- galaxy-dev - lists.galaxyproject.org

Running galaxy as an unprivileged user
by simon andrews (BI) 28 Jul '10

28 Jul '10

I'm in the process of setting up a multi-user galaxy server and am trying to sort out permissions and am having some problems. What I'd like to end up with ideally would be: * A galaxy-dist folder owned by a normal user * The galaxy server running as an unprivileged user 'galaxy' and bound to port 80 At the moment I'm having to have the galaxy user own the galaxy-dist directory and bound to port 8080. So I have a couple of questions: 1) Within galaxy-dist is there are list of locations which the owner of the server process will need to read and write to so I can open up permissions on just these files/directories? 2) Is there any way to have the server be launched as root so it can bind to port 80, but then drop privileges to run as an unprivileged user after that? I found a bug on the paster.py trac site saying this wasn't something they were going to implement (there is a --user option but it drops its privileges too early), but that individual servers could implement it. Thanks Simon.

2 1

Re: [galaxy-dev] Dynamically adding tools to Galaxy
by Sumedha Ganjoo 27 Jul '10

27 Jul '10

Great! I am glad to hear that.. Regards, Sumedha On Mon, Jul 26, 2010 at 8:22 PM, Minh Bui <buiduyminh(a)gmail.com> wrote: > it works great. Thank you for the tool. > > On Mon, Jul 26, 2010 at 7:31 PM, Sumedha Ganjoo <sumedha.coep(a)gmail.com> > wrote: >> >> refreshTool.py is an empty file currently...u can just create an empty >> file called refreshTool.py at '/home/minh/galaxy_dist/tools/mystuff/' >> >> Then execute the tool.It should work >> >> Please let me know if you have any questions, >> >> Regards, >> Sumedha >> >> On Fri, Jul 23, 2010 at 10:22 AM, Minh Bui <buiduyminh(a)gmail.com> wrote: >> > Hi Sumedha, >> > I got this error when i execute the Refresh tool >> > An error occurred running this job: python: can't open file >> > '/home/minh/galaxy_dist/tools/mystuff/refreshTool.py': [Errno 2] No such >> > file or directory >> > Look like its missing refreshtool.py or Am I doing something wrong? >> > Where to >> > do place that refreshTool.xml? >> > Thank you, >> > >> > On Thu, Jul 22, 2010 at 6:40 PM, Sumedha Ganjoo <sumedha.coep(a)gmail.com> >> > wrote: >> >> >> >> Hello, >> >> >> >> We here at the Universoty of Georgia have developed a suite of tools >> >> to enable accessing >> >> Web services through Galaxy's interface, one time and also in >> >> workflows. We do this by reading >> >> the descriptions of the Web services (from WSDLs and WADLs) and adding >> >> tools dynamically to >> >> Galaxy that are able to take correct inputs from the user and invoke >> >> these services. >> >> >> >> Though most of this functionality was added by adding tools, we had to >> >> make minimal change in Galaxy's >> >> source code to support the capability of refreshing Galaxy toolbox >> >> without restarting the server. >> >> This is hardly 5 lines of code that was added to Galaxy's code base. >> >> These tools will be available shortly >> >> on the community page. I was wondering if it will be possible to add >> >> the support for dynamic tool addition >> >> to the main instance of Galaxy. Please find the details below: >> >> >> >> >> >> Changes to Galaxy to add refresh toolbox ability: >> >> 1. change the execute method of the class tool in >> >> lib/galaxy/tools/__init__.py to >> >> >> >> def execute( self, trans, incoming={}, set_output_hid=True ): >> >> """ >> >> Execute the tool using parameter values in `incoming`. This just >> >> dispatches to the `ToolAction` instance specified by >> >> `self.tool_action`. In general this will create a `Job` that >> >> when run will build the tool's outputs, e.g. >> >> `DefaultToolAction`. >> >> """ >> >> >> >> ############# >> >> #add code to verify if user has administrative privileges >> >> #added by sumedha ganjoo, sganjoo(a)uga.edu: line 1104 to 1109 - >> >> to refresh toolbox >> >> if self.id == 'REFRESH_ID': >> >> self.app.refreshToolBox() >> >> ############# >> >> >> >> return self.tool_action.execute( self, trans, >> >> incoming=incoming, set_output_hid=set_output_hid ) >> >> >> >> 2. add refreshToolBox method (find below) to UniverseApplication class >> >> in lib/galaxy/app.py >> >> >> >> ########### >> >> # added by sumedha ganjoo,sganjoo(a)uga.edu, line 86-90 >> >> def refreshToolBox( self): >> >> self.toolbox = tools.ToolBox( self.config.tool_config, >> >> self.config.tool_path, self ) >> >> ########### >> >> >> >> >> >> 3. Add Refresh tool. Attached. >> >> >> >> Thanks, >> >> Sumedha >> >> >> >> >> >> On Tue, May 4, 2010 at 10:37 AM, Nate Coraor <nate(a)bx.psu.edu> wrote: >> >> > Sumedha Ganjoo wrote: >> >> >> >> >> >> Hello, >> >> >> >> >> >> I am a student at the University Of Georgia. We had developed a tool >> >> >> for >> >> >> Galaxy 1.3 that enables accessing >> >> >> various web services as tools from Galaxy. >> >> >> >> >> >> We are currently working on a similar tool for the current version >> >> >> of >> >> >> Galaxy. This requires adding a tool dynamically >> >> >> without having to restart Galaxy. I was wondering if someone has >> >> >> already >> >> >> implemented that feature? We do have most >> >> >> of the code for this in place. Is there a way, once complete, this >> >> >> code >> >> >> can be added to the main Galaxy source code? >> >> > >> >> > Hi Sumedha, >> >> > >> >> > This is on our to-do list - if you already have it implemented and it >> >> > fits >> >> > our design goals, we would likely add it to the source. Please send >> >> > along a >> >> > patch or create a fork in Bitbucket once it's ready. >> >> > >> >> >> Also I would really appreciate if someone could tell me where can I >> >> >> find >> >> >> the older versions ( v 1.3 ) of Galaxy? >> >> > >> >> > Galaxy 1 is about 5 or 6 years old now and was basically unrelated >> >> > sourcewise to Galaxy 2. I'm not sure where the source is now, >> >> > although >> >> > I >> >> > might be able to find it if necessary. Do you need something in >> >> > specific >> >> > from it? >> >> > >> >> >> Thanks in advance. >> >> >> >> >> >> Regards, >> >> >> Sumedha >> >> >> >> >> >> Sumedha Ganjoo >> >> >> Graduate Assistant >> >> >> Computer Science Department >> >> >> University Of Georgia >> >> >> >> >> >> >> >> >> >> >> >> >> >> >> ------------------------------------------------------------------------ >> >> >> >> >> >> _______________________________________________ >> >> >> galaxy-dev mailing list >> >> >> galaxy-dev(a)lists.bx.psu.edu >> >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> > >> >> > >> >> >> >> >> >> >> >> -- >> >> Sumedha Ganjoo >> >> Graduate Assistant, >> >> Department Of Computer Science, >> >> University Of Georgia, >> >> Athens, GA , USA >> >> >> >> _______________________________________________ >> >> galaxy-dev mailing list >> >> galaxy-dev(a)lists.bx.psu.edu >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> >> > >> > >> >> >> >> -- >> Sumedha Ganjoo >> Graduate Assistant, >> Department Of Computer Science, >> University Of Georgia, >> Athens, GA , USA > > -- Sumedha Ganjoo Graduate Assistant, Department Of Computer Science, University Of Georgia, Athens, GA , USA

1 0

Conf files?
by Minh Bui 27 Jul '10

27 Jul '10

Hi, I am running local galaxy and I just wrote a script that allowed me to create a config file for Gbrowse (*.conf) but I dont think Galaxy supports *.conf files. I tried to save the file but Galaxy saved it under "Download" name without extension . What can I do to make Galaxy supports *.conf files? Thank you, Minh.

1 0

Dynamically adding tools to Galaxy
by Sumedha Ganjoo 27 Jul '10

27 Jul '10

Hello, I am a student at the University Of Georgia. We had developed a tool for Galaxy 1.3 that enables accessing various web services as tools from Galaxy. We are currently working on a similar tool for the current version of Galaxy. This requires adding a tool dynamically without having to restart Galaxy. I was wondering if someone has already implemented that feature? We do have most of the code for this in place. Is there a way, once complete, this code can be added to the main Galaxy source code? Also I would really appreciate if someone could tell me where can I find the older versions ( v 1.3 ) of Galaxy? Thanks in advance. Regards, Sumedha Sumedha Ganjoo Graduate Assistant Computer Science Department University Of Georgia

4 7

Question about galaxy
by Simon Lank 26 Jul '10

26 Jul '10

Hi. We have a new server and are planning to dedicate it exclusively to Galaxy. We've previously set up galaxy on OS X, and Ubuntu. I'm wondering if you guys have a preferred linux distribution that you know works well for galaxy. We'd like to spend as little time configuring the dependencies as possible (we already spent a while getting things working in os x), so any advice on the most streamlined distribution (from galaxy's perspective) would be appreciated. Regards, Simon Simon Lank Associate Research Specialist O'Connor Lab, WNPRC 555 Science Dr. Madison WI (608) 265-3389

3 2

July 26, 2010 Galaxy Development News Brief
by Greg Von Kuster 26 Jul '10

26 Jul '10

The latest news brief is available at the following link. http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2010_… Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu

1 0

How to add megablast database?
by Kelly Vincent 26 Jul '10

26 Jul '10

Begin forwarded message: > From: Kelly Vincent <kpvincent(a)bx.psu.edu> > Date: July 26, 2010 11:23:47 AM EDT > To: buiduyminh(a)gmail.com > Cc: Galaxy Lab <galaxy-lab(a)bx.psu.edu> > Subject: Re: [galaxy-lab] [galaxy-dev] How to add megablast database? > > Hi, > > See the wiki page http://bitbucket.org/galaxy/galaxy-central/wiki/NGSLocalSetup > for information on getting the database files in place. > > If you want to use blastn instead of megablast, you would just need > to modify the wrapper slightly. You will at minimum need to modify > tools/metag_tools/megablast_wrapper.py, by changing the command-line > call (line 72) appropriately. If you need only the same parameters > as megablast uses, you can just change the python file that is > called in the command tag in tools/metag_tools/ > megablast_wrapper.xml. Otherwise, you'll need to add relevant > parameters to the XML and python files. > > Let us know if you need any further assistance. > > Regards, > Kelly > > > > > > > On Jul 24, 2010, at 10:56 AM, Minh Bui wrote: > >> Hi, >> >> I am using local Galaxy on my computer. I would like to use >> megablast but I don't know how to add wgs and nt database to local >> galaxy (I am new to galaxy). >> >> 1. Where can I download those databases (if you dont mind, can you >> give me the link?) ? >> 2. How can I add those databases to galaxy? >> 3. What if I want to do BLASTN instead of megablast, how can I do >> that? >> >> Thank you very much, >> _______________________________________________ >> galaxy-dev mailing list >> galaxy-dev(a)lists.bx.psu.edu >> http://lists.bx.psu.edu/listinfo/galaxy-dev > > _______________________________________________ > galaxy-lab mailing list > galaxy-lab(a)lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-lab

1 0

How to add megablast database?
by Minh Bui 24 Jul '10

24 Jul '10

Hi, I am using local Galaxy on my computer. I would like to use megablast but I don't know how to add wgs and nt database to local galaxy (I am new to galaxy). 1. Where can I download those databases (if you dont mind, can you give me the link?) ? 2. How can I add those databases to galaxy? 3. What if I want to do BLASTN instead of megablast, how can I do that? Thank you very much,

1 0

Huge memory usage in latest Galaxy
by Assaf Gordon 23 Jul '10

23 Jul '10

Hello all, After upgrading to a recent version (47411bb09df4), memory usage reaches 12GB per python process after less then 48 hours (with normal usage by users). It only happens with the web-side processes, the job-runner process and the reports process are at their usual usage level. Debug is off and Interactive is off, The major change is that I've started using SGE (with DRMAA). Any tips would be very appreciated. -gordon

2 3

Re: [galaxy-dev] [galaxy-bugs] Fwd: [galaxy-user] Galaxy Tool Shed now includes the ability to upload an archive consisting of a suite of tools in addition to a single tool archive
by Anton Nekrutenko 23 Jul '10

23 Jul '10

Ameena: 454 gives two types of files - reads in fasta format: >FWV11AZ02JY4XI length=110 xy=3973_2596 region=2 run=R_2009_06_02_15_16_12_TTCATGGAGAAGGCTTAGTGCTCTTTACACAGCCACTAACAACAGGTGAGGTGCTTATAAGTCTCAATCAGAAACAGAGTCTTACCCTTCGTTATTCTAAACAAACTACT >FWV11AZ02G3SEQ length=134 xy=2796_1792 region=2 run=R_2009_06_02_15_16_12_TTCTATTTAAGGTGCACATGGTTGAGCTCTAGGGCTTTTTAAGACACTGTGAATCTCAAATTATTTGCATGACTTGAAAGGGCACTTTGAATTAGTGAAAAGTCTTGGGAATACCAAAAAAATTTTTAATTTTT and associated quality scores: >FWV11AZ02JY4XI length=110 xy=3973_2596 region=2 run=R_2009_06_02_15_16_12_37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 37 37 37 37 37 37 35 33 33 33 32 31 31 24 24 15 15 15 15 15 29 30 28 27 27 26 26 30 23 23 23 18 17 14 19 13 13 14 17 17 19 16 16 17 16 20 16 16 16 17 14 12 14 14 >FWV11AZ02G3SEQ length=134 xy=2796_1792 region=2 run=R_2009_06_02_15_16_12_37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 31 31 31 40 28 28 28 28 28 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 30 30 30 37 37 37 37 37 37 37 37 37 36 36 36 36 37 37 37 37 37 37 37 37 37 37 37 35 35 34 16 16 17 17 17 14 15 15 15 12 12 12 10 10 11 11 11 11 11 In the case of metagenomic analysis you only need quality scores if you will be doing selection of high quality segments from your reads, which you can skip if you do not have quality files handy. However, before you begin make sure you understand what is involved in this analysis. A good place to start would a galaxy page for our Genome Research publication: http://main.g2.bx.psu.edu/u/aun1/p/windshield-splatter Thanks, anton galaxy team On Jul 23, 2010, at 12:44 PM, Anton Nekrutenko wrote: > Ameena: > > I am forwarding this to galaxy-bugs mailing list, which more appropriate for your question. > > anton > galaxy team > > Begin forwarded message: > >> From: "Ameena Nalim" <fanalim(a)nmsu.edu> >> Date: July 23, 2010 11:30:48 AM EDT >> To: galaxy-dev(a)bx.psu.edu >> Subject: Re: [galaxy-dev] [galaxy-user] Galaxy Tool Shed now includes the ability to upload an archive consisting of a suite of tools in addition to a single tool archive >> >> >> Hi! >> I am a new user. I have tried unsuccessfully to follow the steps in the >> screencasts for Metagenome Analysis with Galaxy. >> I have successfully uploaded the fasta file in .fas and .fna format from >> 454 sequencing. The dataset is some 150k plus sequences. >> I am unable to create a quality score format to proceed. >> Is this something to do with my fasta file? >> >> My goal is to draw a phylogeny like that possible with MEGAN >> Would you be able to suggest a workflow that will work? >> I have added this email to share my history. >> My public name is fanalim >> the history is the only one saved >> >> thanks >> Ameena >> >> >>> Hello Galaxy Community, >>> >>> The Galaxy Community Space has been renamed to be the Galaxy Tool Shed ( >> contributed by Dave Clements ), the location is still >>> http://usegalaxy.org/community. >>> >>> The site now includes the ability to upload an archive consisting of a >> suite of tools in addition to a single tool archive. >>> >>> Here is the information about uploading both of these types of archives. >> Please start sharing tools, and let us know if you encounter any >> problems. >>> Also, let us know what new features you would like to see in the tool >>> shed. Our next update will include the ability to rate tools. >>> >>> >>> Creating an archive containing a tool or a suite of tools >>> A tool or tool suite archive is a tar-format file (bzipped or gzipped >> tar are valid) containing all the files necessary to load the tool(s) >> into a Galaxy instance. >>> >>> Tool Suite Archive >>> >>> A tools suite must include a file named suite_config.xml which provides >> information about the id, name, version and description of the tool >> suite, as well as the id, name, version and description of each tool in >> the suite. Here is an example suite_config.xml file. >>> >>> >>> <suite id="lastz_toolsuite" name="Suite of Lastz tools" >>> version="1.0.0"> >>> <description>This suite contains all of my Lastz tools for >>> Galaxy</description> >>> <tool id="lastz_wrapper_2" name="Lastz" version="1.1.0"> >>> <description> map short reads against reference >>> sequence</description> >>> </tool> >>> <tool id="lastz_paired_reads_wrapper" name="Lastz paired reads" >>> version="1.0.0"> >>> <description> map short paired reads against reference >>> sequence</description> >>> </tool> >>> </suite> >>> >>> >>> New versions of the suite can be uploaded, replacing an older version of >> the suite, but the version attribute of the tag must be altered the same >> way that the version attribute of a single tool config must be altered >> if uploading a new version of a tool. >>> >>> The id, name and version attributes of each tag in the suite_config.xml >> file must exactly match the same attributes in each associated tool >> config in the archive or you will not be allowed to upload the archive. >>> >>> In addition to the suite_config.xml file, the archive must include all >> tool config files, executables, functional test data (if your tool >> config includes functional tests) and other files needed for each of the >> tools in your suite to function within Galaxy. See the information about >> single tool archives below for additional hints to enable ease-of-use >> when others download your suite of tools. >>> >>> For example, to package the above Lastz suite of tools: >>> >>> user@host:~% tar jcvf ~/Desktop/galaxy_lastz_toolsuite.tar.bz2 >>> lastzsuite >>> lastzsuite/ >>> lastzsuite/README >>> lastzsuite/suite_config.xml >>> lastzsuite/lastz_paired_reads_wrapper.py >>> lastzsuite/lastz_paired_reads_wrapper.xml >>> lastzsuite/lastz_wrapper.py >>> lastzsuite/lastz_wrapper.xml >>> lastzsuite/lastz-distrib-1.02.00/ >>> lastzsuite/lastz-distrib-1.02.00/src/ >>> lastzsuite/lastz-distrib-1.02.00/src/Makefile >>> lastzsuite/lastz-distrib-1.02.00/src/version.mak >>> lastzsuite/lastz-distrib-1.02.00/src/lastz.c >>> lastzsuite/lastz-distrib-1.02.00/src/lastz.h >>> ... >>> ~/Desktop/galaxy_lastz_tool.tar.bz2 is now ready to be uploaded. >>> >>> Single Tool Archive >>> >>> A single tool archive must include a tool config file and will probably >> also include a tool script. If any steps are necessary to install your >> tool beyond the basic instructions below, include a README file to >> provide details. If the tool (or parts of it) are written in C, the >> source code can be included (or put links to the source in the README). >> Do not include pre-compiled binaries without source since Galaxy is run >> on a wide variety of platforms. Also, if you are only wrapping or >> providing a Galaxy config for a tool that is not your own, be sure the >> license allows for >>> redistribution before including any part of that tool in the archive. >>> >>> There are no requirements about the directory structure inside the >> archive, but for ease of use it's generally a good idea to put >> everything inside a sub-directory, instead of directly at the top level. >>> >>> For example, to package the Lastz tool's config file, Galaxy wrapper, >> and the C source: >>> >>> user@host:~% tar jcvf ~/Desktop/galaxy_lastz_tool.tar.bz2 lastz lastz/ >>> lastz/README >>> lastz/lastz_wrapper.py >>> lastz/lastz_wrapper.xml >>> lastz/lastz-distrib-1.02.00/ >>> lastz/lastz-distrib-1.02.00/src/ >>> lastz/lastz-distrib-1.02.00/src/Makefile >>> lastz/lastz-distrib-1.02.00/src/version.mak >>> lastz/lastz-distrib-1.02.00/src/lastz.c >>> lastz/lastz-distrib-1.02.00/src/lastz.h >>> ... >>> ~/Desktop/galaxy_lastz_tool.tar.bz2 is now ready to be uploaded. >>> >>> Editing Information, Categories, and Submitting For Approval >>> >>> Simply uploading a tool to the Galaxy too shed will not allow other >> users to find and download your tool. It will need to be approved by an >> administrator before it appears in the tool list. >>> >>> After your archive has successfully uploaded, you will be redirected to >> the Edit Tool page. Provide a detailed description of what the tool does >> - this will be used by administrators to understand the tool before >> approving it for display on the site. Once approved, this information >> will be displayed to users who view your tool. In addition, the site >>> administrators will have configured a number of categories with which >> you can associate your tool to make it easy to find by users looking to >> solve specific problems. Associate as many categories as are relevant to >> your tool. You may change the description and associated categories as >> often as you'd like until you click the "Submit for approval" button. >> Once submitted, the tool will be approved or rejected by an >> administrator. If the tool is rejected, you will see information about >> why it was rejected, and you can make appropriate changes to the archive >> and re-submit it for approval. When it is approved, your archive will be >> visible to everyone. At that point, the description and associated >> categories can only be changed by an administrator. >>> >>> When the tool has been approved or rejected, you may upload a new >> version by browsing to the tool's "View Tool" page, clicking the "Tool >> actions" menu in the upper right corner of the page, and selecting >> "Upload a new version" from the menu. >>> >>> Downloading and Installing Tools >>> >>> A tool's download link will send you the tool archive. Once downloaded, >> unpack the tool on your local Galaxy instance's server: >>> >>> user@host:~% tar xvf galaxy_lastz_tool.tar >>> ... >>> user@host:~% tar zxvf galaxy_lastz_tool.tar.gz >>> ... >>> user@host:~% tar jxvf galaxy_lastz_tool.tar.bz2 >>> ... >>> If the archive includes a README file, consult it for installation >> instructions. If not, follow these basic steps: >>> Create a directory under galaxy_dist/tools/ to house downloaded tool(s). >> In the new directory, place the XML and any script file(s) which were >> contained in the archive. >>> If the tool includes binaries, you'll need to copy them to a directory >> on your $PATH. If the tool depends on C binaries but does not come with >> them (only source), you'll need to compile the source first. >>> Add the tool to galaxy_dist/tool_conf.xml. >>> Restart your Galaxy server process. >>> >>> In the near future, we plan to implement a more direct method to install >> tools via the Galaxy administrator user interface instead of placing >> files on the filesystem and manually managing the tool_conf.xml file. >>> >>> >>> >>> Greg Von Kuster >>> Galaxy Development Team >>> greg(a)bx.psu.edu >>> >>> >>> >>> _______________________________________________ >>> galaxy-user mailing list >>> galaxy-user(a)lists.bx.psu.edu >>> http://lists.bx.psu.edu/listinfo/galaxy-user >>> >> >> >> -- >> F. Ameena Nalim, Ph.D >> Department of Plant & Environmental Sciences >> Adj. Faculty, Molecular Biology Program >> New Mexico State University >> Las Cruces, NM 88003 >> e-mail:fanalim@nmsu.edu >> http://aces.nmsu.edu/academics/adrianunc/labmembers.html >> http://research.nmsu.edu/molbio/ >> >> >> >> -- >> F. Ameena Nalim, Ph.D >> Department of Plant & Environmental Sciences >> Adj. Faculty, Molecular Biology Program >> New Mexico State University >> Las Cruces, NM 88003 >> e-mail:fanalim@nmsu.edu >> http://aces.nmsu.edu/academics/adrianunc/labmembers.html >> http://research.nmsu.edu/molbio/ >> >> _______________________________________________ >> galaxy-dev mailing list >> galaxy-dev(a)lists.bx.psu.edu >> http://lists.bx.psu.edu/listinfo/galaxy-dev > > Anton Nekrutenko > http://nekrut.bx.psu.edu > http://usegalaxy.org > > > > _______________________________________________ > galaxy-bugs mailing list > galaxy-bugs(a)lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-bugs Anton Nekrutenko http://nekrut.bx.psu.edu http://usegalaxy.org

1 0