- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2517: Added solid_to_fastq and fastq_conversions con...
by Greg Von Kuster 04 Aug '09

04 Aug '09

details: http://www.bx.psu.edu/hg/galaxy/rev/61dd78cafa09 changeset: 2517:61dd78cafa09 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Fri Jul 31 11:48:37 2009 -0400 description: Added solid_to_fastq and fastq_conversions converters to Convert Formats section 14 file(s) affected in this change: test-data/s2fq_out1.tabular test-data/s2fq_out2.tabular test-data/s2fq_out3.tabular test-data/s2fq_paired_F3.csfasta test-data/s2fq_paired_F3_QV.qualsolid test-data/s2fq_paired_R3.csfasta test-data/s2fq_paired_R3_QV.qualsolid test-data/s2fq_phiX.csfasta test-data/s2fq_phiX.qualsolid tool_conf.xml.sample tools/next_gen_conversion/fastq_conversions.py tools/next_gen_conversion/fastq_conversions.xml tools/next_gen_conversion/solid_to_fastq.py tools/next_gen_conversion/solid_to_fastq.xml diffs (2324 lines): diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_out1.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_out1.tabular Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,576 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, +@1831_573_1067/1 +AAGTATGAGTCATTTACCGGGATGCGAAGAAAAG ++ +++#%(',%/$,+&1#&),)&+'*'*%#$&#%('$ +@1831_573_1219/1 +CGCCCTATAATAATACAGCGCGTTAGACCGCTCA ++ +@@=4/+)5)408?'665>*/5?<61';<3,:,5- +@1831_573_1242/1 +GCTGAATCGCACCTAGCAACTATAGCCGGGCCGC ++ +>>::>17=A5?@@=;7A=;2.60>82<8=74+;; +@1831_573_1333/1 +AGAATCGTTACCACACACTGCGTCTGGGTATCCG ++ +='@#%3=.>)/34*117,,/6-4+.9742456<) +@1831_573_1362/1 +CGATCTCAACCAGGTCCGCGCCCACCCCTGCCTC ++ +B@@?@@?@C@BA?@>@<@8A@?@'.8'?17:,+? +@1831_573_1448/1 +TCACGCCGGTCCTTGACTGGCGTTCTCTTCGAGG ++ +7=A)?,.@A@@:@@<=/7)@<-#8662%9613&+ +@1831_573_1490/1 +CTCGTCATGTTACGCAAAGGCACGTCACAGCACC ++ +@@@?,@??@$><=>+%/*>*1,)?26&12'9%7. +@1831_573_1523/1 +ATGGAACGGAACGGGTGAGGAGGGGAACGTAGGG ++ +,//*,#8''.6''6'2&27/80)%&#0'%#*,2' +@1831_573_1578/1 +CGAGTAGCAAACAAGACGCCAATCCAGGCGACCC ++ +?=@<@C@?@@??=>@;7<<8<694)3511(+1<. +@1831_573_1647/1 +AGGGGTTTACACTATTCGACTGGGTGAGAGGCGT ++ +?@@<@@???;A==@@;9?@?3=;6.4/;6:=/;4 +@1831_573_1684/1 +TTCAACTGCGTCGACGTAGCGCACAGGCGTCCGT ++ +>1:8<@39@@??9=;@@<>?@@<;<?7>76?9>? +@1831_573_1769/1 +TGGACGTATAGTGGCGATGAGCATGTAGGTTCTC ++ +54749&&767%/7;3$-7;3#,3//#,45/#&06 +@1831_573_1853/1 +CAAAACGCCCGGGGCCTCACATGCGCGGCAGTTC ++ +4./B@@72B+/4?@?7?+@9/+99.')2<2&)2& +@1831_573_1943/1 +ATAACGTATGGCAGTGAACGGGCGGAACCTGCCC ++ +>/*1,),@-)'0*>5'$/?6(a)/.&?8/(')A43, +@1831_573_1977/1 +GGCGTAGGGCTCATTGTGCAAGTATCCGACCTCC ++ +@?6@8@@9A@=4633A7?9?<3:+7>'@%@?%32 +@1831_574_109/1 +TCGGTTGCGTTACTTCATGGGAGGGCTTTACATT ++ +7651#4817>@65<2:84716=788<1995.7?6 +@1831_574_148/1 +CGAACCTCGTATAACGGAGTAGTCGGAAACAGTC ++ +;->3;;3>//>0;;7=,=4-4/+>029<9<624; +@1831_574_185/1 +CCGTTTTGCCTAGTAATGCTCGGCGCAGCGTCGC ++ +<4;%%@7>#*>97%6;+8$#<07%1372$%<54# +@1831_574_243/1 +AGGCACCGTAACTCAGGACATTCTCGATTAGTTA ++ +@@@95@=9?*><45$<@<4%@9?7#=?>7&>?97 +@1831_574_257/1 +ATACCTTCCAAAGCAATAGAATAAAAAACAGTAC ++ +>>B>)@?>B@B?@1%*%,#+00.'(+&5&%#$3& +@1831_574_293/1 +TGCTGCAAATAAACATACAGCCTTCTAATGACTA ++ +')7'.*%#&$'/.$##$.$&*)+*$#8%&%#&&% +@1831_574_389/1 +CATGGCTATGCACCGGTTTGTAGCGTACTCGAGA ++ +)$>/>8):2@:213;;.1)@3%64%+)<7)+$92 +@1831_574_575/1 +TTCTTGGCAAGCGCAGATTATGCGTTCCGCCTAG ++ +?@>=?@>8@@@=@6*%&<='5@<<',0<=4*5/< +@1831_574_592/1 +TCATTTACCACGTCAGGGTCGGAGTCATTCATTA ++ +3-5)19,,<@>4067<2.-864346;9<1/;212 +@1831_574_617/1 +AAGCATCGGCGGGAGCGCAAGCTGGGAAGGTGCC ++ +>@?;>?=@==@>@=5?@+@:@40@><:0)')64- +@1831_574_725/1 +GACAAGATGGCTATTATTTACAATCCGATCTGCA ++ +'>?52+5=;4$6;<8.1<47*9+?7(+5;-).)4 +@1831_574_734/1 +CCTGTACGAAAGAACGTAGGCATGGGCTGGGGGG ++ +-&.$2&<*(-%):/)%5:)/%7+,9034*A.?70 +@1831_574_824/1 +AGCGCAAATTATGCGTTCCGCCTAGCGGAGAACT ++ +@@@;;),+@<-<7;<&89??&29?<$2:A<);8? +@1831_574_959/1 +CGCGCTAGGACTCGGCCCCAAGAGACGTTCCGCC ++ +A=;+?@9;/<@;<8#&&/*%(%.0$0$2)+1$-1 +@1831_574_1062/1 +ACCGGTAATATAAGGCAACATGATTACGGCCACG ++ +@821<//:136/8<1/5.427.;>288/0<1$)/ +@1831_574_1092/1 +GACTGGCGAAATCATCGCGGAAAAACCCCTATCA ++ +8?.,98)03%#,,,(,++$'69'#9'7#';6.%2 +@1831_574_1103/1 +ATCTCCTGATTAGACATATCTCCGTAGCTCACGC ++ +??>?@=>@@A<>?=@==<:?<;58'&&):+35'1 +@1831_574_1116/1 +CACCTCACGTGAGTATAGCAGCCCGAGCGTCACC ++ +(a)++,)/)?./)%<)2>.==:8?&;44&/&,)/*4 +@1831_574_1194/1 +TTATCACATTTGGGGATCGGAAGGGACTACTTCG ++ +5>;,??9@9@?@1@@=@3=@>@4?@@94?75/,6 +@1831_574_1204/1 +CTTACTGGTCTGCTGGACATATAGTGGCGATGAA ++ +A5A5B@5:;@@,.9?A1?#.?;3),>82%)='7* +@1831_574_1306/1 +ATTGCTTAGATCCAGTGGCGCTCAATACAACGGA ++ +2.7&%''.$&#'%##$#'#%')')$'$%$,)'.1 +@1831_574_1387/1 +GTACTTCTCAATGCTGCACTACTATGTACGCCCC ++ +?A??:@?@@9?@@?9C;:>&).,,);&'<&7(/' +@1831_574_1431/1 +GACCAGTTTCAGGGCTAACCGTCCCTACTCGACC ++ +7?>9BA897;+8*=6#6.+5&-#26$0.,5&'$1 +@1831_574_1560/1 +GGCGTCTTAGGATTGAAGAGGGCCTCCCACCCCC ++ +))&65<4=>99@:597(1&;+&(%&4#,#&&&*$ +@1831_574_1591/1 +TGAGCACTTATGGCTAGGCGTAGGGGACCGTGAG ++ +=<A><?@78@<=;@&@6>8:?,><&&<7>8(8+9 +@1831_574_1624/1 +ACGGGAAGGGCTGGAATCTACCCAGTAGGCATTG ++ +<6.&(,7-+))7..'/;43.)927.(<85&13-) +@1831_574_1826/1 +TACGTCGCGACCGAGCGTTATATAGTCTGACCCC ++ +@<<,))459<?.+57'-'&6?1)(;1;0&%4,#$ +@1831_574_1903/1 +AGTGCAACATCTGCTTTGCTTATCAGCACACGGC ++ +956?@>;7@@@8:@>8><=9>9>@2=71?1:6;/ +@1831_574_1961/1 +GTTTCACTTCGGTTATTAAGAAACCCAAATGGAA ++ +>-07-@>(2'@<#064@%5%@@6.&<<(9)=:47 +@1831_575_54/1 +TTTCTTATGGGTAGAACAGCTGCCACTGACTGAA ++ +=@@68<2;<8;?@<>+9>7,,6972&57:4&9<8 +@1831_575_80/1 +TCTTTGGGTTTGGGGCAATTTGGTATGTTCGTCT ++ +?5><@?/=5%(&.5)+#/0'/'>#$/'37#()6& +@1831_575_192/1 +AACTACGCCCCTTAATTACACAGCGCGTTAGACC ++ +:8<,9(.=/)#%8$,4'<,:)3/.'.5<,>-;7' +@1831_575_197/1 +TTCGCCTACACTTAGATACCTCTTAAACTCAATG ++ +-:?463@A:88?6?437<=.2&1.;@67.4@%2, +@1831_575_223/1 +ACGCACAAAGGAGCTCGGCGCATAGCAACGCAGA ++ +?>?8?@:?;>+$'%&,+#$.--#%$1'&#-7$&' +@1831_575_420/1 +CCCACATGGAAAACACTCACCGCCGAACAGAGCG ++ +2?.>?(-''2+..@),$%1@;')1)?+)7.').. +@1831_575_434/1 +ATCGCTGCGAGGTCACCCTGGTTACGCCCCTTCC ++ +@@><@B@>=@@?>><@?;)@?;6.?=4,'';/3) +@1831_575_444/1 +TAGGCGACCGTGAGGACAAGAGCTGTTGCCTTGA ++ +2@@;<.=?@<+=:A<<@?<</>@><(<8>4&5;> +@1831_575_459/1 +CTTATCAGCACACGGTTTACCAGTCCGACTCCAA ++ +@@C@?A@@A@??A@@'6@@B'=;C@'4<=9,@1. +@1831_575_506/1 +CGCAGAACCCGCACGCTTGTGCTCACCACTGTAC ++ +?)2*5@3+.7=?A:8@,/&):@37/<89'+4*)* +@1831_575_569/1 +AGCAGACTGCTGTAACACGGTGTGGTGTAAGGAT ++ +'9-,@29+479%&>9#&08=>7#9>,69/+'*3) +@1831_575_622/1 +CCAAATCCGGCCCAGTAAGTGTCCTGTCGCACCC ++ +A8B=@@?<@?<>>=?96<497)<4/<':4+;74+ +@1831_575_644/1 +CTTGAATGGCGATCTCGTCGAGGAAATACCACTA ++ +<8>.>&,+)8.10':5(/-62&*.=/%(.<&&18 +@1831_575_663/1 +GGCAACTTATCCGCATTGGTCCCACTGGAGCGCA ++ +@@@@A</;A>@6>0792<5966:?;25+:><1,+ +@1831_575_681/1 +TCTCCTGATTAGACATATCACTGTTGAACACAGC ++ +72?.)25;96-14'*.03'#4#++$)/8+%/((& +@1831_575_711/1 +TATGTTCGTCCACGTCAGACGCGCAAAGTTGCGC ++ +%+:2(#'1+.)&*45-#,<A-%4;>+))<;##*& +@1831_575_730/1 +CACACAGGAACCATAGCGTATGTTATTCACCCCC ++ +%8<%-')5,*1&=#)(1*1)->7$.,4'4'&'*& +@1831_575_904/1 +ACCCGCTTAAAGACGTGAATTTTGCCTCCGCGCC ++ +<><.689@@7@<54:4=@>69=:+6-=42;8<:# +@1831_575_938/1 +TCATCAGGGAAGGCTAGGGGTTTACACTATTCGA ++ +:@@:?@;=8;>=;;:=<93<4.;<6:2<9;4)87 +@1831_575_970/1 +TGACTCCTACAGTCTTTATAGTACCGAGGGAGGC ++ +@=@=;@@><@@:9<:=?;>@=?9>>?@:2===<5 +@1831_575_991/1 +TTCGGCGATCCCCCCCACGGCGCGATGCCGCGCA ++ +>>;7???/4<:::,#&*%'$--5-#(7)&&,-)% +@1831_575_1138/1 +TTGAAAGACCTGAACGCGATTTCATGTTTACTGC ++ +=0;%1936+?96?,?5<:2>@6@<:;4>.7;*:1 +@1831_575_1157/1 +TCGCTGTTTAGATTTCGGGAGGGTACTTCAGTGC ++ +B@B>?A?A@?9'?;?&8?@@6;<@=+<:99+965 +@1831_575_1180/1 +GAATTCACGGCAGTGTTATCACCGTTTCCTTCCA ++ +<B>5?':/78?;1;55:997@@>94=7<186->7 +@1831_575_1283/1 +GGTGGAATACTAAGGACTAATGTGCTGTCTCTTT ++ +C@A54><?A78@<?2>:#>=?@2>80:'?69.'7 +@1831_575_1302/1 +CGACTATTCGTTTCGTCTAGAACGTGACACTAGC ++ +12>/#2'&-2&%'7+$%*#$/1(&&12/$,2,,* +@1831_575_1310/1 +CTTGCTCTCGAGCTATGCCTCAGGACACGCCCTT ++ +<<>663?99@(@7=11@:@@/7??<@<;>'3-7; +@1831_575_1321/1 +CAACACAGTTGAACGGCGGAGGAGTAAAGATGCG ++ +;B@?@>=A@<A?>@>?6>@5>'4@9?)7@7?/89 +@1831_575_1373/1 +CGCTACCGGTTCCAACGGCTGCCTGACTCGCGGA ++ +@@@>@;=9<@??7@>@:@;@;17?630/7=4,2< +@1831_575_1419/1 +TGGGGAATATAACAGCGTAGCGTTGAACACTAGA ++ +//3->&-.->%11/@&/&7:<,-1=,+2<6'%&< +@1831_575_1436/1 +TGCATCTAGCGCGTATTGCGAGCCTTACGGATTC ++ +2@=;39*3<*4<:>52>>9'7:<='0=>1'136< +@1831_575_1442/1 +TCTGACAAGGTTCCTGCACCTGCGTCTGAGAGGG ++ +>58<?7>+1B6-/9<<:5?>A:1@?539.@4/1> +@1831_575_1454/1 +CCTCCTAACCACGAGCCGAGGGGTCTCTGCCCCT ++ +4=?8=6589=0:A=:?>6<;@/,4+-6+/'.,(, +@1831_575_1500/1 +CACAAAAGGTCCCTACCTGTCTACCCTACATAGC ++ +?@@?A@?8<6<:985=99999==B3<5<<,7?>9 +@1831_575_1535/1 +CTCGACGATATGACCGCCAGCCACTTAACTCCGC ++ +B=@<@@B?:A@@=>@?68@=?@5?7;:6<<;>5< +@1831_575_1724/1 +TCGTAAGTGTTAAGGAGCTGTGTACAAAACAACA ++ +<B.+@),2*.%)))4%2@;7#%(%+$8))85%&5 +@1831_575_1829/1 +CATTTGCTGACCCTGCGTAGTTTAGTCTCACAGC ++ +2(*'%.3$+7)@&%$'3*+*#/#/*+0.=&#)+0 +@1831_575_1898/1 +CTTACCATATCATCTCAACCCATAACAGCACTTA ++ +B>@@&1/))'40)%#8/.%#8$((#;4'$'63,, +@1831_575_1964/1 +GACAGACCATGAGGCTGAAGACTACTAAGTGCGT ++ +>39)@2<2/@+9?2=&)>>@*62=5&2<42.'?+ +@1831_576_32/1 +TACGCAACGATTTATGGCCTTATAATTGAGGCCA ++ +<>?>?=7<2)522;><<@40@>704<>5=23@+& +@1831_576_74/1 +ACATTCTGCAGTGGGACAGAGCGGTACGCCGCAA ++ +=@@?@>(??<B5?@@@9<@><+><;@';>6961? +@1831_576_86/1 +ATGAAAACGCATTAGGACAACCATAATGGCCTCA ++ +811)2:*.++5</:3+43924*))/:,6&29)2/ +@1831_576_89/1 +GCTGTTTGATTTGAGAAGAGGAATTAAGCGCCGA ++ +)69+,'.4=-,>/>(*$#)3030*'(,%)2##$, +@1831_576_266/1 +ATGGGGTCACTCGACCTAATCCCGCGGCTTTGGT ++ +@@?=;<?7=@>9,>@1$&&89$/:>7'3178%&6 +@1831_576_327/1 +GCCGTTCTACTCTAGCTGCAACTTGCGATTGCTA ++ +@?@6@@;<@?><@>==3@:==<3@@>53<9><6= +@1831_576_331/1 +GACGCTTTACTCCGGTAGTACCGTGCCGTTTATA ++ +-2)+(*.*1/;5%.-9&#/1'+($*$##()%/$. +@1831_576_387/1 +ACACGCCATGATCCGATAAGAAGGGAACGTAAGG ++ +8).$5#1#*%.$##.*#$%##-%,+,1#&%.%)) +@1831_576_406/1 +AGGTCTTACAGCACGGGGCTGAGCGCATCTGACC ++ +4<>%%14:*4656)&<251&2+3#&19,6&4>5( +@1831_576_449/1 +CTCGAACCGCGGGGTCCAAAGACTGCTGCAAGGA ++ ++'&'.,,$/+.)$$8&%#+?&,#)-&###7,+#* +@1831_576_519/1 +TACCTGCCTACTACTTGCTCTCGAGCTATGCCTC ++ +=46<97@>2/6?;2<4A881>9121+<1/4.9+7 +@1831_576_603/1 +CAATATGTCTTAGTCGTGACTCGGCAACTTATCC ++ +@46=@C.??<A79@@;-<@@>29B?>55<B7598 +@1831_576_655/1 +GAACAGTCTATAGTGGCGGGAATCTCGTCGTCAG ++ +@AA9@@<6*>@@5/<@>9'=;>7+@?9>/9;+,% +@1831_576_677/1 +TTTACTCAGTTGATACATCACTGTAGCACATAGG ++ +290&/*0#&'&,.2'#&*$&('#-%($*#%$)#% +@1831_576_718/1 +CGTGCCTTTCAGGGTCTTTTCTGGTCTGGTCGCT ++ +4###$0###%(#########,####%####$### +@1831_576_722/1 +CGTATGATGGCGAGTCTTTATAATCCAATCTGAA ++ +*,-,##.)*&(*1%*(%(-2#+)-#.&-#%%$') +@1831_576_754/1 +AGGCGTCCTGCATCGACCGTTCTATCCGCTTAGA ++ +4//#(.$)'',>(&#1$<,##%((,#5?#0*%1* +@1831_576_815/1 +TAGGCCTGATATGACACGATCACAGTGCAACATC ++ +3>@?9>@?B=>=;>A???=>:25=4.25?6<57. +@1831_576_882/1 +TGTAAGACGGTGAGGTGTAAGGATCAGACCACGG ++ +26?8?@:4>@>96??<<=5'1<>9846=<9<1>8 +@1831_576_898/1 +AGTACTGTCGCGCATTGGGGTCCTGGTCGTTGCT ++ +@@C2?C>?<>@886B?;?.??87=B<8<15??=. +@1831_576_923/1 +CTGGACATGAGAGACTGCACGCGGTACACGTCGG ++ +6.51=;.699<96>;;49<;;11;<@59:9=647 +@1831_576_930/1 +CTGGCATGTACGTCCATGTCAGACGAGCAGAACT ++ +#*0.2&.:((#'14'##-)#%$$2%#$/1&#%/# +@1831_576_1019/1 +GATGCGCGCTGTCATGGCATCGAACCATCGGTCG ++ +<$>$,1,&++&@,.)'+/+#9'69/6'2(+-'9- +@1831_576_1068/1 +AAGAGTGACTCACTTACCGGGATGCGATGGAGCC ++ +>><=4?;@7=??9?;9>5@9?:8@:=5';7;'#4 +@1831_576_1131/1 +AGTTCGGGAAGGGCTGGAATCTACCCAGTAGGCA ++ +04@#@/@,4>9?2+?1571@',>=;(759;*92< +@1831_576_1168/1 +CACTTAACTCCGCTGTCGGAAGCCTTACAAGACA ++ +@CC6@@2?9=>7?;76<;467@;9,0%26'',4$ +@1831_576_1207/1 +CAACCTGACTAAACGGGGATACGCTGGCGCTACA ++ +$>2,(&?4?(,@:<&,@>?$&:8A%%=0.%,597 +@1831_576_1289/1 +TAGCGCAAGTCCAGAATGTTCATAGACTCGCGAT ++ +9<>1B@@;7@@663==28,5':8<<,.=2>>.50 +@1831_576_1329/1 +CCAATAGCAGAGACCTAATAGGAAACGAAAGCAA ++ +>&0,870/A@@/5.;=;:'&@3'&$$%,+#($&2 +@1831_576_1367/1 +GGTCTCATCCGTTCCAATCGGGACTTTGACCAGT ++ +?@@<>@@=@<@<=@>@??9:?<=>=<8;59@787 +@1831_576_1416/1 +TAGCGTTCAACGTCGATCTCATCTTGCCGATGGC ++ +';?..1.<@'.=+6.5?7<0-?7;(%=>56.98@ +@1831_576_1461/1 +GAGGGGCGGCCCGGTTCAAGCAGGTAAGCAACAA ++ +1&74#(#(&##$#,'###%#%%#*#&%%##%%%' +@1831_576_1605/1 +AGTGCAACATCTGCTTTGCTTATCAGCACACGGC ++ +<@C@@>1;@:;<<@@9@???9<3?5-21=4877, +@1831_576_1664/1 +CGCGCACAACTCGCCATGATACGACAAGACCCGA ++ +@?>?@=A:@@>@='=<>=).>=9*8)(7#/++;) +@1831_576_1671/1 +GTCTTTGTAAGCCTGGCCTGGTCAGGTCTGGTCT ++ +@?@5>@@8&8?25#&)&5&&)15&&,&4%&,&6% +@1831_576_1729/1 +CGTTTCGTCTACAACGTGACACTAGCACAGTATA ++ +?@?<?<@>A?/==?>?7>?@8<?@>99;><+0=> +@1831_576_1880/1 +TATGCGCTGTTGAGCTTACAACTCACTAGCGAAT ++ +515/792,:,7/%/05,%$):+#8%2(1754))3 +@1831_576_1982/1 +AATGTCGTCAGACGACTTTGGCGCGAAAACCATA ++ +@@?@,A><@9@=?@9B=8<6@@6@2<A?>.7<+@ +@1831_576_1987/1 +AAGGTCTTCTGTCGGCGCTGGACTGAACACCTGA ++ +##()(#&##)%)/-#%$11#%3>'##&$,#$$'+ +@1831_576_2014/1 +CCGTGACACACAATGCCGGCCCCAGCCTAGCAAT ++ +@@9,B29-5>'?,+?79+/A';'2@'5&/9,6&1 +@1831_576_2028/1 +ACTCGCCGCATCCCCGAGTGACGCTCGAGACCAA ++ +<>9>5'2(&707.8#&&39,0%7/#(#,*%&5*+ +@1831_577_40/1 +CCCCGCGTTACGAACGAGAGAAATCTCTTATAAT ++ +2/4('.')(<*?#$)%&<,/39<(.2,+<=@611 +@1831_577_119/1 +TCCCACAAGCCATTGACATGCTCGCTCTAAACAG ++ +>?C11)-1/)#;#/,850*+.+$$5550+%-.40 +@1831_577_133/1 +TGCTTGTACGGTCTAACGGGGTATGGGTTTCTGG ++ +4@>>?=1?:+>@07@@><>@*<+1@15)96'2$) +@1831_577_255/1 +ATTGAGGCCAAGATAATTGAGGAGAGAGAAGGTG ++ +<=87@>69%**#&#-+$.#&&#+$-+%&%.,%5# +@1831_577_281/1 +TATGTACGTCGCGTACACTCCGGGGCCCGCAAAA ++ +-:B;8@=;>7@>4?=?+659?;5<7?;9@8(>:? +@1831_577_288/1 +CATCCGAGGCTATCAAGGCGTAAGCACTGACCTA ++ +;/79??&=B::298*6.7/+4&21,7,6?.7#'6 +@1831_577_322/1 +GAATGCTGGAGTACATTATGACAAACTATCGGAG ++ +=;>4506;255464-<#7+194&2<?65968)7/ +@1831_577_362/1 +CGATTAGTTACCACTCGTATTCGCACGCCCAGGA ++ +2B?:@?@<?958=,3:,90:&'-99,6<5.($+6 +@1831_577_382/1 +GTCGCGTATTCCCCGATGCTATGTAGACTTGCAA ++ +2957/:1))=76(*24;,3+:<.&.&-=1=2/5* +@1831_577_464/1 +TAGAGGCACCCTAACTCAGGGCTTTCTCGATTAG ++ +=<7/<826)>#.'&4204+5#/041.7*91&756 +@1831_577_488/1 +TGAATAGTTATGGCCAGAATGTCTGCACCGATAC ++ +48.,*>6566<?8=<=<2>6;94>;=9>@8924@ +@1831_577_511/1 +GGTGCTTATCAGTTCTTTCTCGGGACTTGTATTT ++ +7/+&$:<7%6,$$%'%/+)#$7((&*3>16'0/+ +@1831_577_545/1 +ACCGCTCTTTGGGTATGGGGCAATCTGGCATGTT ++ +><<9?<>?A<481@<@8==@76/61<95.5988- +@1831_577_559/1 +GTGCCACTATGTTCGACAGACCCTAAGGCGGAAG ++ +<@;??@>@?/2<.@1=>12=61/;=?.&2+92)' +@1831_577_562/1 +GTTCCACTACGTTCCACGCAAAGGAATCCGAATC ++ +((&*&0%)1%)#($2-,***%/-,,))&,-.1'* +@1831_577_637/1 +GCCTTCGCGGGAGCATATCAGTCGATACATCCCA ++ +-,4#>:-6+:8,&(5;3=0>7=68&1/9&'?;4, +@1831_577_641/1 +TATCTACCACCGCGGTGGCGCGAGAATGCTCCCT ++ +47;/':A;;5?:72,(=),#*?+.#&7$8#%7/' +@1831_577_692/1 +CCGGTGAGAATTACATCGCGAGTACGCCCAAGGA ++ +B,@?@B(@A?@+@@>@+?=>@'=<@<=<9=?75< diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_out2.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_out2.tabular Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,192 @@ +@1378_11_329/2 +GTTCGTGGCCGGTGGGTGTTTGGG ++ +###$$#$#$&#####$'$#$###$ +@1378_17_1788/2 +TGGGTGGATGTGTTGTCGTTCATG ++ +#$#$###$#$#######$#$#### +@1378_25_2035/2 +GTGCGTCGGGGAGGGTGCTGTCGG ++ +######%#$%#$$###($###&&% +@1378_28_770/2 +GGTTGGGAGTTGGCGCGCGTGGTT ++ +###$##%%$####%#%$#%%#($$ +@1378_33_1945/2 +GGGGGGGGGGGGGGGGGGGGGGGG ++ +.6;?;55697>8779457986264 +@1378_34_789/2 +GGGCTTGCGTTAGTGAGAGGTTGT ++ +###%$%$%%###$####$###$#& +@1378_35_263/2 +GGCGGGGGGGGGGGGGGGGGGGGG ++ +$%%&,)3/)%$-6'$&5&#$''5. +@1378_43_186/2 +GCTAGGGTTTGGGTTTGCGGTGGG ++ +$%#$########%##%#$###'#' +@1378_51_1671/2 +GGTGTTGTTCGGATGTAGCGTGGG ++ +##%$$####$########$##0## +@1378_56_324/2 +GCTGGGTGATCTAAGGAATGTAAT ++ +#$#####$$$#$$$$##%###*(# +@1378_56_773/2 +TCTGGTCGGTTTCGGGGAGTGGAA ++ +##%%#&$###$#$##%$####%%$ +@1378_62_2027/2 +GTTGGCCTGGCCTGCCGTGCTGCG ++ +*##),/%##$)#%##1$#'%.#&# +@1378_62_2029/2 +GGCGGTGTGTGGTGCGGCTGTGCG ++ +/$$$=(####%####)$$%$-&%# +@1378_67_1795/2 +CGTGCCAACGACCGTCCTACGGAG ++ +@@.?7@@@.@:@A<<>>=>70<@7 +@1378_68_466/2 +GTGTCATCTGAGGTAAAGCATTGT ++ +/##$09#$#.=$#$76+$%1'### +@1378_68_1692/2 +TGTTCGATTTAGGTCTTGCCTCGC ++ +###%%$%%##%$#$##$###$$#$ +@1378_80_664/2 +TGTCTGCGTTGTATCTCTGGTGTA ++ +%##%,%$$#&$$###$#$%##'%# +@1378_85_1786/2 +CCCTAGGAGCGTATACCGGACGAG ++ +,'&/%/@,&1,&'/)&,6&&1)(( +@1378_86_1011/2 +AGGCGATGGGATATTATTTTACTT ++ +:$###)%##$9$###1$$#$2### +@1378_86_1789/2 +GGCCAGGTACTAATAAATTCAACA ++ +1.51/&%#'$,*?%#6&0$$5,20 +@1378_91_1596/2 +GCTTTTTCATTCGGTGCCTTTGGA ++ +'>%/3%=()8'#.%?50$&5>%)% +@1378_94_1595/2 +GCGGGTTAACCCAGTACCTCTGGC ++ +,8@6'>8<76>@@(->9)7'*941 +@1378_95_1039/2 +GTTCTGTGCCAGGTGAGGTACGGA ++ +&##,./#$&)6##+,'#$$0(##$ +@1378_95_1767/2 +CTAATTGACCGGGCAAGCTATTAA ++ +',,2'(10/>:=/7).3&%6&)&6 +@1378_96_1037/2 +CTGCTGGGCCATTTGACTTACTCA ++ +'$#+#(##-%5##+*&###-.$$$ +@1378_96_1764/2 +TCTTTGTAACCCACTTAGTATTTC ++ +4='28>.@4881B807:822>%)1 +@1378_98_1574/2 +AGGCGAGTGTGGGGGTTGTTTGAG ++ ++%%$#)##%##$####%###$%$# +@1378_107_1647/2 +GGTCTGGTTCTATGTTGGTCGACT ++ +###'$$#$$$(#%###(#$##$%# +@1378_111_829/2 +GGTCTTCTATGGTGCTAAATTAGT ++ +$##'&###$##)#%($#$%#$'%# +@1378_111_1900/2 +GCACGCCTTTGGGCTAAGCCGTAA ++ +)$)'#%$########$'#&%$#(# +@1378_112_1483/2 +TGGAGTGGTGTGTTTGCTGAGCCA ++ +#$#)#############$#%#%'% +@1378_125_1287/2 +TGACGTGGGTTGTCCCGTGAGATT ++ +##$%%#$###$##$$#&%##$(%% +@1378_126_468/2 +AAAAAACGGGCCGGGCGGACTAGG ++ +@@B@@@>@2>1+?:92)>@8&&<+ +@1378_127_664/2 +TCGCTTTGCCTATGTTTGTTCGGA ++ +#%$%#&##$%#%%###$$###)-' +@1378_129_463/2 +AAAAAAAAAAAAAAAAAAAAAAAA ++ +,)&20%8'(&35-***1-2&+510 +@1378_129_875/2 +GACCTTTACGTATTGGGGGTTGGC ++ +###)###+###$##$#&%##$,#$ +@1378_140_1251/2 +TTTCCTTCGTGTGCGTGCGGAGTG ++ +#%#%$##$$$######.$$$%#%( +@1378_141_809/2 +TCTCGTGGTTTCTTTTTTATGTGT ++ +##%)##$$#####%$#$#%%#'## +@1378_144_983/2 +GTTCGTTCGTGGTGTACGAGGGTG ++ +#(#%#####($#%##$$#%##%#) +@1378_153_270/2 +GGCCGTGTGCGGGTGTAGATTGGA ++ +%$##($######&##$&$$$$%## +@1378_155_1689/2 +CGCGTTCGGACAAAGCTAGCACCT ++ +@4@@=6=@@<4:@@681@@@.24. +@1378_157_1580/2 +GGGATTGAAGGGATGTATGCTAGG ++ +#%$&%#$$'%$%#$##*#%$$$$# +@1378_161_317/2 +AATCCATACCCACAAAAGCAGGCC ++ +.&%','(@''?7//+&)+2.+)0) +@1378_177_735/2 +CGAGCCCTAAACCATGAGATCGGA ++ +@@B>@AC9@A<B8@=9>7@5)>,0 +@1378_181_1684/2 +TTTCTGTTGTGGTTTTGTTGGGGT ++ +$##'$%'##%##$%$#$$####$* +@1378_187_1407/2 +TTGGGTGAAATCTTGTCGAGTGGA ++ +####&##$$###$#####%##%%) +@1378_203_721/2 +CCTTTACGATCATAAACCATGACC ++ +9<&./1&@;12')?<1',?/)&/. +@1378_206_2039/2 +CCCCCCCCCCCCCCCCCCCCCCCC ++ +?=>>?=:;<>>4::<=56199(05 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_out3.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_out3.tabular Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,192 @@ +@1378_11_329/1 +AGACCGGGCGGGGTGGCGTTCGGT ++ +%##+'#######%###$#$##$(# +@1378_17_1788/1 +TGCCGTGTCTTGCTAACGCCGATT ++ +#'#$$#$###%%##$$$$###### +@1378_25_2035/1 +CTGCGTGTTGGTGTCTACTGGGGT ++ +#%#'##$#$##&%#%$$$%#%#'# +@1378_28_770/1 +CTGCTATGCCGGCCGCCTGCCCCT ++ +%##(#$$#%$#$%###$%%$##$# +@1378_33_1945/1 +GGGGGGGGGGGGGGGGGGGGGGGG ++ ++9;64287788752796/576352 +@1378_34_789/1 +ATGGTGGCTGACGCGTTTGACTGT ++ +#$##%#$##$&$#%##$##$###$ +@1378_35_263/1 +GGGCGGGGGGCGGCGGGGGGGGGG ++ +),,#%'$)'-(%&%'%',%%&&(& +@1378_43_186/1 +ATACTAGTTGGGACGCGTTGTGCT ++ +#$(4%$########$#$###$$$# +@1378_51_1671/1 +TGGGTAGGTGCGGCTCTTGCGGTC ++ +##$#$%###%%#%#$##$$##### +@1378_56_324/1 +AGGCTTGGATTGTTGCGCTGACCT ++ +/+#**###%%##%#####$$$#$# +@1378_56_773/1 +TGTCGTGAGGTCACTTATCCCCAT ++ +&%#%##%%#####&#$%##$%##$ +@1378_62_2027/1 +CTTCCACGATCTGCTCGCTGTGGT ++ +(#&&$##$$#$%#%$$$#$###'# +@1378_62_2029/1 +TCTGGGCTGTCTTCGGGTCGGTGT ++ +$%$$####$##$$#)##%%#$### +@1378_67_1795/1 +TAGTGGGCTAGTCCGGGATCTACC ++ +B@C2@@?;-@@1>'A@@91@.@1' +@1378_68_466/1 +GTGATCGTCGGTGCCAGTCCCTGT ++ +#(%)+##$#$#%#+$%##$##### +@1378_68_1692/1 +GGTCTTCTGGGCACGGGCCAAGTT ++ +###)%'&%##$###%#######$# +@1378_80_664/1 +CTGCTTTGATCCCCGGTGGAGCAC ++ +7#%###$$6#######$##$$$## +@1378_85_1786/1 +ATACTATGTCGATCTGTAAAAAAA ++ +)&.)#3%(a)$&%-,2#&+.-%0&./ +@1378_86_1011/1 +CTACGTTATTGCTCTGTTTGTCCT ++ +######$%##$$$%###%#$#### +@1378_86_1789/1 +CGAATATCCCCTGGTTTAGAAGTA ++ +61?1;@/>@<=/(.7'(<5@=%$= +@1378_91_1596/1 +TTAGCGGTTGACTATCTGCTGACA ++ +*&+'#9'(%*'#//,&<),/)'*# +@1378_94_1595/1 +CGTGCGACAGCCCATGTTTTCAGA ++ +-=..5,3826&*+.+#+#%%6;%# +@1378_95_1039/1 +CGGCGTCCATCTTCGCCTTGAGAT ++ +$##.#$##$$#%$#$%%$###$)$ +@1378_95_1767/1 +ACACGCACCATCTGGCGGCTAACC ++ +86<65<4<C27/$5+#;-$+#2%$ +@1378_96_1037/1 +ATCCCCCAAGATGCCTGTTGATTG ++ +$#$'##$$$#%$$#%###+##$#$ +@1378_96_1764/1 +TACACCGGAACCTTGCACTAAAGC ++ +6-9'<#+81?+*<8-=69&6;*3) +@1378_98_1574/1 +GTTCTGCCGGTGTCTGTGGCGGGC ++ +$$#+&$$####%$$$###$%#%%# +@1378_107_1647/1 +AGGCCTACTACGCGTCATTGATAG ++ +&#$$#$(.#%#$$####&$%##($ +@1378_111_829/1 +TGCGGCACTTGCTTCTTCGTATTT ++ +%#%##%#$%#$#%###$$##&#$$ +@1378_111_1900/1 +TCCCCTCGCTCGGCTCTGTGCTGT ++ +$&%*$#(#)##$#'##%(##$#$% +@1378_112_1483/1 +TGTCCAGCTATGCGGCTTCCTCCT ++ +%#$+#%#&#$#####%####%$## +@1378_125_1287/1 +TGTCTCTGGGGGGCCTGGTTAGGT ++ +$##13$'%#$###$$###$$$#&# +@1378_126_468/1 +TCTCCTGATTAGACATATCTCCGT ++ +7>@318?=,=8@49579?..7,7) +@1378_127_664/1 +AGAGGTTGGTGTCTTGTCGCAGCT ++ +##'#$######$$%######$$$# +@1378_129_463/1 +CCTGTGGGCCAAGCCCAATGAAAG ++ +8),,<6(--)<()5&.&/8+;.2+ +@1378_129_875/1 +TTTCTATGGCTTACGCTGTCTGCC ++ +#$($##%####%$#$#####$### +@1378_140_1251/1 +ATCCTAGCGCGGTGTCTTGGGGAC ++ +#$%1#$$$##$##$#$#$##$%$$ +@1378_141_809/1 +TGTCCTCCAGTGTCTGTTGGGTGT ++ +%&,-##$$#(%###$#$$'###'# +@1378_144_983/1 +AGCGCCCGGTTGGTGCGGCTCGTC ++ +-$(&%*$#*#))#$$$#%%$#$## +@1378_153_270/1 +AGTCCTTGTCCCCTGGGTTTTCCC ++ ++''$#&%$%#$##&$$($#&#$$# +@1378_155_1689/1 +TTGGGAGGGAGAGAGACTAGACCG ++ +?4@@4<<??<?-@4@=4<5<?:/> +@1378_157_1580/1 +TGGGCCTCGGTGCCCTTGGTCTGT ++ +#%)$##'#$$$&#####%#$#$## +@1378_161_317/1 +TTGGCCGGCAACCCCGGTACCTAA ++ +7<,<'@)@>.)2@/')'&(?/-<( +@1378_177_735/1 +AGTACGCCATGTATTTGCGACCAG ++ +=?@?C<88@=>:7>@55/.,416, +@1378_181_1684/1 +CGACTCCCGCATTCACGGTCAAGT ++ +&*#,##$#&$*$$#$#$$$#%$## +@1378_187_1407/1 +TGGCGTCCACTCGTGGGTCTATCG ++ +$#$'%#$%$%&$%#####$#$#%# +@1378_203_721/1 +CCTAAATAACCCAGGGTAAAAGAT ++ +9<1+2+1@=259@+;2.71&@+2& +@1378_206_2039/1 +CCCCCCCCCCCCCCCCCCCCCCCC ++ +9@?8>;>>><<994;=895895-8 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_paired_F3.csfasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_paired_F3.csfasta Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,99 @@ +# Fri Jan 23 21:37:16 2009 /share/apps/corona/bin/filter_fasta.pl --output=/data/results/0176/0176_20090114_1/skmusc_cov_25/results.01/primary.20090124033450140 --name=0176_20090114_1_skmusc_cov_25_ --tag=F3 --minlength=25 --mask=1111111111111111111111111 --prefix=T /data/results/0176/0176_20090114_1/skmusc_cov_25/jobs/postPrimerSetPrimary.1708/rawseq +# Cwd: /home/pipeline +# Title: 0176_20090114_1_skmusc_cov_25_ +>1378_11_329_F3 +T0020112221222232212331223 +>1378_17_1788_F3 +T0321123231332130012112033 +>1378_25_2035_F3 +T0132123233223231301322223 +>1378_28_770_F3 +T0132130321122112113211113 +>1378_33_1945_F3 +T2222222222222222222222222 +>1378_34_789_F3 +T0032232213201212333201323 +>1378_35_263_F3 +T0222122222212212222222222 +>1378_43_186_F3 +T0030130233222012123323213 +>1378_51_1671_F3 +T0322230223212213133212231 +>1378_56_324_F3 +T0022133220332332121320113 +>1378_56_773_F3 +T2323123202231013303111103 +>1378_62_2027_F3 +T0133110120313213121323223 +>1378_62_2029_F3 +T0313222132313312223122323 +>1378_67_1795_F3 +T0302322213023112220313011 +>1378_68_466_F3 +T0232031231223211023111323 +>1378_68_1692_F3 +T0223133132221012221100233 +>1378_80_664_F3 +T2132133320311112232202101 +>1378_85_1786_F3 +T0030130323120313230000000 +>1378_86_1011_F3 +T0130123303321313233323113 +>1378_86_1789_F3 +T0120030311113223330200230 +>1378_91_1596_F3 +T3330212233201303132132010 +>1378_94_1595_F3 +T2123212010211103233331020 +>1378_95_1039_F3 +T0122123110313312113320203 +>1378_95_1767_F3 +T2010121011031322122130011 +>1378_96_1037_F3 +T0031111100203211323320332 +>1378_96_1764_F3 +T0301011220011332101300021 +>1378_98_1574_F3 +T0233132112232313232212221 +>1378_107_1647_F3 +T0022113013012123103320302 +>1378_111_829_F3 +T0321221013321331331230333 +>1378_111_1900_F3 +T0311113121312213132321323 +>1378_112_1483_F3 +T0323110213032122133113113 +>1378_125_1287_F3 +T0323131322222211322330223 +>1378_126_468_F3 +T2313113203302010303131123 +>1378_127_664_F3 +T0020223322323133231210213 +>1378_129_463_F3 +T3113232221100211100320002 +>1378_129_875_F3 +T0333130322133012132313211 +>1378_140_1251_F3 +T0031130212122323133222201 +>1378_141_809_F3 +T0323113110232313233222323 +>1378_144_983_F3 +T1021211122332232122131231 +>1378_153_270_F3 +T0023113323111132223333111 +>1378_155_1689_F3 +T0332220222020202013020112 +>1378_157_1580_F3 +T3322211312232111332231323 +>1378_161_317_F3 +T1332211221001111223011300 +>1378_177_735_F3 +T1023012110323033321201102 +>1378_181_1684_F3 +T0120131112103310122310023 +>1378_187_1407_F3 +T0322123110131232223130312 +>1378_203_721_F3 +T0113000300111022230000203 +>1378_206_2039_F3 +T1111111111111111111111111 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_paired_F3_QV.qualsolid --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_paired_F3_QV.qualsolid Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,99 @@ +# Fri Jan 23 21:37:16 2009 /share/apps/corona/bin/filter_fasta.pl --output=/data/results/0176/0176_20090114_1/skmusc_cov_25/results.01/primary.20090124033450140 --name=0176_20090114_1_skmusc_cov_25_ --tag=F3 --minlength=25 --mask=1111111111111111111111111 --prefix=T /data/results/0176/0176_20090114_1/skmusc_cov_25/jobs/postPrimerSetPrimary.1708/rawseq +# Cwd: /home/pipeline +# Title: 0176_20090114_1_skmusc_cov_25_ +>1378_11_329_F3 +7 4 2 2 10 6 2 2 2 2 2 2 2 4 2 2 2 3 2 3 2 2 3 7 2 +>1378_17_1788_F3 +6 2 6 2 3 3 2 3 2 2 2 4 4 2 2 3 3 3 3 2 2 2 2 2 2 +>1378_25_2035_F3 +9 2 4 2 6 2 2 3 2 3 2 2 5 4 2 4 3 3 3 4 2 4 2 6 2 +>1378_28_770_F3 +2 4 2 2 7 2 3 3 2 4 3 2 3 4 2 2 2 3 4 4 3 2 2 3 2 +>1378_33_1945_F3 +18 10 24 26 21 19 17 23 22 22 23 23 22 20 17 22 24 21 14 20 22 21 18 20 17 +>1378_34_789_F3 +2 2 3 2 2 4 2 3 2 2 3 5 3 2 4 2 2 3 2 2 3 2 2 2 3 +>1378_35_263_F3 +3 8 11 11 2 4 6 3 8 6 12 7 4 5 4 6 4 6 11 4 4 5 5 7 5 +>1378_43_186_F3 +2 2 3 7 19 4 3 2 2 2 2 2 2 2 2 3 2 3 2 2 2 3 3 3 2 +>1378_51_1671_F3 +2 2 2 3 2 3 4 2 2 2 4 4 2 4 2 3 2 2 3 3 2 2 2 2 2 +>1378_56_324_F3 +3 14 10 2 9 9 2 2 2 4 4 2 2 4 2 2 2 2 2 3 3 3 2 3 2 +>1378_56_773_F3 +9 5 4 2 4 2 2 4 4 2 2 2 2 2 5 2 3 4 2 2 3 4 2 2 3 +>1378_62_2027_F3 +9 7 2 5 5 3 2 2 3 3 2 3 4 2 4 3 3 3 2 3 2 2 2 6 2 +>1378_62_2029_F3 +4 3 4 3 3 2 2 2 2 3 2 2 3 3 2 8 2 2 4 4 2 3 2 2 2 +>1378_67_1795_F3 +33 33 31 34 17 31 31 30 26 12 31 31 16 29 6 32 31 31 24 16 31 13 31 16 6 +>1378_68_466_F3 +4 2 7 4 8 10 2 2 3 2 3 2 4 2 10 3 4 2 2 3 2 2 2 2 2 +>1378_68_1692_F3 +3 2 2 2 8 4 6 5 4 2 2 3 2 2 2 4 2 2 2 2 2 2 2 3 2 +>1378_80_664_F3 +8 22 2 4 2 2 2 3 3 21 2 2 2 2 2 2 2 3 2 2 3 3 3 2 2 +>1378_85_1786_F3 +6 8 5 13 8 2 18 4 31 3 5 4 12 11 17 2 5 10 13 12 4 15 5 13 14 +>1378_86_1011_F3 +2 2 2 2 2 2 2 3 4 2 2 3 3 3 4 2 2 2 4 2 3 2 2 2 2 +>1378_86_1789_F3 +31 21 16 30 16 26 31 14 29 31 27 28 14 7 13 22 6 7 27 20 31 28 4 3 28 +>1378_91_1596_F3 +4 9 5 10 6 2 24 6 7 4 9 6 2 14 14 11 5 27 8 11 14 8 6 9 2 +>1378_94_1595_F3 +8 12 28 13 13 20 11 18 23 17 21 5 9 10 13 10 2 10 2 4 4 21 26 4 2 +>1378_95_1039_F3 +2 3 2 2 13 2 3 2 2 3 3 2 4 3 2 3 4 4 3 2 2 2 3 8 3 +>1378_95_1767_F3 +12 23 21 27 21 20 27 19 27 34 17 22 14 3 20 10 2 26 12 3 10 2 17 4 3 +>1378_96_1037_F3 +2 3 2 3 6 2 2 3 3 3 2 4 3 3 2 4 2 2 2 10 2 2 3 2 3 +>1378_96_1764_F3 +29 21 12 24 6 27 2 10 23 16 30 10 9 27 23 12 28 21 24 5 21 26 9 18 8 +>1378_98_1574_F3 +2 3 3 2 10 5 3 3 2 2 2 2 4 3 3 3 2 2 2 3 4 2 4 4 2 +>1378_107_1647_F3 +2 5 2 3 3 2 3 7 13 2 4 2 3 3 2 2 2 2 5 3 4 2 2 7 3 +>1378_111_829_F3 +2 4 2 4 2 2 4 2 3 4 2 3 2 4 2 2 2 3 3 2 2 5 2 3 3 +>1378_111_1900_F3 +10 3 5 4 9 3 2 7 2 8 2 2 3 2 6 2 2 4 7 2 2 3 2 3 4 +>1378_112_1483_F3 +9 4 2 3 10 2 4 2 5 2 3 2 2 2 2 2 4 2 2 2 2 4 3 2 2 +>1378_125_1287_F3 +4 3 2 2 16 18 3 6 4 2 3 2 2 2 3 3 2 2 2 3 3 3 2 5 2 +>1378_126_468_F3 +23 22 29 31 18 16 23 30 28 11 28 23 31 19 24 20 22 24 30 13 13 22 11 22 8 +>1378_127_664_F3 +9 2 2 6 2 3 2 2 2 2 2 2 3 3 4 2 2 2 2 2 2 3 3 3 2 +>1378_129_463_F3 +4 23 8 11 11 27 21 7 12 12 8 27 7 8 20 5 13 5 14 23 10 26 13 17 10 +>1378_129_875_F3 +2 2 3 7 3 2 2 4 2 2 2 2 4 3 2 3 2 2 2 2 2 3 2 2 2 +>1378_140_1251_F3 +12 2 3 4 16 2 3 3 3 2 2 3 2 2 3 2 3 2 3 2 2 3 4 3 3 +>1378_141_809_F3 +7 4 5 11 12 2 2 3 3 2 7 4 2 2 2 3 2 3 3 6 2 2 2 6 2 +>1378_144_983_F3 +11 12 3 7 5 4 9 3 2 9 2 8 8 2 3 3 3 2 4 4 3 2 3 2 2 +>1378_153_270_F3 +8 10 6 6 3 2 5 4 3 4 2 3 2 2 5 3 3 7 3 2 5 2 3 3 2 +>1378_155_1689_F3 +31 30 19 31 31 19 27 27 30 30 27 30 12 31 19 31 28 19 27 20 27 30 25 14 29 +>1378_157_1580_F3 +3 2 4 8 3 2 2 6 2 3 3 3 5 2 2 2 2 2 4 2 3 2 3 2 2 +>1378_161_317_F3 +8 22 27 11 27 6 31 8 31 29 13 8 17 31 14 6 8 6 5 7 30 14 12 27 7 +>1378_177_735_F3 +31 28 30 31 30 34 27 23 23 31 28 29 25 22 29 31 20 20 14 13 11 19 16 21 11 +>1378_181_1684_F3 +13 5 9 2 11 2 2 3 2 5 3 9 3 3 2 3 2 3 3 3 2 4 3 2 2 +>1378_187_1407_F3 +2 3 2 3 6 4 2 3 4 3 4 5 3 4 2 2 2 2 2 3 2 3 2 4 2 +>1378_203_721_F3 +33 24 27 16 10 17 10 16 31 28 17 20 24 31 10 26 17 13 22 16 5 31 10 17 5 +>1378_206_2039_F3 +26 24 31 30 23 29 26 29 29 29 27 27 24 24 19 26 28 23 24 20 23 24 20 12 23 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_paired_R3.csfasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_paired_R3.csfasta Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,99 @@ +# Mon Jan 19 06:35:55 2009 /share/apps/corona/bin/filter_fasta.pl --output=/data/results/0176/0176_20090114_1/skmusc_cov_25/results.01/primary.20090119120505312 --name=0176_20090114_1_skmusc_cov_25_ --tag=R3 --minlength=25 --mask=1111111111111111111111111 --prefix=G /data/results/0176/0176_20090114_1/skmusc_cov_25/jobs/postPrimerSetPrimary.1512/rawseq +# Cwd: /home/pipeline +# Title: 0176_20090114_1_skmusc_cov_25_ +>1378_11_329_R3 +G2233123221122322232333222 +>1378_17_1788_R3 +G3322232203232332312331032 +>1378_25_2035_R3 +G2232123122220222321323122 +>1378_28_770_R3 +G2223322202332212121232233 +>1378_33_1945_R3 +G2222222222222222222222222 +>1378_34_789_R3 +G3222133212330232020223323 +>1378_35_263_R3 +G2221222222222222222222222 +>1378_43_186_R3 +G3213022233322233321223222 +>1378_51_1671_R3 +G2223233233122032302123222 +>1378_56_324_R3 +G3213222320313002200323003 +>1378_56_773_R3 +G1313223122333122220232200 +>1378_62_2027_R3 +G2233221132211321123213212 +>1378_62_2029_R3 +G2221223232322321221323212 +>1378_67_1795_R3 +G1123211001201123113012202 +>1378_68_466_R3 +G1232310313202230002103323 +>1378_68_1692_R3 +G3323312033302231332113121 +>1378_80_664_R3 +G2323132123323031313223230 +>1378_85_1786_R3 +G3111302202123030112201202 +>1378_86_1011_R3 +G1022120322203033033330133 +>1378_86_1789_R3 +G1221102230130030003310010 +>1378_91_1596_R3 +G2213333310331223211333220 +>1378_94_1595_R3 +G3212223300111023011313221 +>1378_95_1039_R3 +G3233132321102232022301220 +>1378_95_1767_R3 +G2130033201122210021303300 +>1378_96_1037_R3 +G0132132221103332013301310 +>1378_96_1764_R3 +G3313332300111013302303331 +>1378_98_1574_R3 +G2022120232322222332333202 +>1378_107_1647_R3 +G3223132233130323322312013 +>1378_111_829_R3 +G2223133130322321300033023 +>1378_111_1900_R3 +G2210121133322213002112300 +>1378_112_1483_R3 +G3322023223232333213202110 +>1378_125_1287_R3 +G3320123222332311123202033 +>1378_126_468_R3 +G1000000122211222122013022 +>1378_127_664_R3 +G3312133321130323332331220 +>1378_129_463_R3 +G0000000000000000000000000 +>1378_129_875_R3 +G3201133301230332222233221 +>1378_140_1251_R3 +G3333113312323212321220232 +>1378_141_809_R3 +G3313123223331333333032323 +>1378_144_983_R3 +G2233123312322323012022232 +>1378_153_270_R3 +G2221123232122232302033220 +>1378_155_1689_R3 +G1121233122010002130210113 +>1378_157_1580_R3 +G3222033200222032303213022 +>1378_161_317_R3 +G2003110301110100002102211 +>1378_177_735_R3 +G2120211130001103202031220 +>1378_181_1684_R3 +G3333132332322333323322223 +>1378_187_1407_R3 +G3332223200031332312023220 +>1378_203_721_R3 +G1113330120310300011032011 +>1378_206_2039_R3 +G1111111111111111111111111 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_paired_R3_QV.qualsolid --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_paired_R3_QV.qualsolid Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,99 @@ +# Mon Jan 19 06:35:55 2009 /share/apps/corona/bin/filter_fasta.pl --output=/data/results/0176/0176_20090114_1/skmusc_cov_25/results.01/primary.20090119120505312 --name=0176_20090114_1_skmusc_cov_25_ --tag=R3 --minlength=25 --mask=1111111111111111111111111 --prefix=G /data/results/0176/0176_20090114_1/skmusc_cov_25/jobs/postPrimerSetPrimary.1512/rawseq +# Cwd: /home/pipeline +# Title: 0176_20090114_1_skmusc_cov_25_ +>1378_11_329_R3 +2 2 2 2 3 3 2 3 2 3 5 2 2 2 2 2 3 6 3 2 3 2 2 2 3 +>1378_17_1788_R3 +2 2 3 2 3 2 2 2 3 2 3 2 2 2 2 2 2 2 3 2 3 2 2 2 2 +>1378_25_2035_R3 +2 2 2 2 2 2 2 4 2 3 4 2 3 3 2 2 2 7 3 2 2 2 5 5 4 +>1378_28_770_R3 +2 2 2 2 3 2 2 4 4 3 2 2 2 2 4 2 4 3 2 4 4 2 7 3 3 +>1378_33_1945_R3 +26 13 21 26 30 26 20 20 21 24 22 29 23 22 22 24 19 20 22 24 23 21 17 21 19 +>1378_34_789_R3 +3 2 2 2 4 3 4 3 4 4 2 2 2 3 2 2 2 2 3 2 2 2 3 2 5 +>1378_35_263_R3 +7 3 4 4 5 11 8 18 14 8 4 3 12 21 6 3 5 20 5 2 3 6 6 20 13 +>1378_43_186_R3 +2 3 4 2 3 2 2 2 2 2 2 2 2 4 2 2 4 2 3 2 2 2 6 2 6 +>1378_51_1671_R3 +2 2 2 4 3 3 2 2 2 2 3 2 2 2 2 2 2 2 2 3 2 2 15 2 2 +>1378_56_324_R3 +2 2 3 2 2 2 2 2 3 3 3 2 3 3 3 3 2 2 4 2 2 2 9 7 2 +>1378_56_773_R3 +4 2 2 4 4 2 5 3 2 2 2 3 2 3 2 2 4 3 2 2 2 2 4 4 3 +>1378_62_2027_R3 +10 9 2 2 8 11 14 4 2 2 3 8 2 4 2 2 16 3 2 6 4 13 2 5 2 +>1378_62_2029_R3 +8 14 3 3 3 28 7 2 2 2 2 4 2 2 2 2 8 3 3 4 3 12 5 4 2 +>1378_67_1795_R3 +33 31 31 13 30 22 31 31 31 13 31 25 31 32 27 27 29 29 28 29 22 15 27 31 22 +>1378_68_466_R3 +12 14 2 2 3 15 24 2 3 2 13 28 3 2 3 22 21 10 3 4 16 6 2 2 2 +>1378_68_1692_R3 +4 2 2 2 4 4 3 4 4 2 2 4 3 2 3 2 2 3 2 2 2 3 3 2 3 +>1378_80_664_R3 +4 4 2 2 4 11 4 3 3 2 5 3 3 2 2 2 3 2 3 4 2 2 6 4 2 +>1378_85_1786_R3 +5 11 6 5 14 4 14 31 11 5 16 11 5 6 14 8 5 11 21 5 5 16 8 7 7 +>1378_86_1011_R3 +11 25 3 2 2 2 8 4 2 2 3 24 3 2 2 2 16 3 3 2 3 17 2 2 2 +>1378_86_1789_R3 +19 16 13 20 16 14 5 4 2 6 3 11 9 30 4 2 21 5 15 3 3 20 11 17 15 +>1378_91_1596_R3 +11 6 29 4 14 18 4 28 7 8 23 6 2 13 4 30 20 15 3 5 20 29 4 8 4 +>1378_94_1595_R3 +18 11 23 31 21 6 29 23 27 22 21 29 31 31 7 12 29 24 8 22 6 9 24 19 16 +>1378_95_1039_R3 +6 5 2 2 11 13 14 2 3 5 8 21 2 2 10 11 6 2 3 3 15 7 2 2 3 +>1378_95_1767_R3 +8 6 11 11 17 6 7 16 15 14 29 25 28 14 22 8 13 18 5 4 21 5 8 5 21 +>1378_96_1037_R3 +13 6 3 2 10 2 7 2 2 12 4 20 2 2 10 9 5 2 2 2 12 13 3 3 3 +>1378_96_1764_R3 +13 19 28 6 17 23 29 13 31 19 23 23 16 33 23 15 22 25 23 17 17 29 4 8 16 +>1378_98_1574_R3 +3 10 4 4 3 2 8 2 2 4 2 2 3 2 2 2 2 4 2 2 2 3 4 3 2 +>1378_107_1647_R3 +3 2 2 2 6 3 3 2 3 3 3 7 2 4 2 2 2 7 2 3 2 2 3 4 2 +>1378_111_829_R3 +3 3 2 2 6 5 2 2 2 3 2 2 8 2 4 7 3 2 3 4 2 3 6 4 2 +>1378_111_1900_R3 +6 8 3 8 6 2 4 3 2 2 2 2 2 2 2 2 3 6 2 5 4 3 2 7 2 +>1378_112_1483_R3 +2 2 3 2 8 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 4 2 4 6 4 +>1378_125_1287_R3 +2 2 2 3 4 4 2 3 2 2 2 3 2 2 3 3 2 5 4 2 2 3 7 4 4 +>1378_126_468_R3 +30 31 31 33 31 31 31 29 31 17 29 16 10 30 25 24 17 8 29 31 23 5 5 27 10 +>1378_127_664_R3 +2 2 4 3 4 2 5 2 2 3 4 2 4 4 2 2 2 3 3 2 2 2 8 12 6 +>1378_129_463_R3 +13 11 8 5 17 15 4 23 6 7 5 18 20 12 9 9 9 16 12 17 5 10 20 16 15 +>1378_129_875_R3 +4 2 2 2 8 2 2 2 10 2 2 2 3 2 2 3 2 5 4 2 2 3 11 2 3 +>1378_140_1251_R3 +2 2 4 2 4 3 2 2 3 3 3 2 2 2 2 2 2 13 3 3 3 4 2 4 7 +>1378_141_809_R3 +2 2 2 4 8 2 2 3 3 2 2 2 2 2 4 3 2 3 2 4 4 2 6 2 2 +>1378_144_983_R3 +4 2 7 2 4 2 2 2 2 2 7 3 2 4 2 2 3 3 2 4 2 2 4 2 8 +>1378_153_270_R3 +4 4 3 2 2 7 3 2 2 2 2 2 2 5 2 2 3 5 3 3 3 3 4 2 2 +>1378_155_1689_R3 +31 31 19 31 31 28 21 28 31 31 27 19 25 31 31 21 23 16 31 31 31 13 17 19 13 +>1378_157_1580_R3 +2 2 4 3 5 4 2 3 3 6 4 3 4 2 3 2 2 9 2 4 3 3 3 3 2 +>1378_161_317_R3 +8 13 5 4 6 11 6 7 31 6 6 30 22 14 14 10 5 8 10 17 13 10 8 15 8 +>1378_177_735_R3 +31 31 31 33 29 31 32 34 24 31 32 27 33 23 31 28 24 29 22 31 20 8 29 11 15 +>1378_181_1684_R3 +2 3 2 2 6 3 4 6 2 2 4 2 2 3 4 3 2 3 3 2 2 2 2 3 9 +>1378_187_1407_R3 +2 2 2 2 2 5 2 2 3 3 2 2 2 3 2 2 2 2 2 4 2 2 4 4 8 +>1378_203_721_R3 +24 24 27 5 13 14 16 5 31 26 16 17 6 8 30 27 16 6 11 30 14 8 5 14 13 +>1378_206_2039_R3 +31 30 28 29 29 30 28 25 26 27 29 29 19 25 25 27 28 20 21 16 24 24 7 15 20 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_phiX.csfasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_phiX.csfasta Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,288 @@ +>1831_573_1004_F3 +T00030133312212111300011021310132222 +>1831_573_1050_F3 +T03330322230322112131010221102122113 +>1831_573_1067_F3 +T00023032023103330112220321200200002 +>1831_573_1219_F3 +T11211130300300301021212330201121310 +>1831_573_1242_F3 +T02132003121011302100130302112221121 +>1831_573_1333_F3 +T00200312330110101013212313222303112 +>1831_573_1362_F3 +T21203131001102231121211101111321131 +>1831_573_1448_F3 +T23101211223113320132212331313312022 +>1831_573_1490_F3 +T31312310323301210002210123101021011 +>1831_573_1523_F3 +T10322001220012223202202222001230222 +>1831_573_1578_F3 +T21202302100010020121100311022120111 +>1831_573_1647_F3 +T10222233301013033120132223202022123 +>1831_573_1684_F3 +T13310013212312012302121010221231123 +>1831_573_1769_F3 +T33220123030232212032021032302233131 +>1831_573_1853_F3 +T11000012111222211310103212122102331 +>1831_573_1943_F3 +T20300123032210232001222122001132111 +>1831_573_1977_F3 +T22212302221310332321002303112011311 +>1831_574_109_F3 +T13122332123301331032220222133301033 +>1831_574_148_F3 +T01200113123030012202302312200010231 +>1831_574_185_F3 +T21123333211302300321312212102123121 +>1831_574_243_F3 +T30221011230013102201033131203302330 +>1831_574_257_F3 +T00301133110002100302003000000102301 +>1831_574_293_F3 +T23213210003000103010211331300320130 +>1831_574_389_F3 +T21032213032101122333230212301312020 +>1831_574_575_F3 +T33313322100212102033032123311211302 +>1831_574_592_F3 +T33103330110123102223122023103310330 +>1831_574_617_F3 +T20021031221222021210021322200223211 +>1831_574_725_F3 +T32010020322130330333010031120313210 +>1831_574_734_F3 +T31132301200020012302210322213222222 +>1831_574_824_F3 +T30212100033032123311211302122020013 +>1831_574_959_F3 +T11212130220131221111002020123311211 +>1831_574_1062_F3 +T30112230030300221001032033012211012 +>1831_574_1092_F3 +T02013221200031031212200000111130310 +>1831_574_1103_F3 +T20313113203302010303131123021310121 +>1831_574_1116_F3 +T21011310123202303021021112021231011 +>1831_574_1194_F3 +T23303101033322220312200222013013312 +>1831_574_1204_F3 +T21330132231321322010303023221203200 +>1831_574_1306_F3 +T10332133020311023221213100301001220 +>1831_574_1387_F3 +T12301331310032132101301303230121111 +>1831_574_1431_F3 +T12011023331022213001123111301312011 +>1831_574_1560_F3 +T32212313302203320020222113111011111 +>1831_574_1591_F3 +T23202101330322130221230222201123202 +>1831_574_1624_F3 +T20122200222132200313011102302210332 +>1831_574_1826_F3 +T13012312120112021233030302313201111 +>1831_574_1903_F3 +T30232100103132133321330310210101221 +>1831_574_1961_F3 +T02333101331223303300200011100032200 +>1831_575_54_F3 +T13331330322230200102132110132013200 +>1831_575_80_F3 +T33133322233322221003332230323312313 +>1831_575_192_F3 +T30013012111133003301010212123302011 +>1831_575_197_F3 +T33312113010133020301131330001310032 +>1831_575_223_F3 +T10121010002202131221210302100121020 +>1831_575_420_F3 +T31110103220000101310112112001020212 +>1831_575_434_F3 +T30312132120223101113223301211113311 +>1831_575_444_F3 +T33022120112320220100202132332113320 +>1831_575_459_F3 +T31330310210101223330110231120131100 +>1831_575_506_F3 +T31210200111210121332321310110132301 +>1831_575_569_F3 +T10210201321323001012232322323002203 +>1831_575_622_F3 +T01100031122111023002323113231210111 +>1831_575_644_F3 +T11332003221203131231202200030110130 +>1831_575_663_F3 +T32210013303112103322311101322021210 +>1831_575_681_F3 +T23131132033020103031013233200101021 +>1831_575_711_F3 +T03032331231101231020121210002332121 +>1831_575_730_F3 +T31010102200110302123032330331011111 +>1831_575_904_F3 +T20111213300020123200333321131121211 +>1831_575_938_F3 +T13103102220022130222233301013033120 +>1831_575_970_F3 +T23201311301023133303023011202220221 +>1831_575_991_F3 +T33312212031111111012212120321121210 +>1831_575_1138_F3 +T23320002011320012120333103233301321 +>1831_575_1157_F3 +T13121323330203331222022230133102321 +>1831_575_1180_F3 +T32003310122102323303101123331133110 +>1831_575_1283_F3 +T02232200301300220130032321323131333 +>1831_575_1302_F3 +T01201303312333123130200123201013021 +>1831_575_1310_F3 +T31332131312021303211310220101211133 +>1831_575_1321_F3 +T11001010233200122122022023000203212 +>1831_575_1373_F3 +T21213011223311001221321132013121220 +>1831_575_1419_F3 +T33222200303001021230212332001013020 +>1831_575_1436_F3 +T13210313021212303321202113301220331 +>1831_575_1442_F3 +T33132010022331132101132123132020222 +>1831_575_1454_F3 +T11131130011012021120222231313211113 +>1831_575_1500_F3 +T11010000223111301132313011130103021 +>1831_575_1535_F3 +T21312012030320112110211013300131121 +>1831_575_1724_F3 +T33123002323300220213232301000010010 +>1831_575_1829_F3 +T21033321320111321230233302313101021 +>1831_575_1898_F3 +T31330110303103131001110300102101330 +>1831_575_1964_F3 +T22010201103202213200201301300232123 +>1831_576_32_F3 +T13012100120333032211330300332022110 +>1831_576_74_F3 +T30103313210232220102021223012112100 +>1831_576_86_F3 +T10320000121033022010011030032211310 +>1831_576_89_F3 +T02132333203332020020220033002121120 +>1831_576_266_F3 +T30322223101312011300311121221333223 +>1831_576_327_F3 +T22112331301313021321001332120332130 +>1831_576_331_F3 +T32012133301311223023011232112333030 +>1831_576_387_F3 +T00101211032031120300200222001230022 +>1831_576_406_F3 +T00223133010210122221320212103132011 +>1831_576_449_F3 +T31312001121222231100020132132100220 +>1831_576_519_F3 +T03011321130130133213131202130321131 +>1831_576_603_F3 +T21003032313302312320131221001330311 +>1831_576_655_F3 +T02001023130302322122200313123123102 +>1831_576_677_F3 +T13330131023320301031013230210103022 +>1831_576_718_F3 +T31232113331022231333313223132231213 +>1831_576_722_F3 +T31230320322120231333030031100313200 +>1831_576_754_F3 +T30221231132103120112331303112133020 +>1831_576_815_F3 +T23022113203032010120310102321001031 +>1831_576_882_F3 +T13230020122320223230022031020110122 +>1831_576_898_F3 +T10230132312121033222231132231233213 +>1831_576_923_F3 +T21322010320202013210121223010123122 +>1831_576_930_F3 +T21322103230123110323102012021020013 +>1831_576_1019_F3 +T22032121213231032210312001103122312 +>1831_576_1068_F3 +T00020232013101330112220321203220211 +>1831_576_1131_F3 +T10233122200222132200313011102302210 +>1831_576_1168_F3 +T31013300131121323122002113301002010 +>1831_576_1207_F3 +T21001132013000122220301213221213010 +>1831_576_1289_F3 +T03021210023110200323310302013121203 +>1831_576_1329_F3 +T01100302102020113003022000120002100 +>1831_576_1367_F3 +T12231310311233110031222013332011023 +>1831_576_1416_F3 +T33021233100123120313103133211203221 +>1831_576_1461_F3 +T32022221221112233100210223002100100 +>1831_576_1605_F3 +T30232100103132133321330310210101221 +>1831_576_1664_F3 +T31212101001312110320301201002011120 +>1831_576_1671_F3 +T22313332300211322113223102231322313 +>1831_576_1729_F3 +T11233312313010012320101302101023030 +>1831_576_1880_F3 +T13032121323320213301001310130212003 +>1831_576_1982_F3 +T00032312310201201333221212000011030 +>1831_576_1987_F3 +T30022313313231221213220132001011320 +>1831_576_2014_F3 +T31123201010100321122111102113021003 +>1831_576_2028_F3 +T20131211210311112023201213120201100 +>1831_577_40_F3 +T11111212330120012020200031313303003 +>1831_577_119_F3 +T33111010021103320103213121313000102 +>1831_577_133_F3 +T33213323012231300122223032223331322 +>1831_577_255_F3 +T00332022110020300332022020202002232 +>1831_577_281_F3 +T03032301231212301013112222111210000 +>1831_577_288_F3 +T01031120221303100221230021013201130 +>1831_577_322_F3 +T12003213220230103303201000130312202 +>1831_577_362_F3 +T31203302330110131230331210121110220 +>1831_577_382_F3 +T32312123033111120321303230201332100 +>1831_577_464_F3 +T13020221011130013102221333131203302 +>1831_577_488_F3 +T13200302330322110200323132101120301 +>1831_577_511_F3 +T32232133031023313331312220133230333 +>1831_577_545_F3 +T00112131333222303222210031322103233 +>1831_577_559_F3 +T32321101303233120102011130022122002 +>1831_577_562_F3 +T32331101301233110121000220031120031 +>1831_577_637_F3 +T22113312122202103031023120301031110 +>1831_577_641_F3 +T13031301101121223221212020032131113 +>1831_577_692_F3 +T01122320200330103121202301211100220 diff -r 54aa0543925b -r 61dd78cafa09 test-data/s2fq_phiX.qualsolid --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s2fq_phiX.qualsolid Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,288 @@ +>1831_573_1004_F3 +4 29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22 +>1831_573_1050_F3 +8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11 +>1831_573_1067_F3 +13 10 10 2 4 7 6 11 4 14 3 11 10 5 16 2 5 8 11 8 5 10 6 9 6 9 4 2 3 5 2 4 7 6 3 +>1831_573_1219_F3 +31 31 31 28 19 14 10 8 20 8 19 15 23 30 6 21 21 20 29 9 14 20 30 27 21 16 6 26 27 18 11 25 11 20 12 +>1831_573_1242_F3 +29 29 29 25 25 29 16 22 28 32 20 30 31 31 28 26 22 32 28 26 17 13 21 15 29 23 17 27 23 28 22 19 10 26 26 +>1831_573_1333_F3 +8 28 6 31 2 4 18 28 13 29 8 14 18 19 9 16 16 22 11 11 14 21 12 19 10 13 24 22 19 17 19 20 21 27 8 +>1831_573_1362_F3 +34 33 31 31 30 31 31 30 31 34 31 33 32 30 31 29 31 27 31 23 32 31 30 31 6 13 23 6 30 16 22 25 11 10 30 +>1831_573_1448_F3 +22 22 28 32 8 30 11 13 31 32 31 31 25 31 31 27 28 14 22 8 31 27 12 2 23 21 21 17 4 24 21 16 18 5 10 +>1831_573_1490_F3 +31 31 31 31 30 11 31 30 30 31 3 29 27 28 29 10 4 14 9 29 9 16 11 8 30 17 21 5 16 17 6 24 4 22 13 +>1831_573_1523_F3 +7 11 14 14 9 11 2 23 6 6 13 21 6 6 21 6 17 5 17 22 14 23 15 8 4 5 2 15 6 4 2 9 11 17 6 +>1831_573_1578_F3 +31 30 28 31 27 31 34 31 30 31 31 30 30 28 29 31 26 22 27 27 23 27 21 24 19 8 18 20 16 16 7 10 16 27 13 +>1831_573_1647_F3 +28 30 31 31 27 31 31 30 30 30 26 32 28 28 31 31 26 24 30 31 30 18 28 26 21 13 19 14 26 21 25 28 14 26 19 +>1831_573_1684_F3 +22 29 16 25 23 27 31 18 24 31 31 30 30 24 28 26 31 31 27 29 30 31 31 27 26 27 30 22 29 22 21 30 24 29 30 +>1831_573_1769_F3 +22 20 19 22 19 24 5 5 22 21 22 4 14 22 26 18 3 12 22 26 18 2 11 18 14 14 2 11 19 20 14 2 5 15 21 +>1831_573_1853_F3 +21 19 13 14 33 31 31 22 17 33 10 14 19 30 31 30 22 30 10 31 24 14 10 24 24 13 6 8 17 27 17 5 8 17 5 +>1831_573_1943_F3 +7 29 14 9 16 11 8 11 31 12 8 6 15 9 29 20 6 3 14 30 21 31 14 13 5 30 23 14 7 6 8 32 19 18 11 +>1831_573_1977_F3 +31 31 30 21 31 23 31 31 24 32 31 28 19 21 18 18 32 22 30 24 30 27 18 25 10 22 29 6 31 4 31 30 4 18 17 +>1831_574_109_F3 +15 22 21 20 16 2 19 23 16 22 29 31 21 20 27 17 25 23 19 22 16 21 28 22 23 23 27 16 24 24 20 13 22 30 21 +>1831_574_148_F3 +27 26 12 29 18 26 26 18 29 14 14 29 15 26 26 22 28 11 28 19 12 19 14 10 29 15 17 24 27 24 27 21 17 19 26 +>1831_574_185_F3 +31 27 19 26 4 4 31 22 29 2 9 29 24 22 4 21 26 10 23 3 2 27 15 22 4 16 18 22 17 3 4 27 20 19 2 +>1831_574_243_F3 +2 31 31 31 24 20 31 28 24 30 9 29 27 19 20 3 27 31 27 19 4 31 24 30 22 2 28 30 29 22 5 29 30 24 22 +>1831_574_257_F3 +4 29 29 33 29 8 31 30 29 33 31 33 30 31 16 4 9 4 11 2 10 15 15 13 6 7 10 5 20 5 4 2 3 18 5 +>1831_574_293_F3 +5 6 8 22 6 13 9 4 2 5 3 6 14 13 3 2 2 3 13 3 5 9 8 10 9 3 2 23 4 5 4 2 5 5 4 +>1831_574_389_F3 +8 8 3 29 14 29 23 8 25 17 31 25 17 16 18 26 26 13 16 8 31 18 4 21 19 4 10 8 27 22 8 10 3 24 17 +>1831_574_575_F3 +22 30 31 29 28 30 31 29 23 31 31 31 28 31 21 9 4 5 27 28 6 20 31 27 27 6 11 15 27 28 19 9 20 14 27 +>1831_574_592_F3 +22 18 12 20 8 16 24 11 11 27 31 29 19 15 21 22 27 17 13 12 23 21 19 18 19 21 26 24 27 16 14 26 17 16 17 +>1831_574_617_F3 +31 29 31 30 26 29 30 28 31 28 28 31 29 31 28 20 30 31 10 31 25 31 19 15 31 29 27 25 15 8 6 8 21 19 12 +>1831_574_725_F3 +24 6 29 30 20 17 10 20 28 26 19 3 21 26 27 23 13 16 27 19 22 9 24 10 30 22 7 10 20 26 12 8 13 8 19 +>1831_574_734_F3 +13 12 5 13 3 17 5 27 9 7 12 4 8 25 14 8 4 20 25 8 14 4 22 10 11 24 15 18 19 9 32 13 30 22 15 +>1831_574_824_F3 +26 31 31 31 26 26 8 11 10 31 27 12 27 22 26 27 5 23 24 30 30 5 17 24 30 27 3 17 25 32 27 8 26 23 30 +>1831_574_959_F3 +22 32 28 26 10 30 31 24 26 14 27 31 26 27 23 2 5 5 14 9 4 7 4 13 15 3 15 3 17 8 10 16 3 12 16 +>1831_574_1062_F3 +19 31 23 17 16 27 14 14 25 16 18 21 14 23 27 16 14 20 13 19 17 22 13 26 29 17 23 23 14 15 27 16 3 8 14 +>1831_574_1092_F3 +27 23 30 13 11 24 23 8 15 18 4 2 11 11 11 7 11 10 10 3 6 21 24 6 2 24 6 22 2 6 26 21 13 4 17 +>1831_574_1103_F3 +31 30 30 29 30 31 28 29 31 31 32 27 29 30 28 31 28 28 27 25 30 27 26 20 23 6 5 5 8 25 10 18 20 6 16 +>1831_574_1116_F3 +8 31 10 10 11 8 14 8 30 13 14 8 4 27 8 17 29 13 28 28 25 23 30 5 26 19 19 5 14 5 11 8 14 9 19 +>1831_574_1194_F3 +25 20 29 26 11 30 30 24 31 24 31 30 31 16 31 31 28 31 18 28 31 29 31 19 30 31 31 24 19 30 22 20 14 11 21 +>1831_574_1204_F3 +32 32 20 32 20 33 31 20 25 26 31 31 11 13 24 30 32 16 30 2 13 30 26 18 8 11 29 23 17 4 8 28 6 22 9 +>1831_574_1306_F3 +15 17 13 22 5 4 6 6 13 3 5 2 6 4 2 2 3 2 6 2 4 6 8 6 8 3 6 3 4 3 11 8 6 13 16 +>1831_574_1387_F3 +12 30 32 30 30 25 31 30 31 31 24 30 31 31 30 24 34 26 25 29 5 8 13 11 11 8 26 5 6 27 5 22 7 14 6 +>1831_574_1431_F3 +29 22 30 29 24 33 32 23 24 22 26 10 23 9 28 21 2 21 13 10 20 5 12 2 17 21 3 15 13 11 20 5 6 3 16 +>1831_574_1560_F3 +28 8 8 5 21 20 27 19 28 29 24 24 31 25 20 24 22 7 16 5 26 10 5 7 4 5 19 2 11 2 5 5 5 9 3 +>1831_574_1591_F3 +28 28 27 32 29 27 30 31 22 23 31 27 28 26 31 5 31 21 29 23 25 30 11 29 27 5 5 27 22 29 23 7 23 10 24 +>1831_574_1624_F3 +2 27 21 13 5 7 11 22 12 10 8 8 22 13 13 6 14 26 19 18 13 8 24 17 22 13 7 27 23 20 5 16 18 12 8 +>1831_574_1826_F3 +10 31 27 27 11 8 8 19 20 24 27 30 13 10 20 22 6 12 6 5 21 30 16 8 7 26 16 26 15 5 4 19 11 2 3 +>1831_574_1903_F3 +27 24 20 21 30 31 29 26 22 31 31 31 23 25 31 29 23 29 27 28 24 29 24 29 31 17 28 22 16 30 16 25 21 26 14 +>1831_574_1961_F3 +21 29 12 15 22 12 31 29 7 17 6 31 27 2 15 21 19 31 4 20 4 31 31 21 13 5 27 27 7 24 8 28 25 19 22 +>1831_575_54_F3 +29 28 31 31 21 23 27 17 26 27 23 26 30 31 27 29 10 24 29 22 11 11 21 24 22 17 5 20 22 25 19 5 24 27 23 +>1831_575_80_F3 +9 30 20 29 27 31 30 14 28 20 4 7 5 13 20 8 10 2 14 15 6 14 6 29 2 3 14 6 18 22 2 7 8 21 5 +>1831_575_192_F3 +15 25 23 27 11 24 7 13 28 14 8 2 4 23 3 11 19 6 27 11 25 8 18 14 13 6 13 20 27 11 29 12 26 22 6 +>1831_575_197_F3 +11 12 25 30 19 21 18 31 32 25 23 23 30 21 30 19 18 22 27 28 13 17 5 16 13 26 31 21 22 13 19 31 4 17 11 +>1831_575_223_F3 +31 30 29 30 23 30 31 25 30 26 29 10 3 6 4 5 11 10 2 3 13 12 12 2 4 3 16 6 5 2 12 22 3 5 6 +>1831_575_420_F3 +23 17 30 13 29 30 7 12 6 6 17 10 13 13 31 8 11 3 4 16 31 26 6 8 16 8 30 10 8 22 13 6 8 13 13 +>1831_575_434_F3 +27 31 31 29 27 31 33 31 29 28 31 31 30 29 29 27 31 30 26 8 31 30 26 21 13 30 28 19 11 6 6 26 14 18 8 +>1831_575_444_F3 +27 17 31 31 26 27 13 28 30 31 27 10 28 25 32 27 27 31 30 27 27 14 29 31 29 27 7 27 23 29 19 5 20 26 29 +>1831_575_459_F3 +30 31 31 34 31 30 32 31 31 32 31 30 30 32 31 31 6 21 31 31 33 6 28 26 34 31 6 19 27 28 24 11 31 16 13 +>1831_575_506_F3 +23 30 8 17 9 20 31 18 10 13 22 28 30 32 25 23 31 11 14 5 8 25 31 18 22 14 27 23 24 6 10 19 9 8 9 +>1831_575_569_F3 +14 6 24 12 11 31 17 24 10 19 22 24 4 5 29 24 2 5 15 23 28 29 22 2 24 29 11 21 24 14 10 6 9 18 8 +>1831_575_622_F3 +31 32 23 33 28 31 31 30 27 31 30 27 29 29 28 30 24 21 27 19 24 22 8 27 19 14 27 6 25 19 10 26 22 19 10 +>1831_575_644_F3 +27 27 23 29 13 29 5 11 10 8 23 13 16 15 6 25 20 7 14 12 21 17 5 9 13 28 14 4 7 13 27 5 5 16 23 +>1831_575_663_F3 +31 31 31 31 31 32 27 14 26 32 29 31 21 29 15 22 24 17 27 20 24 21 21 25 30 26 17 20 10 25 29 27 16 11 10 +>1831_575_681_F3 +13 22 17 30 13 8 17 20 26 24 21 12 16 19 6 9 13 15 18 6 2 19 2 10 10 3 8 14 23 10 4 14 7 7 5 +>1831_575_711_F3 +19 4 10 25 17 7 2 6 16 10 13 8 5 9 19 20 12 2 11 27 32 12 4 19 26 29 10 8 8 27 26 2 2 9 5 +>1831_575_730_F3 +11 4 23 27 4 12 6 8 20 11 9 16 5 28 2 8 7 16 9 16 8 12 29 22 3 13 11 19 6 19 6 5 6 9 5 +>1831_575_904_F3 +30 27 29 27 13 21 23 24 31 31 22 31 27 20 19 25 19 28 31 29 21 24 28 25 10 21 12 28 19 17 26 23 27 25 2 +>1831_575_938_F3 +26 25 31 31 25 30 31 26 28 23 26 29 28 26 26 25 28 27 24 18 27 19 13 26 27 21 25 17 27 24 26 19 8 23 22 +>1831_575_970_F3 +28 31 28 31 28 26 31 31 29 27 31 31 25 24 27 25 28 30 26 29 31 28 30 24 29 29 30 31 25 17 28 28 28 27 20 +>1831_575_991_F3 +31 29 29 26 22 30 30 30 14 19 27 25 25 25 11 2 5 9 4 6 3 12 12 20 12 2 7 22 8 5 5 11 12 8 4 +>1831_575_1138_F3 +27 28 15 26 4 16 24 18 21 10 30 24 21 30 11 30 20 27 25 17 29 31 21 31 27 25 26 19 29 13 22 26 9 25 16 +>1831_575_1157_F3 +31 33 31 33 29 30 32 30 32 31 30 24 6 30 26 30 5 23 30 31 31 21 26 27 31 28 10 27 25 24 24 10 24 21 20 +>1831_575_1180_F3 +14 27 33 29 20 30 6 25 14 22 23 30 26 16 26 20 20 25 24 24 22 31 31 29 24 19 28 22 27 16 23 21 12 29 22 +>1831_575_1283_F3 +4 34 31 32 20 19 29 27 30 32 22 23 31 27 30 17 29 25 2 29 28 30 31 17 29 23 15 25 6 30 21 24 13 6 22 +>1831_575_1302_F3 +5 16 17 29 14 2 17 6 5 12 17 5 4 6 22 10 3 4 9 2 3 14 16 7 5 5 16 17 14 3 11 17 11 11 9 +>1831_575_1310_F3 +21 27 27 29 21 21 18 30 24 24 31 7 31 22 28 16 16 31 25 31 31 14 22 30 30 27 31 27 26 29 6 18 12 22 26 +>1831_575_1321_F3 +15 26 33 31 30 31 29 28 32 31 27 32 30 29 31 29 30 21 29 31 20 29 6 19 31 24 30 8 22 31 22 30 14 23 24 +>1831_575_1373_F3 +32 31 31 31 29 31 26 28 24 27 31 30 30 22 31 29 31 25 31 26 31 26 16 22 30 21 18 15 14 22 28 19 11 17 27 +>1831_575_1419_F3 +29 14 14 18 12 29 5 12 13 12 29 4 16 16 14 31 5 14 5 22 25 27 11 12 16 28 11 10 17 27 21 6 4 5 27 +>1831_575_1436_F3 +9 17 31 28 26 18 24 9 18 27 9 19 27 25 29 20 17 29 29 24 6 22 25 27 28 6 15 28 29 16 6 16 18 21 27 +>1831_575_1442_F3 +23 29 20 23 27 30 22 29 10 16 33 21 12 14 24 27 27 25 20 30 29 32 25 16 31 30 20 18 24 13 31 19 14 16 29 +>1831_575_1454_F3 +17 19 28 30 23 28 21 20 23 24 28 15 25 32 28 25 30 29 21 27 26 31 14 11 19 10 12 21 10 14 6 13 11 7 11 +>1831_575_1500_F3 +17 30 31 31 30 32 31 30 23 27 21 27 25 24 23 20 28 24 24 24 24 24 28 28 33 18 27 20 27 27 11 22 30 29 24 +>1831_575_1535_F3 +31 33 28 31 27 31 31 33 30 25 32 31 31 28 29 31 30 21 23 31 28 30 31 20 30 22 26 25 21 27 27 26 29 20 27 +>1831_575_1724_F3 +24 27 33 13 10 31 8 11 17 9 13 4 8 8 8 19 4 17 31 26 22 2 4 7 4 10 3 23 8 8 23 20 4 5 20 +>1831_575_1829_F3 +17 17 7 9 6 4 13 18 3 10 22 8 31 5 4 3 6 18 9 10 9 2 14 2 14 9 10 15 13 28 5 2 8 10 15 +>1831_575_1898_F3 +31 33 29 31 31 5 16 14 8 8 6 19 15 8 4 2 23 14 13 4 2 23 3 7 7 2 26 19 6 3 6 21 18 11 11 +>1831_575_1964_F3 +16 29 18 24 8 31 17 27 17 14 31 10 24 30 17 28 5 8 29 29 31 9 21 17 28 20 5 17 27 19 17 13 6 30 10 +>1831_576_32_F3 +10 27 29 30 29 30 28 22 27 17 8 20 17 17 26 29 27 27 31 19 15 31 29 22 15 19 27 29 20 28 17 18 31 10 5 +>1831_576_74_F3 +23 28 31 31 30 31 29 7 30 30 27 33 20 30 31 31 31 24 27 31 29 27 10 29 27 26 31 6 26 29 21 24 21 16 30 +>1831_576_86_F3 +22 23 16 16 8 17 25 9 13 10 10 20 27 14 25 18 10 19 18 24 17 19 9 8 8 14 25 11 21 5 17 24 8 17 14 +>1831_576_89_F3 +17 8 21 24 10 11 6 13 19 28 12 11 29 14 29 7 9 3 2 8 18 15 18 15 9 6 7 11 4 8 17 2 2 3 11 +>1831_576_266_F3 +27 31 31 30 28 26 27 30 22 28 31 29 24 11 29 31 16 3 5 5 23 24 3 14 25 29 22 6 18 16 22 23 4 5 21 +>1831_576_327_F3 +27 31 30 31 21 31 31 26 27 31 30 29 27 31 29 28 28 18 31 25 28 28 27 18 31 31 29 20 18 27 24 29 27 21 28 +>1831_576_331_F3 +26 12 17 8 10 7 9 13 9 16 14 26 20 4 13 12 24 5 2 14 16 6 10 7 3 9 3 2 2 7 8 4 14 3 13 +>1831_576_387_F3 +14 23 8 13 3 20 2 16 2 9 4 13 3 2 2 13 9 2 3 4 2 2 12 4 11 10 11 16 2 5 4 13 4 8 8 +>1831_576_406_F3 +27 19 27 29 4 4 16 19 25 9 19 21 20 21 8 5 27 17 20 16 5 17 10 18 2 5 16 24 11 21 5 19 29 20 7 +>1831_576_449_F3 +7 10 6 5 6 13 11 11 3 14 10 13 8 3 3 23 5 4 2 10 30 5 11 2 8 12 5 2 2 2 22 11 10 2 9 +>1831_576_519_F3 +28 28 19 21 27 24 22 31 29 17 14 21 30 26 17 27 19 32 23 23 16 29 24 16 17 16 10 27 16 14 19 13 24 10 22 +>1831_576_603_F3 +31 31 19 21 28 31 34 13 30 30 27 32 22 24 31 31 26 12 27 31 31 29 17 24 33 30 29 20 20 27 33 22 20 24 23 +>1831_576_655_F3 +28 31 32 32 24 31 31 27 21 9 29 31 31 20 14 27 31 29 24 6 28 26 29 22 10 31 30 24 29 14 24 26 10 11 4 +>1831_576_677_F3 +21 17 24 15 5 14 9 15 2 5 6 5 11 13 17 6 2 5 9 3 5 7 6 2 12 4 7 3 9 2 4 3 8 2 4 +>1831_576_718_F3 +3 19 2 2 2 3 15 2 2 2 4 7 2 2 2 2 2 2 2 2 2 11 2 2 2 2 4 2 2 2 2 3 2 2 2 +>1831_576_722_F3 +7 9 11 12 11 2 2 13 8 9 5 7 9 16 4 9 7 4 7 12 17 2 10 8 12 2 13 5 12 2 4 4 3 6 8 +>1831_576_754_F3 +13 19 14 14 2 7 13 3 8 6 6 11 29 7 5 2 16 3 27 11 2 2 4 7 7 11 2 20 30 2 15 9 4 16 9 +>1831_576_815_F3 +27 18 29 31 30 24 29 31 30 33 28 29 28 26 29 32 30 30 30 28 29 25 17 20 28 19 13 17 20 30 21 27 20 22 13 +>1831_576_882_F3 +30 17 21 30 23 30 31 25 19 29 31 29 24 21 30 30 27 27 28 20 6 16 27 29 24 23 19 21 28 27 24 27 16 29 23 +>1831_576_898_F3 +28 31 31 34 17 30 34 29 30 27 29 31 23 23 21 33 30 26 30 13 30 30 23 22 28 33 27 23 27 16 20 30 30 28 13 +>1831_576_923_F3 +22 21 13 20 16 28 26 13 21 24 24 27 24 21 29 26 26 19 24 27 26 26 16 16 26 27 31 20 24 25 24 28 21 19 22 +>1831_576_930_F3 +17 2 9 15 13 17 5 13 25 7 7 2 6 16 19 6 2 2 12 8 2 4 3 3 17 4 2 3 14 16 5 2 4 14 2 +>1831_576_1019_F3 +17 27 3 29 3 11 16 11 5 10 10 5 31 11 13 8 6 10 14 10 2 24 6 21 24 14 21 6 17 7 10 12 6 24 12 +>1831_576_1068_F3 +25 29 29 27 28 19 30 26 31 22 28 30 30 24 30 26 24 29 20 31 24 30 25 23 31 25 28 20 6 26 22 26 6 2 19 +>1831_576_1131_F3 +16 15 19 31 2 31 14 31 11 19 29 24 30 17 10 30 16 20 22 16 31 6 11 29 28 26 7 22 20 24 26 9 24 17 27 +>1831_576_1168_F3 +29 31 34 34 21 31 31 17 30 24 28 29 22 30 26 22 21 27 26 19 21 22 31 26 24 11 15 4 17 21 6 6 11 19 3 +>1831_576_1207_F3 +4 3 29 17 11 7 5 30 19 30 7 11 31 25 27 5 11 31 29 30 3 5 25 23 32 4 4 28 15 13 4 11 20 24 22 +>1831_576_1289_F3 +31 24 27 29 16 33 31 31 26 22 31 31 21 21 18 28 28 17 23 11 20 6 25 23 27 27 11 13 28 17 29 29 13 20 15 +>1831_576_1329_F3 +27 29 5 15 11 23 22 15 14 32 31 31 14 20 13 26 28 26 25 6 5 31 18 6 5 3 3 4 11 10 2 7 3 5 17 +>1831_576_1367_F3 +30 30 31 31 27 29 31 31 28 31 27 31 27 28 31 29 31 30 30 24 25 30 27 28 29 28 27 23 26 20 24 31 22 23 22 +>1831_576_1416_F3 +10 6 26 30 13 13 16 13 27 31 6 13 28 10 21 13 20 30 22 27 15 12 30 22 26 7 4 28 29 20 21 13 24 23 31 +>1831_576_1461_F3 +2 16 5 22 19 2 7 2 7 5 2 2 3 2 11 6 2 2 2 4 2 4 4 2 9 2 5 4 4 2 2 4 4 4 6 +>1831_576_1605_F3 +21 27 31 34 31 31 29 16 26 31 25 26 27 27 31 31 24 31 30 30 30 24 27 18 30 20 12 17 16 28 19 23 22 22 11 +>1831_576_1664_F3 +31 31 30 29 30 31 28 32 25 31 31 29 31 28 6 28 27 29 28 8 13 29 28 24 9 23 8 7 22 2 14 10 10 26 8 +>1831_576_1671_F3 +31 31 30 31 20 29 31 31 23 5 23 30 17 20 2 5 8 5 20 5 5 8 16 20 5 5 11 5 19 4 5 11 5 21 4 +>1831_576_1729_F3 +31 30 31 30 27 30 27 31 29 32 30 14 28 28 30 29 30 22 29 30 31 23 27 30 31 29 24 24 26 29 27 10 15 28 29 +>1831_576_1880_F3 +15 20 16 20 14 22 24 17 11 25 11 22 14 4 14 15 20 11 4 3 8 25 10 2 23 4 17 7 16 22 20 19 8 8 18 +>1831_576_1982_F3 +11 31 31 30 31 11 32 29 27 31 24 31 28 30 31 24 33 28 23 27 21 31 31 21 31 17 27 32 30 29 13 22 27 10 31 +>1831_576_1987_F3 +8 2 2 7 8 7 2 5 2 2 8 4 8 14 12 2 4 3 16 16 2 4 18 29 6 2 2 5 3 11 2 3 3 6 10 +>1831_576_2014_F3 +31 31 31 24 11 33 17 24 12 20 29 6 30 11 10 30 22 24 10 14 32 6 26 6 17 31 6 20 5 14 24 11 21 5 16 +>1831_576_2028_F3 +20 27 29 24 29 20 6 17 7 5 22 15 22 13 23 2 5 5 18 24 11 15 4 22 14 2 7 2 11 9 4 5 20 9 10 +>1831_577_40_F3 +24 17 14 19 7 6 13 6 8 7 27 9 30 2 3 8 4 5 27 11 14 18 24 27 7 13 17 11 10 27 28 31 21 16 16 +>1831_577_119_F3 +24 29 30 34 16 16 8 12 16 14 8 2 26 2 14 11 23 20 15 9 10 13 10 3 3 20 20 20 15 10 4 12 13 19 15 +>1831_577_133_F3 +14 19 31 29 29 30 28 16 30 25 10 29 31 15 22 31 31 29 27 29 31 9 27 10 16 31 16 20 8 24 21 6 17 3 8 +>1831_577_255_F3 +22 27 28 23 22 31 29 21 24 4 9 9 2 5 2 12 10 3 13 2 5 5 2 10 3 12 10 4 5 4 13 11 4 20 2 +>1831_577_281_F3 +22 12 25 33 26 23 31 28 26 29 22 31 29 19 30 28 30 10 21 20 24 30 26 20 27 22 30 26 24 31 23 7 29 25 30 +>1831_577_288_F3 +20 26 14 22 24 30 30 5 28 33 25 25 17 24 23 9 21 13 22 14 10 19 5 17 16 11 22 11 21 30 13 22 2 6 21 +>1831_577_322_F3 +24 28 26 29 19 20 15 21 26 17 20 20 19 21 19 12 27 2 22 10 16 24 19 5 17 27 30 21 20 24 21 23 8 22 14 +>1831_577_362_F3 +21 17 33 30 25 31 30 31 27 30 24 20 23 28 11 18 25 11 24 15 25 5 6 12 24 24 11 21 27 20 13 7 3 10 21 +>1831_577_382_F3 +16 17 24 20 22 14 25 16 8 8 28 22 21 7 9 17 19 26 11 18 10 25 27 13 5 13 5 12 28 16 28 17 14 20 9 +>1831_577_464_F3 +18 28 27 22 14 27 23 17 21 8 29 2 13 6 5 19 17 15 19 10 20 2 14 15 19 16 13 22 9 24 16 5 22 20 21 +>1831_577_488_F3 +25 19 23 13 11 9 29 21 20 21 21 27 30 23 28 27 28 27 17 29 21 26 24 19 29 26 28 24 29 31 23 24 17 19 31 +>1831_577_511_F3 +2 22 14 10 5 3 25 27 22 4 21 11 3 3 4 6 4 14 10 8 2 3 22 7 7 5 9 18 29 16 21 6 15 14 10 +>1831_577_545_F3 +29 29 27 27 24 30 27 29 30 32 27 19 23 16 31 27 31 23 28 28 31 22 21 14 21 16 27 24 20 13 20 24 23 23 12 +>1831_577_559_F3 +13 27 31 26 30 30 31 29 31 30 14 17 27 13 31 16 28 29 16 17 28 21 16 14 26 28 30 13 5 17 10 24 17 8 6 +>1831_577_562_F3 +2 7 7 5 9 5 15 4 8 16 4 8 2 7 3 17 12 11 9 9 9 4 14 12 11 11 8 8 5 11 12 13 16 6 9 +>1831_577_637_F3 +23 12 11 19 2 29 25 12 21 10 25 23 11 5 7 20 26 18 28 15 29 22 28 21 23 5 16 14 24 5 6 30 26 19 11 +>1831_577_641_F3 +5 19 22 26 14 6 25 32 26 26 20 30 25 22 17 11 7 28 8 11 2 9 30 10 13 2 5 22 3 23 2 4 22 14 6 +>1831_577_692_F3 +31 33 11 31 30 31 33 7 31 32 30 31 10 31 31 29 31 10 30 28 29 31 6 28 27 31 27 28 27 24 28 30 22 20 27 diff -r 54aa0543925b -r 61dd78cafa09 tool_conf.xml.sample --- a/tool_conf.xml.sample Fri Jul 31 11:38:03 2009 -0400 +++ b/tool_conf.xml.sample Fri Jul 31 11:48:37 2009 -0400 @@ -77,6 +77,8 @@ <tool file="maf/maf_to_bed.xml" /> <tool file="maf/maf_to_fasta.xml" /> <tool file="fasta_tools/tabular_to_fasta.xml" /> + <tool file="next_gen_conversion/solid_to_fastq.xml" /> + <tool file="next_gen_conversion/fastq_conversions.xml" /> </section> <section name="Extract Features" id="features"> <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" /> diff -r 54aa0543925b -r 61dd78cafa09 tools/next_gen_conversion/fastq_conversions.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/next_gen_conversion/fastq_conversions.py Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,41 @@ +#! /usr/bin/python + +""" +Performs various conversions around Sanger FASTQ data + +usage: %prog [options] + -c, --command=c: Command to run + -i, --input=i: Input file to be converted + -o, --outputFastqsanger=o: FASTQ Sanger converted output file for sol2std + -s, --outputFastqsolexa=s: FASTQ Solexa converted output file + -f, --outputFasta=f: FASTA converted output file + +usage: %prog command input_file output_file +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + + cmd = "fq_all2std.pl %s %s > %s" + if options.command == 'sol2std': + cmd = cmd % (options.command, options.input, options.outputFastqsanger) + elif options.command == 'std2sol': + cmd = cmd % (options.command, options.input, options.outputFastqsolexa) + elif options.command == 'fq2fa': + cmd = cmd % (options.command, options.input, options.outputFasta) + try: + os.system(cmd) + except Exception, eq: + stop_err("Error converting data format.\n" + str(eq)) + +if __name__=="__main__": __main__() diff -r 54aa0543925b -r 61dd78cafa09 tools/next_gen_conversion/fastq_conversions.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/next_gen_conversion/fastq_conversions.xml Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,133 @@ +<tool id="fastq_conversions" name="FASTQ Conversions" version="1.0.0"> + <description>converts between FASTQ data and other data formats</description> + <command interpreter="python"> + fastq_conversions.py + --command=$conversionType.type + --input=$input + #if $conversionType.type == "sol2std": + --outputFastqsanger=$outputFastqsanger + #else: + --outputFastqsanger="None" + #end if + #if $conversionType.type == "std2sol": + --outputFastqsolexa=$outputFastqsolexa + #else: + --outputFastqsolexa="None" + #end if + #if $conversionType.type == "fq2fa": + --outputFasta=$outputFasta + #else: + --outputFasta="None" + #end if + </command> + <inputs> + <conditional name="conversionType"> + <param name="type" type="select" label="What type of conversion do you want to do?"> + <option value="sol2std">Solexa/Illumina FASTQ to standard Sanger FASTQ</option> + <option value="std2sol">Standard Sanger FASTQ to Solexa/Illumina FASTQ</option> + <option value="fq2fa">Various FASTQ to FASTA</option> + </param> + <when value="sol2std"> + <param name="input" type="data" format="fastqsolexa" label="File to convert" /> + </when> + <when value="std2sol"> + <param name="input" type="data" format="fastqsanger" label="File to convert" /> + </when> + <when value="fq2fa"> + <param name="input" type="data" format="fastqsolexa, fastqsanger" label="File to convert" /> + </when> + </conditional> + </inputs> + <outputs> + <data name="outputFastqsanger" format="fastqsanger"> + <filter>conversionType['type'] == 'sol2std'</filter> + </data> + <data name="outputFastqsolexa" format="fastqsolexa"> + <filter>conversionType['type'] == 'std2sol'</filter> + </data> + <data name="outputFasta" format="fasta"> + <filter>conversionType['type'] == 'fq2fa'</filter> + </data> + </outputs> + <tests> + <test> + <param name="type" value="sol2std" /> + <param name="input" value="bwa_phiX_sanger.fastq" ftype="fastqsolexa" /> + <output name="outputFastqsanger" file="fastq_conv_out1.fastqsanger" /> + </test> + <test> + <param name="type" value="std2sol" /> + <param name="input" value="1.fastqsanger" ftype="fastqsanger" /> + <output name="outputFastqsolexa" file="fastq_conv_out2.fastqsolexa" /> + </test> + <test> + <param name="type" value="fq2fa" /> + <param name="input" value="1.fastqsanger" ftype="fastqsanger" /> + <output name="outputFasta" file="fastq_conv_out4.fasta" /> + </test> + </tests> + <help> +**What it does** + +This tool offers several conversions options relating to the FASTQ format. + +----- + +**Examples** + +- Converting the Solexa/Illumina FASTQ data:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC + + + II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&&B + +- will produce the following Sanger FASTQ data:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC + + + ++!+++++++!!!!!"+++++++!!!!)!%!!+!!%! + +- Converting standard Sanger FASTQ:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ><C&&9952+C>5<.?<79,=42<292:<(9/-7 + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + ;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, + +- will produce the following Solexa/Illumina FASTQ data:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ][bEEXXTQJb]T[M^[VXK\SQ[QXQY[GXNLV + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + Z__PV^_\]V^^_`W^\\_S`^`SHEJMFEJFPK + +- Converting the Sanger FASTQ data:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ><C&&9952+C>5<.?<79,=42<292:<(9/-7 + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + ;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, + +- will produce the following FASTA data:: + + >1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + >1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + </help> +</tool> diff -r 54aa0543925b -r 61dd78cafa09 tools/next_gen_conversion/solid_to_fastq.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/next_gen_conversion/solid_to_fastq.py Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,53 @@ +#! /usr/bin/python + +""" +Converts SOLiD data to Sanger FASTQ format. + +usage: %prog [options] + -i, --input1=i: Forward reads file + -q, --input2=q: Forward qual file + -I, --input3=I: Reverse reads file + -Q, --input4=Q: Reverse qual file + -o, --output1=o: Forward output + -r, --output2=r: Reverse output + +usage: %prog forward_reads_file forwards_qual_file reverse_reads_file(or_None) reverse_qual_file(or_None) output_file ouptut_id output_dir +""" + +import os, sys, tempfile +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.cookbook import doc_optparse + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + options, args = doc_optparse.parse( __doc__ ) + # if paired-end data (have reverse input files) + if options.input3 != "None" and options.input4 != "None": + tmpf = tempfile.NamedTemporaryFile() #forward reads + tmpr = tempfile.NamedTemporaryFile() #reverse reads + + cmd1 = "bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,None,options.input1,options.input2,options.input3,options.input4) + try: + os.system(cmd1) + os.system('gunzip -c %s >> %s' %(tmpf.name,options.output1)) + os.system('gunzip -c %s >> %s' %(tmpr.name,options.output2)) + + except Exception, eq: + stop_err("Error converting data to fastq format.\n" + str(eq)) + # if single-end data + else: + tmpf = tempfile.NamedTemporaryFile() + cmd1 = "bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" % (tmpf.name, None, None, options.input1, options.input2, None, None) + try: + os.system(cmd1) + os.system('gunzip -c %s >> %s' % (tmpf.name, options.output1)) + tmpf.close() + except Exception, eq: + stop_err("Error converting data to fastq format.\n" + str(eq)) + +if __name__=="__main__": __main__() diff -r 54aa0543925b -r 61dd78cafa09 tools/next_gen_conversion/solid_to_fastq.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/next_gen_conversion/solid_to_fastq.xml Fri Jul 31 11:48:37 2009 -0400 @@ -0,0 +1,101 @@ +<tool id="solid_to_fastq" name="SOLiD-to-FASTQ" version="1.0.0"> + <description>converts SOLiD data to FASTQ data</description> + <command interpreter="python"> + solid_to_fastq.py + --input1=$input1 + --input2=$input2 + #if $paired.pairedSingle == "single": + --input3="None" + --input4="None" + #else: + --input3=$input3 + --input4=$input4 + #end if + --output1=$output1 + #if $paired.pairedSingle == "single": + --output2="None" + #else: + --output2=$output2 + #end if + </command> + <inputs> + <conditional name="paired"> + <param name="pairedSingle" type="select" label="Is this library mate-paired?"> + <option value="single">Single</option> + <option value="paired">Paired</option> + </param> + <when value="single"> + <param name="input1" type="data" format="csfasta" label="F3 read file" /> + <param name="input2" type="data" format="qualsolid" label="F3 qual file" /> + </when> + <when value="paired"> + <param name="input1" type="data" format="csfasta" label="F3 read file" /> + <param name="input2" type="data" format="qualsolid" label="F3 qual file" /> + <param name="input3" type="data" format="csfasta" label="R3 read file" /> + <param name="input4" type="data" format="qualsolid" label="R3 qual file" /> + </when> + </conditional> + </inputs> + <outputs> +  + <data name="output1" format="tabular"/> + <data name="output2" format="tabular"> + <filter>paired['pairedSingle'] == 'paired'</filter> + </data> + </outputs> + <tests> + <test> + <param name="pairedSingle" value="single" /> + <param name="input1" value="s2fq_phiX.csfasta" ftype="csfasta" /> + <param name="input2" value="s2fq_phiX.qualsolid" ftype="qualsolid" /> + <output name="output1" file="s2fq_out1.tabular" /> + </test> +  + </tests> + <help> + +**What it does** + +This tool takes reads and quality files and converts them to FASTQ data ( Sanger variant ). Note that it also converts sequences to base pairs. + +----- + +**Example** + +- Converting the following sequences:: + + >seq1 + T00030133312212111300011021310132222 + >seq2 + T03330322230322112131010221102122113 + +- and quality scores:: + + >seq1 + 4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22 + >seq2 + 8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11 + +- will produce the following Sanger FASTQ data:: + + @seq1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + >CCAA9952+C>5C.?C79,=42C292:C(9/-7 + @seq2 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + ;@@17?@=>7??@A8?==@4A?A4)A+.'A+'1, + + </help> +</tool>

1 0

Feature suggestion: administrative new-job lock
by Assaf Gordon 31 Jul '09

31 Jul '09

Hello, I'd like to suggest a new feature - administrative lock which prevents new jobs from starting. Use case: 1. I need to stop my galaxy server (to upgrade, to add new tool, to add new dbkey, etc). 2. I want to stop it in a friendly way, without killing running jobs, but not allow new jobs to start. 3. Once all the running jobs complete (and new jobs are not started), I can stop the server, fix it, and restart. 4. Restarting the server (and assuming jobs are tracked in the database), all the held jobs are started normally. Code changes: 1. new administrative method ( job_lock() in ./lib/galaxy/web/controller/admin.py ) 2. new template ( ./templates/admin/job_lock.mako ) 3. job lock code in lib/galaxy/jobs/schedulingpolicy/roundrobin.py I'm still testing this patch, but comments are welcomed. -gordon.

3 2

Re: [galaxy-dev] Fresh install has wrong layout (From galaxy-user)
by Nate Coraor 31 Jul '09

31 Jul '09

Hi Chris, Sorry about missing the reply, I was on vacation when you wrote back. Also, I've moved this over to the dev mailing list since it's regarding local installation issues. Could you do the following: Paste the <iframe> tags from "View Source" on the main page. Paste the log output from the server (or paster.log if you're running as a daemon) of your client connecting to Galaxy. Thanks, --nate Chris Cole wrote: > Just realised I'd not sent this to the list. Whoops! > > This is still broken, anyone have any ideas? > Cheers, > > Chris > > -------- Original Message -------- > Subject: Re: [galaxy-user] Fresh install has wrong layout > Date: Tue, 21 Jul 2009 10:47:50 +0100 > From: Chris Cole <chris(a)compbio.dundee.ac.uk> > Organisation: University of Dundee > To: Nate Coraor <nate(a)bx.psu.edu> > References: <4A4E147C.6010107(a)compbio.dundee.ac.uk> > <4A4E1506.5030609(a)bx.psu.edu> <4A4E1716.2070800(a)compbio.dundee.ac.uk> > <4A52AFFA.5020102(a)bx.psu.edu> > > Hi Nate, > > Sorry for not replying earlier, I've been on holiday. Attached should be > my universe_wsgi.ini for the updated server. (The file has a .txt > extension to avoid sending blockage). > > I've used the same settings (where applicable) for my currently working > svn version 1686. > > Chris > > Nate Coraor wrote: >> Chris, >> >> Could you send us your universe_wsgi.ini? We haven't seen this happen >> without a proxy before. >> >> --nate >> >> Chris Cole wrote: >>> Hi Nate, >>> >>> Nope. There's no proxy configured. The only things I changed in the HTTP >>> config part of the universe_wsgi.ini are the host and the port. >>> Cheers, >>> >>> Chris >>> >>> Nate Coraor wrote: >>>> Hi Chris, >>>> >>>> It sounds like you maybe be running through a proxy, away from the >>>> server root, without the proxy-prefix option set in universe_wsgi.ini? >>>> If so, have a look at the documentation here: >>>> >>>> http://g2.trac.bx.psu.edu/wiki/HowToInstall/ApacheProxy#Apacheconfiguration… >>>> >>>> --nate >>>> >>>> Chris Cole wrote: >>>>> Hi, >>>>> >>>>> I've been using the subversion version of Galaxy for a while, but now I >>>>> want to update to the latest mercurial release. >>>>> >>>>> I installed it in a new location as per the wiki and set-up the SGE >>>>> settings as per my previous install and all the tests pass. It launches >>>>> fine, but when viewing the website the frames seem to be off-by-one. >>>>> i.e., the 'Tools' frame is empty except for "This link may not be >>>>> followed from within Galaxy.", the tools are in the middle window and >>>>> the 'History' frame has general information. >>>>> >>>>> I can't see any errors in the paster.log file, so where can I look to >>>>> sort out this error? >>>>> Thanks, >>>>> >>>>> Chris >>>>> _______________________________________________ >>>>> galaxy-user mailing list >>>>> galaxy-user(a)bx.psu.edu >>>>> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user > > > > ------------------------------------------------------------------------ > > _______________________________________________ > galaxy-user mailing list > galaxy-user(a)bx.psu.edu > http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user

2 1

[hg] galaxy 2515: Add new flag, allow_datatype_change, to Dataty...
by Greg Von Kuster 31 Jul '09

31 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/aabcc797c1da changeset: 2515:aabcc797c1da user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 16:23:47 2009 -0400 description: Add new flag, allow_datatype_change, to Datatypes. When set to False, datasets of this datatype cannot be changed from or into. This is needed, i.e. for Rgenetics Datatypes to prevent loss of metadata ('base_name') which occurs when changing to datatypes without this metadata parameter and would render the dataset unusable (composite filenames could be incorrect). 8 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/datatypes/genetics.py lib/galaxy/web/controllers/admin.py lib/galaxy/web/controllers/library.py lib/galaxy/web/controllers/root.py templates/admin/library/ldda_edit_info.mako templates/dataset/edit_attributes.mako templates/library/ldda_edit_info.mako diffs (287 lines): diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Thu Jul 30 16:23:47 2009 -0400 @@ -51,6 +51,8 @@ copy_safe_peek = True is_binary = True #The dataset contains binary data --> do not space_to_tab or convert newlines, etc. Allow binary file uploads of this type when True. + + allow_datatype_change = True #Allow user to change between this datatype and others. If False, this datatype cannot be changed from or into. #Composite datatypes composite_type = None diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/datatypes/genetics.py Thu Jul 30 16:23:47 2009 -0400 @@ -122,6 +122,7 @@ file_ext="html" composite_type = 'auto_primary_file' + allow_datatype_change = False def missing_meta( self, dataset ): """Checks for empty meta values""" @@ -255,6 +256,8 @@ file_ext = None is_binary = True + + allow_datatype_change = False composite_type = 'basic' diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/admin.py --- a/lib/galaxy/web/controllers/admin.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/admin.py Thu Jul 30 16:23:47 2009 -0400 @@ -1094,7 +1094,7 @@ replace_dataset = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well - ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() if params.get( 'new_dataset_button', False ): upload_option = params.get( 'upload_option', 'upload_file' ) @@ -1247,17 +1247,20 @@ elif action == 'edit_info': if params.get( 'change', False ): # The user clicked the Save button on the 'Change data type' form - trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) - trans.app.model.flush() - msg = "Data type changed for library dataset '%s'" % ldda.name - return trans.fill_template( "/admin/library/ldda_edit_info.mako", - ldda=ldda, - library_id=library_id, - datatypes=ldatatypes, - restrict=params.get( 'restrict', True ), - render_templates=params.get( 'render_templates', False ), - msg=msg, - messagetype=messagetype ) + if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) + trans.app.model.flush() + msg = "Data type changed for library dataset '%s'" % ldda.name + return trans.fill_template( "/admin/library/ldda_edit_info.mako", + ldda=ldda, + library_id=library_id, + datatypes=ldatatypes, + restrict=params.get( 'restrict', True ), + render_templates=params.get( 'render_templates', False ), + msg=msg, + messagetype=messagetype ) + else: + return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) ) elif params.get( 'save', False ): # The user clicked the Save button on the 'Edit Attributes' form old_name = ldda.name diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/library.py --- a/lib/galaxy/web/controllers/library.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/library.py Thu Jul 30 16:23:47 2009 -0400 @@ -430,7 +430,7 @@ replace_dataset = None # Let's not overwrite the imported datatypes module with the variable datatypes? # The built-in 'id' is overwritten in lots of places as well - ldatatypes = [ x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys() ] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() if id: if params.get( 'permissions', False ): @@ -505,10 +505,14 @@ if trans.app.security_agent.allow_action( trans.user, trans.app.security_agent.permitted_actions.LIBRARY_MODIFY, library_item=ldda ): - trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) - trans.app.model.flush() - msg = "Data type changed for library dataset '%s'" % ldda.name - messagetype = 'done' + if ldda.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( ldda, params.datatype ) + trans.app.model.flush() + msg = "Data type changed for library dataset '%s'" % ldda.name + messagetype = 'done' + else: + msg = "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( ldda.extension, params.datatype ) + messagetype = 'error' else: msg = "You are not authorized to change the data type of dataset '%s'" % ldda.name messagetype = 'error' diff -r 904a72f5cf4c -r aabcc797c1da lib/galaxy/web/controllers/root.py --- a/lib/galaxy/web/controllers/root.py Thu Jul 30 15:03:53 2009 -0400 +++ b/lib/galaxy/web/controllers/root.py Thu Jul 30 16:23:47 2009 -0400 @@ -247,8 +247,11 @@ params = util.Params( kwd, safe=False ) if params.change: # The user clicked the Save button on the 'Change data type' form - trans.app.datatypes_registry.change_datatype( data, params.datatype ) - trans.app.model.flush() + if data.datatype.allow_datatype_change and trans.app.datatypes_registry.get_datatype_by_extension( params.datatype ).allow_datatype_change: + trans.app.datatypes_registry.change_datatype( data, params.datatype ) + trans.app.model.flush() + else: + return trans.show_error_message( "You are unable to change datatypes in this manner. Changing %s to %s is not allowed." % ( data.extension, params.datatype ) ) elif params.save: # The user clicked the Save button on the 'Edit Attributes' form data.name = params.name @@ -314,7 +317,7 @@ data.metadata.dbkey = data.dbkey # let's not overwrite the imported datatypes module with the variable datatypes? # the built-in 'id' is overwritten in lots of places as well - ldatatypes = [x for x in trans.app.datatypes_registry.datatypes_by_extension.iterkeys()] + ldatatypes = [ dtype_name for dtype_name, dtype_value in trans.app.datatypes_registry.datatypes_by_extension.iteritems() if dtype_value.allow_datatype_change ] ldatatypes.sort() trans.log_event( "Opened edit view on dataset %s" % str(id) ) return trans.fill_template( "/dataset/edit_attributes.mako", data=data, datatypes=ldatatypes ) diff -r 904a72f5cf4c -r aabcc797c1da templates/admin/library/ldda_edit_info.mako --- a/templates/admin/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/admin/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400 @@ -99,24 +99,30 @@ <div class="toolForm"> <div class="toolFormTitle">Change data type of ${ldda.name}</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> + %if ldda.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='admin', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div class="form-row"> + <label>New Type:</label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( ldda, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + This will change the datatype of the existing dataset + but <i>not</i> modify its contents. Use this if Galaxy + has incorrectly guessed the type of your dataset. + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="Save"/> + </div> + </form> + %else: <div class="form-row"> - <label>New Type:</label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( ldda, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - This will change the datatype of the existing dataset - but <i>not</i> modify its contents. Use this if Galaxy - has incorrectly guessed the type of your dataset. - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="Save"/> - </div> - </form> + %endif </div> </div> diff -r 904a72f5cf4c -r aabcc797c1da templates/dataset/edit_attributes.mako --- a/templates/dataset/edit_attributes.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/dataset/edit_attributes.mako Thu Jul 30 16:23:47 2009 -0400 @@ -102,27 +102,34 @@ </div> <p /> %endif + <div class="toolForm"> <div class="toolFormTitle">${_('Change data type')}</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post"> - <input type="hidden" name="id" value="${data.id}"/> + %if data.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='root', action='edit' )}" method="post"> + <input type="hidden" name="id" value="${data.id}"/> + <div class="form-row"> + <label> + ${_('New Type')}: + </label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( data, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')} + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="${_('Save')}"/> + </div> + </form> + %else: <div class="form-row"> - <label> - ${_('New Type')}: - </label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( data, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - ${_('This will change the datatype of the existing dataset but <i>not</i> modify its contents. Use this if Galaxy has incorrectly guessed the type of your dataset.')} - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="${_('Save')}"/> - </div> - </form> + %endif </div> </div> <p /> diff -r 904a72f5cf4c -r aabcc797c1da templates/library/ldda_edit_info.mako --- a/templates/library/ldda_edit_info.mako Thu Jul 30 15:03:53 2009 -0400 +++ b/templates/library/ldda_edit_info.mako Thu Jul 30 16:23:47 2009 -0400 @@ -99,24 +99,30 @@ <div class="toolForm"> <div class="toolFormTitle">Change data type</div> <div class="toolFormBody"> - <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> - <input type="hidden" name="id" value="${ldda.id}"/> + %if ldda.datatype.allow_datatype_change: + <form name="change_datatype" action="${h.url_for( controller='library', action='library_dataset_dataset_association', library_id=library_id, folder_id=ldda.library_dataset.folder.id, edit_info=True )}" method="post"> + <input type="hidden" name="id" value="${ldda.id}"/> + <div class="form-row"> + <label>New Type:</label> + <div style="float: left; width: 250px; margin-right: 10px;"> + ${datatype( ldda, datatypes )} + </div> + <div class="toolParamHelp" style="clear: both;"> + This will change the datatype of the existing dataset + but <i>not</i> modify its contents. Use this if Galaxy + has incorrectly guessed the type of your dataset. + </div> + <div style="clear: both"></div> + </div> + <div class="form-row"> + <input type="submit" name="change" value="Save"/> + </div> + </form> + %else: <div class="form-row"> - <label>New Type:</label> - <div style="float: left; width: 250px; margin-right: 10px;"> - ${datatype( ldda, datatypes )} - </div> - <div class="toolParamHelp" style="clear: both;"> - This will change the datatype of the existing dataset - but <i>not</i> modify its contents. Use this if Galaxy - has incorrectly guessed the type of your dataset. - </div> - <div style="clear: both"></div> + <div class="warningmessagesmall">${_('Changing the datatype of this dataset is not allowed.')}</div> </div> - <div class="form-row"> - <input type="submit" name="change" value="Save"/> - </div> - </form> + %endif </div> </div> <p/>

1 0

[hg] galaxy 2514: Fix for trans.log_event when undeleting a hist...
by Dan Blankenberg 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/904a72f5cf4c changeset: 2514:904a72f5cf4c user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 15:03:53 2009 -0400 description: Fix for trans.log_event when undeleting a history. 1 file(s) affected in this change: lib/galaxy/web/controllers/history.py diffs (12 lines): diff -r 3574137cf7fb -r 904a72f5cf4c lib/galaxy/web/controllers/history.py --- a/lib/galaxy/web/controllers/history.py Thu Jul 30 14:13:04 2009 -0400 +++ b/lib/galaxy/web/controllers/history.py Thu Jul 30 15:03:53 2009 -0400 @@ -166,7 +166,7 @@ default_permissions[ default_action ] = [ private_user_role ] trans.app.security_agent.history_set_default_permissions( history, default_permissions ) n_undeleted += 1 - trans.log_event( "History (%s) %d marked as undeleted" % history.name ) + trans.log_event( "History (%s) %d marked as undeleted" % ( history.name, history.id ) ) status = SUCCESS message_parts = [] if n_undeleted:

1 0

[hg] galaxy 2513: Only require access permission to view private...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3574137cf7fb changeset: 2513:3574137cf7fb user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Jul 30 14:13:04 2009 -0400 description: Only require access permission to view private datasets at external sites. 1 file(s) affected in this change: lib/galaxy/web/controllers/dataset.py diffs (12 lines): diff -r 315ac197ff33 -r 3574137cf7fb lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Thu Jul 30 12:56:16 2009 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Thu Jul 30 14:13:04 2009 -0400 @@ -144,7 +144,7 @@ redirect_url = kwd['redirect_url'] % urllib.quote_plus( kwd['display_url'] ) if trans.app.security_agent.allow_action( None, data.permitted_actions.DATASET_ACCESS, dataset = data ): return trans.response.send_redirect( redirect_url ) # anon access already permitted by rbac - if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_MANAGE_PERMISSIONS, dataset = data ): + if trans.app.security_agent.allow_action( trans.user, data.permitted_actions.DATASET_ACCESS, dataset = data ): trans.app.host_security_agent.set_dataset_permissions( data, trans.user, site ) return trans.response.send_redirect( redirect_url ) else:

1 0

[hg] galaxy 2512: Add a new flag -f/--force_retry to cleanup_dat...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/315ac197ff33 changeset: 2512:315ac197ff33 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 12:56:16 2009 -0400 description: Add a new flag -f/--force_retry to cleanup_datasets.py. This flag will cause the script to attempt to perform the requestion action on objects regardless if it has been performed before. This is useful, i.e. if purge_datasets was called with out using --remove_from_disk, but it is later decided to remove these files: the purge_datasets script should be called with both -r and -f. 1 file(s) affected in this change: scripts/cleanup_datasets/cleanup_datasets.py diffs (162 lines): diff -r ec59d6bcf827 -r 315ac197ff33 scripts/cleanup_datasets/cleanup_datasets.py --- a/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:12:26 2009 -0400 +++ b/scripts/cleanup_datasets/cleanup_datasets.py Thu Jul 30 12:56:16 2009 -0400 @@ -24,6 +24,7 @@ parser.add_option( "-d", "--days", dest="days", action="store", type="int", help="number of days (60)", default=60 ) parser.add_option( "-r", "--remove_from_disk", action="store_true", dest="remove_from_disk", help="remove datasets from disk when purged", default=False ) parser.add_option( "-i", "--info_only", action="store_true", dest="info_only", help="info about the requested action", default=False ) + parser.add_option( "-f", "--force_retry", action="store_true", dest="force_retry", help="performs the requested actions, but ignores whether it might have been done before. Useful when -r wasn't used, but should have been", default=False ) parser.add_option( "-1", "--delete_userless_histories", action="store_true", dest="delete_userless_histories", default=False, help="delete userless histories and datasets" ) @@ -73,28 +74,32 @@ print "# Datasets will NOT be removed from disk.\n" if options.delete_userless_histories: - delete_userless_histories( app, cutoff_time, info_only = options.info_only ) + delete_userless_histories( app, cutoff_time, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_histories: - purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_histories( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_datasets: - purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_datasets( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_libraries: - purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_libraries( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) elif options.purge_folders: - purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only ) + purge_folders( app, cutoff_time, options.remove_from_disk, info_only = options.info_only, force_retry = options.force_retry ) sys.exit(0) -def delete_userless_histories( app, cutoff_time, info_only = False ): +def delete_userless_histories( app, cutoff_time, info_only = False, force_retry = False ): # Deletes userless histories whose update_time value is older than the cutoff_time. # The purge history script will handle marking DatasetInstances as deleted. # Nothing is removed from disk yet. history_count = 0 print '# The following datasets and associated userless histories have been deleted' start = time.clock() - histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, - app.model.History.table.c.deleted==False, - app.model.History.table.c.update_time < cutoff_time ) ).all()# \ + if force_retry: + histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, + app.model.History.table.c.update_time < cutoff_time ) ).all() + else: + histories = app.model.History.filter( and_( app.model.History.table.c.user_id==None, + app.model.History.table.c.deleted==False, + app.model.History.table.c.update_time < cutoff_time ) ).all() for history in histories: if not info_only: history.deleted = True @@ -106,7 +111,7 @@ print "Elapsed time: ", stop - start, "\n" -def purge_histories( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_histories( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted histories whose update_time is older than the cutoff_time. # The dataset associations of each history are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -115,10 +120,15 @@ history_count = 0 print '# The following datasets and associated deleted histories have been purged' start = time.clock() - histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, - app.model.History.table.c.purged==False, - app.model.History.table.c.update_time < cutoff_time ) ) \ - .options( eagerload( 'datasets' ) ).all() + if force_retry: + histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, + app.model.History.table.c.update_time < cutoff_time ) ) \ + .options( eagerload( 'datasets' ) ).all() + else: + histories = app.model.History.filter( and_( app.model.History.table.c.deleted==True, + app.model.History.table.c.purged==False, + app.model.History.table.c.update_time < cutoff_time ) ) \ + .options( eagerload( 'datasets' ) ).all() for history in histories: for dataset_assoc in history.datasets: _purge_dataset_instance( dataset_assoc, app, remove_from_disk, info_only = info_only ) #mark a DatasetInstance as deleted, clear associated files, and mark the Dataset as deleted if it is deletable @@ -136,7 +146,7 @@ print '# Purged %d histories.' % ( history_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_libraries( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted libraries whose update_time is older than the cutoff_time. # The dataset associations of each library are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -145,9 +155,13 @@ library_count = 0 print '# The following libraries and associated folders have been purged' start = time.clock() - libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, - app.model.Library.table.c.purged==False, - app.model.Library.table.c.update_time < cutoff_time ) ).all() + if force_retry: + libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, + app.model.Library.table.c.update_time < cutoff_time ) ).all() + else: + libraries = app.model.Library.filter( and_( app.model.Library.table.c.deleted==True, + app.model.Library.table.c.purged==False, + app.model.Library.table.c.update_time < cutoff_time ) ).all() for library in libraries: _purge_folder( library.root_folder, app, remove_from_disk, info_only = info_only ) if not info_only: @@ -159,7 +173,7 @@ print '# Purged %d libraries .' % ( library_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_folders( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_folders( app, cutoff_time, remove_from_disk, info_only = False, force_retry = False ): # Purges deleted folders whose update_time is older than the cutoff_time. # The dataset associations of each folder are also marked as deleted. # The Purge Dataset method will purge each Dataset as necessary @@ -168,9 +182,13 @@ folder_count = 0 print '# The following folders have been purged' start = time.clock() - folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, - app.model.LibraryFolder.table.c.purged==False, - app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() + if force_retry: + folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, + app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() + else: + folders = app.model.LibraryFolder.filter( and_( app.model.LibraryFolder.table.c.deleted==True, + app.model.LibraryFolder.table.c.purged==False, + app.model.LibraryFolder.table.c.update_time < cutoff_time ) ).all() for folder in folders: _purge_folder( folder, app, remove_from_disk, info_only = info_only ) print "%d" % folder.id @@ -179,17 +197,22 @@ print '# Purged %d folders.' % ( folder_count ), '\n' print "Elapsed time: ", stop - start, "\n" -def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False ): +def purge_datasets( app, cutoff_time, remove_from_disk, info_only = False, repurge = False, force_retry = False ): # Purges deleted datasets whose update_time is older than cutoff_time. Files may or may # not be removed from disk. dataset_count = 0 disk_space = 0 print '# The following deleted datasets have been purged' start = time.clock() - datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, - app.model.Dataset.table.c.purgable==True, - app.model.Dataset.table.c.purged==False, - app.model.Dataset.table.c.update_time < cutoff_time ) ).all() + if force_retry: + datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, + app.model.Dataset.table.c.purgable==True, + app.model.Dataset.table.c.update_time < cutoff_time ) ).all() + else: + datasets = app.model.Dataset.filter( and_( app.model.Dataset.table.c.deleted==True, + app.model.Dataset.table.c.purgable==True, + app.model.Dataset.table.c.purged==False, + app.model.Dataset.table.c.update_time < cutoff_time ) ).all() for dataset in datasets: file_size = dataset.file_size _purge_dataset( dataset, remove_from_disk, info_only = info_only )

1 0

[hg] galaxy 2511: Fix a problem introduced in db version 10 (MyS...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/ec59d6bcf827 changeset: 2511:ec59d6bcf827 user: Nate Coraor <nate(a)bx.psu.edu> date: Thu Jul 30 12:12:26 2009 -0400 description: Fix a problem introduced in db version 10 (MySQL's length limits prevent the creation of an index) 1 file(s) affected in this change: lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py diffs (55 lines): diff -r fab59b1e756d -r ec59d6bcf827 lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/model/migrate/versions/0011_v0010_mysql_index_fix.py Thu Jul 30 12:12:26 2009 -0400 @@ -0,0 +1,51 @@ +from sqlalchemy import * +from sqlalchemy.orm import * +from sqlalchemy.exceptions import * +from migrate import * +from migrate.changeset import * + +import datetime +now = datetime.datetime.utcnow + +import sys, logging +log = logging.getLogger( __name__ ) +log.setLevel(logging.DEBUG) +handler = logging.StreamHandler( sys.stdout ) +format = "%(name)s %(levelname)s %(asctime)s %(message)s" +formatter = logging.Formatter( format ) +handler.setFormatter( formatter ) +log.addHandler( handler ) + +# Need our custom types, but don't import anything else from model +from galaxy.model.custom_types import * + +metadata = MetaData( migrate_engine ) +db_session = scoped_session( sessionmaker( bind=migrate_engine, autoflush=False, transactional=False ) ) + +HistoryDatasetAssociationDisplayAtAuthorization_table = Table( "history_dataset_association_display_at_authorization", metadata, + Column( "id", Integer, primary_key=True ), + Column( "create_time", DateTime, default=now ), + Column( "update_time", DateTime, index=True, default=now, onupdate=now ), + Column( "history_dataset_association_id", Integer, ForeignKey( "history_dataset_association.id" ), index=True ), + Column( "user_id", Integer, ForeignKey( "galaxy_user.id" ), index=True ), + Column( "site", TrimmedString( 255 ) ) ) + +def upgrade(): + if migrate_engine.name == 'mysql': + # Load existing tables + metadata.reflect() + i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id ) + try: + i.create() + except Exception, e: + log.debug( "Adding index 'ix_hdadaa_history_dataset_association_id' to table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) ) + +def downgrade(): + if migrate_engine.name == 'mysql': + # Load existing tables + metadata.reflect() + i = Index( "ix_hdadaa_history_dataset_association_id", HistoryDatasetAssociationDisplayAtAuthorization_table.c.history_dataset_association_id ) + try: + i.drop() + except Exception, e: + log.debug( "Removing index 'ix_hdadaa_history_dataset_association_id' from table 'history_dataset_association_display_at_authorization' table failed: %s" % str( e ) )

1 0

[hg] galaxy 2510: Added fastqsanger data format and required bwa...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/fab59b1e756d changeset: 2510:fab59b1e756d user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Thu Jul 30 12:06:24 2009 -0400 description: Added fastqsanger data format and required bwa_wrapper to take only that format as input 9 file(s) affected in this change: datatypes_conf.xml.sample lib/galaxy/datatypes/registry.py lib/galaxy/datatypes/sequence.py lib/galaxy/datatypes/test/1.fastqsanger lib/galaxy/datatypes/test/2.fastqsanger test-data/1.fastqsanger test-data/2.fastqsanger test/functional/test_sniffing_and_metadata_settings.py tools/sr_mapping/bwa_wrapper.xml diffs (298 lines): diff -r f06777cbd5bb -r fab59b1e756d datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Thu Jul 30 11:05:03 2009 -0400 +++ b/datatypes_conf.xml.sample Thu Jul 30 12:06:24 2009 -0400 @@ -20,6 +20,7 @@ <datatype extension="fasta" type="galaxy.datatypes.sequence:Fasta" display_in_upload="true"> <converter file="fasta_to_tabular_converter.xml" target_datatype="tabular"/> </datatype> + <datatype extension="fastqsanger" type="galaxy.datatypes.sequence:FastqSanger" display_in_upload="true"/> <datatype extension="fastqsolexa" type="galaxy.datatypes.sequence:FastqSolexa" display_in_upload="true"> <converter file="fastqsolexa_to_fasta_converter.xml" target_datatype="fasta"/> <converter file="fastqsolexa_to_qual_converter.xml" target_datatype="qualsolexa"/> @@ -195,6 +196,7 @@ <sniffer type="galaxy.datatypes.qualityscore:QualityScore454"/> <sniffer type="galaxy.datatypes.sequence:Fasta"/> <sniffer type="galaxy.datatypes.sequence:FastqSolexa"/> + <sniffer type="galaxy.datatypes.sequence:FastqSanger"/> <sniffer type="galaxy.datatypes.interval:Wiggle"/> <sniffer type="galaxy.datatypes.images:Html"/> <sniffer type="galaxy.datatypes.sequence:Axt"/> diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/registry.py --- a/lib/galaxy/datatypes/registry.py Thu Jul 30 11:05:03 2009 -0400 +++ b/lib/galaxy/datatypes/registry.py Thu Jul 30 12:06:24 2009 -0400 @@ -117,6 +117,7 @@ 'customtrack' : interval.CustomTrack(), 'csfasta' : sequence.csFasta(), 'fasta' : sequence.Fasta(), + 'fastqsanger' : sequence.FastqSanger(), 'fastqsolexa' : sequence.FastqSolexa(), 'gff' : interval.Gff(), 'gff3' : interval.Gff3(), @@ -144,6 +145,7 @@ 'customtrack' : 'text/plain', 'csfasta' : 'text/plain', 'fasta' : 'text/plain', + 'fastqsanger' : 'text/plain', 'fastqsolexa' : 'text/plain', 'gff' : 'text/plain', 'gff3' : 'text/plain', @@ -173,6 +175,7 @@ qualityscore.QualityScore454(), sequence.Fasta(), sequence.FastqSolexa(), + sequence.FastqSanger(), interval.Wiggle(), images.Html(), sequence.Axt(), diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/sequence.py --- a/lib/galaxy/datatypes/sequence.py Thu Jul 30 11:05:03 2009 -0400 +++ b/lib/galaxy/datatypes/sequence.py Thu Jul 30 12:06:24 2009 -0400 @@ -176,16 +176,139 @@ except: qscore_int = False + # check length and range of quality scores if qscore_int: if len( headers[3] ) != len( headers[1][0] ): return False + if not self.check_qual_values_within_range(headers[3], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[7], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[11], 'int'): + return False + except IndexError: + pass + except IndexError: + pass else: if len( headers[3][0] ) != len( headers[1][0] ): - return False + return False + if not self.check_qual_values_within_range(headers[3][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[7][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[11][0], 'char'): + return False + except IndexError: + pass + except IndexError: + pass return True return False except: return False + def check_qual_values_within_range( self, qual_seq, score_type ): + if score_type == 'char': + for val in qual_seq: + if ord(val) < 59 or ord(val) > 104: + return False + elif score_type == 'int': + for val in qual_seq: + if int(val) < -5 or int(val) > 40: + return False + return True + + +class FastqSanger( Sequence ): + """Class representing a FASTQ sequence ( the Sanger variant )""" + file_ext = "fastqsanger" + + def set_peek( self, dataset ): + if not dataset.dataset.purged: + dataset.peek = data.get_file_peek( dataset.file_name ) + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def sniff( self, filename ): + """ + Determines whether the file is in fastqsanger format (Sanger Variant) + For details, see http://maq.sourceforge.net/fastq.shtml + + Note: There are two kinds of FASTQ files, known as "Sanger" (sometimes called "Standard") and Solexa + These differ in the representation of the quality scores + + >>> fname = get_test_fname( '1.fastqsanger' ) + >>> FastqSanger().sniff( fname ) + True + >>> fname = get_test_fname( '2.fastqsanger' ) + >>> FastqSanger().sniff( fname ) + True + """ + headers = get_headers( filename, None ) + bases_regexp = re.compile( "^[NGTAC]*$" ) + try: + if len( headers ) >= 4 and headers[0][0] and headers[0][0][0] == "@" and headers[2][0] and headers[2][0][0] == "+" and headers[1][0]: + # Check the sequence line, make sure it contains only G/C/A/T/N + if not bases_regexp.match( headers[1][0] ): + return False + # Check quality score: integer or ascii char. + try: + check = int(headers[3][0]) + qscore_int = True + except: + qscore_int = False + + # check length and range of quality scores + if qscore_int: + if len( headers[3] ) != len( headers[1][0] ): + return False + if not self.check_qual_values_within_range(headers[3], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[7], 'int'): + return False + try: + if not self.check_qual_values_within_range(headers[11], 'int'): + return False + except IndexError: + pass + except IndexError: + pass + else: + if len( headers[3][0] ) != len( headers[1][0] ): + return False + if not self.check_qual_values_within_range(headers[3][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[7][0], 'char'): + return False + try: + if not self.check_qual_values_within_range(headers[11][0], 'char'): + return False + except IndexError: + pass + except IndexError: + pass + return True + return False + except: + return False + def check_qual_values_within_range( self, qual_seq, score_type ): + if score_type == 'char': + for val in qual_seq: + if ord(val) >= 33 and ord(val) <= 126: + return True + elif score_type == 'int': + for val in qual_seq: + if int(val) >= 0 and int(val) <= 93: + return True + return False try: from galaxy import eggs diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d lib/galaxy/datatypes/test/2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/test/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11 \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test-data/1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test-data/2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/2.fastqsanger Thu Jul 30 12:06:24 2009 -0400 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +29 27 34 5 5 24 24 20 17 10 34 29 20 27 13 30 27 22 24 11 28 19 17 27 17 24 17 25 27 7 24 14 12 22 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 5 10 13 6 5 10 6 16 11 \ No newline at end of file diff -r f06777cbd5bb -r fab59b1e756d test/functional/test_sniffing_and_metadata_settings.py --- a/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 11:05:03 2009 -0400 +++ b/test/functional/test_sniffing_and_metadata_settings.py Thu Jul 30 12:06:24 2009 -0400 @@ -216,6 +216,16 @@ assert latest_hda is not None, "Problem retrieving wig hda from the database" if not latest_hda.name == '1.wig' and not latest_hda.extension == 'wig': raise AssertionError, "wig data type was not correctly sniffed." + def test_085_fastqsanger_datatype( self ): + """Testing correctly sniffing fastqsanger ( the Sanger variant ) data type upon upload""" + self.upload_file( '1.fastqsanger' ) + self.verify_dataset_correctness( '1.fastqsanger' ) + self.check_history_for_string( '1.fastqsanger format: <span class="fastqsanger">fastqsanger</span>, database: \? Info: uploaded fastqsanger file' ) + latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ + .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() + assert latest_hda is not None, "Problem retrieving fastqsanger hda from the database" + if not latest_hda.name == '1.fastqsanger' and not latest_hda.extension == 'fastqsanger': + raise AssertionError, "fastqsanger data type was not correctly sniffed." def test_9999_clean_up( self ): self.delete_history( id=self.security.encode_id( history1.id ) ) self.logout() diff -r f06777cbd5bb -r fab59b1e756d tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 11:05:03 2009 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Thu Jul 30 12:06:24 2009 -0400 @@ -71,7 +71,7 @@ <option value="history">Use one from the history</option> </param> <when value="history"> - <param name="ownFile" type="data" label="Select a reference genome" /> + <param name="ownFile" type="data" format="fasta" label="Select a reference genome" /> </when> <when value="indexed"> <param name="indices" type="select" label="Select a reference genome"> @@ -91,7 +91,7 @@ <option value="history">Use one from the history</option> </param> <when value="history"> - <param name="ownFile" type="data" label="Select a reference genome" /> + <param name="ownFile" type="data" format="fasta" label="Select a reference genome" /> </when> <when value="indexed"> <param name="indices" type="select" label="Select a reference genome"> @@ -111,11 +111,11 @@ <option value="paired">Paired-end</option> </param> <when value="single"> - <param name="input1" type="data" label="FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="FASTQ file" /> </when> <when value="paired"> - <param name="input1" type="data" label="Forward FASTQ file" /> - <param name="input2" type="data" label="Reverse FASTQ file" /> + <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" /> + <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" /> </when> </conditional> <conditional name="params">

1 0

[hg] galaxy 2509: Add a new config setting to universe_wsgi.ini:...
by Nate Coraor 30 Jul '09

30 Jul '09

details: http://www.bx.psu.edu/hg/galaxy/rev/f06777cbd5bb changeset: 2509:f06777cbd5bb user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Jul 30 11:05:03 2009 -0400 description: Add a new config setting to universe_wsgi.ini: new_user_dataset_access_role_default_private. When set to True, new users will have default dataset access permissions for histories set to their Private role. Default is False (original behavior); datasets are left as public. Resolves ticket #111. 4 file(s) affected in this change: lib/galaxy/config.py lib/galaxy/security/__init__.py lib/galaxy/web/controllers/user.py universe_wsgi.ini.sample diffs (58 lines): diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/config.py --- a/lib/galaxy/config.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/config.py Thu Jul 30 11:05:03 2009 -0400 @@ -46,6 +46,7 @@ self.require_login = string_as_bool( kwargs.get( "require_login", "False" ) ) self.allow_user_creation = string_as_bool( kwargs.get( "allow_user_creation", "True" ) ) self.allow_user_deletion = string_as_bool( kwargs.get( "allow_user_deletion", "False" ) ) + self.new_user_dataset_access_role_default_private = string_as_bool( kwargs.get( "new_user_dataset_access_role_default_private", "False" ) ) self.template_path = resolve_path( kwargs.get( "template_path", "templates" ), self.root ) self.template_cache = resolve_path( kwargs.get( "template_cache_path", "database/compiled_templates" ), self.root ) self.local_job_queue_workers = int( kwargs.get( "local_job_queue_workers", "5" ) ) diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/security/__init__.py --- a/lib/galaxy/security/__init__.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/security/__init__.py Thu Jul 30 11:05:03 2009 -0400 @@ -206,12 +206,16 @@ else: return None return role - def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False ): + def user_set_default_permissions( self, user, permissions={}, history=False, dataset=False, bypass_manage_permission=False, default_access_private = False ): # bypass_manage_permission is used to change permissions of datasets in a userless history when logging in if user is None: return None if not permissions: - permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] } + #default permissions + permissions = { self.permitted_actions.DATASET_MANAGE_PERMISSIONS : [ self.get_private_user_role( user, auto_create=True ) ] } + #new_user_dataset_access_role_default_private is set as True in config file + if default_access_private: + permissions[ self.permitted_actions.DATASET_ACCESS ] = permissions.values()[ 0 ] # Delete all of the current default permissions for the user for dup in user.default_permissions: dup.delete() diff -r e01bfc281e09 -r f06777cbd5bb lib/galaxy/web/controllers/user.py --- a/lib/galaxy/web/controllers/user.py Tue Jul 28 14:16:19 2009 -0400 +++ b/lib/galaxy/web/controllers/user.py Thu Jul 30 11:05:03 2009 -0400 @@ -157,7 +157,7 @@ user.flush() trans.app.security_agent.create_private_user_role( user ) # We set default user permissions, before we log in and set the default history permissions - trans.app.security_agent.user_set_default_permissions( user ) + trans.app.security_agent.user_set_default_permissions( user, default_access_private = trans.app.config.new_user_dataset_access_role_default_private ) # The handle_user_login() method has a call to the history_set_default_permissions() method # (needed when logging in with a history), user needs to have default permissions set before logging in trans.handle_user_login( user ) diff -r e01bfc281e09 -r f06777cbd5bb universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample Tue Jul 28 14:16:19 2009 -0400 +++ b/universe_wsgi.ini.sample Thu Jul 30 11:05:03 2009 -0400 @@ -156,6 +156,9 @@ # Can an admin user delete user accounts? #allow_user_deletion = False +# Should default dataset access permissions be private for new users; default is False (datasets are public) +new_user_dataset_access_role_default_private = False + # ---- Job Execution -------------------------------------------------------- # Number of concurrent jobs to run (local job runner)

1 0