1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/148dc33de394/
changeset: 148dc33de394
user: dan
date: 2011-09-09 16:16:48
summary: Add the ability for a user to log out of all user sessions. Function can be accessed under user preferences when logged in.
affected #: 3 files (1.2 KB)
--- a/lib/galaxy/web/controllers/user.py Thu Sep 08 12:09:10 2011 -0400
+++ b/lib/galaxy/web/controllers/user.py Fri Sep 09 10:16:48 2011 -0400
@@ -363,7 +363,7 @@
else:
refresh_frames = [ 'masthead', 'history' ]
message, status, user, success = self.__validate_login( trans, webapp, **kwd )
- if success and referer and referer != trans.request.base + url_for( controller='user', action='logout' ):
+ if success and referer and not referer.startswith( trans.request.base + url_for( controller='user', action='logout' ) ):
redirect_url = referer
elif success:
redirect_url = url_for( '/' )
@@ -414,7 +414,7 @@
success = True
return ( message, status, user, success )
@web.expose
- def logout( self, trans, webapp='galaxy' ):
+ def logout( self, trans, webapp='galaxy', logout_all=False ):
if webapp == 'galaxy':
if trans.app.config.require_login:
refresh_frames = [ 'masthead', 'history', 'tools' ]
@@ -424,7 +424,7 @@
refresh_frames = [ 'masthead' ]
# Since logging an event requires a session, we'll log prior to ending the session
trans.log_event( "User logged out" )
- trans.handle_user_logout()
+ trans.handle_user_logout( logout_all=logout_all )
message = 'You have been logged out.<br>You can log in again, <a target="_top" href="%s">go back to the page you were visiting</a> or <a target="_top" href="%s">go to the home page</a>.' % \
( trans.request.referer, url_for( '/' ) )
return trans.fill_template( '/user/logout.mako',
--- a/lib/galaxy/web/framework/__init__.py Thu Sep 08 12:09:10 2011 -0400
+++ b/lib/galaxy/web/framework/__init__.py Fri Sep 09 10:16:48 2011 -0400
@@ -543,7 +543,7 @@
self.sa_session.flush()
# This method is not called from the Galaxy reports, so the cookie will always be galaxysession
self.__update_session_cookie( name=cookie_name )
- def handle_user_logout( self ):
+ def handle_user_logout( self, logout_all=False ):
"""
Logout the current user:
- invalidate the current session
@@ -553,6 +553,14 @@
prev_galaxy_session.is_valid = False
self.galaxy_session = self.__create_new_session( prev_galaxy_session )
self.sa_session.add_all( ( prev_galaxy_session, self.galaxy_session ) )
+ galaxy_user_id = prev_galaxy_session.user_id
+ if logout_all and galaxy_user_id is not None:
+ for other_galaxy_session in self.sa_session.query( self.app.model.GalaxySession ) \
+ .filter( and_( self.app.model.GalaxySession.table.c.user_id==galaxy_user_id,
+ self.app.model.GalaxySession.table.c.is_valid==True,
+ self.app.model.GalaxySession.table.c.id!=prev_galaxy_session.id ) ):
+ other_galaxy_session.is_valid = False
+ self.sa_session.add( other_galaxy_session )
self.sa_session.flush()
# This method is not called from the Galaxy reports, so the cookie will always be galaxysession
self.__update_session_cookie( name='galaxysession' )
--- a/templates/user/index.mako Thu Sep 08 12:09:10 2011 -0400
+++ b/templates/user/index.mako Fri Sep 09 10:16:48 2011 -0400
@@ -18,6 +18,13 @@
%if trans.app.config.enable_openid:
<li><a href="${h.url_for( controller='user', action='openid_manage', cntrller=cntrller )}">${ ('Manage OpenIDs')}</a> linked to your account</li>
%endif
+ %if trans.app.config.use_remote_user:
+ %if trans.app.config.remote_user_logout_href:
+ <li><a href="${trans.app.config.remote_user_logout_href}" target="_top">${_('Logout')}</a></li>
+ %endif
+ %else:
+ <li><a href="${h.url_for( controller='user', action='logout', logout_all=True )}" target="_top">${_('Logout')}</a> ${_('of all user sessions')}</li>
+ %endif
%else:
<li><a href="${h.url_for( controller='user', action='manage_user_info', cntrller=cntrller, webapp='community' )}">${_('Manage your information')}</a></li>
%endif
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/314d41df7881/
changeset: 314d41df7881
user: dan
date: 2011-09-08 16:34:56
summary: Minor tool help updates.
affected #: 8 files (1.6 KB)
--- a/tools/fastx_toolkit/fasta_clipping_histogram.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Sep 08 10:34:56 2011 -0400
@@ -99,6 +99,12 @@
Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts.
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool><!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon(a)cshl.edu) -->
--- a/tools/fastx_toolkit/fasta_formatter.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fasta_formatter.xml Thu Sep 08 10:34:56 2011 -0400
@@ -76,5 +76,12 @@
AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT
>Scaffold9299
CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool>
--- a/tools/fastx_toolkit/fasta_nucleotide_changer.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fasta_nucleotide_changer.xml Thu Sep 08 10:34:56 2011 -0400
@@ -62,5 +62,12 @@
>cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
TGGAATGTAAAGAAGTATGTA
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool>
--- a/tools/fastx_toolkit/fastx_barcode_splitter.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Sep 08 10:34:56 2011 -0400
@@ -64,6 +64,13 @@
.. image:: ./static/fastx_icons/barcode_splitter_output_example.png
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool><!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon(a)cshl.edu) -->
--- a/tools/fastx_toolkit/fastx_clipper.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fastx_clipper.xml Thu Sep 08 10:34:56 2011 -0400
@@ -104,6 +104,12 @@
-
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool>
--- a/tools/fastx_toolkit/fastx_collapser.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/fastx_toolkit/fastx_collapser.xml Thu Sep 08 10:34:56 2011 -0400
@@ -77,5 +77,12 @@
means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
</help></tool>
--- a/tools/plotting/boxplot.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/plotting/boxplot.xml Thu Sep 08 10:34:56 2011 -0400
@@ -97,6 +97,12 @@
.. image:: ./static/images/solid_qual.png
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
</help></tool>
--- a/tools/visualization/GMAJ.xml Wed Sep 07 17:19:15 2011 -0400
+++ b/tools/visualization/GMAJ.xml Thu Sep 08 10:34:56 2011 -0400
@@ -194,6 +194,16 @@
For detailed information on GMAJ, click here_.
+
+------
+
+**Citation**
+
+If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. <http://www.ncbi.nlm.nih.gov/pubmed/15060014>`_ and http://globin.cse.psu.edu/dist/gmaj/.
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
.. _here: /static/gmaj/docs/gmaj_readme.html
.. _TBA: http://www.bx.psu.edu/miller_lab/
</help>
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
2 new changesets in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/71dd469f2b9e/
changeset: 71dd469f2b9e
user: dan
date: 2011-09-07 19:55:08
summary: Update GATK Unified Genotyper with num_threads of 4.
affected #: 1 file (42 bytes)
--- a/tools/gatk/unified_genotyper.xml Wed Sep 07 12:28:18 2011 -0400
+++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 13:55:08 2011 -0400
@@ -10,6 +10,7 @@
-p 'java
-jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar"
-T "UnifiedGenotyper"
+ --num_threads 4 ##hard coded, for now
-o "${output_vcf}"
-et "NO_ET" ##ET no phone home
##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout
http://bitbucket.org/galaxy/galaxy-central/changeset/a7c95bedc201/
changeset: a7c95bedc201
user: dan
date: 2011-09-07 21:50:03
summary: merge
affected #: 1 file (42 bytes)
--- a/tools/gatk/unified_genotyper.xml Wed Sep 07 15:07:05 2011 -0400
+++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 15:50:03 2011 -0400
@@ -10,6 +10,7 @@
-p 'java
-jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar"
-T "UnifiedGenotyper"
+ --num_threads 4 ##hard coded, for now
-o "${output_vcf}"
-et "NO_ET" ##ET no phone home
##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.
1 new changeset in galaxy-central:
http://bitbucket.org/galaxy/galaxy-central/changeset/3bd28e1e3e60/
changeset: 3bd28e1e3e60
user: natefoo
date: 2011-09-07 21:07:05
summary: Clarify output messages of set_user_disk_usage.py
affected #: 1 file (2 bytes)
--- a/scripts/set_user_disk_usage.py Wed Sep 07 12:28:18 2011 -0400
+++ b/scripts/set_user_disk_usage.py Wed Sep 07 15:07:05 2011 -0400
@@ -38,7 +38,7 @@
def quotacheck( sa_session, users ):
sa_session.refresh( user )
current = user.get_disk_usage()
- print user.username, '<' + user.email + '> current usage:', str( current ) + ',',
+ print user.username, '<' + user.email + '> old usage:', str( current ) + ',',
new = user.calculate_disk_usage()
sa_session.refresh( user )
# usage changed while calculating, do it again
@@ -49,7 +49,7 @@
if new == current:
print 'no change'
else:
- print 'new:', new
+ print 'new usage:', new
if not options.dryrun:
user.set_disk_usage( new )
sa_session.add( user )
Repository URL: https://bitbucket.org/galaxy/galaxy-central/
--
This is a commit notification from bitbucket.org. You are receiving
this because you have the service enabled, addressing the recipient of
this email.