September 2009 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2680: Fix for cleanup_datasets.py script.
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/8877ef766447 changeset: 2680:8877ef766447 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Sep 11 11:26:26 2009 -0400 description: Fix for cleanup_datasets.py script. 1 file(s) affected in this change: scripts/cleanup_datasets/cleanup_datasets.py diffs (25 lines): diff -r ed4cbaf23c88 -r 8877ef766447 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 09:00:36 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Fri Sep 11 11:26:26 2009 -0400 @@ -1,4 +1,8 @@ #!/usr/bin/env python + +from galaxy import eggs +import pkg_resources +pkg_resources.require( "SQLAlchemy >= 0.4" ) import sys, os, time, ConfigParser, shutil from datetime import datetime, timedelta @@ -9,12 +13,7 @@ new_path.extend( sys.path[1:] ) # remove scripts/ from the path sys.path = new_path -from galaxy import eggs import galaxy.model.mapping -import pkg_resources - -pkg_resources.require( "SQLAlchemy >= 0.4" ) - from galaxy.model.orm import and_, eagerload assert sys.version_info[:2] >= ( 2, 4 )

1 0

[hg] galaxy 2679: Eliminate buttons from shared history grid tha...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ed4cbaf23c88 changeset: 2679:ed4cbaf23c88 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Fri Sep 11 09:00:36 2009 -0400 description: Eliminate buttons from shared history grid that were not meant to be committed. 1 file(s) affected in this change: lib/galaxy/web/controllers/history.py diffs (35 lines): diff -r f0adb6152df9 -r ed4cbaf23c88 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Sep 10 21:24:06 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Sep 11 09:00:36 2009 -0400 @@ -104,9 +104,7 @@ ] operations = [ grids.GridOperation( "Clone" ), - grids.GridOperation( "Unshare" ), - grids.GridOperation( "Enable import via link", condition=( lambda item: item.deleted ) ), - grids.GridOperation( "Disable import via link", condition=( lambda item: item.deleted ) ) + grids.GridOperation( "Unshare" ) ] standard_filters = [] def build_initial_query( self, session ): @@ -280,20 +278,6 @@ association.flush() message = "Unshared %d shared histories" % len( ids ) status = 'done' - elif operation == "enable import via link": - if ids: - histories = [ get_history( trans, id ) for id in ids ] - for history in histories: - if not history.importable: - history.importable = True - history.flush() - elif operation == "disable import via link": - if ids: - histories = [ get_history( trans, id ) for id in ids ] - for history in histories: - if history.importable: - history.importable = False - history.flush() # Render the list view return self.shared_list_grid( trans, status=status, message=message, **kwargs ) @web.expose

1 0

[hg] galaxy 2682: Added Bowtie wrapper tool
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/a7b1304e736f changeset: 2682:a7b1304e736f user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Fri Sep 11 14:38:05 2009 -0400 description: Added Bowtie wrapper tool 9 file(s) affected in this change: test-data/bowtie_in1.fastq test-data/bowtie_in2.fastq test-data/bowtie_in3.fastq test-data/bowtie_out1.sam test-data/bowtie_out2.sam tool-data/bowtie_indices.loc.sample tool_conf.xml.sample tools/sr_mapping/bowtie_wrapper.py tools/sr_mapping/bowtie_wrapper.xml diffs (819 lines): diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in1.fastq Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,5 @@ +@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 +GTTTTTTNNGCATAGATGTTTAGTTGTGGTAGTCAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I + diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in2.fastq Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,4 @@ +@HWI-EAS91_1_30788AAXX:1:2:618:346/1 +TAGACTACGAAAGTGACTTTAATACCTCTGACTACA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_in3.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_in3.fastq Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,4 @@ +@HWI-EAS91_1_30788AAXX:1:2:618:346/2 +ATAGGCTGAATTAGCAATGGATGGTGGGGTTTATCG ++ +IIIIIIIIIIIIIII9I.II5II6DFIIIIII*I2) diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_out1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_out1.sam Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,1 @@ +HWI-EAS91_1_30788AAXX:1:1:1513:715 16 chrM 9563 25 36M * 0 0 CTGACTACCACAACTAAACATCTATGCNNAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 diff -r e7b899fb4462 -r a7b1304e736f test-data/bowtie_out2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie_out2.sam Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,2 @@ +HWI-EAS91_1_30788AAXX:1:2:618:346 0 chrM 441 25 36M * 0 0 TAGACTACGAAAGTGACTTTAATACCTCTGACTACA IIIIIIIIIIIIIIIIIIIIIIIIIIIII%4II;I3 NM:i:0 X0:i:1 MD:Z:36 +HWI-EAS91_1_30788AAXX:1:2:618:346 16 chrM 652 25 36M * 0 0 CGATAAACCCCACCATCCATTGCTAATTCAGCCTAT )2I*IIIIIIFD6II5II.I9IIIIIIIIIIIIIII NM:i:1 X1:i:1 MD:Z:17A18 diff -r e7b899fb4462 -r a7b1304e736f tool-data/bowtie_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie_indices.loc.sample Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,28 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Bowtie indexed sequences data files. You will need +#to create these data files and then create a bowtie_indices.loc file +#similar to this one (store it in this directory ) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (white space characters are TAB characters): +# +#<build> <file_base> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/bowtie/hg18/, +#then the bowtie_indices.loc entry would look like this: +# +#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +# +#and your /depot/data2/galaxy/bowtie/hg18/ directory +#would contain hg18.*.ebwt files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt +#...etc... +# +#Your bowtie_indices.loc file should include an entry per line for +#each index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 diff -r e7b899fb4462 -r a7b1304e736f tool_conf.xml.sample --- a/tool_conf.xml.sample Fri Sep 11 12:48:33 2009 -0400 +++ b/tool_conf.xml.sample Fri Sep 11 14:38:05 2009 -0400 @@ -332,7 +332,8 @@ <tool file="metag_tools/megablast_xml_parser.xml" /> <tool file="metag_tools/blat_wrapper.xml" /> <tool file="metag_tools/mapping_to_ucsc.xml" /> - </section> + <tool file="sr_mapping/bowtie_wrapper.xml" /> + </section> <section name="Tracks" id="tracks"> <tool file="visualization/genetrack.xml" /> </section> diff -r e7b899fb4462 -r a7b1304e736f tools/sr_mapping/bowtie_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/bowtie_wrapper.py Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,174 @@ +#! /usr/bin/python + +""" +Runs Bowtie on single-end or paired-end data. +""" + +import optparse, os, sys, tempfile + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option('', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format') + parser.add_option('', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format') + parser.add_option('', '--output', dest='output', help='The output file') + parser.add_option('', '--paired', dest='paired', help='Whether the data is single- or paired-end') + parser.add_option('', '--genomeSource', dest='genomeSource', help='The type of reference provided') + parser.add_option('', '--ref', dest='ref', help='The reference genome to use or index') + parser.add_option('', '--skip', dest='skip', help='Skip the first n reads') + parser.add_option('', '--alignLimit', dest='alignLimit', help='Only align the first n reads') + parser.add_option('', '--trimH', dest='trimH', help='Trim n bases from high-quality (left) end of each read before alignment') + parser.add_option('', '--trimL', dest='trimL', help='Trim n bases from low-quality (right) end of each read before alignment') + parser.add_option('', '--mismatchSeed', dest='mismatchSeed', help='Maximum number of mismatches permitted in the seed') + parser.add_option('', '--mismatchQual', dest='mismatchQual', help='Maximum permitted total of quality values at mismatched read positions') + parser.add_option('', '--seedLen', dest='seedLen', help='Seed length') + parser.add_option('', '--rounding', dest='rounding', help='Whether or not to round to the nearest 10 and saturating at 30') + parser.add_option('', '--maqSoapAlign', dest='maqSoapAlign', help='Choose MAQ- or SOAP-like alignment policy') + parser.add_option('', '--tryHard', dest='tryHard', help='Whether or not to try as hard as possible to find valid alignments when they exist') + parser.add_option('', '--valAlign', dest='valAlign', help='Report up to n valid arguments per read') + parser.add_option('', '--allValAligns', dest='allValAligns', help='Whether or not to report all valid alignments per read') + parser.add_option('', '--suppressAlign', dest='suppressAlign', help='Suppress all alignments for a read if more than n reportable alignments exist') + parser.add_option('', '--offbase', dest='offbase', help='Number the first base of a reference sequence as n when outputting alignments') + parser.add_option('', '--best', dest='best', help="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions") + parser.add_option('', '--maxBacktracks', dest='maxBacktracks', help='Maximum number of backtracks permitted when aligning a read') + parser.add_option('', '--threadMem', dest='threadMem', help='Number of megabytes of memory a given thread is given to store path descriptors in best mode') + parser.add_option('', '--strata', dest='strata', help='Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable') + parser.add_option('', '--minInsert', dest='minInsert', help='Minimum insert size for valid paired-end alignments') + parser.add_option('', '--maxInsert', dest='maxInsert', help='Maximum insert size for valid paired-end alignments') + parser.add_option('', '--mateOrient', dest='mateOrient', help='The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand') + parser.add_option('', '--maxAlignAttempt', dest='maxAlignAttempt', help='Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate') + parser.add_option('', '--forwardAlign', dest='forwardAlign', help='Whether or not to attempt to align the forward reference strand') + parser.add_option('', '--reverseAlign', dest='reverseAlign', help='Whether or not to attempt to align the reverse-complement reference strand') + parser.add_option('', '--phased', dest='phased', help='Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time') + parser.add_option('', '--offrate', dest='offrate', help='Override the offrate of the index to n') + parser.add_option('', '--mm', dest='mm', help='Whether or not to use memory-mapped I/O to load the index') + parser.add_option('', '--seed', dest='seed', help='Seed for pseudo-random number generator') + parser.add_option('', '--dbkey', dest='dbkey', help='') + parser.add_option('', '--params', dest='params', help='Whether to use default or specified parameters') + parser.add_option('', '--iauto_b', dest='iauto_b', help='Automatic or specified behavior') + parser.add_option('', '--ipacked', dest='ipacked', help='Whether or not to use a packed representation for DNA strings') + parser.add_option('', '--ibmax', dest='ibmax', help='Maximum number of suffixes allowed in a block') + parser.add_option('', '--ibmaxdivn', dest='ibmaxdivn', help='Maximum number of suffixes allowed in a block as a fraction of the length of the reference') + parser.add_option('', '--idcv', dest='idcv', help='The period for the difference-cover sample') + parser.add_option('', '--inodc', dest='inodc', help='Whether or not to disable the use of the difference-cover sample') + parser.add_option('', '--inoref', dest='inoref', help='Whether or not to build the part of the reference index used only in paried-end alignment') + parser.add_option('', '--ioffrate', dest='ioffrate', help='How many rows get marked during annotation of some or all of the Burrows-Wheeler rows') + parser.add_option('', '--iftab', dest='iftab', help='The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query') + parser.add_option('', '--intoa', dest='intoa', help='Whether or not to convert Ns in the reference sequence to As') + parser.add_option('', '--iendian', dest='iendian', help='Endianness to use when serializing integers to the index file') + parser.add_option('', '--iseed', dest='iseed', help='Seed for the pseudorandom number generator') + parser.add_option('', '--icutoff', dest='icutoff', help='Number of first bases of the reference sequence to index') + parser.add_option('', '--ioldpmap', dest='ioldpmap', help='Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8') + parser.add_option('', '--indexSettings', dest='index_settings', help='Whether or not indexing options are to be set') + (options, args) = parser.parse_args() + + # index if necessary + if options.genomeSource == 'history': + # set up commands + if options.index_settings =='index_pre_set': + indexing_cmds = '' + else: + try: + indexing_cmds = '%s %s %s %s %s %s %s --offrate %s %s %s %s %s %s %s' % \ + (('','--noauto')[options.iauto_b=='set'], + ('','--packed')[options.ipacked=='packed'], + ('','--bmax %s'%options.ibmax)[options.ibmax!='None' and options.ibmax>=1], + ('','--bmaxdivn %s'%options.ibmaxdivn)[options.ibmaxdivn!='None'], + ('','--dcv %s'%options.idcv)[options.idcv!='None'], + ('','--nodc')[options.inodc=='nodc'], + ('','--noref')[options.inoref=='noref'], options.ioffrate, + ('','--ftabchars %s'%options.iftab)[int(options.iftab)>=0], + ('','--ntoa')[options.intoa=='yes'], + ('--little','--big')[options.iendian=='big'], + ('','--seed %s'%options.iseed)[int(options.iseed)>0], + ('','--cutoff %s'%options.icutoff)[int(options.icutoff)>0], + ('','--oldpmap')[options.ioldpmap=='yes']) + except ValueError: + indexing_cmds = '' + + # make temp directory for placement of indices and copy reference file there + tmp_dir = tempfile.gettempdir() + try: + os.system('cp %s %s' % (options.ref, tmp_dir)) + except Exception, erf: + stop_err('Error creating temp directory for indexing purposes\n' + str(erf)) + options.ref = os.path.join(tmp_dir,os.path.split(options.ref)[1]) + cmd1 = 'cd %s; bowtie-build %s -f %s %s > /dev/null' % (tmp_dir, indexing_cmds, options.ref, options.ref) + try: + os.system(cmd1) + except Exception, erf: + stop_err('Error indexing reference sequence\n' + str(erf)) + + # set up aligning and generate aligning command options + # automatically set threads to 8 in both cases + if options.params == 'pre_set': + aligning_cmds = '-p 8' + else: + try: + aligning_cmds = '%s %s %s %s %s %s %s %s %s %s %s %s %s %s ' \ + '%s %s %s %s %s %s %s %s %s %s %s %s %s %s -p 8' % \ + (('','-s %s'%options.skip)[options.skip!='None'], + ('','-u %s'%options.alignLimit)[int(options.alignLimit)>0], + ('','-5 %s'%options.trimH)[int(options.trimH)>=0], + ('','-3 %s'%options.trimL)[int(options.trimL)>=0], + ('','-n %s'%options.mismatchSeed)[options.mismatchSeed=='0' or options.mismatchSeed=='1' or options.mismatchSeed=='2' or options.mismatchSeed=='3'], + ('','-e %s'%options.mismatchQual)[int(options.mismatchQual)>=0], + ('','-l %s'%options.seedLen)[int(options.seedLen)>=5], + ('','--nomaqround')[options.rounding=='noRound'], + ('','-v %s'%options.maqSoapAlign)[options.maqSoapAlign!='-1'], + ('','-I %s'%options.minInsert)[options.minInsert!='None'], + ('','-X %s'%options.maxInsert)[options.maxInsert!='None'], + ('','--%s'%options.mateOrient)[options.mateOrient!='None'], + ('','--pairtries %s'%options.maxAlignAttempt)[int(options.maxAlignAttempt)>=0], + ('','--nofw')[options.forwardAlign=='noForward'], + ('','--norc')[options.reverseAlign=='noReverse'], + ('','--maxbts %s'%options.maxBacktracks)[options.maxBacktracks!='None' and (options.mismatchSeed=='2' or options.mismatchSeed=='3')], + ('','-y')[options.tryHard=='doTryHard'], + ('','--chunkmbs %s'%options.threadMem)[options.threadMem!='None' and int(options.threadMem)>=0], + ('','-k %s'%options.valAlign)[options.valAlign!='None' and int(options.valAlign)>=0], + ('','-a')[options.allValAligns=='doAllValAligns' and int(options.allValAligns)>=0], + ('','-m %s'%options.suppressAlign)[int(options.suppressAlign)>=0], + ('','--best')[options.best=='doBest'], + ('','--strata')[options.strata=='doStrata'], + ('','-B %s'%options.offbase)[int(options.offbase)>=0], + ('','-z %s'%options.phased)[options.phased!='None'], + ('','-o %s'%options.offrate)[int(options.offrate)>=0], + ('','--mm')[options.mm=='doMm'], + ('','--seed %s'%options.seed)[int(options.seed)>=0]) + except ValueError: + aligning_cmds = '-p 8' + + tmp_out = tempfile.NamedTemporaryFile() + + # prepare actual aligning commands + if options.paired == 'paired': + cmd2 = 'bowtie %s %s -1 %s -2 %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, options.input2, tmp_out.name) + else: + cmd2 = 'bowtie %s %s %s > %s 2> /dev/null' % (aligning_cmds, options.ref, options.input1, tmp_out.name) + # prepare command to convert bowtie output to sam and alternative + cmd3 = 'bowtie2sam.pl %s > %s' % (tmp_out.name, options.output) + cmd4 = 'cp %s %s' % (tmp_out.name, options.output) + + # align + try: + os.system(cmd2) + except Exception, erf: + stop_err("Error aligning sequence\n" + str(erf)) + if len(file(tmp_out.name,'r').read()) > 0: + #convert + try: + os.system(cmd3) + except Exception, erf: + stop_err('Error converting output to sam format\n' + str(erf)) + else: + try: + os.system(cmd4) + sys.stdout.write('Alignment file contained no data') + except Exception, erf: + stop_err('Error producing alignment file. File contained no data.\n' + str(erf)) + +if __name__=="__main__": __main__() diff -r e7b899fb4462 -r a7b1304e736f tools/sr_mapping/bowtie_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/bowtie_wrapper.xml Fri Sep 11 14:38:05 2009 -0400 @@ -0,0 +1,556 @@ +<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0"> + <description> fast alignment of reads against reference sequence </description> + <command interpreter="python"> + bowtie_wrapper.py + --input1=$singlePaired.input1 + #if $singlePaired.sPaired == "paired": + --input2=$singlePaired.input2 + #else: + --input2="None" + #end if + --output=$output + --paired=$singlePaired.sPaired + --genomeSource=$refGenomeSource.genomeSource + #if $refGenomeSource.genomeSource == "history": + --ref=$refGenomeSource.ownFile + #else: + --ref=$refGenomeSource.indices.value + #end if + --params=$singlePaired.params.settings_type + #if $singlePaired.params.settings_type == "full": + --skip=$singlePaired.params.skip + --alignLimit=$singlePaired.params.alignLimit + --trimH=$singlePaired.params.trimH + --trimL=$singlePaired.params.trimL + --mismatchSeed=$singlePaired.params.mismatchSeed + --mismatchQual=$singlePaired.params.mismatchQual + --seedLen=$singlePaired.params.seedLen + --rounding=$singlePaired.params.rounding + --maqSoapAlign=$singlePaired.params.maqSoapAlign + --tryHard=$singlePaired.params.tryHard + --valAlign=$singlePaired.params.valAlign + --allValAligns=$singlePaired.params.allValAligns + --suppressAlign=$singlePaired.params.suppressAlign + --offbase=$singlePaired.params.offbase + --offrate=$singlePaired.params.offrate + --mm=$singlePaired.params.mm + --seed=$singlePaired.params.seed + --best=$singlePaired.params.bestOption.best + #if $singlePaired.params.bestOption.best == "doBest": + --maxBacktracks=$singlePaired.params.bestOption.maxBacktracks + --threadMem=$singlePaired.params.bestOption.threadMem + --strata=$singlePaired.params.bestOption.strata + --phased="None" + #else: + --maxBacktracks="None" + --threadMem="None" + --strata="None" + #if $singlePaired.sPaired =="single": + --phased=$singlePaired.params.bestOption.phased + #else: + --phased="None" + #end if + #end if + #if $singlePaired.sPaired == "single": + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + #else: + --minInsert=$singlePaired.params.minInsert + --maxInsert=$singlePaired.params.maxInsert + --mateOrient=$singlePaired.params.mateOrient + --maxAlignAttempt=$singlePaired.params.maxAlignAttempt + --forwardAlign=$singlePaired.params.forwardAlign + --reverseAlign=$singlePaired.params.reverseAlign + #end if + #else + --skip="None" + --alignLimit="None" + --trimH="None" + --trimL="None" + --mismatchSeed="None" + --mismatchQual="None" + --seedLen="None" + --rounding="None" + --maqSoapAlign="None" + --tryHard="None" + --valAlign="None" + --allValAligns="None" + --suppressAlign="None" + --offbase="None" + --best="None" + --maxBacktracks="None" + --threadMem="None" + --strata="None" + --minInsert="None" + --maxInsert="None" + --mateOrient="None" + --maxAlignAttempt="None" + --forwardAlign="None" + --reverseAlign="None" + --phased="None" + --offrate="None" + --mm="None" + --seed="None" + #end if + #if $refGenomeSource.genomeSource == "history": + --dbkey=$dbkey + #else: + --dbkey="None" + #end if + #if $refGenomeSource.genomeSource == "history": + --indexSettings=$refGenomeSource.indexParams.index_settings + #else: + --indexSettings="None" + #end if + #if $refGenomeSource.genomeSource == "history" and $refGenomeSource.indexParams.index_settings == "index_full": + --iauto_b=$refGenomeSource.indexParams.auto_behavior.auto_b + #if $refGenomeSource.indexParams.auto_behavior.auto_b == "set": + --ipacked=$refGenomeSource.indexParams.auto_behavior.packed + --ibmax=$refGenomeSource.indexParams.auto_behavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.auto_behavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.auto_behavior.dcv + #else: + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + --ioldpmap=$refGenomeSource.indexParams.oldpmap + #else: + --iauto_b="None" + --ipacked="None" + --ibmax="None" + --ibmaxdivn="None" + --idcv="None" + --inodc="None" + --inoref="None" + --ioffrate="None" + --iftab="None" + --intoa="None" + --iendian="None" + --iseed="None" + --icutoff="None" + --ioldpmap="None" + #end if + </command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="indices" type="select" label="Select a reference genome"> + <options from_file="bowtie_indices.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + <filter type="sort_by" column="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference genome" /> + <conditional name="indexParams"> + <param name="index_settings" type="select" label="Choose whether to use default options or to set your own"> + <option value="index_pre_set">Commonly Used</option> + <option value="index_full">Full Parameter List</option> + </param> + <when value="index_pre_set" /> + <when value="index_full"> + <conditional name="auto_behavior"> + <param name="auto_b" type="select" label="Choose to use automatic or specified behavior for some parameters (-a)" help="Allows you to set --packed, --bmax, --bmaxdivn, and --dcv"> + <option value="auto">Automatic behavior</option> + <option value="set">Set values (sets --noauto and allows others to be set)</option> + </param> + <when value="auto" /> + <when value="set"> + <param name="packed" type="select" label="Whether or not to use a packed representation for DNA strings (-p)"> + <option value="unpacked">Use regular representation</option> + <option value="packed">Use packed representation</option> + </param> + <param name="bmax" type="integer" value="-1" label="Maximum number of suffixes allowed in a block (--bmax)" help="-1 for not specified. Must be at least 1" /> + <param name="bmaxdivn" type="integer" value="4" label="Maximum number of suffixes allowed in a block as a fraction of the length of the reference (--bmaxdivn)" /> + <param name="dcv" type="integer" value="1024" label="The period for the difference-cover sample (--dcv)" /> + </when> + </conditional> + <param name="nodc" type="select" label="Whether or not to disable the use of the difference-cover sample (--nodc)" help="Suffix sorting becomes quadratic-time in the worst case (a very repetetive reference)"> + <option value="dc">Use difference-cover sample</option> + <option value="nodc">Disable difference-cover sample</option> + </param> + <param name="noref" type="select" label="Whether or not to build the part of the reference index used only in paired-end alignment (-r)"> + <option value="ref">Build all index files</option> + <option value="noref">Do not build paired-end alignment index files</option> + </param> + <param name="offrate" type="integer" value="5" label="How many rows get marked during annotation of some or all of the Burrows-Wheeler rows (-o)" /> + <param name="ftab" type="integer" value="10" label="The size of the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first n characters of the query (-t)" help="ftab is 4^(n+1) bytes" /> + <param name="ntoa" type="select" label="Whether or not to convert Ns in the reference sequence to As (--ntoa)"> + <option value="no">Do not convert Ns</option> + <option value="yes">Convert Ns to As</option> + </param> + <param name="endian" type="select" label="Endianness to use when serializing integers to the index file (--big/--little)" help="Little is most appropriate for Intel- and AMD-based architecture"> + <option value="little">Little</option> + <option value="big">Big</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for the pseudorandom number generator (--seed)" help="Use -1 to use default" /> + <param name="cutoff" type="integer" value="-1" label="Number of first bases of the reference sequence to index (--cutoff)" help="Use -1 to use default" /> + <param name="oldpmap" type="select" label="Use the scheme for mapping joined reference locations to original reference locations used in versions of Bowtie prior to 0.9.8 (--oldpmap)" help="The old scheme uses padding and the new one doesn't"> + <option value="no">Use the new scheme</option> + <option value="yes">Use the old scheme</option> + </param> + </when>  + </conditional> + </when> + </conditional>  + <conditional name="singlePaired"> + <param name="sPaired" type="select" label="Is this library mate-paired?"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> + <conditional name="params"> + <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="pre_set">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="pre_set" /> + <when value="full"> + <param name="skip" type="integer" value="0" label="Skip the first n reads (-s)" /> + <param name="alignLimit" type="integer" value="-1" label="Only align the first n reads (-u)" help="-1 for off" /> + <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per read (-k)" /> + <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per read (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a read if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> + <conditional name="bestOption"> + <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="phased" type="select" label="Whether or not it should alternate between using the forward and mirror indexes in a series of phases so that only half of the index is resident in memory at one time (-z)"> + <option value="noPhased">Don't alternate</option> + <option value="doPhased">Do alternate</option> + </param> + </when> + <when value="doBest"> + <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> + <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional>  + <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n (-o)" help="-1 for default" /> + <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--m)"> + <option value="noMm">Use POSIX/C file I/O</option> + <option value="doMm">Use memory-mapped I/O</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when>  + </conditional>  + </when>  + <when value="paired"> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> + <conditional name="params"> + <param name="settings_type" type="select" label="BWA settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list"> + <option value="pre_set">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="pre_set" /> + <when value="full"> + <param name="skip" type="integer" value="0" label="Skip the first n pairs (-s)" /> + <param name="alignLimit" type="integer" value="-1" label="Only align the first n pairs (-u)" help="-1 for off" /> + <param name="trimH" type="integer" value="0" label="Trim n bases from high-quality (left) end of each read before alignment (-5)" /> + <param name="trimL" type="integer" value="0" label="Trim n bases from low-quality (right) end of each read before alignment (-3)" /> + <param name="mismatchSeed" type="integer" value="2" label="Maximum number of mismatches permitted in the seed (-n)" help="May be 0, 1, 2, or 3" /> + <param name="mismatchQual" type="integer" value="70" label="Maximum permitted total of quality values at mismatched read positions (-e)" /> + <param name="seedLen" type="integer" value="28" label="Seed length (-l)" help="Minimum value is 5" /> + <param name="rounding" type="select" label="Whether or not to round to the nearest 10 and saturating at 30 (--nomaqround)"> + <option value="round">Round to nearest 10</option> + <option value="noRound">Do not round to nearest 10</option> + </param> + <param name="maqSoapAlign" type="integer" value="-1" label="Number of mismatches for SOAP-like alignment policy (-v)" help="-1 for default MAQ-like alignment policy" /> + <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments (-I)" /> + <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments (-X)" /> + <param name="mateOrient" type="select" label="The upstream/downstream mate orientation for valid paired-end alignment against the forward reference strand (--fr/--rf/--ff)"> + <option value="fr">FR (for Illumina)</option> + <option value="rf">RF</option> + <option value="ff">FF</option> + </param> + <param name="maxAlignAttempt" type="integer" value="100" label="Maximum number of attempts Bowtie will make to match an alignment for one mate with an alignment for the opposite mate (--pairtries)" /> + <param name="forwardAlign" type="select" label="Choose whether or not to attempt to align the forward reference strand (--nofw)"> + <option value="forward">Align against the forward reference strand</option> + <option value="noForward">Do not align against the forward reference strand</option> + </param> + <param name="reverseAlign" type="select" label="Choose whether or not to align against the reverse-complement reference strand (--norc)"> + <option value="reverse">Align against the reverse-complement reference strand</option> + <option value="noReverse">Do not align against the reverse-complement reference strand</option> + </param> + <param name="tryHard" type="select" label="Whether or not to try as hard as possible to find valid alignments when they exist (-y)" help="Tryhard mode is much slower than regular mode"> + <option value="noTryHard">Do not try hard</option> + <option value="doTryHard">Try hard</option> + </param> + <param name="valAlign" type="integer" value="1" label="Report up to n valid arguments per pair (-k)" /> + <param name="allValAligns" type="select" label="Whether or not to report all valid alignments per pair (-a)"> + <option value="noAllValAligns">Do not report all valid alignments</option> + <option value="doAllValAligns">Report all valid alignments</option> + </param> + <param name="suppressAlign" type="integer" value="-1" label="Suppress all alignments for a pair if more than n reportable alignments exist (-m)" help="-1 for no limit" /> + <param name="offbase" type="integer" value="0" label="Number the first base of a reference sequence as n when outputting alignments (-B)" /> + <conditional name="bestOption"> + <param name="best" type="select" label="Whether or not to make Bowtie guarantee that reported singleton alignments are 'best' in terms of stratum and in terms of the quality values at the mismatched positions (--best)" help="Removes all strand bias. Only affects which alignments are reported by Bowtie. Runs slower with best option"> + <option value="noBest">Do not use best</option> + <option value="doBest">Use best</option> + </param> + <when value="noBest"> + <param name="maxBacktracks" type="integer" value="125" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + </when> + <when value="doBest"> + <param name="maxBacktracks" type="integer" value="800" label="Maximum number of backtracks permitted when aligning a read (--maxbts)" /> + <param name="threadMem" type="integer" value="32" label="Number of megabytes of memory a given thread is given to store path descriptors in best mode (--chunkmbs)" help="If running in best mode, and you run out of memory, try adjusting this" /> + <param name="strata" type="select" label="Whether or not to report only those alignments that fall in the best stratum if many valid alignments exist and are reportable (--strata)"> + <option value="noStrata">Do not use strata option</option> + <option value="doStrata">Use strata option</option> + </param> + </when> + </conditional> + <param name="offrate" type="integer" value="-1" label="Override the offrate of the index to n -o)" help="-1 for default" /> + <param name="mm" type="select" label="Whether or not to use memory-mapped I/O to load the index (--mm)"> + <option value="noMm">Use POSIX/C file I/O</option> + <option value="doMm">Use memory-mapped I/O</option> + </param> + <param name="seed" type="integer" value="-1" label="Seed for pseudo-random number generator (--seed)" help="-1 for default" /> + </when>  + </conditional>  + </when>  + </conditional>  + </inputs> + <outputs> + <data format="sam" name="output" /> + </outputs> + <tests> + <test> + <param name="genomeSource" value="indexed" /> + <param name="indices" value="chrM" /> + <param name="sPaired" value="single" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out1.sam" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chrM.fa" /> + <param name="index_settings" value="index_pre_set" /> + <param name="sPaired" value="paired" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" /> + <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out2.sam" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="chrM.fa" /> + <param name="index_settings" value="index_full" /> + <param name="auto_b" value="set" /> + <param name="packed" value="unpacked" /> + <param name="bmax" value="-1" /> + <param name="bmaxdivn" value="4" /> + <param name="dcv" value="2048" /> + <param name="nodc" value="dc" /> + <param name="noref" value="noref" /> + <param name="offrate" value="6" /> + <param name="ftab" value="10" /> + <param name="ntoa" value="yes" /> + <param name="endian" value="little" /> + <param name="seed" value="-1" /> + <param name="cutoff" value="-1" /> + <param name="oldpmap" value="no" /> + <param name="sPaired" value="single" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in1.fastq" /> + <param name="settings_type" value="pre_set" /> + <output name="output" ftype="sam" file="bowtie_out1.sam" /> + </test> + <test> + <param name="genomeSource" value="indexed" /> + <param name="indices" value="chrM" /> + <param name="sPaired" value="paired" /> + <param name="input1" ftype="fastqsanger" value="bowtie_in2.fastq" /> + <param name="input2" ftype="fastqsanger" value="bowtie_in3.fastq" /> + <param name="settings_type" value="full" /> + <param name="skip" value="0" /> + <param name="alignLimit" value="-1" /> + <param name="trimL" value="0" /> + <param name="trimH" value="0" /> + <param name="mismatchSeed" value="3" /> + <param name="mismatchQual" value="50" /> + <param name="seedLen" value="10" /> + <param name="rounding" value="round" /> + <param name="maqSoapAlign" value="-1" /> + <param name="minInsert" value="0" /> + <param name="maxInsert" value="250" /> + <param name="mateOrient" value="fr" /> + <param name="maxAlignAttempt" value="100" /> + <param name="forwardAlign" value="forward" /> + <param name="reverseAlign" value="reverse" /> + <param name="tryHard" value="doTryHard" /> + <param name="valAlign" value="1" /> + <param name="allValAligns" value="noAllValAligns" /> + <param name="suppressAlign" value="-1" /> + <param name="offbase" value="0" /> + <param name="best" value="doBest" /> + <param name="maxBacktracks" value="800" /> + <param name="threadMem" value="32" /> + <param name="strata" value="noStrata" /> + <param name="offrate" value="-1" /> + <param name="mm" value="noMm" /> + <param name="seed" value="403" /> + <output name="output" ftype="sam" file="bowtie_out2.sam" /> + </test> + </tests> + <help> + +**What it does** + +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. Reads can be as long as 1024 base pairs, though shorter is better. Bowtie produces a specific output format which is converted to SAM by this tool. + +.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +------ + +**Input formats** + +Bowtie accepts files in Sanger FASTQ format. + +------ + +**Outputs** + +The output is in SAM format, and has the following columns:: + + 1 QNAME - Query (pair) NAME + 2 FLAG - bitwise FLAG + 3 RNAME - Reference sequence NAME + 4 POS - 1-based leftmost POSition/coordinate of clipped sequence + 5 MAPQ - MAPping Quality (Phred-scaled) + 6 CIGAR - extended CIGAR string + 7 MRNM - Mate Reference sequence NaMe ('=' if same as RNAME) + 8 MPOS - 1-based Mate POSition + 9 ISIZE - Inferred insert SIZE + 10 SEQ - query SEQuence on the same strand as the reference + 11 QUAL - query QUALity (ASCII-33 gives the Phred base quality) + 12 OPT - variable OPTional fields in the format TAG:VTYPE:VALU + +The flags are as follows:: + + Flag - Description + 0x0001 - the read is paired in sequencing + 0x0002 - the read is mapped in a proper pair + 0x0004 - the query sequence itself is unmapped + 0x0008 - the mate is unmapped + 0x0010 - strand of the query (1 for reverse) + 0x0020 - strand of the mate + 0x0040 - the read is the first read in a pair + 0x0080 - the read is the second read in a pair + 0x0100 - the alignment is not primary + +It looks like this (scroll sideways to see the entire example):: + + QNAME FLAG RNAME POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL OPT + HWI-EAS91_1_30788AAXX:1:1:1761:343 4 * 0 0 * * 0 0 AAAAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAACNNANNGAGTNGNNNNNNNGCTTCCCACAGNNCTGG hhhhhhh;;hhhhhhhhhhh^hOhhhhghhhfhhhgh;;h;;hhhh;h;;;;;;;hhhhhhghhhh;;Phhh + HWI-EAS91_1_30788AAXX:1:1:1578:331 4 * 0 0 * * 0 0 GTATAGANNAATAAGAAAAAAAAAAATGAAGACTTTCNNANNTCTGNANNNNNNNTCTTTTTTCAGNNGTAG hhhhhhh;;hhhhhhhhhhhhhhhhhhhhhhhhhhhh;;h;;hhhh;h;;;;;;;hhhhhhhhhhh;;hhVh + +------- + +**Bowtie settings** + +All of the options have a default value. You can change any of them. Most of the options in Bowtie have been implemented here. + +------ + +**Bowtie parameter list** + +This is an exhaustive list of Bowtie options: + +For indexing (bowtie-build):: + -a No auto behavior. Disable the default behavior where bowtie automatically selects values for --bmax/--dcv/--packed parameters according to the memory available. [off] + -p Packing. Use a packed representation for DNA strings. [auto] + --bmax <int> Suffix maximum. The maximum number of suffixes allowed in a block. [auto] + --bmaxdivn <int> Suffix maximum fraction. The maximum number of suffixes allowed in a block expressed as a fraction of the length of the reference. [4] + --dcv <int> Difference-cover sample. Use <int> as the period for the difference-cover sample. [1024] + --nodc <int> No difference-cover sample. Disable the difference-cover sample. [off] + -r No reference indexes. Do not build the NAME.3.ebwt and NAME.4.ebwt portions of the index, used only for paired-end alignment. [off] + -o Offrate. How many Burrows-Wheeler rows get marked by the indexer. The indexer will mark every 2^<int> rows. The marked rows correspond to rows on the genome. [5] + -t <int> Ftab. The lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. Ftab is 4^<int>+1 bytes. [10] + --ntoa N conversion. Convert Ns to As before building the index. Otherwise, Ns are simply excluded from the index and Bowtie will not find alignments that overlap them. [off] + --big Endianness. Endianness to use when serializing integers to the index file. [off] + --little Endianness. [--little] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + --cutoff <int> Cutoff. Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest. [off] + --oldpmap Use old mapping scheme. Use the padding-based scheme from Bowtie versions before 0.9.8 instead of the current scheme. [off] + +For aligning (bowtie):: + -s <int> Skip. Do not align the first <int> reads or pairs in the input. [off] + -u <int> Align limit. Only align the first <int> reads/pairs from the input. [no limit] + -5 <int> High-quality trim. Trim <int> bases from the high-quality (left) end of each read before alignment. [0] + -3 <int> Low-quality trim. Trim <int> bases from the low-quality (right) end of each read before alignment. [0] + -n <int> Mismatch seed. Maximum number of mismatches permitted in the seed (defined with seed length option). Can be 0, 1, 2, or 3. [2] + -e <int> Mismatch quality. Maximum permitted total of quality values at mismatched read positions. Bowtie rounds quality values to the nearest 10 and saturates at 30. [70] + -l <int> Seed length. The number of bases on the high-quality end of the read to which the -n ceiling applies. Must be at least 5. [28] + --nomaqround Suppress MAQ rounding. Values are internally rounded to the nearest 10 and saturate at 30. This options turns off that rounding. [off] + -v <int> MAQ- or SOAP-like alignment policy. This option turns off the default MAQ-like alignment policy in favor of a SOAP-like one. End-to-end alignments with at most <int> mismatches. [off] + -I <int> Minimum insert. The minimum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [0] + --fr Mate orientation. The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. [--fr] + --rf Mate orientation. [off] + --ff Mate orientation. [off] + -X <int> Maximum insert. The maximum insert size for valid paired-end alignments. Does checking on untrimmed reads if -5 or -3 is used. [250] + --pairtries <int> Maximum alignment attempts for paired-end data. [100] + --nofw No forward aligning. Choosing this option means that Bowtie will not attempt to align against the forward reference strand. [off] + --norc No reverse-complement aligning. Setting this will mean that Bowtie will not attempt to align against the reverse-complement reference strand. [off] + --maxbts <int> Maximum backtracks. The maximum number of backtracks permitted when aligning a read in -n 2 or -n 3 mode. [125 without --best] [800 with --best] + -y Try hard. Try as hard as possible to find valid alignments when they exist, including paired-end alignments. [off] + --chunkmbs <int> Thread memory. The number of megabytes of memory a given thread is given to store path descriptors in --best mode. [32] + -k <int> Valid alignments. The number of valid alignments per read or pair. [off] + -a All valid alignments. Choosing this means that all valid alignments per read or pair will be reported. [off] + -m <int> Suppress alignments. Suppress all alignments for a particular read or pair if more than <int> reportable alignments exist for it. [no limit] + --best Best mode. Make Bowtie guarantee that reported singleton alignments are "best" in terms of stratum (the number of mismatches) and quality values at mismatched position. [off] + --strata Best strata. When running in best mode, report alignments that fall into the best stratum if there are ones falling into more than one. [off] + -B <int> First base number. When outputting alignments, number the first base of a reference sequence as <int>. [0] + -z <int> Phased. Alternate between using the forward and mirror indexes in a series of phases such that only one half of the index is resident in memory at one time. Cannot be used with paired-end alignment. [off] + -o <int> Offrate override. Override the offrate of the index with <int>. Some row markings are discarded when index read into memory. <int> must be greater than the value used to build the index (default: 5). [off] + --mm I/O for index loading. Choosing this option means that memory-mapped I/O will be used to load the index instead of the normal POSIX/C file I/O. Allows memory-efficient parallelization where using -p is not desirable. [off] + --seed <int> Random seed. Use <int> as the seed for the pseudo-random number generator. [off] + + </help> +</tool>

1 0

[hg] galaxy 2681: Fix syntax error when running workflows. This ...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/e7b899fb4462 changeset: 2681:e7b899fb4462 user: James Taylor <james(a)jamestaylor.org> date: Fri Sep 11 12:48:33 2009 -0400 description: Fix syntax error when running workflows. This is actually a regression in Mako, the multiline conditional in the elif was somehow causing it to improperly nest the if statements 2 file(s) affected in this change: eggs.ini templates/workflow/run.mako diffs (34 lines): diff -r 8877ef766447 -r e7b899fb4462 eggs.ini --- a/eggs.ini Fri Sep 11 11:26:26 2009 -0400 +++ b/eggs.ini Fri Sep 11 12:48:33 2009 -0400 @@ -31,7 +31,7 @@ elementtree = 1.2.6_20050316 lrucache = 0.2 ;lsprof - james -Mako = 0.2.4 +Mako = 0.2.5 MyghtyUtils = 0.52 nose = 0.9.1 NoseHTML = 0.2 @@ -79,7 +79,7 @@ docutils = http://downloads.sourceforge.net/docutils/docutils-0.4.tar.gz elementtree = http://effbot.org/downloads/elementtree-1.2.6-20050316.tar.gz lrucache = http://evan.prodromou.name/lrucache/lrucache-0.2.tar.gz -Mako = http://www.makotemplates.org/downloads/Mako-0.2.4.tar.gz +Mako = http://www.makotemplates.org/downloads/Mako-0.2.5.tar.gz MyghtyUtils = http://cheeseshop.python.org/packages/source/M/MyghtyUtils/MyghtyUtils-0.52… nose = http://www.somethingaboutorange.com/mrl/projects/nose/nose-0.9.1.tar.gz NoseHTML = http://dist.g2.bx.psu.edu/nosehtml-0.2.tar.bz2 diff -r 8877ef766447 -r e7b899fb4462 templates/workflow/run.mako --- a/templates/workflow/run.mako Fri Sep 11 11:26:26 2009 -0400 +++ b/templates/workflow/run.mako Fri Sep 11 12:48:33 2009 -0400 @@ -87,8 +87,7 @@ ${param.get_html_field( t, value, other_values ).get_html( str(step.id) + "|" + prefix )} <input type="hidden" name="${step.id}|__force_update__${prefix}${param.name}" value="true" /> %endif - %elif isinstance( value, RuntimeValue ) or \ - ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: + %elif isinstance( value, RuntimeValue ) or ( str(step.id) + '|__runtime__' + prefix + param.name ) in incoming: ## On the first load we may see a RuntimeValue, so we write ## an input field using the initial value for the param. ## Subsequents posts will no longer have the runtime value

1 0

[hg] galaxy 2683: (1) Unicode support for tagging and (2) added ...
by Greg Von Kuster 14 Sep '09

14 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/032478337b82 changeset: 2683:032478337b82 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Fri Sep 11 14:57:02 2009 -0400 description: (1) Unicode support for tagging and (2) added tagging_common mako file to support creation and standardization of tagging elements across all pages. 9 file(s) affected in this change: lib/galaxy/web/controllers/history.py lib/galaxy/web/controllers/tag.py static/scripts/autocomplete_tagging.js static/scripts/packed/autocomplete_tagging.js templates/dataset/edit_attributes.mako templates/history/grid.mako templates/root/history.mako templates/tagging_common.mako tool_conf.xml.main diffs (781 lines): diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Fri Sep 11 09:00:36 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Fri Sep 11 14:57:02 2009 -0400 @@ -38,6 +38,17 @@ if item.users_shared_with or item.importable: return dict( operation="sharing" ) return None + class TagsColumn( grids.GridColumn ): + def __init__(self, col_name): + grids.GridColumn.__init__(self, col_name) + self.tag_elt_id_gen = 0 + + def get_value( self, trans, grid, history ): + self.tag_elt_id_gen += 1 + return trans.fill_template( "/tagging_common.mako", trans=trans, + tagged_item=history, + elt_id="tagging-elt" + str(self.tag_elt_id_gen) ) + # Grid definition title = "Stored histories" model_class = model.History @@ -48,6 +59,7 @@ link=( lambda item: iff( item.deleted, None, dict( operation="switch", id=item.id ) ) ), attach_popup=True ), DatasetsByStateColumn( "Datasets (by state)", ncells=4 ), + #TagsColumn( "Tags" ), StatusColumn( "Status", attach_popup=False ), grids.GridColumn( "Created", key="create_time", format=time_ago ), grids.GridColumn( "Last Updated", key="update_time", format=time_ago ), diff -r ed4cbaf23c88 -r 032478337b82 lib/galaxy/web/controllers/tag.py --- a/lib/galaxy/web/controllers/tag.py Fri Sep 11 09:00:36 2009 -0400 +++ b/lib/galaxy/web/controllers/tag.py Fri Sep 11 14:57:02 2009 -0400 @@ -4,7 +4,6 @@ from galaxy.model import History, HistoryTagAssociation, Dataset, DatasetTagAssociation, \ HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation, Page, PageTagAssociation - from galaxy.web.base.controller import * from galaxy.tags.tag_handler import * from sqlalchemy.sql.expression import func, and_ @@ -15,65 +14,68 @@ def __init__(self, app): BaseController.__init__(self, app) - # Set up dict for mapping from short-hand to full item class. - self.shorthand_to_item_class_dict = dict() - self.shorthand_to_item_class_dict["history"] = History - self.shorthand_to_item_class_dict["hda"] = HistoryDatasetAssociation + # Keep a list of taggable classes. + self.taggable_classes = dict() + self.taggable_classes[History.__name__] = History + self.taggable_classes[HistoryDatasetAssociation.__name__] = HistoryDatasetAssociation + self.taggable_classes[Page.__name__] = Page - # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, ... + # Set up tag handler to recognize the following items: History, HistoryDatasetAssociation, Page, ... self.tag_handler = TagHandler() self.tag_handler.add_tag_assoc_class(History, HistoryTagAssociation) self.tag_handler.add_tag_assoc_class(HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation) - + self.tag_handler.add_tag_assoc_class(Page, PageTagAssociation) + @web.expose - def add_tag_async( self, trans, id=None, item_type=None, new_tag=None ): + @web.require_login( "Add tag to an item." ) + def add_tag_async( self, trans, id=None, item_class=None, new_tag=None ): """ Add tag to an item. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) - self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tag).encode('utf-8') ) trans.sa_session.flush() @web.expose - def remove_tag_async( self, trans, id=None, item_type=None, tag_name=None ): + @web.require_login( "Remove tag from an item." ) + def remove_tag_async( self, trans, id=None, item_class=None, tag_name=None ): """ Remove tag from an item. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) - self.tag_handler.remove_item_tag(item, tag_name) + self.tag_handler.remove_item_tag( item, unicode(tag_name).encode('utf-8') ) + #print tag_name + #print unicode(tag_name) trans.sa_session.flush() # Retag an item. All previous tags are deleted and new tags are applied. @web.expose - def retag_async( self, trans, id=None, item_type=None, new_tags=None ): + @web.require_login( "Apply a new set of tags to an item; previous tags are deleted." ) + def retag_async( self, trans, id=None, item_class=None, new_tags=None ): """ Apply a new set of tags to an item; previous tags are deleted. """ - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) tag_handler.delete_item_tags(item) - self.tag_handler.apply_item_tags(trans.sa_session, item, new_tag) + self.tag_handler.apply_item_tags( trans.sa_session, item, unicode(new_tags).encode('utf-8') ) trans.sa_session.flush() - - tag_handler.delete_item_tags(history) - tag_handler.apply_item_tags(trans.sa_session, history, new_tags) - # Flush to complete changes. - trans.sa_session.flush() - + @web.expose @web.require_login( "get autocomplete data for an item's tags" ) - def tag_autocomplete_data(self, trans, id=None, item_type=None, q=None, limit=None, timestamp=None): + def tag_autocomplete_data(self, trans, id=None, item_class=None, q=None, limit=None, timestamp=None): """ Get autocomplete data for an item's tags. """ # # Get item, do security check, and get autocomplete data. # - item = self._get_item(trans, item_type, trans.security.decode_id(id)) + item = self._get_item(trans, item_class, trans.security.decode_id(id)) self._do_security_check(trans, item) + q = unicode(q).encode('utf-8') if q.find(":") == -1: return self._get_tag_autocomplete_names(trans, item, q, limit, timestamp) else: @@ -184,9 +186,9 @@ # Use the user_id associated with the HDA's history. return History.table.c.user_id - def _get_item(self, trans, item_type, id): + def _get_item(self, trans, item_class_name, id): """ Get an item based on type and id. """ - item_class = self.shorthand_to_item_class_dict[item_type] + item_class = self.taggable_classes[item_class_name] item = trans.sa_session.query(item_class).filter("id=" + str(id))[0] return item; diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/autocomplete_tagging.js --- a/static/scripts/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400 +++ b/static/scripts/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400 @@ -187,13 +187,14 @@ // Tag button is image's parent. var tag_button = $(this).parent(); - // Get tag name. + // Get tag name, value. var tag_name_elt = tag_button.find(".tag-name").eq(0); var tag_str = tag_name_elt.text(); - var tag_name = get_tag_name_and_value(tag_str)[0]; + var tag_name_and_value = get_tag_name_and_value(tag_str); + var tag_name = tag_name_and_value[0]; + var tag_value = tag_name_and_value[1]; - // TODO: should remove succeed if tag is not already applied to - // history? + var prev_button = tag_button.prev(); tag_button.remove(); // Remove tag from local list for consistency. @@ -209,12 +210,28 @@ data: { tag_name: tag_name }, error: function() { - // Failed. - alert( "Remove tag failed" ); + // Failed. Roll back changes and show alert. + settings.tags[tag_name] = tag_value; + if (prev_button.hasClass("tag-button")) + prev_button.after(tag_button); + else + tag_area.prepend(tag_button); + var new_text = settings.get_toggle_link_text_fn(settings.tags); + alert( "Remove tag failed" ); + + toggle_link.text(new_text); + + // TODO: no idea why it's necessary to set this up again. + delete_img.mouseenter( function () + { + $(this).attr("src", settings.delete_tag_img_rollover); + }); + delete_img.mouseleave( function () + { + $(this).attr("src", settings.delete_tag_img); + }); }, - success: function() - { - } + success: function() {} }); return true; @@ -323,8 +340,9 @@ data: { new_tag: new_value }, error: function() { - // Remove tag and show alert. + // Failed. Roll back changes and show alert. new_tag_button.remove(); + delete settings.tags[tag_name_and_value[0]]; var new_text = settings.get_toggle_link_text_fn(settings.tags); toggle_link.text(new_text); alert( "Add tag failed" ); diff -r ed4cbaf23c88 -r 032478337b82 static/scripts/packed/autocomplete_tagging.js --- a/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 09:00:36 2009 -0400 +++ b/static/scripts/packed/autocomplete_tagging.js Fri Sep 11 14:57:02 2009 -0400 @@ -1,1 +1,1 @@ -var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b(); if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var B=$(this).parent();var A=B.find(".tag-name").eq(0);var z=A.text();var C=h(z)[0];B.remove();delete p.tags[C];var y=p.get_toggle_link_text_fn(p.tags);s.text(y);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:C},error:function(){alert("Remove tag failed")},success:function(){}});return true});var w=$("<span>"+u+" </span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){this.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag -button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClas s("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file +var ac_tag_area_id_gen=1;jQuery.fn.autocomplete_tagging=function(c){var e={get_toggle_link_text_fn:function(u){var w="";var v=o(u);if(v!=0){w=v+(v!=0?" Tags":" Tag")}else{w="Add tags"}return w},tag_click_fn:function(u){},input_size:20,in_form:false,tags:{},use_toggle_link:true,item_id:"",add_tag_img:"",add_tag_img_rollover:"",delete_tag_img:"",ajax_autocomplete_tag_url:"",ajax_retag_url:"",ajax_delete_tag_url:"",ajax_add_tag_url:""};var p=jQuery.extend(e,c);var k="tag-area-"+(ac_tag_area_id_gen)++;var m=$("<div></div>").attr("id",k).addClass("tag-area");this.append(m);var o=function(u){if(u.length){return u.length}var v=0;for(element in u){v++}return v};var b=function(){var u=p.get_toggle_link_text_fn(p.tags);var v=$("<a href='/history/tags'>"+u+"</a>").addClass("toggle-link");v.click(function(){var w=(m.css("display")=="none");var x;if(w){x=function(){var y=o(p.tags);if(y==0){m.click()}}}else{x=function(){m.blur()}}m.slideToggle("fast",x);return false});return v};var s=b(); if(p.use_toggle_link){this.prepend(s)}var t=function(u){var v=new Array();for(key in u){v[v.length]=key+"-->"+u[key]}return"{"+v.join(",")+"}"};var a=function(v,u){return v+((u!=""&&u)?":"+u:"")};var h=function(u){return u.split(":")};var i=function(u){var v=$("<img src='"+p.add_tag_img+"' rollover='"+p.add_tag_img_rollover+"'/>").addClass("add-tag-button");v.click(function(){$(this).hide();m.click();return false});return v};var j=function(u){var v=$("<img src='"+p.delete_tag_img+"'/>").addClass("delete-tag-img");v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)});v.click(function(){var D=$(this).parent();var C=D.find(".tag-name").eq(0);var B=C.text();var z=h(B);var F=z[0];var y=z[1];var E=D.prev();D.remove();delete p.tags[F];var A=p.get_toggle_link_text_fn(p.tags);s.text(A);$.ajax({url:p.ajax_delete_tag_url,data:{tag_name:F},error:function(){p.tags[F]=y;if(E.hasClass("tag-button")){E.after(D) }else{m.prepend(D)}var G=p.get_toggle_link_text_fn(p.tags);alert("Remove tag failed");s.text(G);v.mouseenter(function(){$(this).attr("src",p.delete_tag_img_rollover)});v.mouseleave(function(){$(this).attr("src",p.delete_tag_img)})},success:function(){}});return true});var w=$("<span>"+u+"</span>").addClass("tag-name");w.click(function(){p.tag_click_fn(u);return true});var x=$("<span></span>").addClass("tag-button");x.append(w);x.append(v);return x};var d=function(v){var u;if(p.in_form){u=$("<textarea id='history-tag-input' rows='1' cols='"+p.input_size+"' value='"+v+"'></textarea>")}else{u=$("<input id='history-tag-input' type='text' size='"+p.input_size+"' value='"+v+"'></input>")}u.keyup(function(D){if(D.keyCode==27){$(this).trigger("blur")}else{if((D.keyCode==13)||(D.keyCode==188)||(D.keyCode==32)){new_value=this.value;if(return_key_pressed_for_autocomplete==true){return_key_pressed_for_autocomplete=false;return false}if(new_value.indexOf(": ",new_value.length-2)!=-1){thi s.value=new_value.substring(0,new_value.length-1);return false}if((D.keyCode==188)||(D.keyCode==32)){new_value=new_value.substring(0,new_value.length-1)}new_value=new_value.replace(/^\s+|\s+$/g,"");if(new_value.length<3){return false}this.value="";var A=j(new_value);var z=m.children(".tag-button");if(z.length!=0){var E=z.slice(z.length-1);E.after(A)}else{m.prepend(A)}var y=new_value.split(":");p.tags[y[0]]=y[1];var B=p.get_toggle_link_text_fn(p.tags);s.text(B);var C=$(this);$.ajax({url:p.ajax_add_tag_url,data:{new_tag:new_value},error:function(){A.remove();delete p.tags[y[0]];var F=p.get_toggle_link_text_fn(p.tags);s.text(F);alert("Add tag failed")},success:function(){C.flushCache()}});return false}}});var w=function(A,z,y,C,B){tag_name_and_value=C.split(":");return(tag_name_and_value.length==1?tag_name_and_value[0]:tag_name_and_value[1])};var x={selectFirst:false,formatItem:w,autoFill:false,highlight:false};u.autocomplete(p.ajax_autocomplete_tag_url,x);u.addClass("tag-input ");return u};for(tag_name in p.tags){var q=p.tags[tag_name];var l=a(tag_name,q);var g=j(l,s,p.tags);m.append(g)}var n=d("");var f=i(n);m.blur(function(u){r=o(p.tags);if(r!=0){f.show();n.hide();m.removeClass("active-tag-area")}else{}});m.append(f);m.append(n);n.hide();m.click(function(w){var v=$(this).hasClass("active-tag-area");if($(w.target).hasClass("delete-tag-img")&&!v){return false}if($(w.target).hasClass("tag-name")&&!v){return false}$(this).addClass("active-tag-area");f.hide();n.show();n.focus();var u=function(y){var x=m.attr("id");if(($(y.target).attr("id")!=x)&&($(y.target).parents().filter(x).length==0)){m.blur();$(document).unbind("click",u)}};$(window).click(u);return false});if(p.use_toggle_link){m.hide()}else{var r=o(p.tags);if(r==0){f.hide();n.show()}}return this.addClass("tag-element")}; \ No newline at end of file diff -r ed4cbaf23c88 -r 032478337b82 templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Fri Sep 11 14:57:02 2009 -0400 @@ -9,43 +9,8 @@ <% user, user_roles = trans.get_user_and_roles() %> <%def name="javascripts()"> - ##  - ${h.js( "jquery", "galaxy.base", "jquery.autocomplete", "autocomplete_tagging" )} - <script type="text/javascript"> - $( document ).ready( function() { - // Set up autocomplete tagger. -<% - ## Build string of tag name, values. - tag_names_and_values = list() - for tag in data.tags: - tag_name = tag.user_tname - tag_value = "" - if tag.value is not None: - tag_value = tag.user_value - tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"") -%> - var options = { - tags : {${", ".join(tag_names_and_values)}}, - tag_click_fn: function(tag) { /* Do nothing. */ }, - use_toggle_link: false, - input_size: 30, - in_form: true, - <% encoded_data_id = trans.security.encode_id(data.id) %> - ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_data_id, item_type="hda" )}", - ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_data_id, item_type="hda" )}", - ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_data_id, item_type="hda" )}", - delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", - delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", - add_tag_img: "${h.url_for('/static/images/add_icon.png')}", - add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", - }; -% if trans.get_user() is not None: - $("#dataset-tag-area").autocomplete_tagging(options); -% endif -}); - </script> + ${parent.javascripts()} + ${h.js( "jquery.autocomplete", "autocomplete_tagging" )} </%def> <%def name="datatype( dataset, datatypes )"> @@ -84,16 +49,18 @@ <div style="clear: both"></div> </div> %if trans.get_user() is not None: - <div class="form-row"> - <label> - Tags: - </label> - <div id="dataset-tag-area" + <%namespace file="../tagging_common.mako" import="render_tagging_element" /> + <div class="form-row"> + <label> + Tags: + </label> + <div id="dataset-tag-area" style="float: left; margin-left: 1px; width: 295px; margin-right: 10px; border-style: inset; border-color: #ddd; border-width: 1px"> - </div> - <div style="clear: both"></div> - </div> - %endif + </div> + <div style="clear: both"></div> + </div> + ${render_tagging_element(data, "dataset-tag-area", use_toggle_link="false", in_form="true", input_size="30")} + %endif %for name, spec in data.metadata.spec.items(): %if spec.visible: <div class="form-row"> diff -r ed4cbaf23c88 -r 032478337b82 templates/history/grid.mako --- a/templates/history/grid.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/history/grid.mako Fri Sep 11 14:57:02 2009 -0400 @@ -10,6 +10,7 @@ <%def name="javascripts()"> ${parent.javascripts()} + ${h.js("jquery.autocomplete", "autocomplete_tagging" )} <script type="text/javascript"> ## TODO: generalize and move into galaxy.base.js $(document).ready(function() { @@ -58,7 +59,7 @@ </%def> <%def name="stylesheets()"> - <link href="${h.url_for('/static/style/base.css')}" rel="stylesheet" type="text/css" /> + ${h.css( "base", "autocomplete_tagging" )} <style> ## Not generic to all grids -- move to base? .count-box { diff -r ed4cbaf23c88 -r 032478337b82 templates/root/history.mako --- a/templates/root/history.mako Fri Sep 11 09:00:36 2009 -0400 +++ b/templates/root/history.mako Fri Sep 11 14:57:02 2009 -0400 @@ -77,83 +77,6 @@ <% updateable = [data for data in reversed( datasets ) if data.visible and data.state not in [ "deleted", "empty", "error", "ok" ]] %> ${ ",".join( map(lambda data: "\"%s\" : \"%s\"" % (data.id, data.state), updateable) ) } }); - - // Set up autocomplete tagger. -<% - ## Build string of tag name, values. - tag_names_and_values = list() - for tag in history.tags: - tag_name = tag.user_tname - tag_value = "" - if tag.value is not None: - tag_value = tag.user_value - tag_names_and_values.append("\"" + tag_name + "\" : \"" + tag_value + "\"") -%> - // Returns the number of keys (elements) in an array/dictionary. - var array_length = function(an_array) - { - if (an_array.length) - return an_array.length; - - var count = 0; - for (element in an_array) - count++; - return count; - }; - - // Function get text to display on the toggle link. - var get_toggle_link_text = function(tags) - { - var text = ""; - var num_tags = array_length(tags); - if (num_tags != 0) { - text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); - /* - // Show first N tags; hide the rest. - var max_to_show = 1; - - // Build tag string. - var tag_strs = new Array(); - var count = 0; - for (tag_name in tags) - { - tag_value = tags[tag_name]; - tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value); - if (++count == max_to_show) - break; - } - tag_str = tag_strs.join(", "); - - // Finalize text. - var num_tags_hiding = num_tags - max_to_show; - text = "Tags: " + tag_str + - (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : ""); - */ - } else { - // No tags. - text = "Add tags to this history"; - } - return text; - }; - - var options = { - tags : {${", ".join(tag_names_and_values)}}, - get_toggle_link_text_fn: get_toggle_link_text, - input_size: 15, - tag_click_fn: function(tag) { /* Do nothing. */ }, - <% encoded_history_id = trans.security.encode_id(history.id) %> - ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=encoded_history_id, item_type="history" )}", - ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=encoded_history_id, item_type="history" )}", - ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=encoded_history_id, item_type="history" )}", - delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", - delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", - add_tag_img: "${h.url_for('/static/images/add_icon.png')}", - add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", - }; -% if trans.get_user() is not None: - $("#history-tag-area").autocomplete_tagging(options); -% endif - }); // Functionized so AJAX'd datasets can call them function initShowHide() { @@ -361,7 +284,13 @@ <div id="history-tag-area" style="margin-bottom: 1em"> </div> +<%namespace file="../tagging_common.mako" import="render_tagging_element" /> <%namespace file="history_common.mako" import="render_dataset" /> + +%if trans.get_user() is not None: + <div id='history-tag-area' class="tag-element"></div> + ${render_tagging_element(history, "history-tag-area")} +%endif %if not datasets: diff -r ed4cbaf23c88 -r 032478337b82 templates/tagging_common.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/tagging_common.mako Fri Sep 11 14:57:02 2009 -0400 @@ -0,0 +1,92 @@ +## Render the tags 'tags' as an autocomplete element. +<%def name="render_tagging_element(tagged_item, elt_id, use_toggle_link='true', in_form='false', input_size='15')"> + <script type="text/javascript"> + + // + // Set up autocomplete tagger. + // + <% + ## Build string of tag name, values. + tag_names_and_values = list() + for tag in tagged_item.tags: + tag_name = tag.user_tname + tag_value = "" + if tag.value is not None: + tag_value = tag.user_value + tag_names_and_values.append( ("\"" + tag_name + "\" : \"" + tag_value + "\"") ) + %> + // + // Returns the number of keys (elements) in an array/dictionary. + // + var array_length = function(an_array) + { + if (an_array.length) + return an_array.length; + + var count = 0; + for (element in an_array) + count++; + return count; + }; + + // + // Function get text to display on the toggle link. + // + var get_toggle_link_text = function(tags) + { + var text = ""; + var num_tags = array_length(tags); + if (num_tags != 0) + { + text = num_tags + (num_tags != 1 ? " Tags" : " Tag"); + /* + // Show first N tags; hide the rest. + var max_to_show = 1; + + // Build tag string. + var tag_strs = new Array(); + var count = 0; + for (tag_name in tags) + { + tag_value = tags[tag_name]; + tag_strs[tag_strs.length] = build_tag_str(tag_name, tag_value); + if (++count == max_to_show) + break; + } + tag_str = tag_strs.join(", "); + + // Finalize text. + var num_tags_hiding = num_tags - max_to_show; + text = "Tags: " + tag_str + + (num_tags_hiding != 0 ? " and " + num_tags_hiding + " more" : ""); + */ + } + else + { + // No tags. + text = "Add tags to history"; + } + return text; + }; + + var options = + { + tags : {${unicode(", ".join(tag_names_and_values), 'utf-8')}}, + get_toggle_link_text_fn: get_toggle_link_text, + tag_click_fn: function(tag) { /* Do nothing. */ }, + <% tagged_item_id = trans.security.encode_id(tagged_item.id) %> + ajax_autocomplete_tag_url: "${h.url_for( controller='tag', action='tag_autocomplete_data', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + ajax_add_tag_url: "${h.url_for( controller='tag', action='add_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + ajax_delete_tag_url: "${h.url_for( controller='tag', action='remove_tag_async', id=tagged_item_id, item_class=tagged_item.__class__.__name__ )}", + delete_tag_img: "${h.url_for('/static/images/delete_tag_icon_gray.png')}", + delete_tag_img_rollover: "${h.url_for('/static/images/delete_tag_icon_white.png')}", + add_tag_img: "${h.url_for('/static/images/add_icon.png')}", + add_tag_img_rollover: "${h.url_for('/static/images/add_icon_dark.png')}", + input_size: ${input_size}, + in_form: ${in_form}, + use_toggle_link: ${use_toggle_link} + }; + + $("#${elt_id}").autocomplete_tagging(options) + </script> +</%def> \ No newline at end of file diff -r ed4cbaf23c88 -r 032478337b82 tool_conf.xml.main --- a/tool_conf.xml.main Fri Sep 11 09:00:36 2009 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,263 +0,0 @@ -<?xml version="1.0"?> -<toolbox> - <section name="Get Data" id="getext"> - <tool file="data_source/upload.xml"/> - <tool file="data_source/ucsc_tablebrowser.xml" /> - <tool file="data_source/ucsc_tablebrowser_archaea.xml" /> - <tool file="data_source/microbial_import.xml" /> - <tool file="data_source/biomart.xml" /> - <tool file="data_source/gramene_mart.xml" /> - <tool file="data_source/flymine.xml" /> - <tool file="data_source/encode_db.xml" /> - <tool file="data_source/epigraph_import.xml" /> - </section> - <section name="Send Data" id="send"> - <tool file="data_destination/epigraph.xml" /> - </section> - <section name="ENCODE Tools" id="EncodeTools"> - <tool file="encode/gencode_partition.xml" /> - <tool file="encode/random_intervals.xml" /> - </section> - <section name="Lift-Over" id="liftOver"> - <tool file="extract/liftOver_wrapper.xml" /> - </section> - <section name="Text Manipulation" id="textutil"> - <tool file="filters/fixedValueColumn.xml" /> - <tool file="stats/column_maker.xml" /> - <tool file="filters/catWrapper.xml" /> - <tool file="filters/condense_characters.xml" /> - <tool file="filters/convert_characters.xml" /> - <tool file="filters/CreateInterval.xml" /> - <tool file="filters/cutWrapper.xml" /> - <tool file="filters/changeCase.xml" /> - <tool file="filters/pasteWrapper.xml" /> - <tool file="filters/remove_beginning.xml" /> - <tool file="filters/headWrapper.xml" /> - <tool file="filters/tailWrapper.xml" /> - </section> - <section name="Convert Formats" id="convert"> - <tool file="filters/bed2gff.xml" /> - <tool file="fasta_tools/fasta_to_tabular.xml" /> - <tool file="filters/gff2bed.xml" /> - <tool file="maf/maf_to_bed.xml" /> - <tool file="maf/maf_to_fasta.xml" /> - <tool file="fasta_tools/tabular_to_fasta.xml" /> - </section> - <section name="FASTA manipulation" id="fasta_manipulation"> - <tool file="fasta_tools/fasta_compute_length.xml" /> - <tool file="fasta_tools/fasta_filter_by_length.xml" /> - <tool file="fasta_tools/fasta_concatenate_by_species.xml" /> - <tool file="fasta_tools/fasta_to_tabular.xml" /> - <tool file="fasta_tools/tabular_to_fasta.xml" /> - </section> - <section name="Filter and Sort" id="filter"> - <tool file="stats/filtering.xml" /> - <tool file="filters/sorter.xml" /> - <tool file="filters/grep.xml" /> - </section> - <section name="Join, Subtract and Group" id="group"> - <tool file="filters/joiner.xml" /> - <tool file="filters/compare.xml"/> - <tool file="new_operations/subtract_query.xml"/> - <tool file="stats/grouping.xml" /> - </section> - <section name="Extract Features" id="features"> - <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" /> - <tool file="extract/extract_GFF_Features.xml" /> - </section> - <section name="Fetch Sequences" id="fetchSeq"> - <tool file="extract/extract_genomic_dna.xml" /> - </section> - <section name="Fetch Alignments" id="fetchAlign"> - <tool file="maf/interval2maf_pairwise.xml" /> - <tool file="maf/interval2maf.xml" /> - <tool file="maf/interval_maf_to_merged_fasta.xml" /> - <tool file="maf/genebed_maf_to_fasta.xml"/> - <tool file="maf/maf_stats.xml"/> - <tool file="maf/maf_thread_for_species.xml"/> - <tool file="maf/maf_limit_to_species.xml"/> - <tool file="maf/maf_limit_size.xml"/> - <tool file="maf/maf_by_block_number.xml"/> - <tool file="maf/maf_filter.xml"/> -  - </section> - <section name="Get Genomic Scores" id="scores"> - <tool file="stats/wiggle_to_simple.xml" /> - <tool file="stats/aggregate_binned_scores_in_intervals.xml" /> - <tool file="extract/phastOdds/phastOdds_tool.xml" /> - </section> - <section name="Operate on Genomic Intervals" id="bxops"> - <tool file="new_operations/intersect.xml" /> - <tool file="new_operations/subtract.xml" /> - <tool file="new_operations/merge.xml" /> - <tool file="new_operations/concat.xml" /> - <tool file="new_operations/basecoverage.xml" /> - <tool file="new_operations/coverage.xml" /> - <tool file="new_operations/complement.xml" /> - <tool file="new_operations/cluster.xml" id="cluster" /> - <tool file="new_operations/join.xml" /> - <tool file="new_operations/get_flanks.xml" /> - <tool file="new_operations/flanking_features.xml" /> - <tool file="annotation_profiler/annotation_profiler.xml" /> - </section> - <section name="Statistics" id="stats"> - <tool file="stats/gsummary.xml" /> - <tool file="filters/uniq.xml" /> - <tool file="stats/cor.xml" /> - </section> - <section name="Graph/Display Data" id="plots"> - <tool file="plotting/histogram2.xml" /> - <tool file="plotting/scatterplot.xml" /> - <tool file="plotting/xy_plot.xml" /> - <tool file="visualization/GMAJ.xml" /> - <tool file="visualization/build_ucsc_custom_track.xml" /> - </section> - <section name="Regional Variation" id="regVar"> - <tool file="regVariation/windowSplitter.xml" /> - <tool file="regVariation/featureCounter.xml" /> - <tool file="regVariation/quality_filter.xml" /> - <tool file="regVariation/maf_cpg_filter.xml" /> - <tool file="regVariation/getIndels_2way.xml" /> - <tool file="regVariation/getIndels_3way.xml" /> - <tool file="regVariation/getIndelRates_3way.xml" /> - <tool file="regVariation/substitutions.xml" /> - <tool file="regVariation/substitution_rates.xml" /> - <tool file="regVariation/microsats_alignment_level.xml" /> - <tool file="regVariation/microsats_mutability.xml" /> - </section> - <section name="Multiple regression" id="multReg"> - <tool file="regVariation/linear_regression.xml" /> - <tool file="regVariation/best_regression_subsets.xml" /> - <tool file="regVariation/rcve.xml" /> - </section> - <section name="Evolution: HyPhy" id="hyphy"> - <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" /> - <tool file="hyphy/hyphy_nj_tree_wrapper.xml" /> - <tool file="hyphy/hyphy_dnds_wrapper.xml" /> - </section> - <section name="Metagenomic analyses" id="tax_manipulation"> - <tool file="taxonomy/gi2taxonomy.xml" /> - <tool file="taxonomy/t2t_report.xml" /> - <tool file="taxonomy/t2ps_wrapper.xml" /> - <tool file="taxonomy/find_diag_hits.xml" /> - <tool file="taxonomy/lca.xml" /> - <tool file="taxonomy/poisson2test.xml" /> - </section> - <section name="Short Read Analysis" id="short_read_analysis"> - <tool file="metag_tools/short_reads_figure_score.xml" /> - <tool file="metag_tools/short_reads_trim_seq.xml" /> - <tool file="metag_tools/megablast_wrapper.xml" /> - <tool file="metag_tools/megablast_xml_parser.xml" /> - </section> - <section name="EMBOSS" id="EMBOSSLite"> - <tool file="emboss_5/emboss_antigenic.xml" /> - <tool file="emboss_5/emboss_backtranseq.xml" /> - <tool file="emboss_5/emboss_banana.xml" /> - <tool file="emboss_5/emboss_biosed.xml" /> - <tool file="emboss_5/emboss_btwisted.xml" /> - <tool file="emboss_5/emboss_cai_custom.xml" /> - <tool file="emboss_5/emboss_cai.xml" /> - <tool file="emboss_5/emboss_chaos.xml" /> - <tool file="emboss_5/emboss_charge.xml" /> - <tool file="emboss_5/emboss_checktrans.xml" /> - <tool file="emboss_5/emboss_chips.xml" /> - <tool file="emboss_5/emboss_cirdna.xml" /> - <tool file="emboss_5/emboss_codcmp.xml" /> - <tool file="emboss_5/emboss_coderet.xml" /> - <tool file="emboss_5/emboss_compseq.xml" /> - <tool file="emboss_5/emboss_cpgplot.xml" /> - <tool file="emboss_5/emboss_cpgreport.xml" /> - <tool file="emboss_5/emboss_cusp.xml" /> - <tool file="emboss_5/emboss_cutseq.xml" /> - <tool file="emboss_5/emboss_dan.xml" /> - <tool file="emboss_5/emboss_degapseq.xml" /> - <tool file="emboss_5/emboss_descseq.xml" /> - <tool file="emboss_5/emboss_diffseq.xml" /> - <tool file="emboss_5/emboss_digest.xml" /> - <tool file="emboss_5/emboss_dotmatcher.xml" /> - <tool file="emboss_5/emboss_dotpath.xml" /> - <tool file="emboss_5/emboss_dottup.xml" /> - <tool file="emboss_5/emboss_dreg.xml" /> - <tool file="emboss_5/emboss_einverted.xml" /> - <tool file="emboss_5/emboss_epestfind.xml" /> - <tool file="emboss_5/emboss_equicktandem.xml" /> - <tool file="emboss_5/emboss_est2genome.xml" /> - <tool file="emboss_5/emboss_etandem.xml" /> - <tool file="emboss_5/emboss_extractfeat.xml" /> - <tool file="emboss_5/emboss_extractseq.xml" /> - <tool file="emboss_5/emboss_freak.xml" /> - <tool file="emboss_5/emboss_fuzznuc.xml" /> - <tool file="emboss_5/emboss_fuzzpro.xml" /> - <tool file="emboss_5/emboss_fuzztran.xml" /> - <tool file="emboss_5/emboss_garnier.xml" /> - <tool file="emboss_5/emboss_geecee.xml" /> - <tool file="emboss_5/emboss_getorf.xml" /> - <tool file="emboss_5/emboss_helixturnhelix.xml" /> - <tool file="emboss_5/emboss_hmoment.xml" /> - <tool file="emboss_5/emboss_iep.xml" /> - <tool file="emboss_5/emboss_infoseq.xml" /> - <tool file="emboss_5/emboss_isochore.xml" /> - <tool file="emboss_5/emboss_lindna.xml" /> - <tool file="emboss_5/emboss_marscan.xml" /> - <tool file="emboss_5/emboss_maskfeat.xml" /> - <tool file="emboss_5/emboss_maskseq.xml" /> - <tool file="emboss_5/emboss_matcher.xml" /> - <tool file="emboss_5/emboss_megamerger.xml" /> - <tool file="emboss_5/emboss_merger.xml" /> - <tool file="emboss_5/emboss_msbar.xml" /> - <tool file="emboss_5/emboss_needle.xml" /> - <tool file="emboss_5/emboss_newcpgreport.xml" /> - <tool file="emboss_5/emboss_newcpgseek.xml" /> - <tool file="emboss_5/emboss_newseq.xml" /> - <tool file="emboss_5/emboss_noreturn.xml" /> - <tool file="emboss_5/emboss_notseq.xml" /> - <tool file="emboss_5/emboss_nthseq.xml" /> - <tool file="emboss_5/emboss_octanol.xml" /> - <tool file="emboss_5/emboss_oddcomp.xml" /> - <tool file="emboss_5/emboss_palindrome.xml" /> - <tool file="emboss_5/emboss_pasteseq.xml" /> - <tool file="emboss_5/emboss_patmatdb.xml" /> - <tool file="emboss_5/emboss_pepcoil.xml" /> - <tool file="emboss_5/emboss_pepinfo.xml" /> - <tool file="emboss_5/emboss_pepnet.xml" /> - <tool file="emboss_5/emboss_pepstats.xml" /> - <tool file="emboss_5/emboss_pepwheel.xml" /> - <tool file="emboss_5/emboss_pepwindow.xml" /> - <tool file="emboss_5/emboss_pepwindowall.xml" /> - <tool file="emboss_5/emboss_plotcon.xml" /> - <tool file="emboss_5/emboss_plotorf.xml" /> - <tool file="emboss_5/emboss_polydot.xml" /> - <tool file="emboss_5/emboss_preg.xml" /> - <tool file="emboss_5/emboss_prettyplot.xml" /> - <tool file="emboss_5/emboss_prettyseq.xml" /> - <tool file="emboss_5/emboss_primersearch.xml" /> - <tool file="emboss_5/emboss_revseq.xml" /> - <tool file="emboss_5/emboss_seqmatchall.xml" /> - <tool file="emboss_5/emboss_seqret.xml" /> - <tool file="emboss_5/emboss_showfeat.xml" /> - <tool file="emboss_5/emboss_shuffleseq.xml" /> - <tool file="emboss_5/emboss_sigcleave.xml" /> - <tool file="emboss_5/emboss_sirna.xml" /> - <tool file="emboss_5/emboss_sixpack.xml" /> - <tool file="emboss_5/emboss_skipseq.xml" /> - <tool file="emboss_5/emboss_splitter.xml" /> - <tool file="emboss_5/emboss_supermatcher.xml" /> - <tool file="emboss_5/emboss_syco.xml" /> - <tool file="emboss_5/emboss_tcode.xml" /> - <tool file="emboss_5/emboss_textsearch.xml" /> - <tool file="emboss_5/emboss_tmap.xml" /> - <tool file="emboss_5/emboss_tranalign.xml" /> - <tool file="emboss_5/emboss_transeq.xml" /> - <tool file="emboss_5/emboss_trimest.xml" /> - <tool file="emboss_5/emboss_trimseq.xml" /> - <tool file="emboss_5/emboss_twofeat.xml" /> - <tool file="emboss_5/emboss_union.xml" /> - <tool file="emboss_5/emboss_vectorstrip.xml" /> - <tool file="emboss_5/emboss_water.xml" /> - <tool file="emboss_5/emboss_wobble.xml" /> - <tool file="emboss_5/emboss_wordcount.xml" /> - <tool file="emboss_5/emboss_wordmatch.xml" /> - </section> -</toolbox>

1 0

[hg] galaxy 2678: Streamline history sharing, add a "Manage shar...
by Greg Von Kuster 11 Sep '09

11 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f0adb6152df9 changeset: 2678:f0adb6152df9 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Thu Sep 10 21:24:06 2009 -0400 description: Streamline history sharing, add a "Manage shared histories" section to the History options menu. Also use a better approach to setting peek on datasets. 5 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/web/controllers/history.py templates/history/sharing.mako templates/root/index.mako test/functional/test_history_functions.py diffs (482 lines): diff -r 96ccd29277be -r f0adb6152df9 lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Sep 10 17:48:52 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Sep 10 21:24:06 2009 -0400 @@ -416,8 +416,9 @@ count = 0 file_type = None data_checked = False - for line in file( file_name ): - line = line[:WIDTH] + temp = open( file_name, "U" ) + while count <= LINE_COUNT: + line = temp.readline( WIDTH ) if line and not is_multi_byte and not data_checked: # See if we have a compressed or binary file if line[0:2] == util.gzip_magic: @@ -432,9 +433,8 @@ if file_type in [ 'gzipped', 'binary' ]: break lines.append( line ) - if count == LINE_COUNT: - break count += 1 + temp.close() if file_type in [ 'gzipped', 'binary' ]: text = "%s file" % file_type else: diff -r 96ccd29277be -r f0adb6152df9 lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Sep 10 17:48:52 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Sep 10 21:24:06 2009 -0400 @@ -4,7 +4,7 @@ from galaxy.model.mapping import desc from galaxy.model.orm import * from galaxy.util.json import * -import webhelpers, logging +import webhelpers, logging, operator from datetime import datetime from cgi import escape @@ -31,10 +31,12 @@ return "deleted" elif history.users_shared_with: return "shared" + elif history.importable: + return "importable" return "" def get_link( self, trans, grid, item ): - if item.users_shared_with: - return dict( operation="sharing", id=item.id ) + if item.users_shared_with or item.importable: + return dict( operation="sharing" ) return None # Grid definition title = "Stored histories" @@ -55,9 +57,12 @@ operations = [ grids.GridOperation( "Switch", allow_multiple=False, condition=( lambda item: not item.deleted ) ), grids.GridOperation( "Share", condition=( lambda item: not item.deleted ) ), + grids.GridOperation( "Unshare", condition=( lambda item: not item.deleted ) ), grids.GridOperation( "Rename", condition=( lambda item: not item.deleted ) ), grids.GridOperation( "Delete", condition=( lambda item: not item.deleted ) ), - grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ) + grids.GridOperation( "Undelete", condition=( lambda item: item.deleted ) ), + grids.GridOperation( "Enable import via link", condition=( lambda item: item.deleted ) ), + grids.GridOperation( "Disable import via link", condition=( lambda item: item.deleted ) ) ] standard_filters = [ grids.GridColumnFilter( "Active", args=dict( deleted=False ) ), @@ -99,7 +104,9 @@ ] operations = [ grids.GridOperation( "Clone" ), - grids.GridOperation( "Unshare" ) + grids.GridOperation( "Unshare" ), + grids.GridOperation( "Enable import via link", condition=( lambda item: item.deleted ) ), + grids.GridOperation( "Disable import via link", condition=( lambda item: item.deleted ) ) ] standard_filters = [] def build_initial_query( self, session ): @@ -126,19 +133,19 @@ current_history = trans.get_history() status = message = None if 'operation' in kwargs: - history_ids = util.listify( kwargs.get( 'id', [] ) ) - histories = [] operation = kwargs['operation'].lower() if operation == "share": return self.share( trans, **kwargs ) - elif operation == "rename": + if operation == "rename": return self.rename( trans, **kwargs ) - elif operation == 'sharing': - return self.sharing( trans, id=kwargs['id'] ) + history_ids = util.listify( kwargs.get( 'id', [] ) ) + if operation == "sharing": + return self.sharing( trans, id=history_ids ) # Display no message by default status, message = None, None refresh_history = False # Load the histories and ensure they all belong to the current user + histories = [] for history_id in history_ids: history = get_history( trans, history_id ) if history: @@ -161,6 +168,21 @@ trans.template_context['refresh_frames'] = ['history'] elif operation == "undelete": status, message = self._list_undelete( trans, histories ) + elif operation == "unshare": + for history in histories: + husas = trans.app.model.HistoryUserShareAssociation.filter_by( history=history ).all() + for husa in husas: + husa.delete() + elif operation == "enable import via link": + for history in histories: + if not history.importable: + history.importable = True + elif operation == "disable import via link": + if history_ids: + histories = [ get_history( trans, history_id ) for history_id in history_ids ] + for history in histories: + if history.importable: + history.importable = False trans.sa_session.flush() # Render the list view return self.stored_list_grid( trans, status=status, message=message, **kwargs ) @@ -237,24 +259,20 @@ msg = util.restore_text( kwargs.get( 'msg', '' ) ) status = message = None if 'operation' in kwargs: - id = kwargs.get( 'id', None ) + ids = util.listify( kwargs.get( 'id', [] ) ) operation = kwargs['operation'].lower() if operation == "clone": - if not id: + if not ids: message = "Select a history to clone" return self.shared_list_grid( trans, status='error', message=message, **kwargs ) # When cloning shared histories, only copy active datasets new_kwargs = { 'clone_choice' : 'active' } return self.clone( trans, id, **new_kwargs ) elif operation == 'unshare': - if not id: + if not ids: message = "Select a history to unshare" return self.shared_list_grid( trans, status='error', message=message, **kwargs ) - ids = util.listify( id ) - histories = [] - for history_id in ids: - history = get_history( trans, history_id, check_ownership=False ) - histories.append( history ) + histories = [ get_history( trans, history_id ) for history_id in ids ] for history in histories: # Current user is the user with which the histories were shared association = trans.app.model.HistoryUserShareAssociation.filter_by( user=trans.user, history=history ).one() @@ -262,6 +280,20 @@ association.flush() message = "Unshared %d shared histories" % len( ids ) status = 'done' + elif operation == "enable import via link": + if ids: + histories = [ get_history( trans, id ) for id in ids ] + for history in histories: + if not history.importable: + history.importable = True + history.flush() + elif operation == "disable import via link": + if ids: + histories = [ get_history( trans, id ) for id in ids ] + for history in histories: + if history.importable: + history.importable = False + history.flush() # Render the list view return self.shared_list_grid( trans, status=status, message=message, **kwargs ) @web.expose @@ -622,7 +654,9 @@ params = util.Params( kwd ) msg = util.restore_text ( params.get( 'msg', '' ) ) if id: - histories = [ get_history( trans, id ) ] + ids = util.listify( id ) + if ids: + histories = [ get_history( trans, history_id ) for history_id in ids ] for history in histories: if params.get( 'enable_import_via_link', False ): history.importable = True @@ -635,14 +669,34 @@ if not user: msg = 'History (%s) does not seem to be shared with user (%s)' % ( history.name, user.email ) return trans.fill_template( 'history/sharing.mako', histories=histories, msg=msg, messagetype='error' ) - association = trans.app.model.HistoryUserShareAssociation.filter_by( user=user, history=history ).one() - association.delete() - association.flush() - if not id: - shared_msg = "History (%s) now shared with: %d users. " % ( history.name, len( history.users_shared_with ) ) - msg = '%s%s' % ( shared_msg, msg ) + husas = trans.app.model.HistoryUserShareAssociation.filter_by( user=user, history=history ).all() + if husas: + for husa in husas: + husa.delete() + husa.flush() + histories = [] + # Get all histories that have been shared with others + husas = trans.sa_session.query( trans.app.model.HistoryUserShareAssociation ) \ + .join( "history" ) \ + .filter( and_( trans.app.model.History.user == trans.user, + trans.app.model.History.deleted == False ) ) \ + .order_by( trans.app.model.History.table.c.name ) \ + .all() + for husa in husas: + history = husa.history + if history not in histories: + histories.append( history ) + # Get all histories that are importable + importables = trans.sa_session.query( trans.app.model.History ) \ + .filter_by( user=trans.user, importable=True, deleted=False ) \ + .order_by( trans.app.model.History.table.c.name ) \ + .all() + for importable in importables: + if importable not in histories: + histories.append( importable ) + # Sort the list of histories by history.name + histories.sort( key=operator.attrgetter( 'name') ) return trans.fill_template( 'history/sharing.mako', histories=histories, msg=msg, messagetype='done' ) - @web.expose @web.require_login( "rename histories" ) def rename( self, trans, id=None, name=None, **kwd ): diff -r 96ccd29277be -r f0adb6152df9 templates/history/sharing.mako --- a/templates/history/sharing.mako Thu Sep 10 17:48:52 2009 -0400 +++ b/templates/history/sharing.mako Thu Sep 10 21:24:06 2009 -0400 @@ -1,75 +1,63 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> -<h2>Public access via link</h2> +##<h2>Import via link</h2> %if msg: ${render_msg( msg, messagetype )} %endif -%for history in histories: - <p> - %if history.importable: - Send the following URL to users as an easy way for them to import the history, making a copy of their own: - <% url = h.url_for( controller='history', action='imp', id=trans.security.encode_id(history.id), qualified=True ) %> - <blockquote> - <a href="${url}">${url}</a> - </blockquote> - <br/> - <form action="${h.url_for( controller='history', action='sharing', id=trans.security.encode_id( history.id ) )}" method="POST"> - <input class="action-button" type="submit" name="disable_import_via_link" value="Disable import via link"> - </form> - %else: - This history is currently restricted (only you and the users listed below - can access it). Enabling the following option will generate a URL that you - can give to a user to allow them to import this history. - <br/> - <form action="${h.url_for( action='sharing', id=trans.security.encode_id(history.id) )}" method="POST"> - <input class="action-button" type="submit" name="enable_import_via_link" value="Enable import via link"> - </form> - %endif - </p> - <h2>Sharing with specific users</h2> - %if history.users_shared_with: - <ul class="manage-table-actions"> - <li> - <a class="action-button" href="${h.url_for( controller='history', action='share', id=trans.security.encode_id( history.id ) )}"> - <span>Share with another user</span> - </a> - </li> - </ul> - <p> - The following users will see this history in their list of histories - shared with them by others, and they will be able to create their own copy of it: - </p> - <table class="colored" border="0" cellspacing="0" cellpadding="0" width="100%"> - <tr class="header"> - <th>History '${history.name}' currently shared with</th> - <th></th> - </tr> - %for i, association in enumerate( history.users_shared_with ): - <% user = association.user %> - <tr> - <td> - ${user.email} - <a id="user-${i}-popup" class="popup-arrow" style="display: none;">▼</a> - </td> - <td> - %if len( histories ) == 1: - ## Only allow unsharing if we're dealing with 1 history, otherwise - ## page refreshes screw things up - <div popupmenu="user-${i}-popup"> - <a class="action-button" href="${h.url_for( controller='history', action='sharing', id=trans.security.encode_id( history.id ), unshare_user=trans.security.encode_id( user.id ) )}">Unshare</a> +<h2>Histories that you've shared with others or enabled to be imported</h2> + +%if not histories: + You have no histories that you've shared with others or enabled to be imported +%else: + %for history in histories: + <div class="toolForm"> + <div class="toolFormTitle">History '${history.name}' shared with</div> + <div class="toolFormBody"> + <div class="form-row"> + <div style="float: right;"> + <a class="action-button" href="${h.url_for( controller='history', action='share', id=trans.security.encode_id( history.id ) )}"> + <span>Share with another user</span> + </a> + </div> + </div> + %if history.users_shared_with: + %for i, association in enumerate( history.users_shared_with ): + <% user = association.user %> + <div class="form-row"> + <a class="action-button" href="${h.url_for( controller='history', action='sharing', id=trans.security.encode_id( history.id ), unshare_user=trans.security.encode_id( user.id ) )}">Unshare</a> + ${user.email} + </div> + %endfor + %endif + %if history.importable: + <div class="form-row"> + <% url = h.url_for( controller='history', action='imp', id=trans.security.encode_id(history.id), qualified=True ) %> + <a href="${url}">${url}</a> + <div class="toolParamHelp" style="clear: both;"> + Send the above URL to users as an easy way for them to import the history, making a copy of their own + </div> + </div> + <div class="form-row"> + <form action="${h.url_for( controller='history', action='sharing', id=trans.security.encode_id( history.id ) )}" method="POST"> + <div class="form-row"> + <input class="action-button" type="submit" name="disable_import_via_link" value="Disable import via link"> </div> - %endif - </td> - </tr> - %endfor - </table> - %else: - <p>You have not shared this history with any users.</p> - <a class="action-button" href="${h.url_for( controller='history', action='share', id=trans.security.encode_id(history.id) )}"> - <span>Share with another user</span> - </a> - %endif -%endfor + </form> + </div> + %else: + <form action="${h.url_for( action='sharing', id=trans.security.encode_id(history.id) )}" method="POST"> + <div class="form-row"> + <input class="action-button" type="submit" name="enable_import_via_link" value="Enable import via link"> + <div class="toolParamHelp" style="clear: both;"> + Click to generate a URL that you can give to a user to allow them to import this history, making a copy of their own + </div> + </div> + </form> + %endif + </div> + </div> + %endfor +%endif diff -r 96ccd29277be -r f0adb6152df9 templates/root/index.mako --- a/templates/root/index.mako Thu Sep 10 17:48:52 2009 -0400 +++ b/templates/root/index.mako Thu Sep 10 21:24:06 2009 -0400 @@ -9,9 +9,6 @@ "List your histories": null, "Stored by you": function() { galaxy_main.location = "${h.url_for( controller='history', action='list')}"; - }, - "Shared with you": function() { - galaxy_main.location = "${h.url_for( controller='history', action='list_shared')}"; }, "Current History": null, "Create new": function() { @@ -32,10 +29,19 @@ "Show deleted datasets": function() { galaxy_history.location = "${h.url_for( controller='root', action='history', show_deleted=True)}"; }, - "Delete": function() { - if ( confirm( "Really delete the current history?" ) ) { + "Delete": function() + { + if ( confirm( "Really delete the current history?" ) ) + { galaxy_main.location = "${h.url_for( controller='history', action='delete_current' )}"; } + }, + "Manage shared histories": null, + "Shared by you": function() { + galaxy_main.location = "${h.url_for( controller='history', action='list', operation='sharing' )}"; + }, + "Shared with you": function() { + galaxy_main.location = "${h.url_for( controller='history', action='list_shared')}"; } }); }); diff -r 96ccd29277be -r f0adb6152df9 test/functional/test_history_functions.py --- a/test/functional/test_history_functions.py Thu Sep 10 17:48:52 2009 -0400 +++ b/test/functional/test_history_functions.py Thu Sep 10 21:24:06 2009 -0400 @@ -141,14 +141,13 @@ check_str_after_submit='You cannot send histories to yourself.' ) # Share history3 with 1 valid user self.share_current_history( regular_user1.email, - check_str=history3.name, - check_str_after_submit='History (%s) now shared with: 1 users' % history3.name ) + check_str=history3.name ) # Check out list of histories to make sure history3 was shared - self.view_stored_active_histories( check_str='operation=sharing&id=%s">shared' % self.security.encode_id( history3.id ) ) + self.view_stored_active_histories( check_str='operation=sharing">shared' ) # Enable importing history3 via a URL self.enable_import_via_link( self.security.encode_id( history3.id ), check_str='Unshare', - check_str_after_submit='Send the following URL to users' ) + check_str_after_submit='Send the above URL to users' ) # Make sure history3 is now import-able history3.refresh() if not history3.importable: @@ -159,7 +158,7 @@ check_str_after_submit='You cannot import your own history.' ) # Disable the import link for history3 self.disable_import_via_link( self.security.encode_id( history3.id ), - check_str='Send the following URL to users', + check_str='Send the above URL to users', check_str_after_submit='Enable import via link' ) # Try importing history3 after disabling the URL self.import_history_via_url( self.security.encode_id( history3.id ), @@ -274,12 +273,10 @@ self.upload_file( '2.bed', dbkey='hg18' ) ids = '%s,%s' % ( self.security.encode_id( history3.id ), self.security.encode_id( history4.id ) ) emails = '%s,%s' % ( regular_user2.email, regular_user3.email ) - check_str_after_submit = 'History (%s) now shared with: 3 users.' % history3.name self.share_histories_with_users( ids, emails, check_str1='Share 2 histories', - check_str2=history4.name, - check_str_after_submit=check_str_after_submit ) + check_str2=history4.name ) self.logout() self.login( email=regular_user2.email ) # Shared history3 should be in regular_user2's list of shared histories @@ -342,12 +339,10 @@ """Testing sharing a restricted history by making the datasets public""" # Logged in as admin_user action_check_str = 'The following datasets can be shared with %s by updating their permissions' % regular_user1.email - action_check_str_after_submit = 'History (%s) now shared with: 1 users.' % history5.name # Current history is history5 self.share_current_history( regular_user1.email, action='public', - action_check_str=action_check_str, - action_check_str_after_submit=action_check_str_after_submit ) + action_check_str=action_check_str ) self.logout() self.login( email=regular_user1.email ) # Shared history5 should be in regular_user1's list of shared histories @@ -375,12 +370,10 @@ self.upload_file( '2.bed', dbkey='hg18' ) check_str_after_submit = 'The following datasets can be shared with %s with no changes' % regular_user2.email check_str_after_submit2 = 'The following datasets can be shared with %s by updating their permissions' % regular_user2.email - action_check_str_after_submit = 'History (%s) now shared with: 2 users.' % history5.name self.share_current_history( regular_user2.email, check_str_after_submit=check_str_after_submit, check_str_after_submit2=check_str_after_submit2, - action='private', - action_check_str_after_submit=action_check_str_after_submit ) + action='private' ) # We should now have a new sharing role global sharing_role role_name = 'Sharing role for: %s, %s' % ( admin_user.email, regular_user2.email ) @@ -470,12 +463,10 @@ check_str_after_submit = 'The following datasets can be shared with %s with no changes' % email check_str_after_submit2 = 'The following datasets can be shared with %s by updating their permissions' % email # history5 will be shared with regular_user1, regular_user2 and regular_user3 - action_check_str_after_submit = 'History (%s) now shared with: 3 users.' % history5.name self.share_current_history( email, check_str_after_submit=check_str_after_submit, check_str_after_submit2=check_str_after_submit2, - action='share_anyway', - action_check_str_after_submit=action_check_str_after_submit ) + action='share_anyway' ) # Check security on clone of history5 for regular_user2 self.logout() self.login( email=regular_user2.email )

1 0

[hg] galaxy 2677: Merge
by Greg Von Kuster 11 Sep '09

11 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/96ccd29277be changeset: 2677:96ccd29277be user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Sep 10 17:48:52 2009 -0400 description: Merge 0 file(s) affected in this change: diffs (69 lines): diff -r f2e4673d784b -r 96ccd29277be cron/updateucsc.sh.sample --- a/cron/updateucsc.sh.sample Thu Sep 10 17:48:37 2009 -0400 +++ b/cron/updateucsc.sh.sample Thu Sep 10 17:48:52 2009 -0400 @@ -6,7 +6,8 @@ # Edit this line to refer to galaxy's path: GALAXY=/galaxy/path -export PYTHONPATH=${GALAXY}/lib +PYTHONPATH=${GALAXY}/lib +export PYTHONPATH # setup directories echo "Creating required directories." @@ -32,7 +33,11 @@ python ${GALAXY}/cron/parse_builds.py > ${GALAXY}/tool-data/shared/ucsc/new/builds.txt if [ $? -eq 0 ] then - cp -uf ${GALAXY}/tool-data/shared/ucsc/new/builds.txt ${GALAXY}/tool-data/shared/ucsc/builds.txt + diff ${GALAXY}/tool-data/shared/ucsc/new/builds.txt ${GALAXY}/tool-data/shared/ucsc/builds.txt > /dev/null 2>&1 + if [ $? -ne 0 ] + then + cp -f ${GALAXY}/tool-data/shared/ucsc/new/builds.txt ${GALAXY}/tool-data/shared/ucsc/builds.txt + fi else echo "Failed to update builds.txt" >&2 fi @@ -42,7 +47,11 @@ python ${GALAXY}/cron/parse_builds_3_sites.py > ${GALAXY}/tool-data/shared/ucsc/new/ucsc_build_sites.txt if [ $? -eq 0 ] then - cp -uf ${GALAXY}/tool-data/shared/ucsc/new/ucsc_build_sites.txt ${GALAXY}/tool-data/shared/ucsc/ucsc_build_sites.txt + diff ${GALAXY}/tool-data/shared/ucsc/new/ucsc_build_sites.txt ${GALAXY}/tool-data/shared/ucsc/ucsc_build_sites.txt > /dev/null 2>&1 + if [ $? -ne 0 ] + then + cp -f ${GALAXY}/tool-data/shared/ucsc/new/ucsc_build_sites.txt ${GALAXY}/tool-data/shared/ucsc/ucsc_build_sites.txt + fi else echo "Failed to update builds.txt" >&2 fi @@ -52,7 +61,16 @@ python ${GALAXY}/cron/build_chrom_db.py ${GALAXY}/tool-data/shared/ucsc/chrom/new/ ${GALAXY}/tool-data/shared/ucsc/builds.txt if [ $? -eq 0 ] then - cp -uf ${GALAXY}/tool-data/shared/ucsc/chrom/new/*.len ${GALAXY}/tool-data/shared/ucsc/chrom/ + for src in ${GALAXY}/tool-data/shared/ucsc/chrom/new/*.len + do + dst=${GALAXY}/tool-data/shared/ucsc/chrom/`basename $src` + diff $src $dst > /dev/null 2>&1 + if [ $? -ne 0 ] + then + echo "cp -f $src $dst" + cp -f $src $dst + fi + done else echo "Failed to update chromInfo tables." >&2 fi diff -r f2e4673d784b -r 96ccd29277be tools/new_operations/flanking_features.py --- a/tools/new_operations/flanking_features.py Thu Sep 10 17:48:37 2009 -0400 +++ b/tools/new_operations/flanking_features.py Thu Sep 10 17:48:52 2009 -0400 @@ -129,7 +129,7 @@ map(outfields.append, result_down[-1].other) #The last element of result_down will be the closest element to the given interval elif result_up: map(outfields.append, result_up[res_ind].other) - else: + elif result_down: map(outfields.append, result_down[-1].other) #The last element of result_down will be the closest element to the given interval yield outfields

1 0

[hg] galaxy 2675: Support for (1) ordering tags and (2) page tags.
by Greg Von Kuster 11 Sep '09

11 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/2a15e0eca0b9 changeset: 2675:2a15e0eca0b9 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Sep 10 16:48:11 2009 -0400 description: Support for (1) ordering tags and (2) page tags. 5 file(s) affected in this change: lib/galaxy/model/__init__.py lib/galaxy/model/mapping.py lib/galaxy/model/migrate/versions/0018_ordered_tags_and_page_tags.py lib/galaxy/tags/tag_handler.py lib/galaxy/web/controllers/tag.py diffs (249 lines): diff -r dbbc63c0630a -r 2a15e0eca0b9 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Thu Sep 10 10:42:50 2009 -0400 +++ b/lib/galaxy/model/__init__.py Thu Sep 10 16:48:11 2009 -0400 @@ -1145,7 +1145,8 @@ return "Tag(id=%s, type=%i, parent_id=%s, name=%s)" % ( self.id, self.type, self.parent_id, self.name ) class ItemTagAssociation ( object ): - def __init__( self, item_id=None, tag_id=None, user_tname=None, value=None ): + def __init__( self, id=None, item_id=None, tag_id=None, user_tname=None, value=None ): + self.id = id self.item_id = item_id self.tag_id = tag_id self.user_tname = user_tname @@ -1165,6 +1166,8 @@ class HistoryDatasetAssociationTagAssociation ( ItemTagAssociation ): pass +class PageTagAssociation ( ItemTagAssociation ): + pass ## ---- Utility methods ------------------------------------------------------- diff -r dbbc63c0630a -r 2a15e0eca0b9 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Thu Sep 10 10:42:50 2009 -0400 +++ b/lib/galaxy/model/mapping.py Thu Sep 10 16:48:11 2009 -0400 @@ -552,6 +552,7 @@ UniqueConstraint( "name" ) ) HistoryTagAssociation.table = Table( "history_tag_association", metadata, + Column( "id", Integer, primary_key=True ), Column( "history_id", Integer, ForeignKey( "history.id" ), index=True ), Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), Column( "user_tname", TrimmedString(255), index=True), @@ -559,6 +560,7 @@ Column( "user_value", TrimmedString(255), index=True) ) DatasetTagAssociation.table = Table( "dataset_tag_association", metadata, + Column( "id", Integer, primary_key=True ), Column( "dataset_id", Integer, ForeignKey( "dataset.id" ), index=True ), Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), Column( "user_tname", TrimmedString(255), index=True), @@ -566,7 +568,16 @@ Column( "user_value", TrimmedString(255), index=True) ) HistoryDatasetAssociationTagAssociation.table = Table( "history_dataset_association_tag_association", metadata, + Column( "id", Integer, primary_key=True ), Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +PageTagAssociation.table = Table( "page_tag_association", metadata, + Column( "id", Integer, primary_key=True ), + Column( "page_id", Integer, ForeignKey( "page.id" ), index=True ), Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), Column( "user_tname", TrimmedString(255), index=True), Column( "value", TrimmedString(255), index=True), @@ -672,7 +683,7 @@ visible_children=relation( HistoryDatasetAssociation, primaryjoin=( ( HistoryDatasetAssociation.table.c.parent_id == HistoryDatasetAssociation.table.c.id ) & ( HistoryDatasetAssociation.table.c.visible == True ) ) ), - tags=relation(HistoryDatasetAssociationTagAssociation, backref='history_tag_associations') + tags=relation(HistoryDatasetAssociationTagAssociation, order_by=HistoryDatasetAssociationTagAssociation.table.c.id, backref='history_tag_associations') ) ) assign_mapper( context, Dataset, Dataset.table, @@ -689,7 +700,7 @@ active_library_associations=relation( LibraryDatasetDatasetAssociation, primaryjoin=( ( Dataset.table.c.id == LibraryDatasetDatasetAssociation.table.c.dataset_id ) & ( LibraryDatasetDatasetAssociation.table.c.deleted == False ) ) ), - tags=relation(DatasetTagAssociation, backref='datasets') + tags=relation(DatasetTagAssociation, order_by=DatasetTagAssociation.table.c.id, backref='datasets') ) ) assign_mapper( context, HistoryDatasetAssociationDisplayAtAuthorization, HistoryDatasetAssociationDisplayAtAuthorization.table, @@ -709,7 +720,7 @@ properties=dict( galaxy_sessions=relation( GalaxySessionToHistoryAssociation ), datasets=relation( HistoryDatasetAssociation, backref="history", order_by=asc(HistoryDatasetAssociation.table.c.hid) ), active_datasets=relation( HistoryDatasetAssociation, primaryjoin=( ( HistoryDatasetAssociation.table.c.history_id == History.table.c.id ) & ( not_( HistoryDatasetAssociation.table.c.deleted ) ) ), order_by=asc( HistoryDatasetAssociation.table.c.hid ), viewonly=True ), - tags=relation(HistoryTagAssociation, backref="histories") + tags=relation(HistoryTagAssociation, order_by=HistoryTagAssociation.table.c.id, backref="histories") ) ) assign_mapper( context, HistoryUserShareAssociation, HistoryUserShareAssociation.table, @@ -967,7 +978,8 @@ primaryjoin=( Page.table.c.id == PageRevision.table.c.page_id ) ), latest_revision=relation( PageRevision, post_update=True, primaryjoin=( Page.table.c.latest_revision_id == PageRevision.table.c.id ), - lazy=False ) + lazy=False ), + tags=relation(PageTagAssociation, order_by=PageTagAssociation.table.c.id, backref="pages") ) ) assign_mapper( context, Tag, Tag.table, @@ -988,6 +1000,11 @@ properties=dict( tag=relation(Tag, backref="tagged_history_dataset_associations") ), primary_key=[HistoryDatasetAssociationTagAssociation.table.c.history_dataset_association_id, HistoryDatasetAssociationTagAssociation.table.c.tag_id] ) + +assign_mapper( context, PageTagAssociation, PageTagAssociation.table, + properties=dict( tag=relation(Tag, backref="tagged_pages") ), + primary_key=[PageTagAssociation.table.c.page_id, PageTagAssociation.table.c.tag_id] + ) def db_next_hid( self ): """ diff -r dbbc63c0630a -r 2a15e0eca0b9 lib/galaxy/model/migrate/versions/0018_ordered_tags_and_page_tags.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0018_ordered_tags_and_page_tags.py Thu Sep 10 16:48:11 2009 -0400 @@ -0,0 +1,116 @@ +""" +This migration script provides support for (a) ordering tags by recency and +(b) tagging pages. This script deletes all existing tags. +""" + +from sqlalchemy import * +from sqlalchemy.orm import * +from sqlalchemy.exceptions import * +from migrate import * +import migrate.changeset + +import datetime +now = datetime.datetime.utcnow + +# Need our custom types, but don't import anything else from model +from galaxy.model.custom_types import * + +import logging +log = logging.getLogger( __name__ ) + +metadata = MetaData( migrate_engine ) + +def display_migration_details(): + print "" + print "This migration script provides support for (a) ordering tags by recency and" + print "(b) tagging pages. This script deletes all existing tags." + +HistoryTagAssociation_table = Table( "history_tag_association", metadata, + Column( "id", Integer, primary_key=True ), + Column( "history_id", Integer, ForeignKey( "history.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +DatasetTagAssociation_table = Table( "dataset_tag_association", metadata, + Column( "id", Integer, primary_key=True ), + Column( "dataset_id", Integer, ForeignKey( "dataset.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +HistoryDatasetAssociationTagAssociation_table = Table( "history_dataset_association_tag_association", metadata, + Column( "id", Integer, primary_key=True ), + Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +PageTagAssociation_table = Table( "page_tag_association", metadata, + Column( "id", Integer, primary_key=True ), + Column( "page_id", Integer, ForeignKey( "page.id" ), index=True ), + Column( "tag_id", Integer, ForeignKey( "tag.id" ), index=True ), + Column( "user_tname", TrimmedString(255), index=True), + Column( "value", TrimmedString(255), index=True), + Column( "user_value", TrimmedString(255), index=True) ) + +def upgrade(): + display_migration_details() + metadata.reflect() + + # + # Recreate tables. + # + try: + HistoryTagAssociation_table.drop() + HistoryTagAssociation_table.create() + except Exception, e: + print "Recreating history_tag_association table failed: %s" % str( e ) + log.debug( "Recreating history_tag_association table failed: %s" % str( e ) ) + + try: + DatasetTagAssociation_table.drop() + DatasetTagAssociation_table.create() + except Exception, e: + print str(e) + log.debug( "Recreating dataset_tag_association table failed: %s" % str( e ) ) + + try: + HistoryDatasetAssociationTagAssociation_table.drop() + HistoryDatasetAssociationTagAssociation_table.create() + except OperationalError, e: + # Handle error that results from and index name that is too long; this occurs + # in MySQL. + if str(e).find("CREATE INDEX") != -1: + # Manually create index. + i = Index( "ix_hda_ta_history_dataset_association_id", HistoryDatasetAssociationTagAssociation_table.c.history_dataset_association_id ) + try: + i.create() + except Exception, e: + print str(e) + log.debug( "Adding index 'ix_hda_ta_history_dataset_association_id' to table 'history_dataset_association_tag_association' table failed: %s" % str( e ) ) + except Exception, e: + print str(e) + log.debug( "Recreating history_dataset_association_tag_association table failed: %s" % str( e ) ) + + # Create page_tag_association table. + try: + PageTagAssociation_table.create() + except Exception, e: + print str(e) + log.debug( "Creating page_tag_association table failed: %s" % str( e ) ) + +def downgrade(): + metadata.reflect() + + # No need to downgrade other tagging tables. They work fine with verision 16 code. + + # Drop page_tag_association table. + try: + PageTagAssociation_table.drop() + except Exception, e: + print str(e) + log.debug( "Dropping page_tag_association table failed: %s" % str( e ) ) diff -r dbbc63c0630a -r 2a15e0eca0b9 lib/galaxy/tags/tag_handler.py --- a/lib/galaxy/tags/tag_handler.py Thu Sep 10 10:42:50 2009 -0400 +++ b/lib/galaxy/tags/tag_handler.py Thu Sep 10 16:48:11 2009 -0400 @@ -1,4 +1,4 @@ -from galaxy.model import Tag, History, HistoryTagAssociation, Dataset, DatasetTagAssociation, HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation +from galaxy.model import Tag import re class TagHandler( object ): diff -r dbbc63c0630a -r 2a15e0eca0b9 lib/galaxy/web/controllers/tag.py --- a/lib/galaxy/web/controllers/tag.py Thu Sep 10 10:42:50 2009 -0400 +++ b/lib/galaxy/web/controllers/tag.py Thu Sep 10 16:48:11 2009 -0400 @@ -1,6 +1,9 @@ """ Tags Controller: handles tagging/untagging of entities and provides autocomplete support. """ + +from galaxy.model import History, HistoryTagAssociation, Dataset, DatasetTagAssociation, \ + HistoryDatasetAssociation, HistoryDatasetAssociationTagAssociation, Page, PageTagAssociation from galaxy.web.base.controller import * from galaxy.tags.tag_handler import *

1 0

[hg] galaxy 2676: merge
by Greg Von Kuster 11 Sep '09

11 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f2e4673d784b changeset: 2676:f2e4673d784b user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Sep 10 17:48:37 2009 -0400 description: merge 0 file(s) affected in this change: diffs (151 lines): diff -r 2a15e0eca0b9 -r f2e4673d784b lib/galaxy/jobs/__init__.py --- a/lib/galaxy/jobs/__init__.py Thu Sep 10 16:48:11 2009 -0400 +++ b/lib/galaxy/jobs/__init__.py Thu Sep 10 17:48:37 2009 -0400 @@ -502,13 +502,6 @@ context = self.get_dataset_finish_context( job_context, dataset_assoc.dataset.dataset ) #should this also be checking library associations? - can a library item be added from a history before the job has ended? - lets not allow this to occur for dataset in dataset_assoc.dataset.dataset.history_associations: #need to update all associated output hdas, i.e. history was shared with job running - if context.get( 'path', None ): - # The tool can set an alternate output path for the dataset. - try: - shutil.move( context['path'], dataset.file_name ) - except ( IOError, OSError ): - if not context['stderr']: - context['stderr'] = 'This dataset could not be processed' dataset.blurb = 'done' dataset.peek = 'no peek' dataset.info = context['stdout'] + context['stderr'] @@ -707,6 +700,13 @@ sizes.append( ( outfile, os.stat( outfile ).st_size ) ) return sizes def setup_external_metadata( self, exec_dir = None, tmp_dir = None, dataset_files_path = None, config_root = None, datatypes_config = None, **kwds ): + # extension could still be 'auto' if this is the upload tool. + job = model.Job.get( self.job_id ) + for output_dataset_assoc in job.output_datasets: + if output_dataset_assoc.dataset.ext == 'auto': + context = self.get_dataset_finish_context( dict(), output_dataset_assoc.dataset.dataset ) + output_dataset_assoc.dataset.extension = context.get( 'ext', 'data' ) + mapping.context.current.flush() if tmp_dir is None: #this dir should should relative to the exec_dir tmp_dir = self.app.config.new_file_path @@ -716,7 +716,6 @@ config_root = self.app.config.root if datatypes_config is None: datatypes_config = self.app.config.datatypes_config - job = model.Job.get( self.job_id ) return self.external_output_metadata.setup_external_metadata( [ output_dataset_assoc.dataset for output_dataset_assoc in job.output_datasets ], exec_dir = exec_dir, tmp_dir = tmp_dir, dataset_files_path = dataset_files_path, config_root = config_root, datatypes_config = datatypes_config, **kwds ) class DefaultJobDispatcher( object ): diff -r 2a15e0eca0b9 -r f2e4673d784b lib/galaxy/tools/actions/upload.py --- a/lib/galaxy/tools/actions/upload.py Thu Sep 10 16:48:11 2009 -0400 +++ b/lib/galaxy/tools/actions/upload.py Thu Sep 10 17:48:37 2009 -0400 @@ -144,7 +144,7 @@ job.add_parameter( name, value ) job.add_parameter( 'paramfile', to_json_string( json_file_path ) ) for i, dataset in enumerate( data_list ): - job.add_output_dataset( i, dataset ) + job.add_output_dataset( 'output%i' % i, dataset ) job.state = trans.app.model.Job.states.NEW trans.app.model.flush() diff -r 2a15e0eca0b9 -r f2e4673d784b tools/data_source/upload.py --- a/tools/data_source/upload.py Thu Sep 10 16:48:11 2009 -0400 +++ b/tools/data_source/upload.py Thu Sep 10 17:48:37 2009 -0400 @@ -115,7 +115,14 @@ return ( True, False, test_ext ) return ( True, True, test_ext ) -def add_file( dataset, json_file ): +def parse_outputs( args ): + rval = {} + for arg in args: + id, path = arg.split( ':', 1 ) + rval[int( id )] = path + return rval + +def add_file( dataset, json_file, output_path ): data_type = None line_count = None @@ -229,16 +236,18 @@ ext = dataset.ext if ext == 'auto': ext = 'data' + # Move the dataset to its "real" path + shutil.move( dataset.path, output_path ) + # Write the job info info = dict( type = 'dataset', dataset_id = dataset.dataset_id, - path = dataset.path, ext = ext, stdout = 'uploaded %s file' % data_type, name = dataset.name, line_count = line_count ) json_file.write( to_json_string( info ) + "\n" ) -def add_composite_file( dataset, json_file ): +def add_composite_file( dataset, json_file, output_path ): if dataset.composite_files: os.mkdir( dataset.extra_files_path ) for name, value in dataset.composite_files.iteritems(): @@ -253,17 +262,21 @@ else: sniff.convert_newlines( dataset.composite_file_paths[ value.name ][ 'path' ] ) shutil.move( dataset.composite_file_paths[ value.name ][ 'path' ], os.path.join( dataset.extra_files_path, name ) ) + # Move the dataset to its "real" path + shutil.move( dataset.primary_file, output_path ) + # Write the job info info = dict( type = 'dataset', dataset_id = dataset.dataset_id, - path = dataset.primary_file, stdout = 'uploaded %s file' % dataset.file_type ) json_file.write( to_json_string( info ) + "\n" ) def __main__(): - if len( sys.argv ) != 2: - print >>sys.stderr, 'usage: upload.py <json paramfile>' + if len( sys.argv ) < 2: + print >>sys.stderr, 'usage: upload.py <json paramfile> <output spec> ...' sys.exit( 1 ) + + output_paths = parse_outputs( sys.argv[2:] ) json_file = open( 'galaxy.json', 'w' ) @@ -271,10 +284,16 @@ dataset = from_json_string( line ) dataset = util.bunch.Bunch( **safe_dict( dataset ) ) + try: + output_path = output_paths[int( dataset.dataset_id )] + except: + print >>sys.stderr, 'Output path for dataset %s not found on command line' % dataset.dataset_id + sys.exit( 1 ) + if dataset.type == 'composite': - add_composite_file( dataset, json_file ) + add_composite_file( dataset, json_file, output_path ) else: - add_file( dataset, json_file ) + add_file( dataset, json_file, output_path ) # clean up paramfile try: diff -r 2a15e0eca0b9 -r f2e4673d784b tools/data_source/upload.xml --- a/tools/data_source/upload.xml Thu Sep 10 16:48:11 2009 -0400 +++ b/tools/data_source/upload.xml Thu Sep 10 17:48:37 2009 -0400 @@ -7,6 +7,12 @@ <action module="galaxy.tools.actions.upload" class="UploadToolAction"/> <command interpreter="python"> upload.py $paramfile + #set $outnum = 0 + #while $varExists('output%i' % $outnum): + #set $output = $getVar('output%i' % $outnum) + #set $outnum += 1 + ${output.dataset.dataset.id}:${output} + #end while </command> <inputs> <param name="file_type" type="select" label="File Format" help="Which format? See help below">

1 0

[hg] galaxy 2674: Bug fix for 'Fetch closest feature' tool.
by Greg Von Kuster 11 Sep '09

11 Sep '09

details: http://www.bx.psu.edu/hg/galaxy/rev/0a41293e679a changeset: 2674:0a41293e679a user: guru date: Thu Sep 10 17:35:21 2009 -0400 description: Bug fix for 'Fetch closest feature' tool. 1 file(s) affected in this change: tools/new_operations/flanking_features.py diffs (12 lines): diff -r ce8c57840343 -r 0a41293e679a tools/new_operations/flanking_features.py --- a/tools/new_operations/flanking_features.py Thu Sep 10 17:31:05 2009 -0400 +++ b/tools/new_operations/flanking_features.py Thu Sep 10 17:35:21 2009 -0400 @@ -129,7 +129,7 @@ map(outfields.append, result_down[-1].other) #The last element of result_down will be the closest element to the given interval elif result_up: map(outfields.append, result_up[res_ind].other) - else: + elif result_down: map(outfields.append, result_down[-1].other) #The last element of result_down will be the closest element to the given interval yield outfields

1 0