September 2011 - galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: greg: Add the ability for a tool shed repository owner to reset the repository metadata for any change set revision that has associated repository metadata (previously could only be reset for repository tip)
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/7547a3131862/ changeset: 7547a3131862 user: greg date: 2011-09-09 17:18:05 summary: Add the ability for a tool shed repository owner to reset the repository metadata for any change set revision that has associated repository metadata (previously could only be reset for repository tip) affected #: 5 files (3.1 KB) --- a/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 11:18:05 2011 -0400 @@ -110,7 +110,7 @@ """Get last metadata defined for a specified repository from the database""" return trans.sa_session.query( trans.model.RepositoryMetadata ) \ .filter( trans.model.RepositoryMetadata.table.c.repository_id == trans.security.decode_id( id ) ) \ - .order_by( trans.model.RepositoryMetadata.table.c.update_time.desc() ) \ + .order_by( trans.model.RepositoryMetadata.table.c.id.desc() ) \ .first() def generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ): """ @@ -163,7 +163,7 @@ repository.name, tool.id, tool.version ) -def generate_tool_metadata( trans, id, changeset_revision, root, name, tool, metadata_dict ): +def generate_tool_metadata( trans, id, changeset_revision, tool_config, tool, metadata_dict ): """ Update the received metadata_dict with changes that have been applied to the received tool. @@ -189,7 +189,7 @@ version=tool.version, description=tool.description, version_string_cmd = tool.version_string_cmd, - tool_config=os.path.join( root, name ), + tool_config=tool_config, requirements=tool_requirements, tests=tool_tests ) if 'tools' in metadata_dict: @@ -249,49 +249,87 @@ ctx = get_changectx_for_changeset( trans, repo, changeset_revision ) if ctx is not None: metadata_dict = {} - for root, dirs, files in os.walk( repo_dir ): - if not root.find( '.hg' ) >= 0 and not root.find( 'hgrc' ) >= 0: - if '.hg' in dirs: - # Don't visit .hg directories - should be impossible since we don't - # allow uploaded archives that contain .hg dirs, but just in case... - dirs.remove( '.hg' ) - if 'hgrc' in files: - # Don't include hgrc files in commit. - files.remove( 'hgrc' ) - for name in files: - # Find all tool configs. - if name.endswith( '.xml' ): - try: - full_path = os.path.abspath( os.path.join( root, name ) ) - tool = load_tool( trans, full_path ) - if tool is not None: - # Update the list metadata dictionaries for tools in metadata_dict. - metadata_dict = generate_tool_metadata( trans, id, changeset_revision, root, name, tool, metadata_dict ) - except Exception, e: - invalid_files.append( ( name, str( e ) ) ) - # Find all exported workflows - elif name.endswith( '.ga' ): - try: - full_path = os.path.abspath( os.path.join( root, name ) ) - # Convert workflow data from json - fp = open( full_path, 'rb' ) - workflow_text = fp.read() - fp.close() - exported_workflow_dict = from_json_string( workflow_text ) - # Update the list of metadata dictionaries for workflows in metadata_dict. - metadata_dict = generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ) - except Exception, e: - invalid_files.append( ( name, str( e ) ) ) + if changeset_revision == repository.tip: + for root, dirs, files in os.walk( repo_dir ): + if not root.find( '.hg' ) >= 0 and not root.find( 'hgrc' ) >= 0: + if '.hg' in dirs: + # Don't visit .hg directories - should be impossible since we don't + # allow uploaded archives that contain .hg dirs, but just in case... + dirs.remove( '.hg' ) + if 'hgrc' in files: + # Don't include hgrc files in commit. + files.remove( 'hgrc' ) + for name in files: + # Find all tool configs. + if name.endswith( '.xml' ): + try: + full_path = os.path.abspath( os.path.join( root, name ) ) + tool = load_tool( trans, full_path ) + if tool is not None: + # Update the list metadata dictionaries for tools in metadata_dict. + tool_config = os.path.join( root, name ) + metadata_dict = generate_tool_metadata( trans, id, changeset_revision, tool_config, tool, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + # Find all exported workflows + elif name.endswith( '.ga' ): + try: + full_path = os.path.abspath( os.path.join( root, name ) ) + # Convert workflow data from json + fp = open( full_path, 'rb' ) + workflow_text = fp.read() + fp.close() + exported_workflow_dict = from_json_string( workflow_text ) + # Update the list of metadata dictionaries for workflows in metadata_dict. + metadata_dict = generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + else: + # Get all tool config file names from the hgweb url, something like: + # /repos/test/convert_chars1/file/e58dcf0026c7/convert_characters.xml + for filename in ctx: + # Find all tool configs - should not have to update metadata for workflows. + if filename.endswith( '.xml' ): + fctx = ctx[ filename ] + # Write the contents of the old tool config to a temporary file. + fh = tempfile.NamedTemporaryFile( 'w' ) + tmp_filename = fh.name + fh.close() + fh = open( tmp_filename, 'w' ) + fh.write( fctx.data() ) + fh.close() + try: + tool = load_tool( trans, tmp_filename ) + if tool is not None: + # Update the list metadata dictionaries for tools in metadata_dict. Note that filename + # here is the relative path to the config file within the change set context, something + # like filtering.xml, but when the change set was the repository tip, the value was + # something like database/community_files/000/repo_1/filtering.xml. This shouldn't break + # anything, but may result in a bit of confusion when maintaining the code / data over time. + metadata_dict = generate_tool_metadata( trans, id, changeset_revision, filename, tool, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + try: + os.unlink( tmp_filename ) + except: + pass if metadata_dict: - if new_tool_metadata_required( trans, id, metadata_dict ) or new_workflow_metadata_required( trans, id, metadata_dict ): - # Create a new repository_metadata table row. - repository_metadata = trans.model.RepositoryMetadata( repository.id, changeset_revision, metadata_dict ) - trans.sa_session.add( repository_metadata ) - trans.sa_session.flush() + if changeset_revision == repository.tip: + if new_tool_metadata_required( trans, id, metadata_dict ) or new_workflow_metadata_required( trans, id, metadata_dict ): + # Create a new repository_metadata table row. + repository_metadata = trans.model.RepositoryMetadata( repository.id, changeset_revision, metadata_dict ) + trans.sa_session.add( repository_metadata ) + trans.sa_session.flush() + else: + # Update the last saved repository_metadata table row. + repository_metadata = get_latest_repository_metadata( trans, id ) + repository_metadata.changeset_revision = changeset_revision + repository_metadata.metadata = metadata_dict + trans.sa_session.add( repository_metadata ) + trans.sa_session.flush() else: - # Update the last saved repository_metadata table row. - repository_metadata = get_latest_repository_metadata( trans, id ) - repository_metadata.changeset_revision = changeset_revision + # We're re-generating metadata for an old repository revision. + repository_metadata = get_repository_metadata_by_changeset_revision( trans, id, changeset_revision ) repository_metadata.metadata = metadata_dict trans.sa_session.add( repository_metadata ) trans.sa_session.flush() --- a/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 11:18:05 2011 -0400 @@ -1237,22 +1237,26 @@ # /repos/test/convert_chars1/file/e58dcf0026c7/convert_characters.xml old_tool_config_file_name = tool_config.split( '/' )[ -1 ] ctx = get_changectx_for_changeset( trans, repo, changeset_revision ) + fctx = None for filename in ctx: if filename == old_tool_config_file_name: fctx = ctx[ filename ] break - # Write the contents of the old tool config to a temporary file. - fh = tempfile.NamedTemporaryFile( 'w' ) - tmp_filename = fh.name - fh.close() - fh = open( tmp_filename, 'w' ) - fh.write( fctx.data() ) - fh.close() - tool = load_tool( trans, tmp_filename ) - try: - os.unlink( tmp_filename ) - except: - pass + if fctx: + # Write the contents of the old tool config to a temporary file. + fh = tempfile.NamedTemporaryFile( 'w' ) + tmp_filename = fh.name + fh.close() + fh = open( tmp_filename, 'w' ) + fh.write( fctx.data() ) + fh.close() + tool = load_tool( trans, tmp_filename ) + try: + os.unlink( tmp_filename ) + except: + pass + else: + tool = None tool_state = self.__new_state( trans ) is_malicious = change_set_is_malicious( trans, repository_id, repository.tip ) return trans.fill_template( "/webapps/community/repository/tool_form.mako", --- a/lib/galaxy/webapps/community/model/mapping.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/model/mapping.py Fri Sep 09 11:18:05 2011 -0400 @@ -194,7 +194,7 @@ categories=relation( RepositoryCategoryAssociation ), ratings=relation( RepositoryRatingAssociation, order_by=desc( RepositoryRatingAssociation.table.c.update_time ), backref="repositories" ), user=relation( User.mapper ), - downloadable_revisions=relation( RepositoryMetadata, order_by=desc( RepositoryMetadata.table.c.update_time ) ) ) ) + downloadable_revisions=relation( RepositoryMetadata, order_by=desc( RepositoryMetadata.table.c.id ) ) ) ) assign_mapper( context, RepositoryMetadata, RepositoryMetadata.table, properties=dict( repository=relation( Repository ) ) ) --- a/templates/webapps/community/repository/common.mako Fri Sep 09 10:16:48 2011 -0400 +++ b/templates/webapps/community/repository/common.mako Fri Sep 09 11:18:05 2011 -0400 @@ -176,20 +176,16 @@ %endif %endif %if can_set_metadata: - %if repository.tip == changeset_revision: - ## TODO: when we support previewing older versions of tools, we - ## should allow resetting metadata on the older versions as well. - <form name="set_metadata" action="${h.url_for( controller='repository', action='set_metadata', id=trans.security.encode_id( repository.id ), ctx_str=changeset_revision )}" method="post"> - <div class="form-row"> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="submit" name="set_metadata_button" value="Reset metadata"/> - </div> - <div class="toolParamHelp" style="clear: both;"> - Inspect the repository and reset the above attributes for the repository tip. - </div> + <form name="set_metadata" action="${h.url_for( controller='repository', action='set_metadata', id=trans.security.encode_id( repository.id ), ctx_str=changeset_revision )}" method="post"> + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="submit" name="set_metadata_button" value="Reset metadata"/></div> - </form> - %endif + <div class="toolParamHelp" style="clear: both;"> + Inspect the repository and reset the above attributes for the repository tip. + </div> + </div> + </form> %endif </div></div> --- a/templates/webapps/community/repository/tool_form.mako Fri Sep 09 10:16:48 2011 -0400 +++ b/templates/webapps/community/repository/tool_form.mako Fri Sep 09 11:18:05 2011 -0400 @@ -152,26 +152,30 @@ ${render_msg( message, status )} %endif - <div class="toolForm" id="${tool.id}"> - <div class="toolFormTitle">${tool.name} (version ${tool.version})</div> - <div class="toolFormBody"> - <form id="tool_form" name="tool_form" action="" method="get"> - <input type="hidden" name="tool_state" value="${util.object_to_string( tool_state.encode( tool, app ) )}"> - ${do_inputs( tool.inputs_by_page[ tool_state.page ], tool_state.inputs, "" )} - </form> + %if tool: + <div class="toolForm" id="${tool.id}"> + <div class="toolFormTitle">${tool.name} (version ${tool.version})</div> + <div class="toolFormBody"> + <form id="tool_form" name="tool_form" action="" method="get"> + <input type="hidden" name="tool_state" value="${util.object_to_string( tool_state.encode( tool, app ) )}"> + ${do_inputs( tool.inputs_by_page[ tool_state.page ], tool_state.inputs, "" )} + </form> + </div></div> - </div> - %if tool.help: - <div class="toolHelp"> - <div class="toolHelpBody"> - <% - # Convert to unicode to display non-ascii characters. - if type( tool.help ) is not unicode: - tool.help = unicode( tool.help, 'utf-8') - %> - ${tool.help} - </div> - </div> + %if tool.help: + <div class="toolHelp"> + <div class="toolHelpBody"> + <% + # Convert to unicode to display non-ascii characters. + if type( tool.help ) is not unicode: + tool.help = unicode( tool.help, 'utf-8') + %> + ${tool.help} + </div> + </div> + %endif + %else: + Tool not properly loaded. %endif </body></html> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Add the ability for a user to log out of all user sessions. Function can be accessed under user preferences when logged in.
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/148dc33de394/ changeset: 148dc33de394 user: dan date: 2011-09-09 16:16:48 summary: Add the ability for a user to log out of all user sessions. Function can be accessed under user preferences when logged in. affected #: 3 files (1.2 KB) --- a/lib/galaxy/web/controllers/user.py Thu Sep 08 12:09:10 2011 -0400 +++ b/lib/galaxy/web/controllers/user.py Fri Sep 09 10:16:48 2011 -0400 @@ -363,7 +363,7 @@ else: refresh_frames = [ 'masthead', 'history' ] message, status, user, success = self.__validate_login( trans, webapp, **kwd ) - if success and referer and referer != trans.request.base + url_for( controller='user', action='logout' ): + if success and referer and not referer.startswith( trans.request.base + url_for( controller='user', action='logout' ) ): redirect_url = referer elif success: redirect_url = url_for( '/' ) @@ -414,7 +414,7 @@ success = True return ( message, status, user, success ) @web.expose - def logout( self, trans, webapp='galaxy' ): + def logout( self, trans, webapp='galaxy', logout_all=False ): if webapp == 'galaxy': if trans.app.config.require_login: refresh_frames = [ 'masthead', 'history', 'tools' ] @@ -424,7 +424,7 @@ refresh_frames = [ 'masthead' ] # Since logging an event requires a session, we'll log prior to ending the session trans.log_event( "User logged out" ) - trans.handle_user_logout() + trans.handle_user_logout( logout_all=logout_all ) message = 'You have been logged out.<br>You can log in again, <a target="_top" href="%s">go back to the page you were visiting</a> or <a target="_top" href="%s">go to the home page</a>.' % \ ( trans.request.referer, url_for( '/' ) ) return trans.fill_template( '/user/logout.mako', --- a/lib/galaxy/web/framework/__init__.py Thu Sep 08 12:09:10 2011 -0400 +++ b/lib/galaxy/web/framework/__init__.py Fri Sep 09 10:16:48 2011 -0400 @@ -543,7 +543,7 @@ self.sa_session.flush() # This method is not called from the Galaxy reports, so the cookie will always be galaxysession self.__update_session_cookie( name=cookie_name ) - def handle_user_logout( self ): + def handle_user_logout( self, logout_all=False ): """ Logout the current user: - invalidate the current session @@ -553,6 +553,14 @@ prev_galaxy_session.is_valid = False self.galaxy_session = self.__create_new_session( prev_galaxy_session ) self.sa_session.add_all( ( prev_galaxy_session, self.galaxy_session ) ) + galaxy_user_id = prev_galaxy_session.user_id + if logout_all and galaxy_user_id is not None: + for other_galaxy_session in self.sa_session.query( self.app.model.GalaxySession ) \ + .filter( and_( self.app.model.GalaxySession.table.c.user_id==galaxy_user_id, + self.app.model.GalaxySession.table.c.is_valid==True, + self.app.model.GalaxySession.table.c.id!=prev_galaxy_session.id ) ): + other_galaxy_session.is_valid = False + self.sa_session.add( other_galaxy_session ) self.sa_session.flush() # This method is not called from the Galaxy reports, so the cookie will always be galaxysession self.__update_session_cookie( name='galaxysession' ) --- a/templates/user/index.mako Thu Sep 08 12:09:10 2011 -0400 +++ b/templates/user/index.mako Fri Sep 09 10:16:48 2011 -0400 @@ -18,6 +18,13 @@ %if trans.app.config.enable_openid: <li><a href="${h.url_for( controller='user', action='openid_manage', cntrller=cntrller )}">${ ('Manage OpenIDs')}</a> linked to your account</li> %endif + %if trans.app.config.use_remote_user: + %if trans.app.config.remote_user_logout_href: + <li><a href="${trans.app.config.remote_user_logout_href}" target="_top">${_('Logout')}</a></li> + %endif + %else: + <li><a href="${h.url_for( controller='user', action='logout', logout_all=True )}" target="_top">${_('Logout')}</a> ${_('of all user sessions')}</li> + %endif %else: <li><a href="${h.url_for( controller='user', action='manage_user_info', cntrller=cntrller, webapp='community' )}">${_('Manage your information')}</a></li> %endif Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Make it easier to run helper.py from outside the galaxy-dist root directory.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/8a8a587e2167/ changeset: 8a8a587e2167 user: natefoo date: 2011-09-08 18:09:10 summary: Make it easier to run helper.py from outside the galaxy-dist root directory. affected #: 1 file (102 bytes) --- a/scripts/helper.py Thu Sep 08 10:40:44 2011 -0400 +++ b/scripts/helper.py Thu Sep 08 12:09:10 2011 -0400 @@ -9,8 +9,10 @@ from ConfigParser import ConfigParser from optparse import OptionParser +default_config = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', 'universe_wsgi.ini') ) + parser = OptionParser() -parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default='universe_wsgi.ini' ) +parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default=default_config ) parser.add_option( '-e', '--encode-id', dest='encode_id', help='Encode an ID' ) parser.add_option( '-d', '--decode-id', dest='decode_id', help='Decode an ID' ) parser.add_option( '--hda', dest='hda_id', help='Display HistoryDatasetAssociation info' ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Re-add the ability to display links to the same tool in more than one tool panel location, and add some recently introduced Galaxy config attributes to the tool shed app so exceptions won't be thrown.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/2fcf14f59875/ changeset: 2fcf14f59875 user: greg date: 2011-09-08 16:40:44 summary: Re-add the ability to display links to the same tool in more than one tool panel location, and add some recently introduced Galaxy config attributes to the tool shed app so exceptions won't be thrown. affected #: 3 files (203 bytes) --- a/lib/galaxy/tools/__init__.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Sep 08 10:40:44 2011 -0400 @@ -125,9 +125,9 @@ tta = self.app.model.ToolTagAssociation( tool_id=tool.id, tag_id=tag.id ) self.sa_session.add( tta ) self.sa_session.flush() - if tool.id in self.tools_by_id: - raise Exception( "Tool with id %s already loaded." % tool.id ) - else: + if tool.id not in self.tools_by_id: + # Allow for the same tool to be loaded into multiple places in the + # tool panel. self.tools_by_id[ tool.id ] = tool key = 'tool_' + tool.id panel_dict[ key ] = tool --- a/lib/galaxy/webapps/community/app.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/webapps/community/app.py Thu Sep 08 10:40:44 2011 -0400 @@ -1,5 +1,6 @@ import sys, config import galaxy.tools.data +import galaxy.quota import galaxy.datatypes.registry import galaxy.webapps.community.model from galaxy.web import security @@ -36,5 +37,6 @@ self.tool_data_tables = galaxy.tools.data.ToolDataTableManager( self.config.tool_data_table_config_path ) # Load security policy self.security_agent = self.model.security_agent + self.quota_agent = galaxy.quota.NoQuotaAgent( self.model ) def shutdown( self ): pass --- a/lib/galaxy/webapps/community/config.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/webapps/community/config.py Thu Sep 08 10:40:44 2011 -0400 @@ -39,6 +39,8 @@ self.file_path = resolve_path( kwargs.get( "file_path", "database/files" ), self.root ) self.new_file_path = resolve_path( kwargs.get( "new_file_path", "database/tmp" ), self.root ) self.cookie_path = kwargs.get( "cookie_path", "/" ) + # web API + self.enable_api = string_as_bool( kwargs.get( 'enable_api', False ) ) self.datatypes_config = kwargs.get( 'datatypes_config_file', 'datatypes_conf.xml' ) self.test_conf = resolve_path( kwargs.get( "test_conf", "" ), self.root ) self.id_secret = kwargs.get( "id_secret", "USING THE DEFAULT IS NOT SECURE!" ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Minor tool help updates.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/314d41df7881/ changeset: 314d41df7881 user: dan date: 2011-09-08 16:34:56 summary: Minor tool help updates. affected #: 8 files (1.6 KB) --- a/tools/fastx_toolkit/fasta_clipping_histogram.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Sep 08 10:34:56 2011 -0400 @@ -99,6 +99,12 @@ Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts. +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fasta_formatter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_formatter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -76,5 +76,12 @@ AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fasta_nucleotide_changer.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_nucleotide_changer.xml Thu Sep 08 10:34:56 2011 -0400 @@ -62,5 +62,12 @@ >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_barcode_splitter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -64,6 +64,13 @@ .. image:: ./static/fastx_icons/barcode_splitter_output_example.png + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_clipper.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_clipper.xml Thu Sep 08 10:34:56 2011 -0400 @@ -104,6 +104,12 @@ - + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_collapser.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_collapser.xml Thu Sep 08 10:34:56 2011 -0400 @@ -77,5 +77,12 @@ means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/plotting/boxplot.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/plotting/boxplot.xml Thu Sep 08 10:34:56 2011 -0400 @@ -97,6 +97,12 @@ .. image:: ./static/images/solid_qual.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + </help></tool> --- a/tools/visualization/GMAJ.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/visualization/GMAJ.xml Thu Sep 08 10:34:56 2011 -0400 @@ -194,6 +194,16 @@ For detailed information on GMAJ, click here_. + +------ + +**Citation** + +If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. <http://www.ncbi.nlm.nih.gov/pubmed/15060014>`_ and http://globin.cse.psu.edu/dist/gmaj/. + +If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + .. _here: /static/gmaj/docs/gmaj_readme.html .. _TBA: http://www.bx.psu.edu/miller_lab/ </help> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Do away with the encoding of 'file.<id>' and 'folder.<id>' in the API. All IDs in the API, with the exception of library folders, are now just the object's real encoded id. Library folders have an 'F' prepended to the id AFTER encoding. All real IDs (including the ldda ID of library datasets) can be seen in an item's element view. Workflows started from the API using the 'ld=' src should now use the new IDs as opposed to the old 'file.<id>' IDs.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/435e3f628e7d/ changeset: 435e3f628e7d user: natefoo date: 2011-09-07 23:19:15 summary: Do away with the encoding of 'file.<id>' and 'folder.<id>' in the API. All IDs in the API, with the exception of library folders, are now just the object's real encoded id. Library folders have an 'F' prepended to the id AFTER encoding. All real IDs (including the ldda ID of library datasets) can be seen in an item's element view. Workflows started from the API using the 'ld=' src should now use the new IDs as opposed to the old 'file.<id>' IDs. affected #: 7 files (1.8 KB) --- a/lib/galaxy/model/__init__.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/model/__init__.py Wed Sep 07 17:19:15 2011 -0400 @@ -1136,7 +1136,9 @@ # display in other objects, we can't use the simpler method used by # other model classes. hda = self - rval = dict( name = hda.name, + rval = dict( id = hda.id, + model_class = self.__class__.__name__, + name = hda.name, deleted = hda.deleted, visible = hda.visible, state = hda.state, @@ -1230,7 +1232,7 @@ return name class LibraryFolder( object, APIItem ): - api_element_visible_keys = ( 'name', 'description', 'item_count', 'genome_build' ) + api_element_visible_keys = ( 'id', 'name', 'description', 'item_count', 'genome_build' ) def __init__( self, name=None, description=None, item_count=0, order_id=None ): self.name = name or "Unnamed folder" self.description = description @@ -1371,7 +1373,10 @@ tmp_dict[field['label']] = content[field['name']] template_data[template.name] = tmp_dict - rval = dict( name = ldda.name, + rval = dict( id = self.id, + ldda_id = ldda.id, + model_class = self.__class__.__name__, + name = ldda.name, file_name = ldda.file_name, uploaded_by = ldda.user.email, message = ldda.message, --- a/lib/galaxy/web/api/history_contents.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/history_contents.py Wed Sep 07 17:19:15 2011 -0400 @@ -32,7 +32,7 @@ try: for dataset in history.datasets: api_type = "file" - encoded_id = trans.security.encode_id( '%s.%s' % (api_type, dataset.id) ) + encoded_id = trans.security.encode_id( dataset.id ) rval.append( dict( id = encoded_id, type = api_type, name = dataset.name, @@ -46,9 +46,10 @@ @web.expose_api def show( self, trans, id, history_id, **kwd ): """ - GET /api/histories/{encoded_history_id}/contents/{encoded_content_type_and_id} + GET /api/histories/{encoded_history_id}/contents/{encoded_content_id} Displays information about a history content (dataset). """ + content_id = id try: content = get_history_content_for_access( trans, content_id ) except Exception, e: @@ -62,6 +63,7 @@ # http://routes.groovie.org/generating.html # url_for is being phased out, so new applications should use url item['download_url'] = url(controller='dataset', action='display', dataset_id=trans.security.encode_id(content.id), to_ext=content.ext) + item = encode_all_ids( trans, item ) except Exception, e: item = "Error in history API at listing dataset" log.error( item + ": %s" % str(e) ) --- a/lib/galaxy/web/api/libraries.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/libraries.py Wed Sep 07 17:19:15 2011 -0400 @@ -87,7 +87,7 @@ trans.sa_session.flush() encoded_id = trans.security.encode_id( library.id ) rval = {} - rval['url'] = url_for( 'libraries', id=encoded_id ) + rval['url'] = url_for( 'library', id=encoded_id ) rval['name'] = name rval['id'] = encoded_id return [ rval ] --- a/lib/galaxy/web/api/library_contents.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/library_contents.py Wed Sep 07 17:19:15 2011 -0400 @@ -52,14 +52,16 @@ if not library or not ( trans.user_is_admin() or trans.app.security_agent.can_access_library( current_user_roles, library ) ): trans.response.status = 400 return "Invalid library id ( %s ) specified." % str( library_id ) - encoded_id = trans.security.encode_id( 'folder.%s' % library.root_folder.id ) + encoded_id = 'F' + trans.security.encode_id( library.root_folder.id ) rval.append( dict( id = encoded_id, type = 'folder', name = '/', url = url_for( 'library_content', library_id=library_id, id=encoded_id ) ) ) library.root_folder.api_path = '' for content in traverse( library.root_folder ): - encoded_id = trans.security.encode_id( '%s.%s' % ( content.api_type, content.id ) ) + encoded_id = trans.security.encode_id( content.id ) + if content.api_type == 'folder': + encoded_id = 'F' + encoded_id rval.append( dict( id = encoded_id, type = content.api_type, name = content.api_path, @@ -69,7 +71,7 @@ @web.expose_api def show( self, trans, id, library_id, **kwd ): """ - GET /api/libraries/{encoded_library_id}/contents/{encoded_content_type_and_id} + GET /api/libraries/{encoded_library_id}/contents/{encoded_content_id} Displays information about a library content (file or folder). """ content_id = id @@ -77,7 +79,7 @@ content = get_library_content_for_access( trans, content_id ) except Exception, e: return str( e ) - return content.get_api_value( view='element' ) + return encode_all_ids( trans, content.get_api_value( view='element' ) ) @web.expose_api def create( self, trans, library_id, payload, **kwd ): @@ -88,51 +90,40 @@ create_type = None if 'create_type' not in payload: trans.response.status = 400 - return "Missing required 'create_type' parameter. Please consult the API documentation for help." + return "Missing required 'create_type' parameter." else: create_type = payload.pop( 'create_type' ) if create_type not in ( 'file', 'folder' ): trans.response.status = 400 - return "Invalid value for 'create_type' parameter ( %s ) specified. Please consult the API documentation for help." % create_type + return "Invalid value for 'create_type' parameter ( %s ) specified." % create_type + if 'folder_id' not in payload: + trans.response.status = 400 + return "Missing requred 'folder_id' parameter." + else: + folder_id = payload.pop( 'folder_id' ) try: - content_id = str( payload.pop( 'folder_id' ) ) - decoded_type_and_id = trans.security.decode_string_id( content_id ) - parent_type, decoded_parent_id = decoded_type_and_id.split( '.' ) - assert parent_type in ( 'folder', 'file' ) - except: - trans.response.status = 400 - return "Malformed parent id ( %s ) specified, unable to decode." % content_id - # "content" can be either a folder or a file, but the parent of new contents can only be folders. - if parent_type == 'file': - trans.response.status = 400 - try: - # With admins or people who can access the dataset provided as the parent, be descriptive. - dataset = trans.sa_session.query( trans.app.model.LibraryDataset ).get( decoded_parent_id ).library_dataset_dataset_association.dataset - assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), dataset ) - return "The parent id ( %s ) points to a file, not a folder." % content_id - except: - # If you can't access the parent we don't want to reveal its existence. - return "Invalid parent folder id ( %s ) specified." % content_id + # _for_modification is not necessary, that security happens in the library_common controller. + parent = get_library_folder_for_access( trans, library_id, folder_id ) + except Exception, e: + return str( e ) # The rest of the security happens in the library_common controller. - folder_id = trans.security.encode_id( decoded_parent_id ) + real_folder_id = trans.security.encode_id( parent.id ) # Now create the desired content object, either file or folder. if create_type == 'file': - status, output = trans.webapp.controllers['library_common'].upload_library_dataset( trans, 'api', library_id, folder_id, **payload ) + status, output = trans.webapp.controllers['library_common'].upload_library_dataset( trans, 'api', library_id, real_folder_id, **payload ) elif create_type == 'folder': - status, output = trans.webapp.controllers['library_common'].create_folder( trans, 'api', folder_id, library_id, **payload ) + status, output = trans.webapp.controllers['library_common'].create_folder( trans, 'api', real_folder_id, library_id, **payload ) if status != 200: trans.response.status = status - # We don't want to reveal the encoded folder_id since it's invalid - # in the API context. Instead, return the content_id originally - # supplied by the client. - output = output.replace( folder_id, content_id ) return output else: rval = [] for k, v in output.items(): if type( v ) == trans.app.model.LibraryDatasetDatasetAssociation: v = v.library_dataset - encoded_id = trans.security.encode_id( create_type + '.' + str( v.id ) ) + encoded_id = trans.security.encode_id( v.id ) + if create_type == 'folder': + encoded_id = 'F' + encoded_id rval.append( dict( id = encoded_id, name = v.name, url = url_for( 'library_content', library_id=library_id, id=encoded_id ) ) ) --- a/lib/galaxy/web/api/util.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/util.py Wed Sep 07 17:19:15 2011 -0400 @@ -34,46 +34,61 @@ # Note that we could check the history provided in the URL heirarchy here, # but it's irrelevant, we care about the history associated with the hda. try: - content_type, decoded_content_id = trans.security.decode_string_id( content_id ).split( '.' ) - decoded_content_id = int( decoded_content_id ) + decoded_content_id = trans.security.decode_id( content_id ) + model_class = trans.app.model.HistoryDatasetAssociation except: trans.response.status = 400 raise BadRequestException( "Malformed history content id ( %s ) specified, unable to decode." % str( content_id ) ) try: - assert content_type == 'file' - model_class = trans.app.model.HistoryDatasetAssociation - except: - trans.response.status = 400 - raise BadRequestException( "Invalid type ( %s ) specified." % str( content_type ) ) - try: content = trans.sa_session.query( model_class ).get( decoded_content_id ) assert content if content.history.user != trans.user and not trans.user_is_admin(): assert trans.sa_session.query(trans.app.model.HistoryUserShareAssociation).filter_by(user=trans.user, history=content.history).count() != 0 except: trans.response.status = 400 - raise BadRequestException( "Invalid %s id ( %s ) specified." % ( content_type, str( content_id ) ) ) + raise BadRequestException( "Invalid history content id ( %s ) specified." % ( str( content_id ) ) ) return content +def get_library_folder_for_access( trans, library_id, folder_id ): + """ + When we know we're looking for a folder, take either the 'F' + encoded_id or bare encoded_id. + """ + if ( len( folder_id ) % 16 == 0 ): + folder_id = 'F' + folder_id + return get_library_content_for_access( trans, folder_id ) + def get_library_content_for_access( trans, content_id ): try: - content_type, decoded_content_id = trans.security.decode_string_id( content_id ).split( '.' ) - decoded_content_id = int( decoded_content_id ) + if ( len( content_id ) % 16 == 0 ): + model_class = trans.app.model.LibraryDataset + decoded_content_id = trans.security.decode_id( content_id ) + elif ( content_id.startswith( 'F' ) ): + model_class = trans.app.model.LibraryFolder + decoded_content_id = trans.security.decode_id( content_id[1:] ) + else: + raise Exception( 'Bad id' ) except: trans.response.status = 400 - raise BadRequestException( "Malformed library %s id ( %s ) specified, unable to decode." % ( content_type, str( content_id ) ) ) - if content_type == 'file': - model_class = trans.app.model.LibraryDataset - elif content_type == 'folder': - model_class = trans.app.model.LibraryFolder - else: - trans.response.status = 400 - raise BadRequestException( "Invalid type ( %s ) specified." % str( content_type ) ) + raise BadRequestException( "Malformed library content id ( %s ) specified, unable to decode." % str( content_id ) ) try: content = trans.sa_session.query( model_class ).get( decoded_content_id ) assert content assert trans.user_is_admin() or trans.app.security_agent.can_access_library_item( trans.get_current_user_roles(), content, trans.user ) except: trans.response.status = 400 - raise BadRequestException( "Invalid %s id ( %s ) specified." % ( content_type, str( content_id ) ) ) + raise BadRequestException( "Invalid library content id ( %s ) specified." % str( content_id ) ) return content + +def encode_all_ids( trans, rval ): + """ + encodes all integer values in the dict rval whose keys are 'id' or end with '_id' + """ + if type( rval ) != dict: + return rval + for k, v in rval.items(): + if k == 'id' or k.endswith( '_id' ): + try: + rval[k] = trans.security.encode_id( v ) + except: + pass # probably already encoded + return rval --- a/lib/galaxy/web/api/workflows.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/workflows.py Wed Sep 07 17:19:15 2011 -0400 @@ -106,9 +106,8 @@ assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), ldda.dataset ) hda = ldda.to_history_dataset_association(history, add_to_history=add_to_history) elif ds_map[k]['src'] == 'ld': - ld_t, ld_id = trans.security.decode_string_id(ds_map[k]['id']).split('.') ldda = trans.sa_session.query(self.app.model.LibraryDataset).get( - ld_id).library_dataset_dataset_association + trans.security.decode_id(ds_map[k]['id'])).library_dataset_dataset_association assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), ldda.dataset ) hda = ldda.to_history_dataset_association(history, add_to_history=add_to_history) elif ds_map[k]['src'] == 'hda': --- a/lib/galaxy/web/security/__init__.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/security/__init__.py Wed Sep 07 17:19:15 2011 -0400 @@ -43,8 +43,6 @@ return self.id_cipher.encrypt( s ).encode( 'hex' ) def decode_id( self, obj_id ): return int( self.id_cipher.decrypt( obj_id.decode( 'hex' ) ).lstrip( "!" ) ) - def decode_string_id( self, obj_id ): - return self.id_cipher.decrypt( obj_id.decode( 'hex' ) ).lstrip( "!" ) def encode_guid( self, session_key ): # Session keys are strings # Pad to a multiple of 8 with leading "!" Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 07 Sep '11

07 Sep '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/71dd469f2b9e/ changeset: 71dd469f2b9e user: dan date: 2011-09-07 19:55:08 summary: Update GATK Unified Genotyper with num_threads of 4. affected #: 1 file (42 bytes) --- a/tools/gatk/unified_genotyper.xml Wed Sep 07 12:28:18 2011 -0400 +++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 13:55:08 2011 -0400 @@ -10,6 +10,7 @@ -p 'java -jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar" -T "UnifiedGenotyper" + --num_threads 4 ##hard coded, for now -o "${output_vcf}" -et "NO_ET" ##ET no phone home ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout http://bitbucket.org/galaxy/galaxy-central/changeset/a7c95bedc201/ changeset: a7c95bedc201 user: dan date: 2011-09-07 21:50:03 summary: merge affected #: 1 file (42 bytes) --- a/tools/gatk/unified_genotyper.xml Wed Sep 07 15:07:05 2011 -0400 +++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 15:50:03 2011 -0400 @@ -10,6 +10,7 @@ -p 'java -jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar" -T "UnifiedGenotyper" + --num_threads 4 ##hard coded, for now -o "${output_vcf}" -et "NO_ET" ##ET no phone home ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Clarify output messages of set_user_disk_usage.py
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/3bd28e1e3e60/ changeset: 3bd28e1e3e60 user: natefoo date: 2011-09-07 21:07:05 summary: Clarify output messages of set_user_disk_usage.py affected #: 1 file (2 bytes) --- a/scripts/set_user_disk_usage.py Wed Sep 07 12:28:18 2011 -0400 +++ b/scripts/set_user_disk_usage.py Wed Sep 07 15:07:05 2011 -0400 @@ -38,7 +38,7 @@ def quotacheck( sa_session, users ): sa_session.refresh( user ) current = user.get_disk_usage() - print user.username, '<' + user.email + '> current usage:', str( current ) + ',', + print user.username, '<' + user.email + '> old usage:', str( current ) + ',', new = user.calculate_disk_usage() sa_session.refresh( user ) # usage changed while calculating, do it again @@ -49,7 +49,7 @@ if new == current: print 'no change' else: - print 'new:', new + print 'new usage:', new if not options.dryrun: user.set_disk_usage( new ) sa_session.add( user ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Updates for dist-eggs definitions, Python 2.7 for Mac OS X 10.6+ (intel-only) from python.org is now supported.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/c62544f290b4/ changeset: c62544f290b4 user: natefoo date: 2011-09-07 18:28:18 summary: Updates for dist-eggs definitions, Python 2.7 for Mac OS X 10.6+ (intel-only) from python.org is now supported. affected #: 1 file (100 bytes) --- a/dist-eggs.ini Wed Sep 07 10:20:14 2011 -0400 +++ b/dist-eggs.ini Wed Sep 07 12:28:18 2011 -0400 @@ -27,7 +27,8 @@ py2.5-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.5 py2.6-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.6 py2.7-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.7 -py2.6-macosx-10.6-universal-ucs2 = fanty.bx.psu.edu /usr/bin/python2.6 +py2.6-macosx-10.6-universal-ucs2 = lion.bx.psu.edu /usr/bin/python2.6 +py2.7-macosx-10.6-intel-ucs2 = lion.bx.psu.edu /usr/local/bin/python2.7 py2.4-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.4 py2.5-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.5 py2.6-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.6 @@ -70,7 +71,7 @@ py2.4-macosx = py2.4-macosx-10.3-fat-ucs2 py2.5-macosx = py2.5-macosx-10.3-fat-ucs2 py2.6-macosx = py2.6-macosx-10.3-fat-ucs2 py2.6-macosx-10.6-universal-ucs2 -py2.7-macosx = py2.7-macosx-10.3-fat-ucs2 +py2.7-macosx = py2.7-macosx-10.3-fat-ucs2 py2.7-macosx-10.6-intel-ucs2 macosx = py2.4-macosx py2.5-macosx py2.6-macosx py2.7-macosx py2.4-solaris-i86pc = py2.4-solaris-2.10-i86pc_32-ucs2 py2.4-solaris-2.10-i86pc_64-ucs2 py2.5-solaris-i86pc = py2.5-solaris-2.10-i86pc_32-ucs2 py2.5-solaris-2.10-i86pc_64-ucs2 Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fixes for browsing repository contents.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/431eda93e017/ changeset: 431eda93e017 user: greg date: 2011-09-07 16:20:14 summary: Fixes for browsing repository contents. affected #: 1 file (774 bytes) --- a/lib/galaxy/webapps/community/controllers/repository.py Wed Sep 07 09:05:52 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Wed Sep 07 10:20:14 2011 -0400 @@ -1,4 +1,4 @@ -import os, logging, urllib, ConfigParser, tempfile, shutil, pexpect +import os, logging, urllib, ConfigParser, tempfile, shutil from time import strftime from datetime import date, datetime from galaxy import util @@ -1357,7 +1357,12 @@ trans.response.headers['Expires'] = '0' repository = trans.sa_session.query( trans.model.Repository ).get( trans.security.decode_id( repository_id ) ) folder_path = key - files_list = self.__get_files( trans, repository, folder_path ) + try: + files_list = self.__get_files( trans, folder_path ) + except OSError, e: + if str( e ).find( 'No such file or directory' ) >= 0: + # We have a repository with no contents. + return [] folder_contents = [] for filename in files_list: is_folder = False @@ -1372,31 +1377,20 @@ "key": full_path } folder_contents.append( node ) return folder_contents - def __get_files( self, trans, repository, folder_path ): - def print_ticks( d ): - pass - cmd = "ls -p '%s'" % folder_path - output = pexpect.run( cmd, - events={ pexpect.TIMEOUT : print_ticks }, - timeout=10 ) - if 'No such file or directory' in output: - if 'root' in output: - # The repository is empty - return [] - else: - # Some strange error occurred, the selected file was displayed, but - # does not exist in the sub-directory from which it was displayed. - # This should not happen... - status = 'error' - message = "No folder named (%s) exists." % folder_path - return trans.response.send_redirect( web.url_for( controller='repository', - action='browse_repositories', - operation="view_or_manage_repository", - id=trans.security.encode_id( repository.id ), - changeset_revision=repository.tip, - status=status, - message=message ) ) - return output.split( '\r\n' ) + def __get_files( self, trans, folder_path ): + contents = [] + for item in os.listdir( folder_path ): + # Skip .hg directories + if str( item ).startswith( '.hg' ): + continue + if os.path.isdir( os.path.join( folder_path, item ) ): + # Append a '/' character so that our jquery dynatree will + # function properly. + item = '%s/' % item + contents.append( item ) + if contents: + contents.sort() + return contents @web.json def get_file_contents( self, trans, file_path ): # Avoid caching Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0