April 2010 - galaxy-dev - lists.galaxyproject.org

[hg] galaxy 3582: Patch: show User menu's history, dataset, and ...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/feff604427ee changeset: 3582:feff604427ee user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Tue Mar 30 17:03:29 2010 -0400 description: Patch: show User menu's history, dataset, and pages links independent of app.config.use_remote_user setting. Patch contributed by Ryan Brase ( ry4an+galaxy(a)msi.umn.edu ). diffstat: templates/base_panels.mako | 12 ++++++------ 1 files changed, 6 insertions(+), 6 deletions(-) diffs (22 lines): diff -r c07a6bdc794c -r feff604427ee templates/base_panels.mako --- a/templates/base_panels.mako Tue Mar 30 16:33:19 2010 -0400 +++ b/templates/base_panels.mako Tue Mar 30 17:03:29 2010 -0400 @@ -269,12 +269,12 @@ logout_url = h.url_for( controller='/user', action='logout' ) %> <li><a target="${logout_target}" href="${logout_url}">Logout</a></li> - <li><hr style="color: inherit; background-color: gray"/></li> - <li><a target="galaxy_main" href="${h.url_for( controller='/history', action='list' )}">Histories</a></li> - <li><a target="galaxy_main" href="${h.url_for( controller='/dataset', action='list' )}">Datasets</a></li> - %if app.config.get_bool( 'enable_pages', False ): - <li><a href="${h.url_for( controller='/page', action='list' )}">Pages</a></li> - %endif + %endif + <li><hr style="color: inherit; background-color: gray"/></li> + <li><a target="galaxy_main" href="${h.url_for( controller='/history', action='list' )}">Histories</a></li> + <li><a target="galaxy_main" href="${h.url_for( controller='/dataset', action='list' )}">Datasets</a></li> + %if app.config.get_bool( 'enable_pages', False ): + <li><a href="${h.url_for( controller='/page', action='list' )}">Pages</a></li> %endif </ul> </div>

1 0

[hg] galaxy 3581: Updated several NGS tools to better handle std...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/c07a6bdc794c changeset: 3581:c07a6bdc794c user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Tue Mar 30 16:33:19 2010 -0400 description: Updated several NGS tools to better handle stderr (allow for extremely large stderr output) diffstat: tools/metag_tools/megablast_wrapper.py | 43 +++++++++---- tools/metag_tools/megablast_wrapper.xml | 98 ++++++++++++++++---------------- tools/samtools/sam_merge.py | 11 +++- tools/samtools/sam_pileup.py | 22 ++++++- tools/samtools/sam_to_bam.py | 33 ++++++++++- tools/sr_mapping/bowtie_wrapper.py | 21 ++++++- tools/sr_mapping/bowtie_wrapper_code.py | 4 +- tools/sr_mapping/bwa_wrapper.py | 42 ++++++++++++- 8 files changed, 197 insertions(+), 77 deletions(-) diffs (453 lines): diff -r 8268439390c6 -r c07a6bdc794c tools/metag_tools/megablast_wrapper.py --- a/tools/metag_tools/megablast_wrapper.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/metag_tools/megablast_wrapper.py Tue Mar 30 16:33:19 2010 -0400 @@ -15,7 +15,7 @@ usage: %prog db_build input_file word_size identity_cutoff eval_cutoff filter_query index_dir output_file """ -import sys, os, tempfile +import os, subprocess, sys, tempfile from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) from bx.cookbook import doc_optparse @@ -29,7 +29,7 @@ def __main__(): #Parse Command Line options, args = doc_optparse.parse( __doc__ ) - + db_build = options.db_build query_filename = options.input.strip() output_filename = options.output.strip() @@ -66,18 +66,33 @@ if not db.has_key( db_build ): stop_err( 'Cannot locate the target database. Please check your location file.' ) - + # arguments for megablast chunk = db[ ( db_build ) ] - megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null 2>&1 " \ + megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null " \ % ( chunk, query_filename, mega_temp_output, mega_word_size, mega_iden_cutoff, mega_evalue_cutoff, mega_filter ) - + print megablast_command - + try: - os.system( megablast_command ) + proc = subprocess.Popen( args=megablast_command, shell=True, stderr=subprocess.PIPE ) + returncode = proc.wait() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + if returncode != 0: + raise Exception, stderr except Exception, e: - stop_err( str( e ) ) + if os.path.exists( mega_temp_output ): + os.unlink( mega_temp_output ) + stop_err( 'Error indexing reference sequence. ' + str( e ) ) output = open( output_filename, 'w' ) invalid_lines = 0 @@ -89,24 +104,24 @@ gi, gi_len = fields[1].split( '_' ) # convert the last column (causing problem in filter tool) to float fields[-1] = float( fields[-1] ) - new_line = "%s\t%s\t%s\t%s\t%0.1f" % ( fields[0], gi, gi_len, '\t'.join( fields[2:-1] ), fields[-1] ) except: new_line = line invalid_lines += 1 output.write( "%s\n" % new_line ) output.close() - - os.unlink( mega_temp_output ) #remove the tempfile that we just reformatted the contents of - + + if os.path.exists( mega_temp_output ): + os.unlink( mega_temp_output ) #remove the tempfile that we just reformatted the contents of + if invalid_lines: print "Unable to parse %d lines. Keep the default format." % invalid_lines - + # megablast generates a file called error.log, if empty, delete it, if not, show the contents if os.path.exists( './error.log' ): for i, line in enumerate( file( './error.log' ) ): line = line.rstrip( '\r\n' ) print line os.remove( './error.log' ) - + if __name__ == "__main__" : __main__() diff -r 8268439390c6 -r c07a6bdc794c tools/metag_tools/megablast_wrapper.xml --- a/tools/metag_tools/megablast_wrapper.xml Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/metag_tools/megablast_wrapper.xml Tue Mar 30 16:33:19 2010 -0400 @@ -1,55 +1,55 @@ <tool id="megablast_wrapper" name="Megablast" version="1.0.5"> - <description> compare short reads against htgs, nt, and wgs databases</description> - <command interpreter="python"> - megablast_wrapper.py - --db_build="$source_select" - --input=$input_query - --word_size=$word_size - --identity_cutoff=$iden_cutoff - --eval_cutoff=$evalue_cutoff - --filter_query=$filter_query - --index_dir=${GALAXY_DATA_INDEX_DIR} - --output=$output1 - </command> - <inputs> - <param name="input_query" type="data" format="fasta" label="Compare these sequences"/> - <param name="source_select" type="select" display="radio" label="against target database"> - <options from_file="blastdb.loc"> - <column name="name" index="0"/> - <column name="value" index="0"/> - </options> - </param> - <param name="word_size" type="select" label="using word size" help="Size of best perfect match"> - <option value="28">28</option> - <option value="16">16</option> - </param> - <param name="iden_cutoff" type="float" size="15" value="90.0" label="report hits above this identity" help="no cutoff if 0" /> + <description> compare short reads against htgs, nt, and wgs databases</description> + <command interpreter="python"> + megablast_wrapper.py + --db_build="$source_select" + --input=$input_query + --word_size=$word_size + --identity_cutoff=$iden_cutoff + --eval_cutoff=$evalue_cutoff + --filter_query=$filter_query + --index_dir=${GALAXY_DATA_INDEX_DIR} + --output=$output1 + </command> + <inputs> + <param name="input_query" type="data" format="fasta" label="Compare these sequences"/> + <param name="source_select" type="select" display="radio" label="against target database"> + <options from_file="blastdb.loc"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + <param name="word_size" type="select" label="using word size" help="Size of best perfect match"> + <option value="28">28</option> + <option value="16">16</option> + </param> + <param name="iden_cutoff" type="float" size="15" value="90.0" label="report hits above this identity" help="no cutoff if 0" /> <param name="evalue_cutoff" type="float" size="15" value="0.001" label="set expectation value cutoff" /> - <param name="filter_query" type="select" label="Filter out low complexity regions?"> + <param name="filter_query" type="select" label="Filter out low complexity regions?"> <option value="T">Yes</option> <option value="F">No</option> - </param> - </inputs> - <outputs> - <data name="output1" format="tabular"/> - </outputs> - <requirements> - <requirement type="binary">megablast</requirement> - </requirements> - <tests> - <test> - <param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/> -  - <param name="source_select" value="phiX" /> - <param name="word_size" value="28" /> - <param name="iden_cutoff" value="99.0" /> - <param name="evalue_cutoff" value="10.0" /> - <param name="filter_query" value="T" /> - <output name="output1" file="megablast_wrapper_test1.out"/> - </test> - </tests> - <help> - + </param> + </inputs> + <outputs> + <data name="output1" format="tabular"/> + </outputs> + <requirements> + <requirement type="binary">megablast</requirement> + </requirements> + <tests> + <test> + <param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/> +  + <param name="source_select" value="phiX" /> + <param name="word_size" value="28" /> + <param name="iden_cutoff" value="99.0" /> + <param name="evalue_cutoff" value="10.0" /> + <param name="filter_query" value="T" /> + <output name="output1" file="megablast_wrapper_test1.out"/> + </test> + </tests> + <help> + .. class:: warningmark **Note**. Database searches may take substantial amount of time. For large input datasets it is advisable to allow overnight processing. @@ -86,5 +86,5 @@ Zhang et al. A Greedy Algorithm for Aligning DNA Sequences. 2000. JCB: 203-214. - </help> + </help> </tool> diff -r 8268439390c6 -r c07a6bdc794c tools/samtools/sam_merge.py --- a/tools/samtools/sam_merge.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/samtools/sam_merge.py Tue Mar 30 16:33:19 2010 -0400 @@ -25,7 +25,16 @@ try: proc = subprocess.Popen( args=cmd, shell=True, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: diff -r 8268439390c6 -r c07a6bdc794c tools/samtools/sam_pileup.py --- a/tools/samtools/sam_pileup.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/samtools/sam_pileup.py Tue Mar 30 16:33:19 2010 -0400 @@ -90,7 +90,16 @@ cmdIndex = 'samtools faidx %s' % ( tmpf1_name ) proc = subprocess.Popen( args=cmdIndex, shell=True, cwd=tmpDir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass #did index succeed? if returncode != 0: raise Exception, 'Error creating index file\n' + stderr @@ -99,7 +108,16 @@ proc = subprocess.Popen( args=cmd, shell=True, cwd=tmpDir, stderr=subprocess.PIPE ) returncode = proc.wait() #did it succeed? - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: diff -r 8268439390c6 -r c07a6bdc794c tools/samtools/sam_to_bam.py --- a/tools/samtools/sam_to_bam.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/samtools/sam_to_bam.py Tue Mar 30 16:33:19 2010 -0400 @@ -77,7 +77,16 @@ command = 'samtools faidx %s' % fai_index_file_base proc = subprocess.Popen( args=command, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr if len( open( fai_index_file_path ).read().strip() ) == 0: @@ -97,7 +106,16 @@ command = 'samtools view -bt %s -o %s %s' % ( fai_index_file_path, tmp_aligns_file_name, options.input1 ) proc = subprocess.Popen( args=command, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr if len( open( tmp_aligns_file_name ).read() ) == 0: @@ -117,7 +135,16 @@ command = 'samtools sort %s %s' % ( tmp_aligns_file_name, tmp_sorted_aligns_file_name ) proc = subprocess.Popen( args=command, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: diff -r 8268439390c6 -r c07a6bdc794c tools/sr_mapping/bowtie_wrapper.py --- a/tools/sr_mapping/bowtie_wrapper.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/sr_mapping/bowtie_wrapper.py Tue Mar 30 16:33:19 2010 -0400 @@ -196,7 +196,15 @@ try: proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=subprocess.PIPE, stdout=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: @@ -352,7 +360,16 @@ # align proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_index_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr # check that there are results in the output file diff -r 8268439390c6 -r c07a6bdc794c tools/sr_mapping/bowtie_wrapper_code.py --- a/tools/sr_mapping/bowtie_wrapper_code.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/sr_mapping/bowtie_wrapper_code.py Tue Mar 30 16:33:19 2010 -0400 @@ -10,6 +10,6 @@ refFile = '?' dbkey = os.path.split( refFile )[1].split( '.' )[0] # deal with the one odd case - if dbkey.find( 'chrM' ) >= 0 or dbkey.find( 'chr_m' ) >= 0: + if dbkey == 'equCab2chrM': dbkey = 'equCab2' - out_data[ 'output' ].set_dbkey(dbkey) + out_data[ 'output' ].set_dbkey( dbkey ) diff -r 8268439390c6 -r c07a6bdc794c tools/sr_mapping/bwa_wrapper.py --- a/tools/sr_mapping/bwa_wrapper.py Tue Mar 30 15:39:14 2010 -0400 +++ b/tools/sr_mapping/bwa_wrapper.py Tue Mar 30 16:33:19 2010 -0400 @@ -93,7 +93,16 @@ try: proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: @@ -151,6 +160,7 @@ else: cmd3 = 'bwa samse %s %s %s %s >> %s' % ( gen_alignment_cmds, ref_file_name, tmp_align_out_name, options.fastq, options.output ) # perform alignments + buffsize = 1048576 try: # need to nest try-except in try-finally to handle 2.4 try: @@ -158,7 +168,15 @@ try: proc = subprocess.Popen( args=cmd2, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: @@ -168,7 +186,15 @@ if cmd2b: proc = subprocess.Popen( args=cmd2b, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e: @@ -177,7 +203,15 @@ try: proc = subprocess.Popen( args=cmd3, shell=True, cwd=tmp_dir, stderr=subprocess.PIPE ) returncode = proc.wait() - stderr = proc.stderr.read() + # get stderr, allowing for case where it's very large + stderr = '' + try: + while True: + stderr += proc.stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass if returncode != 0: raise Exception, stderr except Exception, e:

1 0

[hg] galaxy 3580: lims: fixed a bug in selecting workflow in the...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/8268439390c6 changeset: 3580:8268439390c6 user: rc date: Tue Mar 30 15:39:14 2010 -0400 description: lims: fixed a bug in selecting workflow in the samples page diffstat: templates/admin/requests/show_request.mako | 10 ++++++---- templates/requests/show_request.mako | 20 +++++++++++++++++++- 2 files changed, 25 insertions(+), 5 deletions(-) diffs (60 lines): diff -r 153e7dd5ba1e -r 8268439390c6 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Tue Mar 30 09:34:56 2010 -0400 +++ b/templates/admin/requests/show_request.mako Tue Mar 30 15:39:14 2010 -0400 @@ -287,10 +287,12 @@ %elif field['type'] == 'WorkflowField': <select name="sample_${index}_field_${field_index}"> %for option_index, option in enumerate(request.user.stored_workflows): - %if option == sample_values[field_index]: - <option value="${option.id}" selected>${option.name}</option> - %else: - <option value="${option.id}">${option.name}</option> + %if not option.deleted: + %if str(option.id) == str(sample_values[field_index]): + <option value="${option.id}" selected>${option.name}</option> + %else: + <option value="${option.id}">${option.name}</option> + %endif %endif %endfor </select> diff -r 153e7dd5ba1e -r 8268439390c6 templates/requests/show_request.mako --- a/templates/requests/show_request.mako Tue Mar 30 09:34:56 2010 -0400 +++ b/templates/requests/show_request.mako Tue Mar 30 15:39:14 2010 -0400 @@ -212,6 +212,18 @@ %endif %endfor </select> + %elif field['type'] == 'WorkflowField': + <select name="sample_${index}_field_${field_index}"> + %for option_index, option in enumerate(request.user.stored_workflows): + %if not option.deleted: + %if str(option.id) == str(sample_values[field_index]): + <option value="${option.id}" selected>${option.name}</option> + %else: + <option value="${option.id}">${option.name}</option> + %endif + %endif + %endfor + </select> %elif field['type'] == 'CheckboxField': <input type="checkbox" name="sample_${index}_field_${field_index}" value="Yes"/> %endif @@ -229,10 +241,16 @@ %for field_index, field in fields_dict.items(): <td> %if sample_values[field_index]: - ${sample_values[field_index]} + %if field['type'] == 'WorkflowField': + <% workflow = trans.sa_session.query( trans.app.model.StoredWorkflow ).get( int(sample_values[field_index]) ) %> + <a href="${h.url_for( controller='workflow', action='run', id=trans.security.encode_id(workflow.id) )}">${workflow.name}</a> + %else: + ${sample_values[field_index]} + %endif %else: <i>None</i> %endif + </td> %endfor </%def>

1 0

[hg] galaxy 3579: Only display history name/rename if logged in
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/153e7dd5ba1e changeset: 3579:153e7dd5ba1e user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Mar 30 09:34:56 2010 -0400 description: Only display history name/rename if logged in diffstat: templates/root/history.mako | 2 ++ 1 files changed, 2 insertions(+), 0 deletions(-) diffs (15 lines): diff -r 2f4807d6c38c -r 153e7dd5ba1e templates/root/history.mako --- a/templates/root/history.mako Mon Mar 29 14:54:23 2010 -0400 +++ b/templates/root/history.mako Tue Mar 30 09:34:56 2010 -0400 @@ -410,9 +410,11 @@ <div id="history-name-area" class="historyLinks"> + %if trans.get_user(): <div id="history-name-container"> <div id="history-name" class="tooltip editable-text" title="Click to rename history">${history.get_display_name() | h}</div> </div> + %endif </div>

1 0

[hg] galaxy 3578: Add ability for reverse complement in e.g. FAS...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/2f4807d6c38c changeset: 3578:2f4807d6c38c user: Dan Blankenberg <dan(a)bx.psu.edu> date: Mon Mar 29 14:54:23 2010 -0400 description: Add ability for reverse complement in e.g. FASTQ Manipulation tool to handle ambiguity codes. diffstat: lib/galaxy_utils/sequence/transform.py | 7 +++---- test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger | 16 ++++++++++++++++ test-data/misc_dna_original_sanger.fastqsanger | 16 ++++++++++++++++ test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger | 16 ++++++++++++++++ test-data/misc_rna_original_sanger.fastqsanger | 16 ++++++++++++++++ tools/fastq/fastq_manipulation.xml | 20 ++++++++++++++++++++ 6 files changed, 87 insertions(+), 4 deletions(-) diffs (127 lines): diff -r d34c1a8df003 -r 2f4807d6c38c lib/galaxy_utils/sequence/transform.py --- a/lib/galaxy_utils/sequence/transform.py Mon Mar 29 14:33:23 2010 -0400 +++ b/lib/galaxy_utils/sequence/transform.py Mon Mar 29 14:54:23 2010 -0400 @@ -2,10 +2,9 @@ #Contains methods to tranform sequence strings import string -#FIXME: This should Handle ambiguity codes... -#Translation table for reverse Complement -DNA_COMPLEMENT = string.maketrans( "ACGTacgt", "TGCAtgca" ) -RNA_COMPLEMENT = string.maketrans( "ACGUacgu", "UGCAugca" ) +#Translation table for reverse Complement, with ambiguity codes +DNA_COMPLEMENT = string.maketrans( "ACGTRYKMBDHVacgtrykmbdhv", "TGCAYRMKVHDBtgcayrmkvhdb" ) +RNA_COMPLEMENT = string.maketrans( "ACGURYKMBDHVacgurykmbdhv", "UGCAYRMKVHDBugcayrmkvhdb" ) #Translation table for DNA <--> RNA DNA_TO_RNA = string.maketrans( "Tt", "Uu" ) RNA_TO_DNA = string.maketrans( "Uu", "Tt" ) diff -r d34c1a8df003 -r 2f4807d6c38c test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger Mon Mar 29 14:54:23 2010 -0400 @@ -0,0 +1,16 @@ +@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +actgactgactgactgactgactgactgactgactgactga ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) +NHBVDMKSWRYGATCnhbvdmkswrygatc ++ +?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I diff -r d34c1a8df003 -r 2f4807d6c38c test-data/misc_dna_original_sanger.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_dna_original_sanger.fastqsanger Mon Mar 29 14:54:23 2010 -0400 @@ -0,0 +1,16 @@ +@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTA ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +gTcatAGcgTcatAGcgTcatAGcgTcatAGcgTcatAGcg ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +tcagtcagtcagtcagtcagtcagtcagtcagtcagtcagt ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) +gatcrywsmkhbvdnGATCRYWSMKHBVDN ++ +I?5+I?5+I?5+I?5+I?5+I?5+I?5+I? diff -r d34c1a8df003 -r 2f4807d6c38c test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger Mon Mar 29 14:54:23 2010 -0400 @@ -0,0 +1,16 @@ +@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +acugacugacugacugacugacugacugacugacugacuga ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) +NHBVDMKSWRYGAUCnhbvdmkswrygauc ++ +IHGFEDIHGFEDIHGFEDIHGFEDIHGFED diff -r d34c1a8df003 -r 2f4807d6c38c test-data/misc_rna_original_sanger.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_rna_original_sanger.fastqsanger Mon Mar 29 14:54:23 2010 -0400 @@ -0,0 +1,16 @@ +@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +ucagucagucagucagucagucagucagucagucagucagu ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) +gaucrywsmkhbvdnGAUCRYWSMKHBVDN ++ +DEFGHIDEFGHIDEFGHIDEFGHIDEFGHI diff -r d34c1a8df003 -r 2f4807d6c38c tools/fastq/fastq_manipulation.xml --- a/tools/fastq/fastq_manipulation.xml Mon Mar 29 14:33:23 2010 -0400 +++ b/tools/fastq/fastq_manipulation.xml Mon Mar 29 14:54:23 2010 -0400 @@ -331,6 +331,26 @@ <param name="manipulation_selector" value="rev_comp" /> <output name="output_file" file="sanger_full_range_rev_comp.fastqsanger" /> </test> +  + <test> + <param name="input_file" value="misc_dna_original_sanger.fastqsanger" ftype="fastqsanger" /> + <param name="match_type_selector" value="identifier" /> + <param name="match_selector" value="regex" /> + <param name="match_by" value=".*" /> + <param name="manipulation_type_selector" value="sequence" /> + <param name="manipulation_selector" value="rev_comp" /> + <output name="output_file" file="misc_dna_as_sanger_rev_comp_1.fastqsanger" /> + </test> +  + <test> + <param name="input_file" value="misc_rna_original_sanger.fastqsanger" ftype="fastqsanger" /> + <param name="match_type_selector" value="identifier" /> + <param name="match_selector" value="regex" /> + <param name="match_by" value=".*" /> + <param name="manipulation_type_selector" value="sequence" /> + <param name="manipulation_selector" value="rev_comp" /> + <output name="output_file" file="misc_rna_as_sanger_rev_comp_1.fastqsanger" /> + </test>  <test> <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />

1 0

[hg] galaxy 3577: Fix the column_maker tool so that if round is ...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/d34c1a8df003 changeset: 3577:d34c1a8df003 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Mon Mar 29 14:33:23 2010 -0400 description: Fix the column_maker tool so that if round is set to 'yes', the computed result is actually rounded. Added 2 new functional test to cover behavior. diffstat: test-data/column_maker_out1.interval | 65 ++++++++++++++++++++++++++++++++++++ test-data/column_maker_out2.interval | 5 ++ test-data/column_maker_out3.interval | 5 ++ test-data/eq-compute.dat | 65 ------------------------------------ tools/stats/column_maker.py | 11 +++-- tools/stats/column_maker.xml | 16 +++++++- 6 files changed, 96 insertions(+), 71 deletions(-) diffs (224 lines): diff -r 5b793b193cac -r d34c1a8df003 test-data/column_maker_out1.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/column_maker_out1.interval Mon Mar 29 14:33:23 2010 -0400 @@ -0,0 +1,65 @@ +chr1 147962192 147962580 CCDS989.1_cds_0_0_chr1_147962193_r 0 - 388.0 +chr1 147984545 147984630 CCDS990.1_cds_0_0_chr1_147984546_f 0 + 85.0 +chr1 148078400 148078582 CCDS993.1_cds_0_0_chr1_148078401_r 0 - 182.0 +chr1 148185136 148185276 CCDS996.1_cds_0_0_chr1_148185137_f 0 + 140.0 +chr10 55251623 55253124 CCDS7248.1_cds_0_0_chr10_55251624_r 0 - 1501.0 +chr11 116124407 116124501 CCDS8374.1_cds_0_0_chr11_116124408_r 0 - 94.0 +chr11 116206508 116206563 CCDS8377.1_cds_0_0_chr11_116206509_f 0 + 55.0 +chr11 116211733 116212337 CCDS8378.1_cds_0_0_chr11_116211734_r 0 - 604.0 +chr11 1812377 1812407 CCDS7726.1_cds_0_0_chr11_1812378_f 0 + 30.0 +chr12 38440094 38440321 CCDS8736.1_cds_0_0_chr12_38440095_r 0 - 227.0 +chr13 112381694 112381953 CCDS9526.1_cds_0_0_chr13_112381695_f 0 + 259.0 +chr14 98710240 98712285 CCDS9949.1_cds_0_0_chr14_98710241_r 0 - 2045.0 +chr15 41486872 41487060 CCDS10096.1_cds_0_0_chr15_41486873_r 0 - 188.0 +chr15 41673708 41673857 CCDS10097.1_cds_0_0_chr15_41673709_f 0 + 149.0 +chr15 41679161 41679250 CCDS10098.1_cds_0_0_chr15_41679162_r 0 - 89.0 +chr15 41826029 41826196 CCDS10101.1_cds_0_0_chr15_41826030_f 0 + 167.0 +chr16 142908 143003 CCDS10397.1_cds_0_0_chr16_142909_f 0 + 95.0 +chr16 179963 180135 CCDS10401.1_cds_0_0_chr16_179964_r 0 - 172.0 +chr16 244413 244681 CCDS10402.1_cds_0_0_chr16_244414_f 0 + 268.0 +chr16 259268 259383 CCDS10403.1_cds_0_0_chr16_259269_r 0 - 115.0 +chr18 23786114 23786321 CCDS11891.1_cds_0_0_chr18_23786115_r 0 - 207.0 +chr18 59406881 59407046 CCDS11985.1_cds_0_0_chr18_59406882_f 0 + 165.0 +chr18 59455932 59456337 CCDS11986.1_cds_0_0_chr18_59455933_r 0 - 405.0 +chr18 59600586 59600754 CCDS11988.1_cds_0_0_chr18_59600587_f 0 + 168.0 +chr19 59068595 59069564 CCDS12866.1_cds_0_0_chr19_59068596_f 0 + 969.0 +chr19 59236026 59236146 CCDS12872.1_cds_0_0_chr19_59236027_r 0 - 120.0 +chr19 59297998 59298008 CCDS12877.1_cds_0_0_chr19_59297999_f 0 + 10.0 +chr19 59302168 59302288 CCDS12878.1_cds_0_0_chr19_59302169_r 0 - 120.0 +chr2 118288583 118288668 CCDS2120.1_cds_0_0_chr2_118288584_f 0 + 85.0 +chr2 118394148 118394202 CCDS2121.1_cds_0_0_chr2_118394149_r 0 - 54.0 +chr2 220190202 220190242 CCDS2441.1_cds_0_0_chr2_220190203_f 0 + 40.0 +chr2 220229609 220230869 CCDS2443.1_cds_0_0_chr2_220229610_r 0 - 1260.0 +chr20 33330413 33330423 CCDS13249.1_cds_0_0_chr20_33330414_r 0 - 10.0 +chr20 33513606 33513792 CCDS13255.1_cds_0_0_chr20_33513607_f 0 + 186.0 +chr20 33579500 33579527 CCDS13256.1_cds_0_0_chr20_33579501_r 0 - 27.0 +chr20 33593260 33593348 CCDS13257.1_cds_0_0_chr20_33593261_f 0 + 88.0 +chr21 32707032 32707192 CCDS13614.1_cds_0_0_chr21_32707033_f 0 + 160.0 +chr21 32869641 32870022 CCDS13615.1_cds_0_0_chr21_32869642_r 0 - 381.0 +chr21 33321040 33322012 CCDS13620.1_cds_0_0_chr21_33321041_f 0 + 972.0 +chr21 33744994 33745040 CCDS13625.1_cds_0_0_chr21_33744995_r 0 - 46.0 +chr22 30120223 30120265 CCDS13897.1_cds_0_0_chr22_30120224_f 0 + 42.0 +chr22 30160419 30160661 CCDS13898.1_cds_0_0_chr22_30160420_r 0 - 242.0 +chr22 30665273 30665360 CCDS13901.1_cds_0_0_chr22_30665274_f 0 + 87.0 +chr22 30939054 30939266 CCDS13903.1_cds_0_0_chr22_30939055_r 0 - 212.0 +chr5 131424298 131424460 CCDS4149.1_cds_0_0_chr5_131424299_f 0 + 162.0 +chr5 131556601 131556672 CCDS4151.1_cds_0_0_chr5_131556602_r 0 - 71.0 +chr5 131621326 131621419 CCDS4152.1_cds_0_0_chr5_131621327_f 0 + 93.0 +chr5 131847541 131847666 CCDS4155.1_cds_0_0_chr5_131847542_r 0 - 125.0 +chr6 108299600 108299744 CCDS5061.1_cds_0_0_chr6_108299601_r 0 - 144.0 +chr6 108594662 108594687 CCDS5063.1_cds_0_0_chr6_108594663_f 0 + 25.0 +chr6 108640045 108640151 CCDS5064.1_cds_0_0_chr6_108640046_r 0 - 106.0 +chr6 108722976 108723115 CCDS5067.1_cds_0_0_chr6_108722977_f 0 + 139.0 +chr7 113660517 113660685 CCDS5760.1_cds_0_0_chr7_113660518_f 0 + 168.0 +chr7 116512159 116512389 CCDS5771.1_cds_0_0_chr7_116512160_r 0 - 230.0 +chr7 116714099 116714152 CCDS5773.1_cds_0_0_chr7_116714100_f 0 + 53.0 +chr7 116945541 116945787 CCDS5774.1_cds_0_0_chr7_116945542_r 0 - 246.0 +chr8 118881131 118881317 CCDS6324.1_cds_0_0_chr8_118881132_r 0 - 186.0 +chr9 128764156 128764189 CCDS6914.1_cds_0_0_chr9_128764157_f 0 + 33.0 +chr9 128787519 128789136 CCDS6915.1_cds_0_0_chr9_128787520_r 0 - 1617.0 +chr9 128882427 128882523 CCDS6917.1_cds_0_0_chr9_128882428_f 0 + 96.0 +chr9 128937229 128937445 CCDS6919.1_cds_0_0_chr9_128937230_r 0 - 216.0 +chrX 122745047 122745924 CCDS14606.1_cds_0_0_chrX_122745048_f 0 + 877.0 +chrX 152648964 152649196 CCDS14733.1_cds_0_0_chrX_152648965_r 0 - 232.0 +chrX 152691446 152691471 CCDS14735.1_cds_0_0_chrX_152691447_f 0 + 25.0 +chrX 152694029 152694263 CCDS14736.1_cds_0_0_chrX_152694030_r 0 - 234.0 diff -r 5b793b193cac -r d34c1a8df003 test-data/column_maker_out2.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/column_maker_out2.interval Mon Mar 29 14:33:23 2010 -0400 @@ -0,0 +1,5 @@ +chr1 4348187 4348589 3.70 4.90 2.55 0.24 0.46 3.7 +chr1 4488177 4488442 4.03 5.77 1.92 -0.67 0.81 4.03 +chr1 4774091 4774440 8.07 8.33 7.82 0.85 -0.40 8.07 +chr1 4800122 4800409 6.40 7.35 5.44 1.19 -0.42 6.4 +chr1 4878925 4879277 2.18 0.28 4.93 -0.96 1.24 2.18 diff -r 5b793b193cac -r d34c1a8df003 test-data/column_maker_out3.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/column_maker_out3.interval Mon Mar 29 14:33:23 2010 -0400 @@ -0,0 +1,5 @@ +chr1 4348187 4348589 3.70 4.90 2.55 0.24 0.46 4 +chr1 4488177 4488442 4.03 5.77 1.92 -0.67 0.81 4 +chr1 4774091 4774440 8.07 8.33 7.82 0.85 -0.40 8 +chr1 4800122 4800409 6.40 7.35 5.44 1.19 -0.42 6 +chr1 4878925 4879277 2.18 0.28 4.93 -0.96 1.24 2 diff -r 5b793b193cac -r d34c1a8df003 test-data/eq-compute.dat --- a/test-data/eq-compute.dat Mon Mar 29 11:48:05 2010 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,65 +0,0 @@ -chr1 147962192 147962580 CCDS989.1_cds_0_0_chr1_147962193_r 0 - 388.0 -chr1 147984545 147984630 CCDS990.1_cds_0_0_chr1_147984546_f 0 + 85.0 -chr1 148078400 148078582 CCDS993.1_cds_0_0_chr1_148078401_r 0 - 182.0 -chr1 148185136 148185276 CCDS996.1_cds_0_0_chr1_148185137_f 0 + 140.0 -chr10 55251623 55253124 CCDS7248.1_cds_0_0_chr10_55251624_r 0 - 1501.0 -chr11 116124407 116124501 CCDS8374.1_cds_0_0_chr11_116124408_r 0 - 94.0 -chr11 116206508 116206563 CCDS8377.1_cds_0_0_chr11_116206509_f 0 + 55.0 -chr11 116211733 116212337 CCDS8378.1_cds_0_0_chr11_116211734_r 0 - 604.0 -chr11 1812377 1812407 CCDS7726.1_cds_0_0_chr11_1812378_f 0 + 30.0 -chr12 38440094 38440321 CCDS8736.1_cds_0_0_chr12_38440095_r 0 - 227.0 -chr13 112381694 112381953 CCDS9526.1_cds_0_0_chr13_112381695_f 0 + 259.0 -chr14 98710240 98712285 CCDS9949.1_cds_0_0_chr14_98710241_r 0 - 2045.0 -chr15 41486872 41487060 CCDS10096.1_cds_0_0_chr15_41486873_r 0 - 188.0 -chr15 41673708 41673857 CCDS10097.1_cds_0_0_chr15_41673709_f 0 + 149.0 -chr15 41679161 41679250 CCDS10098.1_cds_0_0_chr15_41679162_r 0 - 89.0 -chr15 41826029 41826196 CCDS10101.1_cds_0_0_chr15_41826030_f 0 + 167.0 -chr16 142908 143003 CCDS10397.1_cds_0_0_chr16_142909_f 0 + 95.0 -chr16 179963 180135 CCDS10401.1_cds_0_0_chr16_179964_r 0 - 172.0 -chr16 244413 244681 CCDS10402.1_cds_0_0_chr16_244414_f 0 + 268.0 -chr16 259268 259383 CCDS10403.1_cds_0_0_chr16_259269_r 0 - 115.0 -chr18 23786114 23786321 CCDS11891.1_cds_0_0_chr18_23786115_r 0 - 207.0 -chr18 59406881 59407046 CCDS11985.1_cds_0_0_chr18_59406882_f 0 + 165.0 -chr18 59455932 59456337 CCDS11986.1_cds_0_0_chr18_59455933_r 0 - 405.0 -chr18 59600586 59600754 CCDS11988.1_cds_0_0_chr18_59600587_f 0 + 168.0 -chr19 59068595 59069564 CCDS12866.1_cds_0_0_chr19_59068596_f 0 + 969.0 -chr19 59236026 59236146 CCDS12872.1_cds_0_0_chr19_59236027_r 0 - 120.0 -chr19 59297998 59298008 CCDS12877.1_cds_0_0_chr19_59297999_f 0 + 10.0 -chr19 59302168 59302288 CCDS12878.1_cds_0_0_chr19_59302169_r 0 - 120.0 -chr2 118288583 118288668 CCDS2120.1_cds_0_0_chr2_118288584_f 0 + 85.0 -chr2 118394148 118394202 CCDS2121.1_cds_0_0_chr2_118394149_r 0 - 54.0 -chr2 220190202 220190242 CCDS2441.1_cds_0_0_chr2_220190203_f 0 + 40.0 -chr2 220229609 220230869 CCDS2443.1_cds_0_0_chr2_220229610_r 0 - 1260.0 -chr20 33330413 33330423 CCDS13249.1_cds_0_0_chr20_33330414_r 0 - 10.0 -chr20 33513606 33513792 CCDS13255.1_cds_0_0_chr20_33513607_f 0 + 186.0 -chr20 33579500 33579527 CCDS13256.1_cds_0_0_chr20_33579501_r 0 - 27.0 -chr20 33593260 33593348 CCDS13257.1_cds_0_0_chr20_33593261_f 0 + 88.0 -chr21 32707032 32707192 CCDS13614.1_cds_0_0_chr21_32707033_f 0 + 160.0 -chr21 32869641 32870022 CCDS13615.1_cds_0_0_chr21_32869642_r 0 - 381.0 -chr21 33321040 33322012 CCDS13620.1_cds_0_0_chr21_33321041_f 0 + 972.0 -chr21 33744994 33745040 CCDS13625.1_cds_0_0_chr21_33744995_r 0 - 46.0 -chr22 30120223 30120265 CCDS13897.1_cds_0_0_chr22_30120224_f 0 + 42.0 -chr22 30160419 30160661 CCDS13898.1_cds_0_0_chr22_30160420_r 0 - 242.0 -chr22 30665273 30665360 CCDS13901.1_cds_0_0_chr22_30665274_f 0 + 87.0 -chr22 30939054 30939266 CCDS13903.1_cds_0_0_chr22_30939055_r 0 - 212.0 -chr5 131424298 131424460 CCDS4149.1_cds_0_0_chr5_131424299_f 0 + 162.0 -chr5 131556601 131556672 CCDS4151.1_cds_0_0_chr5_131556602_r 0 - 71.0 -chr5 131621326 131621419 CCDS4152.1_cds_0_0_chr5_131621327_f 0 + 93.0 -chr5 131847541 131847666 CCDS4155.1_cds_0_0_chr5_131847542_r 0 - 125.0 -chr6 108299600 108299744 CCDS5061.1_cds_0_0_chr6_108299601_r 0 - 144.0 -chr6 108594662 108594687 CCDS5063.1_cds_0_0_chr6_108594663_f 0 + 25.0 -chr6 108640045 108640151 CCDS5064.1_cds_0_0_chr6_108640046_r 0 - 106.0 -chr6 108722976 108723115 CCDS5067.1_cds_0_0_chr6_108722977_f 0 + 139.0 -chr7 113660517 113660685 CCDS5760.1_cds_0_0_chr7_113660518_f 0 + 168.0 -chr7 116512159 116512389 CCDS5771.1_cds_0_0_chr7_116512160_r 0 - 230.0 -chr7 116714099 116714152 CCDS5773.1_cds_0_0_chr7_116714100_f 0 + 53.0 -chr7 116945541 116945787 CCDS5774.1_cds_0_0_chr7_116945542_r 0 - 246.0 -chr8 118881131 118881317 CCDS6324.1_cds_0_0_chr8_118881132_r 0 - 186.0 -chr9 128764156 128764189 CCDS6914.1_cds_0_0_chr9_128764157_f 0 + 33.0 -chr9 128787519 128789136 CCDS6915.1_cds_0_0_chr9_128787520_r 0 - 1617.0 -chr9 128882427 128882523 CCDS6917.1_cds_0_0_chr9_128882428_f 0 + 96.0 -chr9 128937229 128937445 CCDS6919.1_cds_0_0_chr9_128937230_r 0 - 216.0 -chrX 122745047 122745924 CCDS14606.1_cds_0_0_chrX_122745048_f 0 + 877.0 -chrX 152648964 152649196 CCDS14733.1_cds_0_0_chrX_152648965_r 0 - 232.0 -chrX 152691446 152691471 CCDS14735.1_cds_0_0_chrX_152691447_f 0 + 25.0 -chrX 152694029 152694263 CCDS14736.1_cds_0_0_chrX_152694030_r 0 - 234.0 diff -r 5b793b193cac -r d34c1a8df003 tools/stats/column_maker.py --- a/tools/stats/column_maker.py Mon Mar 29 11:48:05 2010 -0400 +++ b/tools/stats/column_maker.py Mon Mar 29 14:33:23 2010 -0400 @@ -17,7 +17,7 @@ inp_file = sys.argv[1] out_file = sys.argv[2] expr = sys.argv[3] -round = sys.argv[4] +round_result = sys.argv[4] try: in_columns = int( sys.argv[5] ) except: @@ -52,11 +52,11 @@ col_name = "c%d" % col cols.append( col_name ) col_type = in_column_types[ col - 1 ].strip() - if round == 'no' and col_type == 'int': + if round_result == 'no' and col_type == 'int': col_type = 'float' type_cast = "%s(%s)" % ( col_type, col_name ) type_casts.append( type_cast ) - + col_str = ', '.join( cols ) # 'c1, c2, c3, c4' type_cast_str = ', '.join( type_casts ) # 'str(c1), int(c2), int(c3), str(c4)' assign = "%s = line.split( '\\t' )" % col_str @@ -82,7 +82,10 @@ try: %s %s - new_line = line + '\\t' + str( %s ) + new_val = %s + if round_result == "yes": + new_val = int( round( new_val ) ) + new_line = line + '\\t' + str( new_val ) print >> out, new_line lines_kept += 1 except: diff -r 5b793b193cac -r d34c1a8df003 tools/stats/column_maker.xml --- a/tools/stats/column_maker.xml Mon Mar 29 11:48:05 2010 -0400 +++ b/tools/stats/column_maker.xml Mon Mar 29 14:33:23 2010 -0400 @@ -1,4 +1,4 @@ -<tool id="Add_a_column1" name="Compute"> +<tool id="Add_a_column1" name="Compute" version="1.1.0"> <description>an expression on every row</description> <command interpreter="python"> column_maker.py $input $out_file1 "$cond" $round ${input.metadata.columns} "${input.metadata.column_types}" @@ -19,7 +19,19 @@ <param name="cond" value="c3-c2"/> <param name="input" value="1.bed"/> <param name="round" value="no"/> - <output name="out_file1" file="eq-compute.dat"/> + <output name="out_file1" file="column_maker_out1.interval"/> + </test> + <test> + <param name="cond" value="c4*1"/> + <param name="input" value="1.interval"/> + <param name="round" value="no"/> + <output name="out_file1" file="column_maker_out2.interval"/> + </test> + <test> + <param name="cond" value="c4*1"/> + <param name="input" value="1.interval"/> + <param name="round" value="yes"/> + <output name="out_file1" file="column_maker_out3.interval"/> </test> </tests> <help>

1 0

[hg] galaxy 3576: Fix an eggs bug wherein compatible platform ve...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/5b793b193cac changeset: 3576:5b793b193cac user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Mar 29 11:48:05 2010 -0400 description: Fix an eggs bug wherein compatible platform versions would match even when python versions differed diffstat: lib/galaxy/eggs/__init__.py | 1 + 1 files changed, 1 insertions(+), 0 deletions(-) diffs (11 lines): diff -r b1165a0614ff -r 5b793b193cac lib/galaxy/eggs/__init__.py --- a/lib/galaxy/eggs/__init__.py Sat Mar 27 14:25:10 2010 -0400 +++ b/lib/galaxy/eggs/__init__.py Mon Mar 29 11:48:05 2010 -0400 @@ -97,6 +97,7 @@ if tmp_dist.platform is not None and \ self.distribution.project_name == tmp_dist.project_name and \ self.distribution.version == tmp_dist.version and \ + self.distribution.py_version == tmp_dist.py_version and \ pkg_resources.compatible_platforms( tmp_dist.platform, pkg_resources.get_platform() ): return file return None

1 0

[hg] galaxy 3575: Change to rgCaCo to output NAs unchanged rathe...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/b1165a0614ff changeset: 3575:b1165a0614ff user: fubar: ross Lazarus at gmail period com date: Sat Mar 27 14:25:10 2010 -0400 description: Change to rgCaCo to output NAs unchanged rather than fiddling with any p values This fixes an ugly artifact detected in manhatten plots Improved fidelity means downstream apps will need to cope with the awful realities diffstat: test-data/rgCaCotest1_CaCo.xls | 50 +++++++++++----------- test-data/rgtestouts/rgManQQ/Allelep_qqplot.png | 0 test-data/rgtestouts/rgManQQ/Armitagep_qqplot.png | 0 3 files changed, 25 insertions(+), 25 deletions(-) diffs (59 lines): diff -r bda77e05c7c0 -r b1165a0614ff test-data/rgCaCotest1_CaCo.xls --- a/test-data/rgCaCotest1_CaCo.xls Sat Mar 27 11:42:45 2010 -0400 +++ b/test-data/rgCaCotest1_CaCo.xls Sat Mar 27 14:25:10 2010 -0400 @@ -1,26 +1,26 @@ rs Chr Offset Genop log10Genop Armitagep log10Armitagep Allelep log10Allelep Domp log10Domp -rs2283802 22 21784722 1.000 0.000000 1.000 -0.000000 1.000 -0.000000 1.000 0.000000 -rs2267000 22 21785366 1.000 0.000000 0.893 0.049197 0.896 0.047450 1.000 0.000000 -rs16997606 22 21794754 1.000 0.000000 0.512 0.290815 0.540 0.267606 1.000 0.000000 -rs4820537 22 21794810 1.000 0.000000 0.266 0.575935 0.238 0.623423 1.000 0.000000 -rs3788347 22 21797804 1.000 0.000000 0.528 0.276955 0.518 0.285251 1.000 0.000000 -rs756632 22 21799918 1.000 0.000000 0.847 0.072014 0.838 0.076704 1.000 0.000000 -rs4820539 22 21807970 1.000 0.000000 0.663 0.178618 0.669 0.174704 1.000 0.000000 -rs2283804 22 21820335 1.000 0.000000 0.888 0.051636 0.891 0.049927 1.000 0.000000 -rs2267006 22 21820990 1.000 0.000000 0.888 0.051636 0.891 0.049927 1.000 0.000000 -rs4822363 22 21821000 1.000 0.000000 0.609 0.215311 0.624 0.204815 1.000 0.000000 -rs5751592 22 21827674 1.000 0.000000 0.426 0.370998 0.470 0.328272 1.000 0.000000 -rs5759608 22 21832708 1.000 0.000000 1.000 -0.000000 1.000 -0.000000 1.000 0.000000 -rs5759612 22 21833170 1.000 0.000000 1.000 -0.000000 1.000 -0.000000 1.000 0.000000 -rs2267009 22 21860168 1.000 0.000000 1.000 -0.000000 1.000 -0.000000 1.000 0.000000 -rs2267010 22 21864366 1.000 0.000000 0.729 0.137332 0.734 0.134304 1.000 0.000000 -rs5759636 22 21868698 1.000 0.000000 0.215 0.667360 0.228 0.642256 1.000 0.000000 -rs2071436 22 21871488 1.000 0.000000 1.000 -0.000000 1.000 -0.000000 1.000 0.000000 -rs2267013 22 21875879 1.000 0.000000 0.512 0.290815 0.540 0.267606 1.000 0.000000 -rs6003566 22 21889806 1.000 0.000000 0.361 0.442132 0.389 0.409604 1.000 0.000000 -rs2256725 22 21892891 1.000 0.000000 0.512 0.290815 0.540 0.267606 1.000 0.000000 -rs12160770 22 21892925 1.000 0.000000 0.594 0.225921 0.597 0.224098 1.000 0.000000 -rs5751611 22 21896019 1.000 0.000000 0.893 0.049246 0.894 0.048565 1.000 0.000000 -rs762601 22 21898858 1.000 0.000000 0.897 0.047111 0.893 0.049051 1.000 0.000000 -rs2156921 22 21899063 1.000 0.000000 0.897 0.047111 0.893 0.049051 1.000 0.000000 -rs4822375 22 21905642 1.000 0.000000 0.897 0.047111 0.893 0.049051 1.000 0.000000 +rs2283802 22 21784722 NA 0.000000 1 -0.000000 1 -0.000000 NA 0.000000 +rs2267000 22 21785366 NA 0.000000 0.8929 0.049197 0.8965 0.047450 NA 0.000000 +rs16997606 22 21794754 NA 0.000000 0.5119 0.290815 0.54 0.267606 NA 0.000000 +rs4820537 22 21794810 NA 0.000000 0.2655 0.575935 0.238 0.623423 NA 0.000000 +rs3788347 22 21797804 NA 0.000000 0.5285 0.276955 0.5185 0.285251 NA 0.000000 +rs756632 22 21799918 NA 0.000000 0.8472 0.072014 0.8381 0.076704 NA 0.000000 +rs4820539 22 21807970 NA 0.000000 0.6628 0.178618 0.6688 0.174704 NA 0.000000 +rs2283804 22 21820335 NA 0.000000 0.8879 0.051636 0.8914 0.049927 NA 0.000000 +rs2267006 22 21820990 NA 0.000000 0.8879 0.051636 0.8914 0.049927 NA 0.000000 +rs4822363 22 21821000 NA 0.000000 0.6091 0.215311 0.624 0.204815 NA 0.000000 +rs5751592 22 21827674 NA 0.000000 0.4256 0.370998 0.4696 0.328272 NA 0.000000 +rs5759608 22 21832708 NA 0.000000 1 -0.000000 1 -0.000000 NA 0.000000 +rs5759612 22 21833170 NA 0.000000 1 -0.000000 1 -0.000000 NA 0.000000 +rs2267009 22 21860168 NA 0.000000 1 -0.000000 1 -0.000000 NA 0.000000 +rs2267010 22 21864366 NA 0.000000 0.7289 0.137332 0.734 0.134304 NA 0.000000 +rs5759636 22 21868698 NA 0.000000 0.2151 0.667360 0.2279 0.642256 NA 0.000000 +rs2071436 22 21871488 NA 0.000000 1 -0.000000 1 -0.000000 NA 0.000000 +rs2267013 22 21875879 NA 0.000000 0.5119 0.290815 0.54 0.267606 NA 0.000000 +rs6003566 22 21889806 NA 0.000000 0.3613 0.442132 0.3894 0.409604 NA 0.000000 +rs2256725 22 21892891 NA 0.000000 0.5119 0.290815 0.54 0.267606 NA 0.000000 +rs12160770 22 21892925 NA 0.000000 0.5944 0.225921 0.5969 0.224098 NA 0.000000 +rs5751611 22 21896019 NA 0.000000 0.8928 0.049246 0.8942 0.048565 NA 0.000000 +rs762601 22 21898858 NA 0.000000 0.8972 0.047111 0.8932 0.049051 NA 0.000000 +rs2156921 22 21899063 NA 0.000000 0.8972 0.047111 0.8932 0.049051 NA 0.000000 +rs4822375 22 21905642 NA 0.000000 0.8972 0.047111 0.8932 0.049051 NA 0.000000 diff -r bda77e05c7c0 -r b1165a0614ff test-data/rgtestouts/rgManQQ/Allelep_qqplot.png Binary file test-data/rgtestouts/rgManQQ/Allelep_qqplot.png has changed diff -r bda77e05c7c0 -r b1165a0614ff test-data/rgtestouts/rgManQQ/Armitagep_qqplot.png Binary file test-data/rgtestouts/rgManQQ/Armitagep_qqplot.png has changed

1 0

[hg] galaxy 3574: Two small tweaks to WGA/SNP tests - for rgQC a...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/bda77e05c7c0 changeset: 3574:bda77e05c7c0 user: fubar: ross Lazarus at gmail period com date: Sat Mar 27 11:42:45 2010 -0400 description: Two small tweaks to WGA/SNP tests - for rgQC and for rgManQQ diffstat: tools/rgenetics/rgManQQ.py | 5 ++--- tools/rgenetics/rgManQQ.xml | 1 + tools/rgenetics/rgQC.xml | 2 +- 3 files changed, 4 insertions(+), 4 deletions(-) diffs (39 lines): diff -r b5757fb7ab13 -r bda77e05c7c0 tools/rgenetics/rgManQQ.py --- a/tools/rgenetics/rgManQQ.py Fri Mar 26 22:40:46 2010 -0400 +++ b/tools/rgenetics/rgManQQ.py Sat Mar 27 11:42:45 2010 -0400 @@ -189,10 +189,9 @@ if chrom_col == 1 or offset_col == 1: # was passed as zero - do not do manhattan plots chrom_col = 0 offset_col = 0 - if sys.argv[8].lower() in ['1','true']: + grey = 0 + if (sys.argv[8].lower() in ['1','true']): grey = 1 - else: - grey = 0 rcmd = '%s%s' % (rcode,rcode2 % (input_fname,chrom_col,offset_col,pval_cols,title,grey)) rlog,flist = RRun(rcmd=rcmd,title=ctitle,outdir=outdir) flist.sort() diff -r b5757fb7ab13 -r bda77e05c7c0 tools/rgenetics/rgManQQ.xml --- a/tools/rgenetics/rgManQQ.xml Fri Mar 26 22:40:46 2010 -0400 +++ b/tools/rgenetics/rgManQQ.xml Sat Mar 27 11:42:45 2010 -0400 @@ -41,6 +41,7 @@ <param name='pval_col' value='5,7' /> <param name='chrom_col' value='1' /> <param name='offset_col' value='2' /> + <param name='grey' value='0' /> <output name='out_html' file='rgtestouts/rgManQQ/rgManQQtest1.html' ftype='html' lines_diff='17'> <extra_files type="file" name='Allelep_manhattan.png' value='rgtestouts/rgManQQ/Allelep_manhattan.png' compare="sim_size" delta = "100" /> diff -r b5757fb7ab13 -r bda77e05c7c0 tools/rgenetics/rgQC.xml --- a/tools/rgenetics/rgQC.xml Fri Mar 26 22:40:46 2010 -0400 +++ b/tools/rgenetics/rgQC.xml Sat Mar 27 11:42:45 2010 -0400 @@ -37,7 +37,7 @@ <extra_files type="file" name='tinywga.imiss' value="rgtestouts/rgQC/tinywga.imiss" compare="diff" /> <extra_files type="file" name='tinywga.lmendel' value="rgtestouts/rgQC/tinywga.lmendel" compare="diff" /> <extra_files type="file" name='tinywga.lmiss' value="rgtestouts/rgQC/tinywga.lmiss" compare="diff" /> - <extra_files type="file" name='tinywga_All_3x3.pdf' value="rgtestouts/rgQC/tinywga_All_3x3.pdf" compare="diff" lines_diff="1112"/> + <extra_files type="file" name='tinywga_All_3x3.pdf' value="rgtestouts/rgQC/tinywga_All_3x3.pdf" compare="diff" lines_diff="2660"/> <extra_files type="file" name='ldp_tinywga.bed' value="rgtestouts/rgQC/ldp_tinywga.bed" compare="diff" /> <extra_files type="file" name='ldp_tinywga.bim' value="rgtestouts/rgQC/ldp_tinywga.bim" compare="diff" /> <extra_files type="file" name='ldp_tinywga.fam' value="rgtestouts/rgQC/ldp_tinywga.fam" compare="diff" />

1 0

[hg] galaxy 3573: added a grey option for manhattan plot chromos...
by Greg Von Kuster 15 Apr '10

15 Apr '10

details: http://www.bx.psu.edu/hg/galaxy/rev/b5757fb7ab13 changeset: 3573:b5757fb7ab13 user: fubar: ross Lazarus at gmail period com date: Fri Mar 26 22:40:46 2010 -0400 description: added a grey option for manhattan plot chromosome colours diffstat: tools/rgenetics/rgCaCo.py | 15 +++++++-------- tools/rgenetics/rgManQQ.py | 16 ++++++++++------ tools/rgenetics/rgManQQ.xml | 4 +++- tools/rgenetics/rgQC.xml | 4 ++-- 4 files changed, 22 insertions(+), 17 deletions(-) diffs (138 lines): diff -r b8689cf28fa7 -r b5757fb7ab13 tools/rgenetics/rgCaCo.py --- a/tools/rgenetics/rgCaCo.py Fri Mar 26 16:46:44 2010 -0400 +++ b/tools/rgenetics/rgCaCo.py Fri Mar 26 22:40:46 2010 -0400 @@ -112,14 +112,13 @@ if p <> 'NA': # eesh logp = '%9.9f' % -math.log10(p) else: - logp = '1' + logp = 'NA' try: orat = ll[8] - if orat == 'NA': - orat = '1' except: - orat = '1' + orat = 'NA' orat2 = orat + # invert large negative odds ratios if float(orat) < 1 and float(orat) > 0.0: orat2 = '%9.9f' % (1.0/float(orat)) outl = [ll[1],logp, orat2, orat] @@ -207,16 +206,16 @@ flog.write('### offending line #%d in %s = %s' % (lnum,l)) except: pass - width = max(3,1+int(abs(lp))) # get desired precision for output - w = '%d' % width - fps = '%%%s.%sf' % (w,w) # eg '%9.9f' if snp <> lastsnp: if len(outl.keys()) > 3: sl = [outl.get(x,'?') for x in ('snp','chrom','offset','GENO','TREND','ALLELIC','DOM')] res.append('\t'.join(sl)) # last snp line outl = {'snp':snp,'chrom':chrom,'offset':offset} # first 3 cols for gg line lastsnp = snp # reset for next marker - outl[test] = '\t'.join([(fps % fp).strip(),('%6.6f' % lp).strip()]) + #if p == 'NA': + # p = 1.0 + # let's pass downstream for handling R is fine? + outl[test] = '%s\t%f' % (p,lp) if len(outl.keys()) > 3: l = [outl.get(x,'?') for x in ('snp','chrom','offset','GENO','TREND','ALLELIC','DOM')] res.append('\t'.join(l)) # last snp line diff -r b8689cf28fa7 -r b5757fb7ab13 tools/rgenetics/rgManQQ.py --- a/tools/rgenetics/rgManQQ.py Fri Mar 26 16:46:44 2010 -0400 +++ b/tools/rgenetics/rgManQQ.py Fri Mar 26 22:40:46 2010 -0400 @@ -31,7 +31,7 @@ manhattan = function(chrom=NULL,offset=NULL,pvals=NULL, title=NULL, max.y="max", - suggestiveline=0, genomewide=T, size.x.labels=9, size.y.labels=10, annotate=F, SNPlist=NULL,grey=F) { + suggestiveline=0, genomewide=T, size.x.labels=9, size.y.labels=10, annotate=F, SNPlist=NULL,grey=0) { if (annotate & is.null(SNPlist)) stop("You requested annotation but provided no SNPlist!") genomewideline=NULL # was genomewideline=-log10(5e-8) @@ -120,7 +120,7 @@ # instantiate rcode2 string with infile,chromcol,offsetcol,pvalscols,title before saving and running rcode2 = """rgqqMan = function(infile="%s",chromcolumn=%d, offsetcolumn=%d, pvalscolumns=%s, - title="%s") { + title="%s",grey=%d) { d = read.table(infile,head=T,sep='\t') print(paste('###',length(d[,1]),'values read from',infile,'read - now running plots',sep=' ')) for (pvalscolumn in pvalscolumns) { @@ -133,7 +133,7 @@ print(paste('## qqplot on',cname,'done')) if ((chromcolumn > 0) & (offsetcolumn > 0)) { print(paste('## manhattan on',cname,'starting',chromcolumn,offsetcolumn,pvalscolumn)) - mymanplot= manhattan(chrom=d[,chromcolumn],offset=d[,offsetcolumn],pvals=d[,pvalscolumn],title=mytitle) + mymanplot= manhattan(chrom=d[,chromcolumn],offset=d[,offsetcolumn],pvals=d[,pvalscolumn],title=mytitle,grey=grey) print(paste('## manhattan plot on',cname,'done')) ggsave(file=paste(myfname,"manhattan.png",sep='_'),mymanplot,width=11,height=8,dpi=100) } @@ -141,7 +141,7 @@ print(paste('chrom column =',chromcolumn,'offset column = ',offsetcolumn, 'so no Manhattan plot - supply both chromosome and offset as numerics for Manhattan plots if required')) } - ggsave(file=paste(myfname,"qqplot.png",sep='_'),myqqplot,w=5,h=5,dpi=100) + ggsave(file=paste(myfname,"qqplot.png",sep='_'),myqqplot,width=8,height=11,dpi=100) } else { print(paste('pvalue column =',pvalscolumn,'Cannot parse it so no plots possible')) @@ -160,7 +160,7 @@ </command> """ print >> sys.stdout,'## rgManQQ.py. cl=',sys.argv - npar = 7 + npar = 8 if len(sys.argv) < npar: print >> sys.stdout, '## error - too few command line parameters - wanting %d' % npar print >> sys.stdout, u @@ -189,7 +189,11 @@ if chrom_col == 1 or offset_col == 1: # was passed as zero - do not do manhattan plots chrom_col = 0 offset_col = 0 - rcmd = '%s%s' % (rcode,rcode2 % (input_fname,chrom_col,offset_col,pval_cols,title)) + if sys.argv[8].lower() in ['1','true']: + grey = 1 + else: + grey = 0 + rcmd = '%s%s' % (rcode,rcode2 % (input_fname,chrom_col,offset_col,pval_cols,title,grey)) rlog,flist = RRun(rcmd=rcmd,title=ctitle,outdir=outdir) flist.sort() html = [galhtmlprefix % progname,] diff -r b8689cf28fa7 -r b5757fb7ab13 tools/rgenetics/rgManQQ.xml --- a/tools/rgenetics/rgManQQ.xml Fri Mar 26 16:46:44 2010 -0400 +++ b/tools/rgenetics/rgManQQ.xml Fri Mar 26 22:40:46 2010 -0400 @@ -4,7 +4,7 @@ <description>Plots for WGA P values</description> <command interpreter="python"> - rgManQQ.py '$i' "$name" '$out_html' '$out_html.files_path' '$chrom_col' '$offset_col' '$pval_col' + rgManQQ.py '$i' "$name" '$out_html' '$out_html.files_path' '$chrom_col' '$offset_col' '$pval_col' '$grey' </command> <inputs> @@ -23,6 +23,8 @@ <param name="offset_col" type='select' label = 'Base pair offset column in input file' help='Select "None" if offset not available or no Manhattan plot required' dynamic_options="get_phecols(i,True,'offs')" /> + <param name="grey" type="boolean" checked="false" truevalue="true" falsevalue="false" + label="Grey scale for Manhatten plot (default is colour"/> </page> </inputs> diff -r b8689cf28fa7 -r b5757fb7ab13 tools/rgenetics/rgQC.xml --- a/tools/rgenetics/rgQC.xml Fri Mar 26 16:46:44 2010 -0400 +++ b/tools/rgenetics/rgQC.xml Fri Mar 26 22:40:46 2010 -0400 @@ -27,8 +27,8 @@ <composite_data value='tinywga.fam' /> </param> <param name='out_prefix' value='rgQCtest1' /> - <output name='html_file' file='rgtestouts/rgQC/rgQCtest1.html' ftype='html' lines_diff='437'> - <extra_files type="file" name='tinywga_All_Paged.pdf' value="rgtestouts/rgQC/tinywga_All_Paged.pdf" compare="diff" lines_diff="1190"/> + <output name='html_file' file='rgtestouts/rgQC/rgQCtest1.html' ftype='html' lines_diff='250'> + <extra_files type="file" name='tinywga_All_Paged.pdf' value="rgtestouts/rgQC/tinywga_All_Paged.pdf" compare="diff" lines_diff="2600"/> <extra_files type="file" name='tinywga.log' value="rgtestouts/rgQC/tinywga.log" compare="diff" lines_diff="10"/> <extra_files type="file" name='tinywga.frq' value="rgtestouts/rgQC/tinywga.frq" compare="diff" /> <extra_files type="file" name='tinywga.het' value="rgtestouts/rgQC/tinywga.het" compare="diff" />

1 0