- galaxy-dev - lists.galaxyproject.org

jupyter notebook / nginx / ssl
by cristel thomas 30 May '17

30 May '17

Hi Galaxy developers, we are trying to get notebooks to run on our production server, with half success: we can get jupyter to load, and it does access the history, but notebooks uploaded to history do not load, and any modification to the notebook provided can be saved but do not show up when the notebook is re-opened. we're running NGINX and have SSL certs in place. Any idea how to fix this? Thanks Cris

1 0

Issue with job_name, UnicodeDecodeError in drmaa
by Saravanaraj Ayyampalayam 29 May '17

29 May '17

Hello, I updated to the latest version (17.05) galaxy code. I was updating from a very old version. I fixed all the issues with except one. I am getting the following error when I submit a job. galaxy.jobs.runners ERROR 2017-05-29 01:42:44,008 (15131) Unhandled exception calling queue_job Traceback (most recent call last): File "/panfs/pstor.storage/home/qbcglab/galaxy_run/galaxy-dist/lib/galaxy/jobs/runners/__init__.py", line 104, in run_next method(arg) File "/panfs/pstor.storage/home/qbcglab/galaxy_run/galaxy-dist/lib/galaxy/jobs/runners/drmaa.py", line 132, in queue_job job_name = self._job_name(job_wrapper) File "/panfs/pstor.storage/home/qbcglab/galaxy_run/galaxy-dist/lib/galaxy/jobs/runners/drmaa.py", line 397, in _job_name job_name = ''.join( x if x in ( string.letters + string.digits + '_' ) else '_' for x in job_name ) File "/panfs/pstor.storage/home/qbcglab/galaxy_run/galaxy-dist/lib/galaxy/jobs/runners/drmaa.py", line 397, in <genexpr> job_name = ''.join( x if x in ( string.letters + string.digits + '_' ) else '_' for x in job_name ) UnicodeDecodeError: 'ascii' codec can't decode byte 0xa6 in position 52: ordinal not in range(128) I spent a day trying to debug this and didn’t get anywhere. The job_name looks OK. I would really appreciate some help from the community. Thanks! -Raj

2 7

Shiny in Galaxy
by Mohamed Kassam 26 May '17

26 May '17

Dear all, I have a shiny application working in my RStudio, but I would like to integrate it to Galaxy that the users can call my application via Galaxy . Thanks in Advance, Mohamed

2 1

protein ligand docking
by Matthias Bernt 24 May '17

24 May '17

Dear list, I have recently evaluated the software for protein docking that is available in the toolshed. I could need some help / suggestions. 1. autodock_vina The receptor of my example contains Au atoms which are not understood by autodock_vina. For autodock there is the possibility to add configuration for atoms: http://autodock.scripps.edu/faqs-help/how-to/adding-new-atom-parameters-to-… Does somebody know if this is also possible for autodock_vina in galaxy? In my pdb file there are CONECT lines which cause autodock_vina to abort. If I remove them the program runs (when the Au atoms are also removed). So this is the smaller problem (Maybe this can be solved by extending openbabel). 2. rdock Fails with a memory access failure /gpfs1/data/galaxy_server/galaxy-dev/database/dependencies/_conda/envs/__rDock(a)2013.1/bin/rbcavity: Zeile 7: 104454 Speicherzugriffsfehler (Speicherabzug geschrieben) "$RBT_ROOT/bin/$PROGNAME" "$@" 3. caddsuite_workflows + caddsuite_linux_x86_64 The installation of the workflows works, but I do not see them in galaxy? The installation of the other package fails with: No information is available for the requested repository revision. One or more of the following parameter values is likely invalid: tool_shed_url: https://toolshed.g2.bx.psu.edu/ name: caddsuite_linux_x86_64 owner: marcel changeset_revision: 026f5a483650 err_code: 400008 4. BALL I just tested one tool of the suite: ProteinProtonator. This fails with command not found. Fatal error: Exit code 127 () /gpfs1/data/galaxy_server/galaxy-dev/jobs_dir/000/165/tool_script.sh: Zeile 9: ProteinProtonator: Kommando nicht gefunden. Are there any suggestion on how to solve these problems or other options for docking with galaxy. Cheers, Matthias -- ------------------------------------------- Matthias Bernt Bioinformatics Service Molekulare Systembiologie (MOLSYB) Helmholtz-Zentrum für Umweltforschung GmbH - UFZ/ Helmholtz Centre for Environmental Research GmbH - UFZ Permoserstraße 15, 04318 Leipzig, Germany Phone +49 341 235 482296, m.bernt(a)ufz.de, www.ufz.de Sitz der Gesellschaft/Registered Office: Leipzig Registergericht/Registration Office: Amtsgericht Leipzig Handelsregister Nr./Trade Register Nr.: B 4703 Vorsitzender des Aufsichtsrats/Chairman of the Supervisory Board: MinDirig Wilfried Kraus Wissenschaftlicher Geschäftsführer/Scientific Managing Director: Prof. Dr. Dr. h.c. Georg Teutsch Administrative Geschäftsführerin/ Administrative Managing Director: Prof. Dr. Heike Graßmann -------------------------------------------

1 0

python subprocess OSError when running bwa-mem
by Georgios Nikolis 24 May '17

24 May '17

2 3

Decrease Galaxy polling of slurm?
by Philip Blood 24 May '17

24 May '17

An admin at our center noticed our Galaxy instance is polling slurm every second and asked if the polling frequency can be decreased. Is there an easy way to do this? Phil -- Philip D. Blood, Ph.D. Senior Computational Scientist Voice: (412) 268-9329 Pittsburgh Supercomputing Center Fax: (412) 268-5832 Carnegie Mellon University Email: blood(a)psc.edu

2 2

vcftools - errors running vcf-merge
by Poole, Richard 24 May '17

24 May '17

Hi all, I am trying to run the vcf-merge tool, which depends on the vcftools 0.1.11 package. I have this vcftools package and also the required tabix 0.2.6 both installed via the toolshed (tabix is set in the PATH of the Galaxy startup script). However, I keep getting gunzip error messages such as the following: Log: tool progress gunzip: error writing to output: Broken pipe gunzip: 0.vcf.sorted.gz: uncompress failed Using column name 'mutant' for 0.vcf.sorted.gz:mutant Using column name 'sibling' for 0.vcf.sorted.gz:sibling gunzip: error writing to output: Broken pipe gunzip: 1.vcf.sorted.gz: uncompress failed Using column name '1.vcf.sorted_mutant' for 1.vcf.sorted.gz:mutant Using column name '1.vcf.sorted_sibling' for 1.vcf.sorted.gz:sibling Does anyone have any idea how to solve this? The command that the wrapper is generating is: vcf-sort /Volumes/ngs/database/files/058/dataset_58073.dat > 0.vcf.sorted ; bgzip 0.vcf.sorted ; tabix -p vcf 0.vcf.sorted.gz ; vcf-sort /Volumes/ngs/database/files/058/dataset_58078.dat > 1.vcf.sorted ; bgzip 1.vcf.sorted ; tabix -p vcf 1.vcf.sorted.gz ; vcf-merge 0.vcf.sorted.gz 1.vcf.sorted.gz > /Volumes/ngs/database/files/058/dataset_58489.dat Thanks, Richard

1 0

cluster access
by Matthias Bernt 22 May '17

22 May '17

Dear list, I'm just starting to get jobs submitted to our cluster as real system user. I read in the documentation that the name of the system user is determined by "the Galaxy user's email address (with the @domain stripped off)". But this does not work on our system, rather the username stored in the galaxy_user table is the name of the user (this is correctly generated by the LDAP login). The job runner script seems to get the user id, so I guess I need to dig deeper. So my question is: Where could I change this behavior? Thanks a lot. Cheers, Matthias -- ------------------------------------------- Matthias Bernt Bioinformatics Service Molekulare Systembiologie (MOLSYB) Helmholtz-Zentrum für Umweltforschung GmbH - UFZ/ Helmholtz Centre for Environmental Research GmbH - UFZ Permoserstraße 15, 04318 Leipzig, Germany Phone +49 341 235 482296, m.bernt(a)ufz.de, www.ufz.de Sitz der Gesellschaft/Registered Office: Leipzig Registergericht/Registration Office: Amtsgericht Leipzig Handelsregister Nr./Trade Register Nr.: B 4703 Vorsitzender des Aufsichtsrats/Chairman of the Supervisory Board: MinDirig Wilfried Kraus Wissenschaftlicher Geschäftsführer/Scientific Managing Director: Prof. Dr. Dr. h.c. Georg Teutsch Administrative Geschäftsführerin/ Administrative Managing Director: Prof. Dr. Heike Graßmann -------------------------------------------

2 4

OpenBabel Requirements
by Matthias Bernt 22 May '17

22 May '17

Dear galaxy-dev list, I have problems to install package_openbabel. The problem seems to be that cmake is not found during installation. The documentation also states that: "Compiling OpenBabel requires g++ and CMake 2.4+" My question is: Does this refer to cmake installed on the system or in galaxy (since there is also package_cmake_3_2_3)? Thanks a lot. Cheers, Matthias

2 6

Which ID ('id', 'workflow_id', and 'dataset_id') should be used?
by Aarthi Mohan 22 May '17

22 May '17

Hi all, I will appreciate your help in understanding the 'id' key returned from the API. I am using Galaxy Version 15.03 & bioblend Version 0.8.0. Example: I have highlighted the id and related fields with bold and red. >>> workflowClient.get_invocations('f7bb1edd6b95db62') > [{u'inputs': {u'1': {u'src': u'hda', u'id': u'06d9fe130fbe098e'}}, > u'update_time': u'2017-05-17T03:09:10', u'uuid': > u'fd066a98-3aad-11e7-90e9-1cc1de6d5ef4', u'history_id': > u'b8a0d6158b9961df', u'state': u'scheduled', *u'workflow_id': > u'915ae9a80309f157'*, u'steps': > ... > u'model_class': u'WorkflowInvocation', *u'id': u'8c49be448cfe29bc'*}] Why is the '*workflow_id*' different from the one I passed to the fucntion? And why is that '*workflow_id' *is not found anywhere in the return value? >>> historyClient.show_dataset(hid,'468b2dfe96a5a9a1') > {u'accessible': True, u'resubmitted': False, u'create_time': > u'2017-05-17T03:04:02', u'download_url': > u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1/display', > u'file_size': 545, *u'dataset_id': u'56c890cbef28295c', u'id': > u'468b2dfe96a5a9a1'*, u'misc_info': u'uploaded fastqsanger file', > u'hda_ldda': u'hda', u'metadata_sequences': 5, u'state': u'ok', > u'display_types': [], u'display_apps': [], u'type': u'file', u'file_path': > None, u'misc_blurb': u'5 sequences', u'peek': u'<table cellspacing="0" > cellpadding="3"><tr><td>@1</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr><tr><td>+</td></tr><tr><td>IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII</td></tr><tr><td>@2</td></tr><tr><td>tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact</td></tr></table>', > u'update_time': u'2017-05-17T03:04:06', u'data_type': > u'galaxy.datatypes.sequence.FastqSanger', u'tags': [], u'deleted': False, > u'history_id': u'b8a0d6158b9961df', u'meta_files': [], u'genome_build': > u'?', u'hid': 1, u'model_class': u'HistoryDatasetAssociation', > u'metadata_data_lines': 20, u'file_ext': u'fastqsanger', u'annotation': > None, u'metadata_dbkey': u'?', u'history_content_type': u'dataset', *u'name': > u'a_1.fastq'*, u'extension': u'fastqsanger', u'visible': True, u'url': > u'/api/histories/b8a0d6158b9961df/contents/468b2dfe96a5a9a1', u'uuid': > u'aa6dcf49-6fe9-49e0-8064-c8bc275a37d5', u'visualizations': [], u'purged': > False, u'api_type': u'file'} > >>> historyClient.show_dataset(hid,'56c890cbef28295c') > {u'accessible': True, u'resubmitted': False, u'create_time': > u'2017-05-17T02:59:27', u'file_size': 64, *u'dataset_id': > u'9ccf9e6f1cf4d1fa', u'id': u'56c890cbef28295c'*, u'misc_info': > u'##fileformat=VCFv4.1\n##FILTER=<ID=PASS,Description="All filters > passed">\n##fileDate=20170517\n##source=freeBayes > v0.9.20\n##reference=localref.fa\n##phasing=none\n##commandline="freebayes > --bam localbam_0.bam --fasta-reference localref.fa --vcf /home/sphadmi', > u'hda_ldda': u'hda', u'download_url': > u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c/display', > u'state': u'ok', u'display_types': [], u'display_apps': [], u'type': > u'file', u'file_path': None, u'misc_blurb': u'0 lines', u'peek': u'<table > cellspacing="0" cellpadding="3"><tr><td>#Calculation and writing of high > density regions has completed.</td></tr></table>', u'update_time': > u'2017-05-17T02:59:36', u'data_type': u'galaxy.datatypes.data.Text', > u'tags': [], u'deleted': False, u'history_id': u'06ec17aefa2d49dd', > u'meta_files': [], u'genome_build': u'?', u'hid': 44, u'model_class': > u'HistoryDatasetAssociation', u'metadata_data_lines': None, u'file_ext': > u'txt', u'annotation': None, u'metadata_dbkey': u'?', > u'history_content_type': u'dataset', *u'name': u'High density regions',* > u'extension': u'txt', u'visible': False, u'url': > u'/api/histories/06ec17aefa2d49dd/contents/56c890cbef28295c', u'uuid': > u'8b8c70a4-cd2e-43d3-bc77-b06511557c96', u'visualizations': [], u'purged': > False, u'api_type': u'file'} Similarly, here the '*dataset_id' *is different from the one I passed to *show_dataset* method. If I check the '*dataset_id*' from first call, it points to another different file! Please let me know which of these 'id' should be used and what would be the purpose of the other id? Thanks for your help and time! Best, Aarthi

2 2