sequence\n' + str(erf))
+
+ # set up aligning and generate aligning command options
+ # automatically set threads to 8 in both cases
+ if options.params == 'pre_set':
+ aligning_cmds = '-p 8'
+ else:
+ try:
+ aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \
+ '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \
+ (('','-s %s'%options.skip)[options.skip!='None'],
+ ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0],
+ ('','-5 %s'%options.trimH)[int(options.trimH)>=0],
+ ('','-3 %s'%options.trimL)[int(options.trimL)>=0],
+ ('','-n %s'%options.mismatchSeed)[options.mismatchSeed=='0' or options.mismatchSeed=='1' or options.mismatchSeed=='2' or options.mismatchSeed=='3'],
+ ('','-e %s'%options.mismatchQual)[int(options.mismatchQual)>=0],
+ ('','-l %s'%options.seedLen)[int(options.seedLen)>=5],
+ ('','--nomaqround')[options.rounding=='noRound'],
+ ('','-v %s'%options.maqSoapAlign)[options.maqSoapAlign!='-1'],
+ ('','-I %s'%options.minInsert)[options.minInsert!='None'],
+ ('','-X %s'%options.maxInsert)[options.maxInsert!='None'],
+ ('','--%s'%options.mateOrient)[options.mateOrient!='None'],
+ ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0],
+ ('','--nofw')[options.forwardAlign=='noForward'],
+ ('','--norc')[options.reverseAlign=='noReverse'],
+ ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')],
+ ('','-y')[options.tryHard=='doTryHard'],
+ ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0],
+ ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0],
+ ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0],
+ ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0],
+ ('','--best')[options.best=='doBest'],
+ ('','--strata')[options.strata=='doStrata'],
+ ('','-B %s'%options.offbase)[int(options.offbase)>=0],
+ ('','-z %s'%options.phased)[options.phased!='None'],
+ ('','-o %s'%options.offrate)[int(options.offrate)>=0],
+ ('','--mm')[options.mm=='doMm'],
+ ('','--seed %s'%options.seed)[int(options.seed)>=0])
+ except ValueError:
+ aligning_cmds = '-p 8'
+
+ tmp_out = tempfile.NamedTemporaryFile()
+
+ # prepare actual aligning commands
+ if options.paired == 'paired':
+ cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name)
+ else:
+ cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name)
+ # prepare command to convert bowtie output to sam and alternative
+ cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output)
+ cmd4 = 'cp %s %s' % (tmp_out.name, options.output)
+
+ # align
+ try:
+ os.system(cmd2)
+ except Exception, erf:
+ stop_err("Error aligning sequence\n" + str(erf))
+ if len(file(tmp_out.name,'r').read()) > 0:
+ #convert
+ try:
+ os.system(cmd3)
+ except Exception, erf:
+ stop_err('Error converting output to sam format\n' + str(erf))
+ else:
+ try:
+ os.system(cmd4)
+ sys.stdout.write('Alignment file contained no data')
+ except Exception, erf:
+ stop_err('Error producing alignment file. File contained no data.\n' + str(erf))
+
+if __name__=="__main__": __main__()
diff -r 032478337b82 -r 355b6844b123 tools/sr_mapping/bowtie_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/sr_mapping/bowtie_wrapper.xml Fri Sep 11 15:04:53 2009 -0400
@@ -0,0 +1,556 @@
+<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0">
+ <description> fast alignment of reads against reference sequence </description>
+ <command interpreter="python">
+ bowtie_wrapper.py
+ --input1=$singlePaired.input1
+ #if $singlePaired.sPaired == "paired":
+ --input2=$singlePaired.input2
+ #else:
+ --input2="None"
+ #end if
+ --output=$output
+ --paired=$singlePaired.sPaired
+ --genomeSource=$refGenomeSource.genomeSource
+ #if $refGenomeSource.genomeSource == "history":
+ --ref=$refGenomeSource.ownFile
+ #else:
+ --ref=$refGenomeSource.indices.value
+ #end if
+ --params=$singlePaired.params.settings_type
+ #if $singlePaired.params.settings_type == "full":
+ --skip=$singlePaired.params.skip
+ --alignLimit=$singlePaired.params.alignLimit
+ --trimH=$singlePaired.params.trimH
+ --trimL=$singlePaired.params.trimL
+ --mismatchSeed=$singlePaired.params.mismatchSeed
+ --mismatchQual=$singlePaired.params.mismatchQual
+ --seedLen=$singlePaired.params.seedLen
+ --rounding=$singlePaired.params.rounding
+ --maqSoapAlign=$singlePaired.params.maqSoapAlign
+ --tryHard=$singlePaired.params.tryHard
+ --valAlign=$singlePaired.params.valAlign
+ --allValAligns=$singlePaired.params.allValAligns
+ --suppressAlign=$singlePaired.params.suppressAlign
+ --offbase=$singlePaired.params.offbase
+ --offrate=$singlePaired.params.offrate
+ --mm=$singlePaired.params.mm
+ --seed=$singlePaired.params.seed
+ --best=$singlePaired.params.bestOption.best
+ #if $singlePaired.params.bestOption.best == "doBest":
+ --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks
+ --threadMem=$singlePaired.params.bestOption.threadMem
+ --strata=$singlePaired.params.bestOption.strata
+ --phased="None"
+ #else:
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ #if $singlePaired.sPaired =="single":
+ --phased=$singlePaired.params.bestOption.phased
+ #else:
+ --phased="None"
+ #end if
+ #end if
+ #if $singlePaired.sPaired == "single":
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ #else:
+ --minInsert=$singlePaired.params.minInsert
+ --maxInsert=$singlePaired.params.maxInsert
+ --mateOrient=$singlePaired.params.mateOrient
+ --maxAlignAttempt=$singlePaired.params.maxAlignAttempt
+ --forwardAlign=$singlePaired.params.forwardAlign
+ --reverseAlign=$singlePaired.params.reverseAlign
+ #end if
+ #else
+ --skip="None"
+ --alignLimit="None"
+ --trimH="None"
+ --trimL="None"
+ --mismatchSeed="None"
+ --mismatchQual="None"
+ --seedLen="None"
+ --rounding="None"
+ --maqSoapAlign="None"
+ --tryHard="None"
+ --valAlign="None"
+ --allValAligns="None"
+ --suppressAlign="None"
+ --offbase="None"
+ --best="None"
+ --maxBacktracks="None"
+ --threadMem="None"
+ --strata="None"
+ --minInsert="None"
+ --maxInsert="None"
+ --mateOrient="None"
+ --maxAlignAttempt="None"
+ --forwardAlign="None"
+ --reverseAlign="None"
+ --phased="None"
+ --offrate="None"
+ --mm="None"
+ --seed="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --dbkey=$dbkey
+ #else:
+ --dbkey="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history":
+ --indexSettings=$refGenomeSource.indexParams.index_settings
+ #else:
+ --indexSettings="None"
+ #end if
+ #if $refGenomeSource.genomeSource == "history" and $refGenomeSource.indexParams.index_settings == "index_full":
+ --iauto_b=$refGenomeSource.indexParams.auto_behavior.auto_b
+ #if $refGenomeSource.indexParams.auto_behavior.auto_b == "set":
+ --ipacked=$refGenomeSource.indexParams.auto_behavior.packed
+ --ibmax=$refGenomeSource.indexParams.auto_behavior.bmax
+ --ibmaxdivn=$refGenomeSource.indexParams.auto_behavior.bmaxdivn
+ --idcv=$refGenomeSource.indexParams.auto_behavior.dcv
+ #else:
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ #end if
+ --inodc=$refGenomeSource.indexParams.nodc
+ --inoref=$refGenomeSource.indexParams.noref
+ --ioffrate=$refGenomeSource.indexParams.offrate
+ --iftab=$refGenomeSource.indexParams.ftab
+ --intoa=$refGenomeSource.indexParams.ntoa
+ --iendian=$refGenomeSource.indexParams.endian
+ --iseed=$refGenomeSource.indexParams.seed
+ --icutoff=$refGenomeSource.indexParams.cutoff
+ --ioldpmap=$refGenomeSource.indexParams.oldpmap
+ #else:
+ --iauto_b="None"
+ --ipacked="None"
+ --ibmax="None"
+ --ibmaxdivn="None"
+ --idcv="None"
+ --inodc="None"
+ --inoref="None"
+ --ioffrate="None"
+ --iftab="None"
+ --intoa="None"
+ --iendian="None"
+ --iseed="None"
+ --icutoff="None"
+ --ioldpmap="None"
+ #end if
+ </command>
+ <inputs>
+ <conditional name="refGenomeSource">
+ <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+ <option value="indexed">Use a built-in index</option>
+ <option value="history">Use one from the history</option>
+ </param>
+ <when value="indexed">
+ <param name="indices" type="select" label="Select a reference genome">
+ <options from_file="bowtie_indices.loc">
+ <column name="value" index="1" />
+ <column name="name" index="0" />
+ <filter type="sort_by" column="0" />
+ </options>
+ </param>
+ </when>
+ <when value="history">
+ <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" />
+ <conditional name="indexParams">
+ <param name="index_settings" type="select" label="Choose whether to use default options or to set your own">
+ <option value="index_pre_set">Commonly Used</option>
+ <option value="index_full">Full Parameter List</option>
+ </param>
+ <when value="index_pre_set" />
+ <when value="index_full">
+ <conditional name="auto_behavior">
+ <param name="auto_b" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv">
+ <option value="auto">Automatic behavior</option>
+ <option value="set">Set values (sets --noauto and allows others to be set)</option>
+ </param>
+ <when value="auto" />
+ <when value="set">
+ <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)">
+ <option value="unpacked">Use regular representation</option>
+ <option value="packed">Use packed representation</option>
+ </param>
+ <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" />
+ <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" />
+ <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" />
+ </when>
+ </conditional>
+ <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetetive reference)">
+ <option value="dc">Use difference-cover sample</option>
+ <option value="nodc">Disable difference-cover sample</option>
+ </param>
+ <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)">
+ <option value="ref">Build all index files</option>
+ <option value="noref">Do not build paired-end alignment index files</option>
+ </param>
+ <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" />
+ <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" />
+ <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)">
+ <option value="no">Do not convert Ns</option>
+ <option value="yes">Convert Ns to As</option>
+ </param>
+ <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture">
+ <option value="little">Little</option>
+ <option value="big">Big</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" />
+ <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" />
+ <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't">
+ <option value="no">Use the new scheme</option>
+ <option value="yes">Use the old scheme</option>
+ </param>
+ </when> <!-- index_full -->
+ </conditional>
+ </when>
+ </conditional> <!-- refGenomeSource -->
+ <conditional name="singlePaired">
+ <param name="sPaired" type="select" label="Is this library mate-paired?">
+ <option value="single">Single-end</option>
+ <option value="paired">Paired-end</option>
+ </param>
+ <when value="single">
+ <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n reads (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)">
+ <option value="noPhased">Don't alternate</option>
+ <option value="doPhased">Do alternate</option>
+ </param>
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional> <!-- bestOption -->
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- single -->
+ <when value="paired">
+ <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
+ <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
+ <conditional name="params">
+ <param name="settings_type" type="select" label="BWA settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
+ <option value="pre_set">Commonly used</option>
+ <option value="full">Full parameter list</option>
+ </param>
+ <when value="pre_set" />
+ <when value="full">
+ <param name="skip" type="integer" value="0" label="Skip the first n pairs (-s)" />
+ <param name="alignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" />
+ <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" />
+ <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" />
+ <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" />
+ <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" />
+ <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" />
+ <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)">
+ <option value="round">Round to nearest 10</option>
+ <option value="noRound">Do not round to nearest 10</option>
+ </param>
+ <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" />
+ <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" />
+ <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" />
+ <param name="mateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)">
+ <option value="fr">FR (for Illumina)</option>
+ <option value="rf">RF</option>
+ <option value="ff">FF</option>
+ </param>
+ <param name="maxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" />
+ <param name="forwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)">
+ <option value="forward">Align against the forward reference strand</option>
+ <option value="noForward">Do not align against the forward reference strand</option>
+ </param>
+ <param name="reverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)">
+ <option value="reverse">Align against the reverse-complement reference strand</option>
+ <option value="noReverse">Do not align against the reverse-complement reference strand</option>
+ </param>
+ <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode">
+ <option value="noTryHard">Do not try hard</option>
+ <option value="doTryHard">Try hard</option>
+ </param>
+ <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" />
+ <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)">
+ <option value="noAllValAligns">Do not report all valid alignments</option>
+ <option value="doAllValAligns">Report all valid alignments</option>
+ </param>
+ <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" />
+ <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" />
+ <conditional name="bestOption">
+ <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option">
+ <option value="noBest">Do not use best</option>
+ <option value="doBest">Use best</option>
+ </param>
+ <when value="noBest">
+ <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ </when>
+ <when value="doBest">
+ <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" />
+ <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" />
+ <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)">
+ <option value="noStrata">Do not use strata option</option>
+ <option value="doStrata">Use strata option</option>
+ </param>
+ </when>
+ </conditional>
+ <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" />
+ <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)">
+ <option value="noMm">Use POSIX/C file I/O</option>
+ <option value="doMm">Use memory-mapped I/O</option>
+ </param>
+ <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" />
+ </when> <!-- full -->
+ </conditional> <!-- params -->
+ </when> <!-- paired -->
+ </conditional> <!-- singlePaired -->
+ </inputs>
+ <outputs>
+ <data format="sam" name="output" />
+ </outputs>
+ <tests>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_pre_set" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="history" />
+ <param name="ownFile" value="chrM.fa" />
+ <param name="index_settings" value="index_full" />
+ <param name="auto_b" value="set" />
+ <param name="packed" value="unpacked" />
+ <param name="bmax" value="-1" />
+ <param name="bmaxdivn" value="4" />
+ <param name="dcv" value="2048" />
+ <param name="nodc" value="dc" />
+ <param name="noref" value="noref" />
+ <param name="offrate" value="6" />
+ <param name="ftab" value="10" />
+ <param name="ntoa" value="yes" />
+ <param name="endian" value="little" />
+ <param name="seed" value="-1" />
+ <param name="cutoff" value="-1" />
+ <param name="oldpmap" value="no" />
+ <param name="sPaired" value="single" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" />
+ <param name="settings_type" value="pre_set" />
+ <output name="output" ftype="sam" file="bowtie_out1.sam" />
+ </test>
+ <test>
+ <param name="genomeSource" value="indexed" />
+ <param name="indices" value="chrM" />
+ <param name="sPaired" value="paired" />
+ <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" />
+ <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" />
+ <param name="settings_type" value="full" />
+ <param name="skip" value="0" />
+ <param name="alignLimit" value="-1" />
+ <param name="trimL" value="0" />
+ <param name="trimH" value="0" />
+ <param name="mismatchSeed" value="3" />
+ <param name="mismatchQual" value="50" />
+ <param name="seedLen" value="10" />
+ <param name="rounding" value="round" />
+ <param name="maqSoapAlign" value="-1" />
+ <param name="minInsert" value="0" />
+ <param name="maxInsert" value="250" />
+ <param name="mateOrient" value="fr" />
+ <param name="maxAlignAttempt" value="100" />
+ <param name="forwardAlign" value="forward" />
+ <param name="reverseAlign" value="reverse" />
+ <param name="tryHard" value="doTryHard" />
+ <param name="valAlign" value="1" />
+ <param name="allValAligns" value="noAllValAligns" />
+ <param name="suppressAlign" value="-1" />
+ <param name="offbase" value="0" />
+ <param name="best" value="doBest" />
+ <param name="maxBacktracks" value="800" />
+ <param name="threadMem" value="32" />
+ <param name="strata" value="noStrata" />
+ <param name="offrate" value="-1" />
+ <param name="mm" value="noMm" />
+ <param name="seed" value="403" />
+ <output name="output" ftype="sam" file="bowtie_out2.sam" />
+ </test>
+ </tests>
+ <help>
+
+**What it does**
+
+Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool.
+
+.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
+
+------
+
+**Input formats**
+
+Bowtie accepts files in Sanger FASTQ format.
+
+------
+
+**Outputs**
+
+The output is in SAM format, and has the following columns::
+
+ 1 QNAME - Query (pair) NAME
+ 2 FLAG - bitwise FLAG
+ 3 RNAME - Reference sequence NAME
+ 4 POS - 1-based leftmost POSition/coordinate of clipped sequence
+ 5 MAPQ - MAPping Quality (Phred-scaled)
+ 6 CIGAR - extended CIGAR string
+ 7 MRNM - Mate Reference sequence NaMe ('=' if same as RNAME)
+ 8 MPOS - 1-based Mate POSition
+ 9 ISIZE - Inferred insert SIZE
+ 10 SEQ - query SEQuence on the same strand as the reference
+ 11 QUAL - query QUALity (ASCII-33 gives the Phred base quality)
+ 12 OPT - variable OPTional fields in the format TAG:VTYPE:VALU
+
+The flags are as follows::
+
+ Flag - Description
+ 0x0001 - the read is paired in sequencing
+ 0x0002 - the read is mapped in a proper pair
+ 0x0004 - the query sequence itself is unmapped
+ 0x0008 - the mate is unmapped
+ 0x0010 - strand of the query (1 for reverse)
+ 0x0020 - strand of the mate
+ 0x0040 - the read is the first read in a pair
+ 0x0080 - the read is the second read in a pair
+ 0x0100 - the alignment is not primary
+
+It looks like this (scroll sideways to see the entire example)::
+
+ QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT
+ HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh
+ HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh
+
+-------
+
+**Bowtie settings**
+
+All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here.
+
+------
+
+**Bowtie parameter list**
+
+This is an exhaustive list of Bowtie options:
+
+For indexing (bowtie-build)::
+ -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off]
+ -p Packing. Use a packed representation for DNA strings. [auto]
+ --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto]
+ --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4]
+ --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024]
+ --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off]
+ -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off]
+ -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5]
+ -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10]
+ --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off]
+ --big Endianness. Endianness to use when serializing integers to the index file. [off]
+ --little Endianness. [--little]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+ --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off]
+ --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off]
+
+For aligning (bowtie)::
+ -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off]
+ -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit]
+ -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0]
+ -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0]
+ -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2]
+ -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70]
+ -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28]
+ --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off]
+ -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off]
+ -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0]
+ --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr]
+ --rf Mate orientation. [off]
+ --ff Mate orientation. [off]
+ -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250]
+ --pairtries <int> Maximum alignment attempts for paired-end data. [100]
+ --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off]
+ --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off]
+ --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best]
+ -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off]
+ --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32]
+ -k <int> Valid alignments. The number of valid alignments per read or pair. [off]
+ -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off]
+ -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit]
+ --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off]
+ --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off]
+ -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0]
+ -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off]
+ -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off]
+ --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off]
+ --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off]
+
+ </help>
+</tool>