- galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: carlfeberhard: base controller, get_history_dataset_association: remove deleted=False flag; api/histories, update: remove deleted flag; casperjs tests: update for previous and remove tool iframe code
by commits-noreply＠bitbucket.org 23 Jul '13

23 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/fdcd30ffdafd/ Changeset: fdcd30ffdafd User: carlfeberhard Date: 2013-07-23 19:55:39 Summary: base controller, get_history_dataset_association: remove deleted=False flag; api/histories, update: remove deleted flag; casperjs tests: update for previous and remove tool iframe code Affected #: 7 files diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c lib/galaxy/web/base/controller.py --- a/lib/galaxy/web/base/controller.py +++ b/lib/galaxy/web/base/controller.py @@ -512,7 +512,8 @@ """ #TODO: duplicate of above? alias to above (or vis-versa) self.security_check( trans, history, check_ownership=check_ownership, check_accessible=check_accessible ) - hda = self.get_object( trans, dataset_id, 'HistoryDatasetAssociation', check_ownership=False, check_accessible=False, deleted=False ) + hda = self.get_object( trans, dataset_id, 'HistoryDatasetAssociation', + check_ownership=False, check_accessible=False ) if check_accessible: if not trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), hda.dataset ): diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c lib/galaxy/webapps/galaxy/api/histories.py --- a/lib/galaxy/webapps/galaxy/api/histories.py +++ b/lib/galaxy/webapps/galaxy/api/histories.py @@ -193,7 +193,7 @@ """ #TODO: PUT /api/histories/{encoded_history_id} payload = { rating: rating } (w/ no security checks) try: - history = self.get_history( trans, id, check_ownership=True, check_accessible=True, deleted=True ) + history = self.get_history( trans, id, check_ownership=True, check_accessible=True ) # validation handled here and some parsing, processing, and conversion payload = self._validate_and_parse_update_payload( payload ) # additional checks here (security, etc.) diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c test/casperjs/api-hda-tests.js --- a/test/casperjs/api-hda-tests.js +++ b/test/casperjs/api-hda-tests.js @@ -217,7 +217,7 @@ deleted: true }); //this.debug( 'returned:\n' + this.jsonStr( returned ) ); - hdaShow = this.api.hdas.show( lastHistory.id, firstHda.id ); + hdaShow = this.api.hdas.show( lastHistory.id, firstHda.id, true ); this.test.assert( hdaShow.deleted === true, "Update set the deleted flag: " + hdaShow.deleted ); this.test.comment( 'update should allow changing the deleted flag back' ); diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c test/casperjs/api-history-tests.js --- a/test/casperjs/api-history-tests.js +++ b/test/casperjs/api-history-tests.js @@ -107,7 +107,7 @@ this.test.comment( 'A bad id to show should throw an error' ); this.assertRaises( function(){ this.api.histories.show( '1234123412341234' ); - }, 'Error in history API at showing history detail: 400 Bad Request', 'Raises an exception' ); + }, '400 Bad Request', 'Raises an exception' ); // ------------------------------------------------------------------------------------------- CREATE @@ -131,8 +131,10 @@ this.test.comment( 'calling delete should delete the given history and remove it from the standard index' ); var deletedHistory = this.api.histories.delete_( createdHistory.id ); //this.debug( 'returned from delete:\n' + this.jsonStr( deletedHistory ) ); - this.test.assert( deletedHistory === 'OK', - "Deletion returned 'OK' - even though that's not a great, informative response: " + deletedHistory ); + this.test.assert( deletedHistory.id === createdHistory.id, + "Deletion returned id matching created history: " + deletedHistory.id ); + this.test.assert( deletedHistory.deleted === true, + "Deletion return 'deleted: true': " + deletedHistory.deleted ); newFirstHistory = this.api.histories.index()[0]; //this.debug( 'newFirstHistory:\n' + this.jsonStr( newFirstHistory ) ); @@ -252,7 +254,7 @@ deleted: true }); //this.debug( 'returned:\n' + this.jsonStr( returned ) ); - historyShow = this.api.histories.show( newFirstHistory.id ); + historyShow = this.api.histories.show( newFirstHistory.id, true ); this.test.assert( historyShow.deleted === true, "Update set the deleted flag: " + historyShow.deleted ); this.test.comment( 'update should allow changing the deleted flag back' ); diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c test/casperjs/modules/api.js --- a/test/casperjs/modules/api.js +++ b/test/casperjs/modules/api.js @@ -261,7 +261,7 @@ }; HDAAPI.prototype.show = function show( historyId, id, deleted ){ - this.api.spaceghost.info( 'hdas.show: ' + [ historyId, id, (( deleted )?( 'w deleted' ):( '' )) ] ); + this.api.spaceghost.info( 'hdas.show: ' + [ historyId, id, (( deleted )?( 'w/deleted' ):( '' )) ] ); id = ( id === 'most_recently_used' )?( id ):( this.api.ensureId( id ) ); deleted = deleted || false; diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c test/casperjs/modules/tools.js --- a/test/casperjs/modules/tools.js +++ b/test/casperjs/modules/tools.js @@ -87,7 +87,7 @@ uploadInfo[ spaceghost.data.selectors.tools.upload.fileInput ] = filepath; // click the upload tool - spaceghost.thenOpen( spaceghost.baseUrl ).withToolPanel( function(){ + spaceghost.thenOpen( spaceghost.baseUrl, function(){ // we can apprently click a tool label without expanding the tool container for it this.clickLabel( spaceghost.data.labels.tools.upload.panelLabel ); this.jumpToMain( function(){ diff -r 6187607058e66e1b8b31f2da905d603ae0c65f23 -r fdcd30ffdafd0a11ba7c90d5c01d1a3b5cb1f60c test/casperjs/spaceghost.js --- a/test/casperjs/spaceghost.js +++ b/test/casperjs/spaceghost.js @@ -635,13 +635,6 @@ return this.withFrame( this.data.selectors.frames.history, then ); }; -/** Version of Casper#withFrame for the tool iframe. - * @param {Function} then function called when in the frame - */ -SpaceGhost.prototype.withToolPanel = function withToolPanel( then ){ - return this.withFrame( this.data.selectors.frames.tools, then ); -}; - /** Version of Casper#withFrame for the main iframe. * @param {Function} then function called when in the frame */ @@ -687,15 +680,6 @@ return this.jumpToFrame( this.data.selectors.frames.history, fn ); }; -/** Jumps into tools frame, exectutes fn, and jumps back to original frame. - * @param {Selector} frame the selector for the frame to jump to - * @param {Function} fn function called when in the frame - * @returns {Any} the return value of fn - */ -SpaceGhost.prototype.jumpToTools = function jumpToTools( fn ){ - return this.jumpToFrame( this.data.selectors.frames.tools, fn ); -}; - /** Jumps into main frame, exectutes fn, and jumps back to original frame. * @param {Selector} frame the selector for the frame to jump to * @param {Function} fn function called when in the frame @@ -1141,7 +1125,6 @@ frames : { main : 'galaxy_main', - tools : 'galaxy_tools', history : 'galaxy_history' }, Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: api/genomes, create: update docs
by commits-noreply＠bitbucket.org 23 Jul '13

23 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/6187607058e6/ Changeset: 6187607058e6 User: carlfeberhard Date: 2013-07-23 16:12:59 Summary: api/genomes, create: update docs Affected #: 1 file diff -r 547bfb9b7bbe090f93dc4b0935522662bb9805b5 -r 6187607058e66e1b8b31f2da905d603ae0c65f23 lib/galaxy/webapps/galaxy/api/genomes.py --- a/lib/galaxy/webapps/galaxy/api/genomes.py +++ b/lib/galaxy/webapps/galaxy/api/genomes.py @@ -49,19 +49,14 @@ Download and/or index a genome. Parameters:: - - dbkey DB key of the build to download, ignored unless 'UCSC' is specified as the source - ncbi_name NCBI's genome identifier, ignored unless NCBI is specified as the source - ensembl_dbkey Ensembl's genome identifier, ignored unless Ensembl is specified as the source - url_dbkey DB key to use for this build, ignored unless URL is specified as the source - source Data source for this build. Can be: UCSC, Ensembl, NCBI, URL + liftover None or array of liftover url partial paths + dbkey DB key of the build to download indexers POST array of indexers to run after downloading (indexers[] = first, indexers[] = second, ...) + longname a more descriptive name for the genome func Allowed values: 'download' Download and index 'index' Index only - Returns:: - If no error: dict( status: 'ok', job: <job ID> ) @@ -69,6 +64,17 @@ dict( status: 'error', error: <error message> ) """ + #??: Planned? + #Parameters:: + # dbkey DB key of the build to download, ignored unless 'UCSC' is specified as the source + # ncbi_name NCBI's genome identifier, ignored unless NCBI is specified as the source + # ensembl_dbkey Ensembl's genome identifier, ignored unless Ensembl is specified as the source + # url_dbkey DB key to use for this build, ignored unless URL is specified as the source + # source Data source for this build. Can be: UCSC, Ensembl, NCBI, URL + # indexers POST array of indexers to run after downloading (indexers[] = first, indexers[] = second, ...) + # func Allowed values: + # 'download' Download and index + # 'index' Index only params = util.Params( payload ) from galaxy.web.controllers.data_admin import build_param_dict as massage paramdict = massage( params, trans ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: History panel: disable (w/ message) display button for uploading files
by commits-noreply＠bitbucket.org 23 Jul '13

23 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/547bfb9b7bbe/ Changeset: 547bfb9b7bbe User: carlfeberhard Date: 2013-07-23 15:32:22 Summary: History panel: disable (w/ message) display button for uploading files Affected #: 2 files diff -r 72cf2a3a6a2a5d476022072b6646dfbc1d519b09 -r 547bfb9b7bbe090f93dc4b0935522662bb9805b5 static/scripts/mvc/dataset/hda-base.js --- a/static/scripts/mvc/dataset/hda-base.js +++ b/static/scripts/mvc/dataset/hda-base.js @@ -235,6 +235,11 @@ displayBtnData.enabled = false; displayBtnData.title = _l( 'Cannot display datasets removed from disk' ); + // disable if still uploading + } else if( this.model.get( 'state' ) === HistoryDatasetAssociation.STATES.UPLOAD ){ + displayBtnData.enabled = false; + displayBtnData.title = _l( 'This dataset must finish uploading before it can be viewed' ); + } else { displayBtnData.title = _l( 'View data' ); @@ -243,7 +248,14 @@ // add frame manager option onclick event var self = this; - displayBtnData.on_click = function() { parent.frame_manager.frame_new({title: "Data Viewer", type: "url", location: "center", content: self.urls.display }); }; + displayBtnData.on_click = function(){ + parent.frame_manager.frame_new({ + title : "Data Viewer", + type : "url", + location: "center", + content : self.urls.display + }); + }; } this.displayButton = new IconButtonView({ model : new IconButton( displayBtnData ) }); diff -r 72cf2a3a6a2a5d476022072b6646dfbc1d519b09 -r 547bfb9b7bbe090f93dc4b0935522662bb9805b5 static/scripts/packed/mvc/dataset/hda-base.js --- a/static/scripts/packed/mvc/dataset/hda-base.js +++ b/static/scripts/packed/mvc/dataset/hda-base.js @@ -1,1 +1,1 @@ -var HDABaseView=Backbone.View.extend(LoggableMixin).extend({tagName:"div",className:"historyItemContainer",initialize:function(a){if(a.logger){this.logger=this.model.logger=a.logger}this.log(this+".initialize:",a);this.defaultPrimaryActionButtonRenderers=[this._render_showParamsButton];if(!a.urlTemplates){throw ("HDAView needs urlTemplates on initialize")}this.urlTemplates=a.urlTemplates;this.expanded=a.expanded||false;this.model.bind("change",function(c,d){var b=_.without(_.keys(d.changes),"display_apps","display_types");if(b.length){this.render()}else{if(this.expanded){this._render_displayApps()}}},this)},render:function(){var b=this,e=this.model.get("id"),c=this.model.get("state"),a=$("<div/>").attr("id","historyItem-"+e),d=(this.$el.children().size()===0);this.$el.attr("id","historyItemContainer-"+e);this.urls=this._renderUrls(this.urlTemplates,this.model.toJSON());a.addClass("historyItemWrapper").addClass("historyItem").addClass("historyItem-"+c);a.append(this._render_warnings());a.append(this._render_titleBar());this._setUpBehaviors(a);this.body=$(this._render_body());a.append(this.body);this.$el.fadeOut("fast",function(){b.$el.children().remove();b.$el.append(a).fadeIn("fast",function(){b.log(b+" rendered:",b.$el);var f="rendered";if(d){f+=":initial"}else{if(b.model.inReadyState()){f+=":ready"}}b.trigger(f)})});return this},_renderUrls:function(d,a){var b=this,c={};_.each(d,function(e,f){if(_.isObject(e)){c[f]=b._renderUrls(e,a)}else{if(f==="meta_download"){c[f]=b._renderMetaDownloadUrls(e,a)}else{try{c[f]=_.template(e,a)}catch(g){throw (b+"._renderUrls error: "+g+"\n rendering:"+e+"\n with "+JSON.stringify(a))}}}});return c},_renderMetaDownloadUrls:function(b,a){return _.map(a.meta_files,function(c){return{url:_.template(b,{id:a.id,file_type:c.file_type}),file_type:c.file_type}})},_setUpBehaviors:function(a){a=a||this.$el;make_popup_menus(a);a.find(".tooltip").tooltip({placement:"bottom"})},_render_warnings:function(){return $(jQuery.trim(HDABaseView.templates.messages(this.model.toJSON())))},_render_titleBar:function(){var a=$('<div class="historyItemTitleBar" style="overflow: hidden"></div>');a.append(this._render_titleButtons());a.append('<span class="state-icon"></span>');a.append(this._render_titleLink());return a},_render_titleButtons:function(){var a=$('<div class="historyItemButtons"></div>');a.append(this._render_displayButton());return a},_render_displayButton:function(){if((this.model.get("state")===HistoryDatasetAssociation.STATES.NOT_VIEWABLE)||(this.model.get("state")===HistoryDatasetAssociation.STATES.NEW)||(!this.model.get("accessible"))){this.displayButton=null;return null}var a={icon_class:"display",target:"galaxy_main"};if(this.model.get("purged")){a.enabled=false;a.title=_l("Cannot display datasets removed from disk")}else{a.title=_l("View data");a.href="javascript:parent.frame_manager.frame_new({title: 'Data Viewer', type: 'url', location: 'center', content: '"+this.urls.display+"'});"}this.displayButton=new IconButtonView({model:new IconButton(a)});return this.displayButton.render().$el},_render_titleLink:function(){return $(jQuery.trim(HDABaseView.templates.titleLink(_.extend(this.model.toJSON(),{urls:this.urls}))))},_render_hdaSummary:function(){var a=_.extend(this.model.toJSON(),{urls:this.urls});return HDABaseView.templates.hdaSummary(a)},_render_primaryActionButtons:function(c){var a=this,b=$("<div/>").attr("id","primary-actions-"+this.model.get("id"));_.each(c,function(d){b.append(d.call(a))});return b},_render_downloadButton:function(){if(this.model.get("purged")||!this.model.hasData()){return null}var a=HDABaseView.templates.downloadLinks(_.extend(this.model.toJSON(),{urls:this.urls}));return $(a.trim())},_render_showParamsButton:function(){this.showParamsButton=new IconButtonView({model:new IconButton({title:_l("View details"),href:this.urls.show_params,target:"galaxy_main",icon_class:"information"})});return this.showParamsButton.render().$el},_render_displayAppArea:function(){return $("<div/>").addClass("display-apps")},_render_displayApps:function(c){c=c||this.$el;var d=c.find("div.display-apps"),a=this.model.get("display_types"),b=this.model.get("display_apps");if((!this.model.hasData())||(!c||!c.length)||(!d.length)){return}d.html(null);if(!_.isEmpty(a)){d.append(HDABaseView.templates.displayApps({displayApps:a}))}if(!_.isEmpty(b)){d.append(HDABaseView.templates.displayApps({displayApps:b}))}},_render_peek:function(){var a=this.model.get("peek");if(!a){return null}return $("<div/>").append($("<pre/>").attr("id","peek"+this.model.get("id")).addClass("peek").append(a))},_render_body:function(){var a=$("<div/>").attr("id","info-"+this.model.get("id")).addClass("historyItemBody").attr("style","display: none");if(this.expanded){this._render_body_html(a);a.css("display","block")}return a},_render_body_html:function(a){a.html("");switch(this.model.get("state")){case HistoryDatasetAssociation.STATES.NEW:this._render_body_new(a);break;case HistoryDatasetAssociation.STATES.NOT_VIEWABLE:this._render_body_not_viewable(a);break;case HistoryDatasetAssociation.STATES.UPLOAD:this._render_body_uploading(a);break;case HistoryDatasetAssociation.STATES.PAUSED:this._render_body_paused(a);break;case HistoryDatasetAssociation.STATES.QUEUED:this._render_body_queued(a);break;case HistoryDatasetAssociation.STATES.RUNNING:this._render_body_running(a);break;case HistoryDatasetAssociation.STATES.ERROR:this._render_body_error(a);break;case HistoryDatasetAssociation.STATES.DISCARDED:this._render_body_discarded(a);break;case HistoryDatasetAssociation.STATES.SETTING_METADATA:this._render_body_setting_metadata(a);break;case HistoryDatasetAssociation.STATES.EMPTY:this._render_body_empty(a);break;case HistoryDatasetAssociation.STATES.FAILED_METADATA:this._render_body_failed_metadata(a);break;case HistoryDatasetAssociation.STATES.OK:this._render_body_ok(a);break;default:a.append($('<div>Error: unknown dataset state "'+this.model.get("state")+'".</div>'))}a.append('<div style="clear: both"></div>');this._setUpBehaviors(a)},_render_body_new:function(b){var a=_l("This is a new dataset and not all of its data are available yet");b.append($("<div>"+_l(a)+"</div>"))},_render_body_not_viewable:function(a){a.append($("<div>"+_l("You do not have permission to view dataset")+"</div>"))},_render_body_uploading:function(a){a.append($("<div>"+_l("Dataset is uploading")+"</div>"))},_render_body_queued:function(a){a.append($("<div>"+_l("Job is waiting to run")+"</div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_paused:function(a){a.append($("<div>"+_l("Job is paused. Use the history menu to resume")+"</div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_running:function(a){a.append("<div>"+_l("Job is currently running")+"</div>");a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_error:function(a){if(!this.model.get("purged")){a.append($("<div>"+this.model.get("misc_blurb")+"</div>"))}a.append((_l("An error occurred with this dataset")+": <i>"+$.trim(this.model.get("misc_info"))+"</i>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers.concat([this._render_downloadButton])))},_render_body_discarded:function(a){a.append("<div>"+_l("The job creating this dataset was cancelled before completion")+".</div>");a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_setting_metadata:function(a){a.append($("<div>"+_l("Metadata is being auto-detected")+".</div>"))},_render_body_empty:function(a){a.append($("<div>"+_l("No data")+": <i>"+this.model.get("misc_blurb")+"</i></div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_failed_metadata:function(a){a.append($(HDABaseView.templates.failedMetadata(_.extend(this.model.toJSON(),{urls:this.urls}))));this._render_body_ok(a)},_render_body_ok:function(a){a.append(this._render_hdaSummary());if(this.model.isDeletedOrPurged()){a.append(this._render_primaryActionButtons([this._render_downloadButton,this._render_showParamsButton]));return}a.append(this._render_primaryActionButtons([this._render_downloadButton,this._render_showParamsButton]));a.append('<div class="clear"/>');a.append(this._render_displayAppArea());this._render_displayApps(a);a.append(this._render_peek())},events:{"click .historyItemTitle":"toggleBodyVisibility"},toggleBodyVisibility:function(c,a){var b=this;this.expanded=(a===undefined)?(!this.body.is(":visible")):(a);if(this.expanded){b._render_body_html(b.body);this.body.slideDown("fast",function(){b.trigger("body-expanded",b.model.get("id"))})}else{this.body.slideUp("fast",function(){b.trigger("body-collapsed",b.model.get("id"))})}},remove:function(b){var a=this;this.$el.fadeOut("fast",function(){a.$el.remove();a.off();if(b){b()}})},toString:function(){var a=(this.model)?(this.model+""):("(no model)");return"HDABaseView("+a+")"}});HDABaseView.templates={warningMsg:Handlebars.templates["template-warningmessagesmall"],messages:Handlebars.templates["template-hda-warning-messages"],titleLink:Handlebars.templates["template-hda-titleLink"],hdaSummary:Handlebars.templates["template-hda-hdaSummary"],downloadLinks:Handlebars.templates["template-hda-downloadLinks"],failedMetadata:Handlebars.templates["template-hda-failedMetadata"],displayApps:Handlebars.templates["template-hda-displayApps"]}; \ No newline at end of file +var HDABaseView=Backbone.View.extend(LoggableMixin).extend({tagName:"div",className:"historyItemContainer",initialize:function(a){if(a.logger){this.logger=this.model.logger=a.logger}this.log(this+".initialize:",a);this.defaultPrimaryActionButtonRenderers=[this._render_showParamsButton];if(!a.urlTemplates){throw ("HDAView needs urlTemplates on initialize")}this.urlTemplates=a.urlTemplates;this.expanded=a.expanded||false;this.model.bind("change",function(c,d){var b=_.without(_.keys(d.changes),"display_apps","display_types");if(b.length){this.render()}else{if(this.expanded){this._render_displayApps()}}},this)},render:function(){var b=this,e=this.model.get("id"),c=this.model.get("state"),a=$("<div/>").attr("id","historyItem-"+e),d=(this.$el.children().size()===0);this.$el.attr("id","historyItemContainer-"+e);this.urls=this._renderUrls(this.urlTemplates,this.model.toJSON());a.addClass("historyItemWrapper").addClass("historyItem").addClass("historyItem-"+c);a.append(this._render_warnings());a.append(this._render_titleBar());this._setUpBehaviors(a);this.body=$(this._render_body());a.append(this.body);this.$el.fadeOut("fast",function(){b.$el.children().remove();b.$el.append(a).fadeIn("fast",function(){b.log(b+" rendered:",b.$el);var f="rendered";if(d){f+=":initial"}else{if(b.model.inReadyState()){f+=":ready"}}b.trigger(f)})});return this},_renderUrls:function(d,a){var b=this,c={};_.each(d,function(e,f){if(_.isObject(e)){c[f]=b._renderUrls(e,a)}else{if(f==="meta_download"){c[f]=b._renderMetaDownloadUrls(e,a)}else{try{c[f]=_.template(e,a)}catch(g){throw (b+"._renderUrls error: "+g+"\n rendering:"+e+"\n with "+JSON.stringify(a))}}}});return c},_renderMetaDownloadUrls:function(b,a){return _.map(a.meta_files,function(c){return{url:_.template(b,{id:a.id,file_type:c.file_type}),file_type:c.file_type}})},_setUpBehaviors:function(a){a=a||this.$el;make_popup_menus(a);a.find(".tooltip").tooltip({placement:"bottom"})},_render_warnings:function(){return $(jQuery.trim(HDABaseView.templates.messages(this.model.toJSON())))},_render_titleBar:function(){var a=$('<div class="historyItemTitleBar" style="overflow: hidden"></div>');a.append(this._render_titleButtons());a.append('<span class="state-icon"></span>');a.append(this._render_titleLink());return a},_render_titleButtons:function(){var a=$('<div class="historyItemButtons"></div>');a.append(this._render_displayButton());return a},_render_displayButton:function(){if((this.model.get("state")===HistoryDatasetAssociation.STATES.NOT_VIEWABLE)||(this.model.get("state")===HistoryDatasetAssociation.STATES.NEW)||(!this.model.get("accessible"))){this.displayButton=null;return null}var b={icon_class:"display",target:"galaxy_main"};if(this.model.get("purged")){b.enabled=false;b.title=_l("Cannot display datasets removed from disk")}else{if(this.model.get("state")===HistoryDatasetAssociation.STATES.UPLOAD){b.enabled=false;b.title=_l("This dataset must finish uploading before it can be viewed")}else{b.title=_l("View data");b.href=this.urls.display;var a=this;b.on_click=function(){parent.frame_manager.frame_new({title:"Data Viewer",type:"url",location:"center",content:a.urls.display})}}}this.displayButton=new IconButtonView({model:new IconButton(b)});return this.displayButton.render().$el},_render_titleLink:function(){return $(jQuery.trim(HDABaseView.templates.titleLink(_.extend(this.model.toJSON(),{urls:this.urls}))))},_render_hdaSummary:function(){var a=_.extend(this.model.toJSON(),{urls:this.urls});return HDABaseView.templates.hdaSummary(a)},_render_primaryActionButtons:function(c){var a=this,b=$("<div/>").attr("id","primary-actions-"+this.model.get("id"));_.each(c,function(d){b.append(d.call(a))});return b},_render_downloadButton:function(){if(this.model.get("purged")||!this.model.hasData()){return null}var a=HDABaseView.templates.downloadLinks(_.extend(this.model.toJSON(),{urls:this.urls}));return $(a.trim())},_render_showParamsButton:function(){this.showParamsButton=new IconButtonView({model:new IconButton({title:_l("View details"),href:this.urls.show_params,target:"galaxy_main",icon_class:"information"})});return this.showParamsButton.render().$el},_render_displayAppArea:function(){return $("<div/>").addClass("display-apps")},_render_displayApps:function(c){c=c||this.$el;var d=c.find("div.display-apps"),a=this.model.get("display_types"),b=this.model.get("display_apps");if((!this.model.hasData())||(!c||!c.length)||(!d.length)){return}d.html(null);if(!_.isEmpty(a)){d.append(HDABaseView.templates.displayApps({displayApps:a}))}if(!_.isEmpty(b)){d.append(HDABaseView.templates.displayApps({displayApps:b}))}},_render_peek:function(){var a=this.model.get("peek");if(!a){return null}return $("<div/>").append($("<pre/>").attr("id","peek"+this.model.get("id")).addClass("peek").append(a))},_render_body:function(){var a=$("<div/>").attr("id","info-"+this.model.get("id")).addClass("historyItemBody").attr("style","display: none");if(this.expanded){this._render_body_html(a);a.css("display","block")}return a},_render_body_html:function(a){a.html("");switch(this.model.get("state")){case HistoryDatasetAssociation.STATES.NEW:this._render_body_new(a);break;case HistoryDatasetAssociation.STATES.NOT_VIEWABLE:this._render_body_not_viewable(a);break;case HistoryDatasetAssociation.STATES.UPLOAD:this._render_body_uploading(a);break;case HistoryDatasetAssociation.STATES.PAUSED:this._render_body_paused(a);break;case HistoryDatasetAssociation.STATES.QUEUED:this._render_body_queued(a);break;case HistoryDatasetAssociation.STATES.RUNNING:this._render_body_running(a);break;case HistoryDatasetAssociation.STATES.ERROR:this._render_body_error(a);break;case HistoryDatasetAssociation.STATES.DISCARDED:this._render_body_discarded(a);break;case HistoryDatasetAssociation.STATES.SETTING_METADATA:this._render_body_setting_metadata(a);break;case HistoryDatasetAssociation.STATES.EMPTY:this._render_body_empty(a);break;case HistoryDatasetAssociation.STATES.FAILED_METADATA:this._render_body_failed_metadata(a);break;case HistoryDatasetAssociation.STATES.OK:this._render_body_ok(a);break;default:a.append($('<div>Error: unknown dataset state "'+this.model.get("state")+'".</div>'))}a.append('<div style="clear: both"></div>');this._setUpBehaviors(a)},_render_body_new:function(b){var a=_l("This is a new dataset and not all of its data are available yet");b.append($("<div>"+_l(a)+"</div>"))},_render_body_not_viewable:function(a){a.append($("<div>"+_l("You do not have permission to view dataset")+"</div>"))},_render_body_uploading:function(a){a.append($("<div>"+_l("Dataset is uploading")+"</div>"))},_render_body_queued:function(a){a.append($("<div>"+_l("Job is waiting to run")+"</div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_paused:function(a){a.append($("<div>"+_l("Job is paused. Use the history menu to resume")+"</div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_running:function(a){a.append("<div>"+_l("Job is currently running")+"</div>");a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_error:function(a){if(!this.model.get("purged")){a.append($("<div>"+this.model.get("misc_blurb")+"</div>"))}a.append((_l("An error occurred with this dataset")+": <i>"+$.trim(this.model.get("misc_info"))+"</i>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers.concat([this._render_downloadButton])))},_render_body_discarded:function(a){a.append("<div>"+_l("The job creating this dataset was cancelled before completion")+".</div>");a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_setting_metadata:function(a){a.append($("<div>"+_l("Metadata is being auto-detected")+".</div>"))},_render_body_empty:function(a){a.append($("<div>"+_l("No data")+": <i>"+this.model.get("misc_blurb")+"</i></div>"));a.append(this._render_primaryActionButtons(this.defaultPrimaryActionButtonRenderers))},_render_body_failed_metadata:function(a){a.append($(HDABaseView.templates.failedMetadata(_.extend(this.model.toJSON(),{urls:this.urls}))));this._render_body_ok(a)},_render_body_ok:function(a){a.append(this._render_hdaSummary());if(this.model.isDeletedOrPurged()){a.append(this._render_primaryActionButtons([this._render_downloadButton,this._render_showParamsButton]));return}a.append(this._render_primaryActionButtons([this._render_downloadButton,this._render_showParamsButton]));a.append('<div class="clear"/>');a.append(this._render_displayAppArea());this._render_displayApps(a);a.append(this._render_peek())},events:{"click .historyItemTitle":"toggleBodyVisibility"},toggleBodyVisibility:function(c,a){var b=this;this.expanded=(a===undefined)?(!this.body.is(":visible")):(a);if(this.expanded){b._render_body_html(b.body);this.body.slideDown("fast",function(){b.trigger("body-expanded",b.model.get("id"))})}else{this.body.slideUp("fast",function(){b.trigger("body-collapsed",b.model.get("id"))})}},remove:function(b){var a=this;this.$el.fadeOut("fast",function(){a.$el.remove();a.off();if(b){b()}})},toString:function(){var a=(this.model)?(this.model+""):("(no model)");return"HDABaseView("+a+")"}});HDABaseView.templates={warningMsg:Handlebars.templates["template-warningmessagesmall"],messages:Handlebars.templates["template-hda-warning-messages"],titleLink:Handlebars.templates["template-hda-titleLink"],hdaSummary:Handlebars.templates["template-hda-hdaSummary"],downloadLinks:Handlebars.templates["template-hda-downloadLinks"],failedMetadata:Handlebars.templates["template-hda-failedMetadata"],displayApps:Handlebars.templates["template-hda-displayApps"]}; \ No newline at end of file Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: API histories, delete: ensure HTTPExceptions are raised, better return values; API workflows delete: add code 400 to not found clause, change to code 403 for not accessible clause
by commits-noreply＠bitbucket.org 22 Jul '13

22 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/72cf2a3a6a2a/ Changeset: 72cf2a3a6a2a User: carlfeberhard Date: 2013-07-22 23:04:52 Summary: API histories, delete: ensure HTTPExceptions are raised, better return values; API workflows delete: add code 400 to not found clause, change to code 403 for not accessible clause Affected #: 2 files diff -r 3a27539764348d4099669bc7fe94c9432e62aff0 -r 72cf2a3a6a2a5d476022072b6646dfbc1d519b09 lib/galaxy/webapps/galaxy/api/histories.py --- a/lib/galaxy/webapps/galaxy/api/histories.py +++ b/lib/galaxy/webapps/galaxy/api/histories.py @@ -4,7 +4,7 @@ import pkg_resources pkg_resources.require( "Paste" ) -from paste.httpexceptions import HTTPBadRequest, HTTPForbidden +from paste.httpexceptions import HTTPBadRequest, HTTPForbidden, HTTPInternalServerError, HTTPException from galaxy import web from galaxy.util import string_as_bool, restore_text @@ -124,6 +124,7 @@ if kwd.get( 'payload', None ): purge = string_as_bool( kwd['payload'].get( 'purge', False ) ) + rval = { 'id' : history_id } try: history = self.get_history( trans, history_id, check_ownership=True, check_accessible=False ) history.deleted = True @@ -152,14 +153,24 @@ # Now mark the history as purged history.purged = True self.sa_session.add( history ) + rval[ 'purged' ] = True trans.sa_session.flush() + rval[ 'deleted' ] = True - #TODO: better feedback than this... - except Exception, e: - return str( e ) + except HTTPInternalServerError, http_server_err: + log.exception( 'Histories API, delete: uncaught HTTPInternalServerError: %s, %s\n%s', + history_id, str( kwd ), str( http_server_err ) ) + raise + except HTTPException, http_exc: + raise + except Exception, exc: + log.exception( 'Histories API, delete: uncaught exception: %s, %s\n%s', + history_id, str( kwd ), str( exc ) ) + trans.response.status = 500 + rval.update({ 'error': str( exc ) }) - return 'OK' + return rval @web.expose_api def undelete( self, trans, id, **kwd ): diff -r 3a27539764348d4099669bc7fe94c9432e62aff0 -r 72cf2a3a6a2a5d476022072b6646dfbc1d519b09 lib/galaxy/webapps/galaxy/api/workflows.py --- a/lib/galaxy/webapps/galaxy/api/workflows.py +++ b/lib/galaxy/webapps/galaxy/api/workflows.py @@ -290,13 +290,14 @@ try: stored_workflow = trans.sa_session.query(self.app.model.StoredWorkflow).get(trans.security.decode_id(workflow_id)) - except Exception,e: + except Exception, e: + trans.response.status = 400 return ("Workflow with ID='%s' can not be found\n Exception: %s") % (workflow_id, str( e )) # check to see if user has permissions to selected workflow if stored_workflow.user != trans.user and not trans.user_is_admin(): if trans.sa_session.query(trans.app.model.StoredWorkflowUserShareAssociation).filter_by(user=trans.user, stored_workflow=stored_workflow).count() == 0: - trans.response.status = 400 + trans.response.status = 403 return("Workflow is not owned by or shared with current user") #Mark a workflow as deleted Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: library upload: sort dbkeys, default to unspecified, remove unneeded call to replace_big_select_inputs
by commits-noreply＠bitbucket.org 22 Jul '13

22 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/3a2753976434/ Changeset: 3a2753976434 User: carlfeberhard Date: 2013-07-22 21:48:50 Summary: library upload: sort dbkeys, default to unspecified, remove unneeded call to replace_big_select_inputs Affected #: 2 files diff -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 -r 3a27539764348d4099669bc7fe94c9432e62aff0 lib/galaxy/webapps/galaxy/controllers/library_common.py --- a/lib/galaxy/webapps/galaxy/controllers/library_common.py +++ b/lib/galaxy/webapps/galaxy/controllers/library_common.py @@ -949,7 +949,10 @@ # Send list of data formats to the upload form so the "extension" select list can be populated dynamically file_formats = trans.app.datatypes_registry.upload_file_formats + dbkeys = trans.app.genomes.get_dbkeys( trans ) + dbkeys.sort( key=lambda dbkey: dbkey[0].lower() ) + # Send the current history to the form to enable importing datasets from history to library history = trans.get_history() if history is not None: diff -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 -r 3a27539764348d4099669bc7fe94c9432e62aff0 templates/webapps/galaxy/library/common/common.mako --- a/templates/webapps/galaxy/library/common/common.mako +++ b/templates/webapps/galaxy/library/common/common.mako @@ -271,8 +271,16 @@ <label>Genome:</label><div class="form-row-input"><select name="dbkey" last_selected_value="?"> + <% + # move unspecified to the first option and set as default if not last_used_build + #TODO: remove when we decide on a common dbkey selector widget + unspecified = ('unspecified (?)', '?') + dbkeys.remove( unspecified ) + dbkeys.insert( 0, unspecified ) + default_selected = last_used_build or '?' + %> %for dbkey in dbkeys: - %if dbkey[1] == last_used_build: + %if dbkey[1] == default_selected: <option value="${dbkey[1]}" selected>${dbkey[0]}</option> %else: <option value="${dbkey[1]}">${dbkey[0]}</option> @@ -331,13 +339,6 @@ </form></div></div> - ## Script to replace dbkey select with select+search. - <script type="text/javascript"> - // Replace dbkey select with search+select. - jQuery(document).ready( function() { - replace_big_select_inputs(); - }); - </script> %elif upload_option == 'import_from_history': <div class="toolForm"><div class="toolFormTitle">Active datasets in your current history (${ util.unicodify( history.name )})</div> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: Dave Bouvier: Wrap the repository type select in form tags so that Twill will correctly parse the HTML on the browse repository files page. This resolves failing functional tests in the test_0440_deleting_dependency_definitions script.
by commits-noreply＠bitbucket.org 22 Jul '13

22 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/b72d967e0cf4/ Changeset: b72d967e0cf4 User: Dave Bouvier Date: 2013-07-22 19:14:58 Summary: Wrap the repository type select in form tags so that Twill will correctly parse the HTML on the browse repository files page. This resolves failing functional tests in the test_0440_deleting_dependency_definitions script. Affected #: 2 files diff -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 templates/webapps/tool_shed/repository/browse_repository.mako --- a/templates/webapps/tool_shed/repository/browse_repository.mako +++ b/templates/webapps/tool_shed/repository/browse_repository.mako @@ -46,7 +46,9 @@ ${render_clone_str( repository )} </div> %endif - ${render_repository_type_select_field( repository_type_select_field, render_help=False )} + <form name="repository_type"> + ${render_repository_type_select_field( repository_type_select_field, render_help=False )} + </form> %if can_push: <form name="select_files_to_delete" id="select_files_to_delete" action="${h.url_for( controller='repository', action='select_files_to_delete', id=trans.security.encode_id( repository.id ))}" method="post" ><div class="form-row" > diff -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 -r b72d967e0cf4a506f0bfbcef0f068fe1709659e9 test/tool_shed/base/twilltestcase.py --- a/test/tool_shed/base/twilltestcase.py +++ b/test/tool_shed/base/twilltestcase.py @@ -348,7 +348,7 @@ # Twill sets hidden form fields to read-only by default. We need to write to this field. form = tc.browser.get_form( 'select_files_to_delete' ) form.find_control( "selected_files_to_delete" ).readonly = False - tc.fv( "1", "selected_files_to_delete", ','.join( files_to_delete ) ) + tc.fv( "2", "selected_files_to_delete", ','.join( files_to_delete ) ) tc.submit( 'select_files_to_delete_button' ) self.check_for_strings( strings_displayed, strings_not_displayed ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/ca99a6970101/ Changeset: ca99a6970101 Branch: mepcotterell/allow-pip-to-run-when-venv_directory-con-1373715782557 User: mepcotterell Date: 2013-07-13 13:44:05 Summary: allow pip to run when venv_directory contains spaces Affected #: 1 file diff -r a0ea8ac5583cd295266eac38a12da4d9fd7613ac -r ca99a6970101125e19328e72216c120a3a8027aa lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -277,7 +277,7 @@ # POSIXLY_CORRECT forces shell commands . and source to have the same # and well defined behavior in bash/zsh. activate_command = "POSIXLY_CORRECT=1; . %s" % os.path.join( venv_directory, "bin", "activate" ) - install_command = "pip install -r '%s'" % requirements_path + install_command = "python '%s' install -r '%s'" % ( os.path.join( venv_directory, "bin", "pip" ), requirements_path ) full_setup_command = "%s; %s; %s" % ( setup_command, activate_command, install_command ) return_code = handle_command( app, tool_dependency, install_dir, full_setup_command ) if return_code: https://bitbucket.org/galaxy/galaxy-central/commits/559effee9eb7/ Changeset: 559effee9eb7 User: natefoo Date: 2013-07-19 22:52:50 Summary: Merged in mepcotterell/galaxy-central/mepcotterell/allow-pip-to-run-when-venv_directory-con-1373715782557 (pull request #195) allow pip to run when venv_directory contains spaces Affected #: 1 file diff -r 2ba6bd8a9d25e26ce6668c2a0219199b49e255d7 -r 559effee9eb7a5b0b78fea2df900e35dd5cf7d04 lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -277,7 +277,7 @@ # POSIXLY_CORRECT forces shell commands . and source to have the same # and well defined behavior in bash/zsh. activate_command = "POSIXLY_CORRECT=1; . %s" % os.path.join( venv_directory, "bin", "activate" ) - install_command = "pip install -r '%s'" % requirements_path + install_command = "python '%s' install -r '%s'" % ( os.path.join( venv_directory, "bin", "pip" ), requirements_path ) full_setup_command = "%s; %s; %s" % ( setup_command, activate_command, install_command ) return_code = handle_command( app, tool_dependency, install_dir, full_setup_command ) if return_code: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Enhance the change_directory action for installing tool dependencies via fabric to allow for changing the current directory to a location above the current working directory as long as the location is still within the defined working_directory.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/2ba6bd8a9d25/ Changeset: 2ba6bd8a9d25 User: greg Date: 2013-07-19 21:19:04 Summary: Enhance the change_directory action for installing tool dependencies via fabric to allow for changing the current directory to a location above the current working directory as long as the location is still within the defined working_directory. Affected #: 1 file diff -r 5d0cfe53740b554f2643a3518ea23807dfdb26a5 -r 2ba6bd8a9d25e26ce6668c2a0219199b49e255d7 lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py --- a/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py +++ b/lib/tool_shed/galaxy_install/tool_dependencies/fabric_util.py @@ -339,9 +339,13 @@ extract = action_dict.get( 'extract', False ) common_util.url_download( current_dir, filename, url, extract=extract ) elif action_type == 'change_directory': - target_directory = os.path.realpath( os.path.join( current_dir, action_dict[ 'directory' ] ) ) + target_directory = os.path.realpath( os.path.normpath( os.path.join( current_dir, action_dict[ 'directory' ] ) ) ) if target_directory.startswith( os.path.realpath( current_dir ) ) and os.path.exists( target_directory ): + # Change directory to a directory within the current working directory. dir = target_directory + elif target_directory.startswith( os.path.realpath( work_dir ) ) and os.path.exists( target_directory ): + # Change directory to a directory above the current working directory, but within the defined work_dir. + dir = target_directory.replace( os.path.realpath( work_dir ), '' ).lstrip( '/' ) else: log.error( 'Invalid or nonexistent directory %s specified, ignoring change_directory action.', target_directory ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: guerler: bowtie2 wrapper update
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/5d0cfe53740b/ Changeset: 5d0cfe53740b User: guerler Date: 2013-07-19 20:56:39 Summary: bowtie2 wrapper update Affected #: 1 file diff -r 883d7c4b387c0e701539b49e593144b7c027a64c -r 5d0cfe53740b554f2643a3518ea23807dfdb26a5 tools/sr_mapping/bowtie2_wrapper.xml --- a/tools/sr_mapping/bowtie2_wrapper.xml +++ b/tools/sr_mapping/bowtie2_wrapper.xml @@ -99,7 +99,7 @@ ## rename unaligned sequence files #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: - #set left = str(str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )) + #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' ) #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) mv $left $output_unaligned_reads_l; @@ -317,6 +317,7 @@ Trim n-bases from 5' (left) end of each read before alignment. *-3/--trim3 (default: 0)* + Trim n-bases from 3' (right) end of each read before alignment. *--nofw/--norc (default: both strands enabled)* Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: guerler: bowtie2 tool wrapper update
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/883d7c4b387c/ Changeset: 883d7c4b387c User: guerler Date: 2013-07-19 20:30:38 Summary: bowtie2 tool wrapper update Affected #: 2 files diff -r cd7fe5ef532822f778dda054ec434aec6ce17eee -r 883d7c4b387c0e701539b49e593144b7c027a64c tools/sr_mapping/bowtie2_wrapper.py --- a/tools/sr_mapping/bowtie2_wrapper.py +++ /dev/null @@ -1,172 +0,0 @@ -#!/usr/bin/env python - -import optparse, os, shutil, subprocess, sys, tempfile, fileinput - -def stop_err( msg ): - sys.stderr.write( "%s\n" % msg ) - sys.exit() - -def __main__(): - #Parse Command Line - parser = optparse.OptionParser() - parser.add_option( '-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.' ) - parser.add_option( '', '--own-file', dest='own_file', help='' ) - parser.add_option( '-D', '--indexes-path', dest='index_path', help='Indexes directory; location of .ebwt and .fa files.' ) - - # Wrapper options. - parser.add_option( '-O', '--output', dest='output' ) - parser.add_option( '-1', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) - parser.add_option( '-2', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) - parser.add_option( '', '--single-paired', dest='single_paired', help='' ) - parser.add_option( '-I', '--minins', dest='min_insert' ) - parser.add_option( '-X', '--maxins', dest='max_insert' ) - parser.add_option( '', '--settings', dest='settings', help='' ) - parser.add_option( '', '--end-to-end', dest='end_to_end', action="store_true" ) - parser.add_option( '', '--local', dest='local', action="store_true" ) - parser.add_option( '', '--preset-alignment', dest='preset_alignment') - - # Read group options. - parser.add_option( '', '--rgid', dest='rgid', help='Read group identifier' ) - parser.add_option( '', '--rglb', dest='rglb', help='Library name' ) - parser.add_option( '', '--rgpl', dest='rgpl', help='Platform/technology used to produce the reads' ) - parser.add_option( '', '--rgsm', dest='rgsm', help='Sample' ) - - parser.add_option( '', '--output_unaligned_reads', dest='output_unaligned_reads', help='File name for unaligned reads (single-end)' ) - parser.add_option( '', '--output_unaligned_reads_l', dest='output_unaligned_reads_l', help='File name for unaligned reads (left, paired-end)' ) - parser.add_option( '', '--output_unaligned_reads_r', dest='output_unaligned_reads_r', help='File name for unaligned reads (right, paired-end)' ) - - (options, args) = parser.parse_args() - - tmp_unaligned_file_name = None - # Creat bowtie index if necessary. - tmp_index_dir = tempfile.mkdtemp() - - if options.single_paired == 'paired': - if options.output_unaligned_reads_l and options.output_unaligned_reads_r: - tmp_unaligned_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir, suffix='.fastq' ) - tmp_unaligned_file_name = tmp_unaligned_file.name - tmp_unaligned_file.close() - output_unaligned_reads = '--un-conc %s' % tmp_unaligned_file_name - else: - output_unaligned_reads = '' - elif options.output_unaligned_reads: - output_unaligned_reads = '--un %s' % options.output_unaligned_reads - else: - output_unaligned_reads = '' - - if options.own_file: - index_path = os.path.join( tmp_index_dir, '.'.join( os.path.split( options.own_file )[1].split( '.' )[:-1] ) ) - try: - os.link( options.own_file, index_path + '.fa' ) - except: - # Bowtie prefers (but doesn't require) fasta file to be in same directory, with .fa extension - pass - cmd_index = 'bowtie2-build -f %s %s' % ( options.own_file, index_path ) - try: - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name - tmp_stderr = open( tmp, 'wb' ) - proc = subprocess.Popen( args=cmd_index, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - except Exception, e: - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( 'Error indexing reference sequence\n' + str( e ) ) - else: - index_path = options.index_path - - # Build bowtie command; use view and sort to create sorted bam. - cmd = 'bowtie2 %s -x %s %s %s | samtools view -Su - | samtools sort -o - - > %s' - - # Set up reads. - if options.single_paired == 'paired': - reads = " -1 %s -2 %s" % ( options.input1, options.input2 ) - else: - reads = " -U %s" % ( options.input1 ) - - # Set up options. - opts = '-p %s' % ( options.num_threads ) - if options.single_paired == 'paired': - if options.min_insert: - opts += ' -I %s' % options.min_insert - if options.max_insert: - opts += ' -X %s' % options.max_insert - if options.settings == 'preSet': - pass - else: - if options.local: - opts += ' --local' - if options.preset_alignment: - opts += ' --' + options.preset_alignment - - # Read group options. - if options.rgid: - if not options.rglb or not options.rgpl or not options.rgsm: - stop_err( 'If you want to specify read groups, you must include the ID, LB, PL, and SM tags.' ) - opts += ' --rg-id %s' % options.rgid - opts += ' --rg %s:%s' % ( 'LB', options.rglb ) - opts += ' --rg %s:%s' % ( 'PL', options.rgpl ) - opts += ' --rg %s:%s' % ( 'SM', options.rgsm ) - - # Final command: - cmd = cmd % ( opts, index_path, reads, output_unaligned_reads, options.output ) - print cmd - - # Run - try: - tmp_out = tempfile.NamedTemporaryFile().name - tmp_stdout = open( tmp_out, 'wb' ) - tmp_err = tempfile.NamedTemporaryFile().name - tmp_stderr = open( tmp_err, 'wb' ) - proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stdout=tmp_stdout, stderr=tmp_stderr ) - returncode = proc.wait() - tmp_stderr.close() - # get stderr, allowing for case where it's very large - tmp_stderr = open( tmp_err, 'rb' ) - stderr = '' - buffsize = 1048576 - try: - while True: - stderr += tmp_stderr.read( buffsize ) - if not stderr or len( stderr ) % buffsize != 0: - break - except OverflowError: - pass - tmp_stdout.close() - tmp_stderr.close() - if returncode != 0: - raise Exception, stderr - - # TODO: look for errors in program output. - except Exception, e: - stop_err( 'Error in bowtie2:\n' + str( e ) ) - - # get unaligned reads output files in place if appropriate - if options.single_paired == 'paired' and tmp_unaligned_file_name and options.output_unaligned_reads_l and options.output_unaligned_reads_r: - try: - left = tmp_unaligned_file_name.replace( '.fastq', '.1.fastq' ) - right = tmp_unaligned_file_name.replace( '.fastq', '.2.fastq' ) - shutil.move( left, options.output_unaligned_reads_l ) - shutil.move( right, options.output_unaligned_reads_r ) - except Exception, e: - sys.stdout.write( 'Error producing the unaligned output files.\n' ) - - # Clean up temp dirs - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - -if __name__=="__main__": __main__() diff -r cd7fe5ef532822f778dda054ec434aec6ce17eee -r 883d7c4b387c0e701539b49e593144b7c027a64c tools/sr_mapping/bowtie2_wrapper.xml --- a/tools/sr_mapping/bowtie2_wrapper.xml +++ b/tools/sr_mapping/bowtie2_wrapper.xml @@ -1,4 +1,4 @@ -<tool id="bowtie2" name="Bowtie2" version="0.1"> +<tool id="bowtie2" name="Bowtie2" version="0.2"><description>is a short-read aligner</description><version_command>bowtie2 --version</version_command> @@ -6,85 +6,136 @@ <requirement type="package">bowtie2</requirement><requirement type="package">samtools</requirement></requirements> - <command interpreter="python"> - bowtie2_wrapper.py + + <command> + ## prepare bowtie2 index + #set index_path = '' + #if str($reference_genome.source) == "history": + bowtie2-build "$reference_genome.own_file" genome; ln -s "$reference_genome.own_file" genome.fa; + #set index_path = 'genome' + #else: + #set index_path = $reference_genome.index.fields.path + #end if - ## Change this to accommodate the number of threads you have available. - --num-threads="4" + ## execute bowtie2 + bowtie2 + + ## number of threads + -p 4 - ## Outputs. - --output=$output - - #if str( $singlePaired.sPaired ) == "single" + ## index file path + -x $index_path + + ## check for single/pair-end + #if str( $library.type ) == "single" + ## prepare inputs + -U $library.input_1 + #if $output_unaligned_reads_l - --output_unaligned_reads=$output_unaligned_reads_l + --un $output_unaligned_reads_l #end if #else - #if $output_unaligned_reads_l and $output_unaligned_reads_r - --output_unaligned_reads_l=$output_unaligned_reads_l - --output_unaligned_reads_r=$output_unaligned_reads_r + ## prepare inputs + -1 $library.input_1 + -2 $library.input_2 + -I $library.min_insert + -X $library.max_insert + + #if $output_unaligned_reads_l + --un-conc $output_unaligned_reads_l #end if #end if - ## Handle reference file. - #if $refGenomeSource.genomeSource == "history": - --own-file=$refGenomeSource.ownFile - #else: - --indexes-path="${refGenomeSource.index.fields.path}" - #end if + ## configure settings + #if str($params.full) == "yes": + ## add alignment type + $params.align_type - ## Are reads single-end or paired? - --single-paired=$singlePaired.sPaired + ## add performance + $params.performance + + ## add time flag + $params.time + + ## add nofw/norc + $params.nofw_norc - ## First input file always required. - --input1=$input1 + ## set gbar + --gbar $params.gbar - ## Second input only if input is paired-end. - #if $singlePaired.sPaired == "paired" - --input2=$singlePaired.input2 - -I $singlePaired.minInsert - -X $singlePaired.maxInsert - #end if + ## check skip + #if str($params.skip) != "0": + -s $params.skip + #end if - ## Set params. - --settings=$params.settingsType + ## check upto + #if str($params.upto) != "0": + -u $params.upto + #end if - #if $params.settingsType == "full": - #if str($params.align_type) == "end_to_end": - --end-to-end --preset-alignment=$params.preset.align_preset_select - #else: - --local --preset-alignment=$params.preset.align_preset_select-local + ## check trim5 + #if str($params.trim5) != "0": + -5 $params.trim5 + #end if + + ## check trim3 + #if str($params.trim3) != "0": + -3 $params.trim3 #end if #end if - - ## Read group information. - #if $readGroup.specReadGroup == "yes" - --rgid="$readGroup.rgid" - --rglb="$readGroup.rglb" - --rgpl="$readGroup.rgpl" - --rgsm="$readGroup.rgsm" + + ## read group information + #if str($read_group.selection) == "yes": + #if $read_group.rgid and $read_group.rglb and $read_group.rgpl and $read_group.rgsm: + --rg-id $read_group.rgid + --rg LB:$read_group.rglb + --rg PL:$read_group.rgpl + --rg SM:$read_group.rgsm + #end if + #end if + + ## view/sort and output file + | samtools view -Su - | samtools sort -o - - > $output; + + ## rename unaligned sequence files + #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: + #set left = str(str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )) + #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' ) + + mv $left $output_unaligned_reads_l; + mv $right $output_unaligned_reads_r; #end if </command> + +  + <stdio> + <regex match="Exception" source="stderr" level="fatal" description="Tool exception"/> + </stdio> + <inputs> - <conditional name="singlePaired"> - <param name="sPaired" type="select" label="Is this library mate-paired?"> +  + <conditional name="library"> + <param name="type" type="select" label="Is this library mate-paired?"><option value="single">Single-end</option><option value="paired">Paired-end</option></param><when value="single"> - <param format="fastqsanger" name="input1" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/> + <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/></when><when value="paired"> - <param format="fastqsanger" name="input1" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> - <param format="fastqsanger" name="input2" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> -  - <param name="minInsert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments" /> - <param name="maxInsert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments" /> + <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <param name="input_2" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <param name="min_insert" type="integer" value="0" label="Minimum insert size for valid paired-end alignments" /> + <param name="max_insert" type="integer" value="250" label="Maximum insert size for valid paired-end alignments" /></when></conditional> - <param name="unalignedFile" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write all reads that could not be aligned to a file (uses --un for single-end and --un-conc for paired-ends)" /> - <conditional name="refGenomeSource"> - <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + +  + <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads to separate file(s)" /> + +  + <conditional name="reference_genome"> + <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"><option value="indexed">Use a built-in index</option><option value="history">Use one from the history</option></param> @@ -97,40 +148,13 @@ </param></when><when value="history"> - <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> - </when> - </conditional> - <conditional name="params"> - <param name="settingsType" type="select" label="Parameter Settings" help="You can use the default settings or set custom values for any of Bowtie's parameters."> - <option value="preSet">Use Defaults</option> - <option value="full">Full parameter list</option> - </param> - <when value="preSet" /> -  - <when value="full"> - <param name="align_type" type="select" label="Type of alignment"> - <option selected="true" value="end_to_end">End to end</option> - <option value="local">Local</option> - </param> - <conditional name="preset"> - <param name="b2_preset" type="select" label="Use Preset options"> - <option selected="true" value="Yes">Yes</option> - <option value="No">No</option> - </param> - <when value="Yes"> - <param name="align_preset_select" type="select" label="Preset option"> - <option value="very-fast">Very fast</option> - <option value="fast">Fast</option> - <option selected="true" value="sensitive">Sensitive</option> - <option value="very-sensitive">Very sensitive</option> - </param> - </when> - <when value="No" /> - </conditional> - </when> - </conditional> - <conditional name="readGroup"> - <param name="specReadGroup" type="select" label="Specify the read group for this file?"> + <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> + </when> + </conditional> + +  + <conditional name="read_group"> + <param name="selection" type="select" label="Specify the read group for this file?"><option value="yes">Yes</option><option value="no" selected="True">No</option></param> @@ -141,40 +165,87 @@ <param name="rgsm" type="text" size="25" label="Sample (SM)" help="Required if RG specified. Use pool name where a pool is being sequenced" /></when><when value="no" /> - </conditional> + </conditional> + +  + <conditional name="params"> + <param name="full" type="select" label="Parameter Settings" help="You can use the default settings or set custom values for any of Bowtie's parameters."> + <option value="no">Use defaults</option> + <option value="yes">Full parameter list</option> + </param> + <when value="yes"> + <param name="align_type" type="select" label="Type of alignment"> + <option value="" selected="true">End to end</option> + <option value="--local">Local</option> + </param> + + <param name="performance" type="select" label="Preset option"> + <option value="">Default</option> + <option value="--very-fast">Very fast</option> + <option value="--fast">Fast</option> + <option value="--sensitive" selected="true">Sensitive</option> + <option value="--very-sensitive">Very sensitive</option> + </param> + + <param name="gbar" type="integer" value="4" label="Disallow gaps within n-positions of read" /> + + <param name="trim5" type="integer" value="0" label="Trim n-bases from 5' of each read" /> + + <param name="trim3" type="integer" value="0" label="Trim n-bases from 3' of each read" /> + + <param name="skip" type="integer" value="0" label="Skip the first n-reads" /> + + <param name="upto" type="integer" value="0" label="Number of reads to be aligned (0 = unlimited)" /> + + <param name="nofw_norc" type="select" label="Strand directions"> + <option value="">Both</option> + <option value="--nofw">Disable forward</option> + <option value="--norc">Disable reverse</option> + </param> + + <param name="time" type="select" label="Log mapping time"> + <option value="">No</option> + <option value="--time">Yes</option> + </param> + + </when> + <when value="no" /> + </conditional> + </inputs> + <outputs><data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > - <filter>unalignedFile is True</filter> + <filter>unaligned_file is True</filter><actions><action type="format"> - <option type="from_param" name="singlePaired.input1" param_attribute="ext" /> + <option type="from_param" name="library.input_1" param_attribute="ext" /></action></actions></data><data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)"> - <filter>singlePaired['sPaired'] == "paired" and unalignedFile is True</filter> + <filter>library['type'] == "paired" and unaligned_file is True</filter><actions><action type="format"> - <option type="from_param" name="singlePaired.input1" param_attribute="ext" /> + <option type="from_param" name="library.input_1" param_attribute="ext" /></action></actions></data><data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads"><actions> - <conditional name="refGenomeSource.genomeSource"> + <conditional name="reference_genome.source"><when value="indexed"><action type="metadata" name="dbkey"><option type="from_data_table" name="bowtie2_indexes" column="1" offset="0"><filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> - <filter type="param_value" ref="refGenomeSource.index" column="0"/> + <filter type="param_value" ref="reference_genome.index" column="0"/></option></action></when><when value="history"><action type="metadata" name="dbkey"> - <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" /></action></when></conditional> @@ -186,5 +257,115 @@ </tests><help> +**Bowtie2 Overview** + +Bowtie_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools. + +*Please cite:* Langmead, B., Trapnell, C., Pop, M. and Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25 (2009) + +.. _Bowtie: http://bowtie-bio.sourceforge.net/bowtie2/ + +------ + +**Inputs** + +Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. + +------ + +**Outputs** + +The mapped sequence reads are provided as BAM file, while unmapped reads are optionally available as SAM records. When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:: + + 20000 reads; of these: + 20000 (100.00%) were unpaired; of these: + 1247 (6.24%) aligned 0 times + 18739 (93.69%) aligned exactly 1 time + 14 (0.07%) aligned >1 times + 93.77% overall alignment rate + +------ + +**Alignment options** + +*--end-to-end/--local* + +By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment. When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score. + +End-to-end alignment example:: + + Read GACTGGGCGATCTCGACTTCG + ||||| |||||||||||||| + Reference GACTG--CGATCTCGACATCG + +Local alignment example:: + + Read ACGGTTGCGTTAA-TCCGCCACG + ||||||||| |||||| + Reference TAACTTGCGTTAAATCCGCCTGG + +*-s/--skip (default: 0)* + +Skip (i.e. do not align) the first n-reads or pairs in the input. + +*-u/--qupto (default: no limit)* + +Align the first n-reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop. + +*-5/--trim5 (default: 0)* + +Trim n-bases from 5' (left) end of each read before alignment. + +*-3/--trim3 (default: 0)* +Trim n-bases from 3' (right) end of each read before alignment. + +*--nofw/--norc (default: both strands enabled)* + +If --nofw is specified, Bowtie 2 will not attempt to align unpaired reads to the forward (Watson) reference strand. If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes Bowtie 2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled. + +*--gbar (default: 4)* + +Disallow gaps within n-positions of the beginning or end of the read. + +------ + +**Paired-end options** + +*-I/--minins (default: 0)* + +The minimum fragment length for valid paired-end alignments. E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. + +The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. + +*-X/--maxins (default: 0)* + +The maximum fragment length for valid paired-end alignments. E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. + +The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. + +------ + +**SAM options** + +*--rg-id [text]* + +Set the read group ID to [text]. This causes the SAM @RG header line to be printed, with [text] as the value associated with the ID: tag. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to [text]. + +*--rg [text]* + +Add [text] as a field on the @RG header line. Note: in order for the @RG line to appear, --rg-id must also be specified. This is because the ID tag is required by the SAM Spec. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal. + +------ + +**Output options** + +*--un/--un-conc* + +Write reads that fail to align concordantly to file(s). These reads correspond to the SAM records. + +*-t/--time (default: off)* + +Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. + </help></tool> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: More fixes for managing tool dependencies for installed tool shed repositories.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/cd7fe5ef5328/ Changeset: cd7fe5ef5328 User: greg Date: 2013-07-19 20:14:59 Summary: More fixes for managing tool dependencies for installed tool shed repositories. Affected #: 1 file diff -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 -r cd7fe5ef532822f778dda054ec434aec6ce17eee lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -731,9 +731,15 @@ message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) tool_dependency_ids = tool_dependency_util.get_tool_dependency_ids( as_string=False, **kwd ) - # We need a tool_shed_repository, so get it from one of the tool_dependencies. - tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) - tool_shed_repository = tool_dependency.tool_shed_repository + repository_id = kwd.get( 'repository_id', None ) + if tool_dependency_ids: + # We need a tool_shed_repository, so get it from one of the tool_dependencies. + tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) + tool_shed_repository = tool_dependency.tool_shed_repository + else: + # The user must be on the manage_repository_tool_dependencies page and clicked the button to either install or uninstall a + # tool dependency, but they didn't check any of the available tool dependencies on which to perform the action. + tool_shed_repository = suc.get_tool_shed_repository_by_id( trans, repository_id ) self.tool_dependency_grid.title = "Tool shed repository '%s' tool dependencies" % tool_shed_repository.name if 'operation' in kwd: operation = kwd[ 'operation' ].lower() @@ -773,6 +779,7 @@ return trans.response.send_redirect( web.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids, + repository_id=repository_id, message=message, status=status ) ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fixes for managing the tool dependencies of an installed tool shed repository.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/2c257f0cbeb8/ Changeset: 2c257f0cbeb8 User: greg Date: 2013-07-19 19:57:31 Summary: Fixes for managing the tool dependencies of an installed tool shed repository. Affected #: 3 files diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -653,9 +653,15 @@ message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) tool_dependency_ids = tool_dependency_util.get_tool_dependency_ids( as_string=False, **kwd ) - # We need a tool_shed_repository, so get it from one of the tool_dependencies. - tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) - tool_shed_repository = tool_dependency.tool_shed_repository + if tool_dependency_ids: + # We need a tool_shed_repository, so get it from one of the tool_dependencies. + tool_dependency = tool_dependency_util.get_tool_dependency( trans, tool_dependency_ids[ 0 ] ) + tool_shed_repository = tool_dependency.tool_shed_repository + else: + # The user must be on the manage_repository_tool_dependencies page and clicked the button to either install or uninstall a + # tool dependency, but they didn't check any of the available tool dependencies on which to perform the action. + repository_id = kwd.get( 'repository_id', None ) + tool_shed_repository = suc.get_tool_shed_repository_by_id( trans, repository_id ) if 'operation' in kwd: operation = kwd[ 'operation' ].lower() if not tool_dependency_ids: @@ -664,7 +670,7 @@ kwd[ 'status' ] = 'error' del kwd[ 'operation' ] return trans.response.send_redirect( web.url_for( controller='admin_toolshed', - action='manage_installed_tool_dependencies', + action='manage_repository_tool_dependencies', **kwd ) ) if operation == 'browse': return trans.response.send_redirect( web.url_for( controller='admin_toolshed', @@ -720,7 +726,7 @@ @web.expose @web.require_admin def manage_tool_dependencies( self, trans, **kwd ): - # This method is called when tool dependencies are being installed. See the related manage_repository_tool-dependencies + # This method is called when tool dependencies are being installed. See the related manage_repository_tool_dependencies # method for managing the tool dependencies for a specified installed tool shed repository. message = kwd.get( 'message', '' ) status = kwd.get( 'status', 'done' ) diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako --- a/templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako +++ b/templates/admin/tool_shed_repository/manage_repository_tool_dependencies.mako @@ -44,7 +44,7 @@ <tr><td> %if tool_dependency.status not in [ trans.model.ToolDependency.installation_status.UNINSTALLED ]: - <a target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='browse', tool_dependency_ids=trans.security.encode_id( tool_dependency.id ) )}"> + <a target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='browse', tool_dependency_ids=trans.security.encode_id( tool_dependency.id ), repository_id=trans.security.encode_id( repository.id ) )}"> ${tool_dependency.name} </a> %else: @@ -60,7 +60,7 @@ </table> %if can_install: <br/> - <form name="install_tool_dependencies" id="install_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_tool_dependencies', operation='install' )}" method="post" > + <form name="install_tool_dependencies" id="install_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_tool_dependencies', operation='install', repository_id=trans.security.encode_id( repository.id ) )}" method="post" ><div class="form-row"> Check each tool dependency that you want to install and click <b>Install</b>. </div> @@ -81,7 +81,7 @@ %endif %if can_uninstall: <br/> - <form name="uninstall_tool_dependencies" id="uninstall_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='uninstall' )}" method="post" > + <form name="uninstall_tool_dependencies" id="uninstall_tool_dependencies" action="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', operation='uninstall', repository_id=trans.security.encode_id( repository.id ) )}" method="post" ><div class="form-row"> Check each tool dependency that you want to uninstall and click <b>Uninstall</b>. </div> diff -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b -r 2c257f0cbeb8a09e9b04a67ae59bf68a46e650e9 templates/admin/tool_shed_repository/repository_actions_menu.mako --- a/templates/admin/tool_shed_repository/repository_actions_menu.mako +++ b/templates/admin/tool_shed_repository/repository_actions_menu.mako @@ -32,7 +32,7 @@ <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='set_tool_versions', id=trans.security.encode_id( repository.id ) )}">Set tool versions</a> %endif %if tool_dependency_ids: - <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids )}">Manage tool dependencies</a> + <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='manage_repository_tool_dependencies', tool_dependency_ids=tool_dependency_ids, repository_id=trans.security.encode_id( repository.id ) )}">Manage tool dependencies</a> %endif <a class="action-button" target="galaxy_main" href="${h.url_for( controller='admin_toolshed', action='deactivate_or_uninstall_repository', id=trans.security.encode_id( repository.id ) )}">Deactivate or uninstall repository</a> %endif Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

2 new commits in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/25a0393e9112/ Changeset: 25a0393e9112 User: dan Date: 2013-07-19 19:40:39 Summary: Fix server error when an invalid locale is provided by a clients browser. Better handling of locales provided with surrounding whitespace. Affected #: 1 file diff -r a498340fed83e012e23f83f00d63b6ddaa5687cb -r 25a0393e91120b4e0fa79b868f5fafc8ea14843b lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py +++ b/lib/galaxy/web/framework/__init__.py @@ -367,9 +367,9 @@ client_locales = self.environ['HTTP_ACCEPT_LANGUAGE'].split( ',' ) for locale in client_locales: try: - locales.append( Locale.parse( locale.split( ';' )[0], sep='-' ).language ) - except UnknownLocaleError: - pass + locales.append( Locale.parse( locale.split( ';' )[0].strip(), sep='-' ).language ) + except Exception, e: + log.debug( "Error parsing locale '%s'. %s: %s", locale, type( e ), e ) if not locales: # Default to English locales = 'en' https://bitbucket.org/galaxy/galaxy-central/commits/cd6fec2f5cba/ Changeset: cd6fec2f5cba Branch: stable User: dan Date: 2013-07-19 19:40:39 Summary: Fix server error when an invalid locale is provided by a clients browser. Better handling of locales provided with surrounding whitespace. Affected #: 1 file diff -r 9ebd7732e616492f4570587496f1b9074cb2eac7 -r cd6fec2f5cba878de9943dd00abe816a65dc96db lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py +++ b/lib/galaxy/web/framework/__init__.py @@ -367,9 +367,9 @@ client_locales = self.environ['HTTP_ACCEPT_LANGUAGE'].split( ',' ) for locale in client_locales: try: - locales.append( Locale.parse( locale.split( ';' )[0], sep='-' ).language ) - except UnknownLocaleError: - pass + locales.append( Locale.parse( locale.split( ';' )[0].strip(), sep='-' ).language ) + except Exception, e: + log.debug( "Error parsing locale '%s'. %s: %s", locale, type( e ), e ) if not locales: # Default to English locales = 'en' Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Filter out repository dependencies that have been deleted from the repository grids in the tool shed.
by commits-noreply＠bitbucket.org 19 Jul '13

19 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/a498340fed83/ Changeset: a498340fed83 User: greg Date: 2013-07-19 15:47:41 Summary: Filter out repository dependencies that have been deleted from the repository grids in the tool shed. Affected #: 1 file diff -r d9fe5bea5a43c4c4645408a9035ad818d89d012c -r a498340fed83e012e23f83f00d63b6ddaa5687cb lib/tool_shed/grids/repository_grids.py --- a/lib/tool_shed/grids/repository_grids.py +++ b/lib/tool_shed/grids/repository_grids.py @@ -1270,7 +1270,7 @@ owner = rd_tup[ 2 ] changeset_revision = rd_tup[ 3 ] required_repository = suc.get_repository_by_name_and_owner( trans.app, name, owner ) - if required_repository: + if required_repository and not required_repository.deleted: required_repository_id = trans.security.encode_id( required_repository.id ) required_repository_metadata = metadata_util.get_repository_metadata_by_repository_id_changeset_revision( trans, required_repository_id, Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Visualizations registry: turned off by default in main .ini
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/d9fe5bea5a43/ Changeset: d9fe5bea5a43 User: carlfeberhard Date: 2013-07-18 22:27:38 Summary: Visualizations registry: turned off by default in main .ini Affected #: 1 file diff -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa -r d9fe5bea5a43c4c4645408a9035ad818d89d012c universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample +++ b/universe_wsgi.ini.sample @@ -177,7 +177,7 @@ # Visualizations config directory, where to look for individual visualization # xml configuration files. Those files define how visualizations apply to # particular data and how to pass them the necessary parameters -visualizations_config_directory = config/visualizations +#visualizations_config_directory = config/visualizations # Each job is given a unique empty directory as its current working directory. # This option defines in what parent directory those directories will be Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Visualizations registry: move built-in vis config files to sample, copying them over on registry start; add vis xml files to .hgignore; fix test data in scatterplot.xml
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/6781bf1f3de1/ Changeset: 6781bf1f3de1 User: carlfeberhard Date: 2013-07-18 22:24:18 Summary: Visualizations registry: move built-in vis config files to sample, copying them over on registry start; add vis xml files to .hgignore; fix test data in scatterplot.xml Affected #: 13 files diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa .hgignore --- a/.hgignore +++ b/.hgignore @@ -60,7 +60,7 @@ job_conf.xml data_manager_conf.xml shed_data_manager_conf.xml -visualizations_conf.xml +config/visualizations/*.xml static/welcome.html.* static/welcome.html diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/circster.xml --- a/config/visualizations/circster.xml +++ /dev/null @@ -1,26 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="circster"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="hda">hda_ldda</to_param> - </data_source> - <data_source> - <model_class>LibraryDatasetDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="ldda">hda_ldda</to_param> - </data_source> - </data_sources> - <params> - <param type="visualization">id</param> - <param type="hda_or_ldda">dataset_id</param> - <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> - <param type="dbkey">dbkey</param> - </params> - <template>circster.mako</template> - <render_location>_top</render_location> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/circster.xml.sample --- /dev/null +++ b/config/visualizations/circster.xml.sample @@ -0,0 +1,26 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="circster"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization">id</param> + <param type="hda_or_ldda">dataset_id</param> + <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> + <param type="dbkey">dbkey</param> + </params> + <template>circster.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/example.xml.example --- a/config/visualizations/example.xml.example +++ /dev/null @@ -1,30 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="test"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="bler">string</to_param> - <to_param assign="False">boolean</to_param> - <to_param assign="-5">integer</to_param> - <to_param assign="3.14">float</to_param> - <to_param assign="{}">json</to_param> - </data_source> - </data_sources> - <params> - <param>default</param> - <param type="str">string</param> - <param type="bool">boolean</param> - <param type="int">integer</param> - <param type="float">float</param> - <param type="json">json</param> - <param type="str" required="true">string</param> - <param type="visualization" var_name_in_template="visualization">visualization_id</param> - <param type="dataset" var_name_in_template="dataset">dataset_id</param> - <param type="hda_or_ldda">dataset_instance</param> - <param_modifier type="str" modifies="dataset_instance">hda_ldda</param_modifier> - </params> - <template>v_fwork_test.mako</template> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/phyloviz.xml --- a/config/visualizations/phyloviz.xml +++ /dev/null @@ -1,18 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="phyloviz"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Newick</test> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Nexus</test> - <to_param param_attr="id">dataset_id</to_param> - </data_source> - </data_sources> - <params> - <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> - <param type="integer" default="0">tree_index</param> - </params> - <template>phyloviz.mako</template> - <render_location>_top</render_location> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/phyloviz.xml.sample --- /dev/null +++ b/config/visualizations/phyloviz.xml.sample @@ -0,0 +1,18 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="phyloviz"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Newick</test> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Nexus</test> + <to_param param_attr="id">dataset_id</to_param> + </data_source> + </data_sources> + <params> + <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> + <param type="integer" default="0">tree_index</param> + </params> + <template>phyloviz.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/scatterplot.xml --- a/config/visualizations/scatterplot.xml +++ /dev/null @@ -1,16 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="scatterplot"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">tabular.Tabular</test> - <to_param param_attr="id">dataset_id</to_param> - </data_source> - </data_sources> - <params> - <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> - <param required="true">bler</param> - </params> - <template>scatterplot.mako</template> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/scatterplot.xml.sample --- /dev/null +++ b/config/visualizations/scatterplot.xml.sample @@ -0,0 +1,15 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="scatterplot"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">tabular.Tabular</test> + <to_param param_attr="id">dataset_id</to_param> + </data_source> + </data_sources> + <params> + <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> + </params> + <template>scatterplot.mako</template> +</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/sweepster.xml --- a/config/visualizations/sweepster.xml +++ /dev/null @@ -1,25 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="sweepster"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="hda">hda_ldda</to_param> - </data_source> - <data_source> - <model_class>LibraryDatasetDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="ldda">hda_ldda</to_param> - </data_source> - </data_sources> - <params> - <param type="visualization" var_name_in_template="viz">visualization</param> - <param type="hda_or_ldda" var_name_in_template="dataset">dataset_id</param> - <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> - </params> - <template>sweepster.mako</template> - <render_location>_top</render_location> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/sweepster.xml.sample --- /dev/null +++ b/config/visualizations/sweepster.xml.sample @@ -0,0 +1,25 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="sweepster"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization" var_name_in_template="viz">visualization</param> + <param type="hda_or_ldda" var_name_in_template="dataset">dataset_id</param> + <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> + </params> + <template>sweepster.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/trackster.xml --- a/config/visualizations/trackster.xml +++ /dev/null @@ -1,29 +0,0 @@ -<?xml version="1.0" encoding="UTF-8"?> -<!DOCTYPE visualization SYSTEM "visualization.dtd"> -<visualization name="trackster"> -  - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="hda">hda_ldda</to_param> - <to_param param_attr="dbkey">dbkey</to_param> - </data_source> - <data_source> - <model_class>LibraryDatasetDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="ldda">hda_ldda</to_param> - </data_source> - </data_sources> - <params> - <param type="visualization">id</param> - <param type="dataset">dataset_id</param> - <param type="genome_region">genome_region</param> - <param type="dbkey">dbkey</param> - </params> - <template_root>tracks</template_root> - <template>browser.mako</template> - <render_location>_top</render_location> -</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa config/visualizations/trackster.xml.sample --- /dev/null +++ b/config/visualizations/trackster.xml.sample @@ -0,0 +1,29 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="trackster"> +  + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + <to_param param_attr="dbkey">dbkey</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization">id</param> + <param type="dataset">dataset_id</param> + <param type="genome_region">genome_region</param> + <param type="dbkey">dbkey</param> + </params> + <template_root>tracks</template_root> + <template>browser.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 -r 6781bf1f3de1514967d62b6cf4fe4910cf9ec0aa lib/galaxy/visualization/registry.py --- a/lib/galaxy/visualization/registry.py +++ b/lib/galaxy/visualization/registry.py @@ -67,6 +67,7 @@ # load the registry from the xml files located in configuration_filepath using the given parser configuration_filepath = os.path.join( galaxy_root, configuration_filepath ) self.configuration_filepath = self.check_conf_filepath( configuration_filepath ) + self.move_sample_conf_files() self.load() # what to use to parse query strings into resources/vars for the template @@ -82,6 +83,20 @@ raise IOError( 'visualization configuration directory (%s) not found' %( configuration_filepath ) ) return configuration_filepath + def move_sample_conf_files( self ): + """ + Copies any `*.xml.sample` files in `configuration_filepath` to + `.xml` files of the same names if no file with that name already exists. + + :returns: a list of the files moved + """ + files_moved = [] + for sample_file in glob.glob( os.path.join( self.configuration_filepath, '*.sample' ) ): + new_name = os.path.splitext( sample_file )[0] + if not os.path.exists( new_name ): + shutil.copy2( sample_file, new_name ) + files_moved.append( new_name ) + def load( self ): """ Builds the registry by parsing the xml in `self.configuration_filepath` Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Visualizations registry: break visualizations_conf.xml into one xml file per visualization and place in config/visualizations
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/91de48b4fd3b/ Changeset: 91de48b4fd3b User: carlfeberhard Date: 2013-07-18 21:52:38 Summary: Visualizations registry: break visualizations_conf.xml into one xml file per visualization and place in config/visualizations Affected #: 12 files diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/circster.xml --- /dev/null +++ b/config/visualizations/circster.xml @@ -0,0 +1,26 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="circster"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization">id</param> + <param type="hda_or_ldda">dataset_id</param> + <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> + <param type="dbkey">dbkey</param> + </params> + <template>circster.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/example.xml.example --- /dev/null +++ b/config/visualizations/example.xml.example @@ -0,0 +1,30 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="test"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="bler">string</to_param> + <to_param assign="False">boolean</to_param> + <to_param assign="-5">integer</to_param> + <to_param assign="3.14">float</to_param> + <to_param assign="{}">json</to_param> + </data_source> + </data_sources> + <params> + <param>default</param> + <param type="str">string</param> + <param type="bool">boolean</param> + <param type="int">integer</param> + <param type="float">float</param> + <param type="json">json</param> + <param type="str" required="true">string</param> + <param type="visualization" var_name_in_template="visualization">visualization_id</param> + <param type="dataset" var_name_in_template="dataset">dataset_id</param> + <param type="hda_or_ldda">dataset_instance</param> + <param_modifier type="str" modifies="dataset_instance">hda_ldda</param_modifier> + </params> + <template>v_fwork_test.mako</template> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/phyloviz.xml --- /dev/null +++ b/config/visualizations/phyloviz.xml @@ -0,0 +1,18 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="phyloviz"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Newick</test> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Nexus</test> + <to_param param_attr="id">dataset_id</to_param> + </data_source> + </data_sources> + <params> + <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> + <param type="integer" default="0">tree_index</param> + </params> + <template>phyloviz.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/scatterplot.xml --- /dev/null +++ b/config/visualizations/scatterplot.xml @@ -0,0 +1,16 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="scatterplot"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">tabular.Tabular</test> + <to_param param_attr="id">dataset_id</to_param> + </data_source> + </data_sources> + <params> + <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> + <param required="true">bler</param> + </params> + <template>scatterplot.mako</template> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/sweepster.xml --- /dev/null +++ b/config/visualizations/sweepster.xml @@ -0,0 +1,25 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="sweepster"> + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization" var_name_in_template="viz">visualization</param> + <param type="hda_or_ldda" var_name_in_template="dataset">dataset_id</param> + <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> + </params> + <template>sweepster.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/trackster.xml --- /dev/null +++ b/config/visualizations/trackster.xml @@ -0,0 +1,29 @@ +<?xml version="1.0" encoding="UTF-8"?> +<!DOCTYPE visualization SYSTEM "visualization.dtd"> +<visualization name="trackster"> +  + <data_sources> + <data_source> + <model_class>HistoryDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="hda">hda_ldda</to_param> + <to_param param_attr="dbkey">dbkey</to_param> + </data_source> + <data_source> + <model_class>LibraryDatasetDatasetAssociation</model_class> + <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> + <to_param param_attr="id">dataset_id</to_param> + <to_param assign="ldda">hda_ldda</to_param> + </data_source> + </data_sources> + <params> + <param type="visualization">id</param> + <param type="dataset">dataset_id</param> + <param type="genome_region">genome_region</param> + <param type="dbkey">dbkey</param> + </params> + <template_root>tracks</template_root> + <template>browser.mako</template> + <render_location>_top</render_location> +</visualization> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 config/visualizations/visualization.dtd --- /dev/null +++ b/config/visualizations/visualization.dtd @@ -0,0 +1,132 @@ + + + +<!ELEMENT visualization (data_sources*,params*,template_root*,template,link_text*,render_location*)> + +<!ATTLIST visualization + name CDATA #REQUIRED +> + +<!ELEMENT data_sources (data_source*)> + + <!ELEMENT data_source (model_class,(test|to_param)*)> + <!ELEMENT model_class (#PCDATA)> +  + <!ELEMENT test (#PCDATA)> +  + <!ATTLIST test + type CDATA #IMPLIED + test_attr CDATA #IMPLIED + result_type CDATA #IMPLIED + > + + <!ELEMENT to_param (#PCDATA)> +  + <!ATTLIST to_param + param_attr CDATA #IMPLIED + assign CDATA #IMPLIED + > + +<!ELEMENT params ((param|param_modifier)*)> + + <!ELEMENT param (#PCDATA)> +  + <!ATTLIST param + type CDATA #IMPLIED + default CDATA #IMPLIED + required CDATA #IMPLIED + csv CDATA #IMPLIED + constrain_to CDATA #IMPLIED + var_name_in_template CDATA #IMPLIED + > +  + <!ELEMENT param_modifier (#PCDATA)> + <!ATTLIST param_modifier + modifies CDATA #REQUIRED + type CDATA #IMPLIED + default CDATA #IMPLIED + required CDATA #IMPLIED + csv CDATA #IMPLIED + constrain_to CDATA #IMPLIED + var_name_in_template CDATA #IMPLIED + > + + +<!ELEMENT template_root (#PCDATA)> + +<!ELEMENT template (#PCDATA)> + +<!ELEMENT link_text (#PCDATA)> + + +<!ELEMENT render_location (#PCDATA)> diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 lib/galaxy/app.py --- a/lib/galaxy/app.py +++ b/lib/galaxy/app.py @@ -123,8 +123,10 @@ # Load genome indexer tool. load_genome_index_tools( self.toolbox ) # visualizations registry: associates resources with visualizations, controls how to render - self.visualizations_registry = ( VisualizationsRegistry( self.config.root, self.config.visualizations_conf_path ) - if self.config.visualizations_conf_path else None ) + self.visualizations_registry = None + if self.config.visualizations_config_directory: + self.visualizations_registry = VisualizationsRegistry( self.config.root, + self.config.visualizations_config_directory ) # Load security policy. self.security_agent = self.model.security_agent self.host_security_agent = galaxy.security.HostAgent( model=self.security_agent.model, permitted_actions=self.security_agent.permitted_actions ) diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 lib/galaxy/config.py --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -288,8 +288,8 @@ self.fluent_log = string_as_bool( kwargs.get( 'fluent_log', False ) ) self.fluent_host = kwargs.get( 'fluent_host', 'localhost' ) self.fluent_port = int( kwargs.get( 'fluent_port', 24224 ) ) - # visualizations registry config path - self.visualizations_conf_path = kwargs.get( 'visualizations_conf_path', None ) + # visualization registries config directory + self.visualizations_config_directory = kwargs.get( 'visualizations_config_directory', None ) @property def sentry_dsn_public( self ): diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 lib/galaxy/visualization/registry.py --- a/lib/galaxy/visualization/registry.py +++ b/lib/galaxy/visualization/registry.py @@ -6,6 +6,7 @@ """ import os import shutil +import glob from galaxy import util import galaxy.model @@ -26,6 +27,7 @@ some confused vocabulary in docs, var names tests: anding, grouping, not + has_dataprovider data_sources: lists of add description element to visualization. @@ -62,10 +64,9 @@ return 'VisualizationsRegistry(%s)' %( listings_keys_str ) def __init__( self, galaxy_root, configuration_filepath ): - # load the registry from the given xml file using the given parser + # load the registry from the xml files located in configuration_filepath using the given parser configuration_filepath = os.path.join( galaxy_root, configuration_filepath ) - configuration_filepath = self.check_conf_filepath( configuration_filepath ) - self.configuration_filepath = configuration_filepath + self.configuration_filepath = self.check_conf_filepath( configuration_filepath ) self.load() # what to use to parse query strings into resources/vars for the template @@ -73,20 +74,13 @@ def check_conf_filepath( self, configuration_filepath ): """ - If given file at filepath exists, return that filepath. If not, - see if filepath + '.sample' exists and, if so, copy that into filepath. - - If neither original or sample exist, throw an IOError (currently, - this is a requireed file). + Checks for the existence of the given filepath. + :param configurarion_filepath: full filepath to the visualization config directory + :raises IOError: if the given directory doesn't exist """ - if os.path.exists( configuration_filepath ): - return configuration_filepath - else: - sample_file = configuration_filepath + '.sample' - if os.path.exists( sample_file ): - shutil.copy2( sample_file, configuration_filepath ) - return configuration_filepath - raise IOError( 'visualization configuration file (%s) not found' %( configuration_filepath ) ) + if not os.path.exists( configuration_filepath ): + raise IOError( 'visualization configuration directory (%s) not found' %( configuration_filepath ) ) + return configuration_filepath def load( self ): """ @@ -274,11 +268,11 @@ VALID_RENDER_LOCATIONS = [ 'galaxy_main', '_top', '_blank' ] @classmethod - def parse( cls, xml_filepath, debug=True ): + def parse( cls, config_dir, debug=True ): """ - Static class interface + Static class interface. """ - return cls( debug ).parse_file( xml_filepath ) + return cls( debug ).parse_files( config_dir ) def __init__( self, debug=False ): self.debug = debug @@ -288,38 +282,47 @@ self.param_parser = ParamParser() self.param_modifier_parser = ParamModifierParser() - def parse_file( self, xml_filepath ): + def parse_files( self, config_dir ): """ - Parse the given XML file for visualizations data. + Parse each XML file in `config_dir` for visualizations config data. - If an error occurs while parsing a visualizations entry it is skipped. + If an error occurs while parsing a visualizations entry, it is skipped. + :returns: registry data in dictionary form """ returned = {} try: - xml_tree = galaxy.util.parse_xml( xml_filepath ) - for visualization_conf in xml_tree.getroot().findall( 'visualization' ): - visualization = None - visualization_name = visualization_conf.get( 'name' ) - + for xml_filepath in glob.glob( os.path.join( config_dir, '*.xml' ) ): try: - visualization = self.parse_visualization( visualization_conf ) + visualization_name, visualization = self.parse_file( xml_filepath ) # skip vis' with parsing errors - don't shutdown the startup except ParsingException, parse_exc: - log.error( 'Skipped visualization configuration "%s" due to parsing errors: %s', - visualization_name, str( parse_exc ), exc_info=self.debug ) + log.error( 'Skipped visualization config "%s" due to parsing errors: %s', + xml_filepath, str( parse_exc ), exc_info=self.debug ) if visualization: returned[ visualization_name ] = visualization + log.debug( 'Visualization config loaded for: %s', visualization_name ) except Exception, exc: - log.error( 'Error parsing visualization configuration file %s: %s', - xml_filepath, str( exc ), exc_info=( not self.debug ) ) - #TODO: change when this is required + log.error( 'Error parsing visualizations configuration directory %s: %s', + config_dir, str( exc ), exc_info=( not self.debug ) ) + #TODO: change when this framework is on by default if self.debug: raise return returned + def parse_file( self, xml_filepath ): + """ + Parse the given XML file for visualizations data. + :returns: tuple of ( `visualization_name`, `visualization` ) + """ + xml_tree = galaxy.util.parse_xml( xml_filepath ) + visualization_conf = xml_tree.getroot() + visualization_name = visualization_conf.get( 'name' ) + visualization = self.parse_visualization( visualization_conf ) + return visualization_name, visualization + def parse_visualization( self, xml_tree ): """ Parse the template, name, and any data_sources and params from the diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample +++ b/universe_wsgi.ini.sample @@ -174,9 +174,10 @@ # Galaxy. #datatypes_config_file = datatypes_conf.xml -# Visualizations config file, defines what visualizations apply to particular data and how to pass them -# the necessary parameters -#visualizations_conf_path = visualizations_conf.xml +# Visualizations config directory, where to look for individual visualization +# xml configuration files. Those files define how visualizations apply to +# particular data and how to pass them the necessary parameters +visualizations_config_directory = config/visualizations # Each job is given a unique empty directory as its current working directory. # This option defines in what parent directory those directories will be diff -r 3422736c168d6d864ec3c478d3e725b1184e3778 -r 91de48b4fd3b5628d5a434f68bd6cf2473ad62c3 visualizations_conf.xml.sample --- a/visualizations_conf.xml.sample +++ /dev/null @@ -1,292 +0,0 @@ -<?xml version="1.0"?> - - - - -<!DOCTYPE visualizations [ -  - <!ELEMENT visualizations (visualization*)> -  - <!ELEMENT visualization (data_sources*,params*,template_root*,template,link_text*,render_location*)> -  - <!ATTLIST visualization - name CDATA #REQUIRED - > - - <!ELEMENT data_sources (data_source*)> -  - <!ELEMENT data_source (model_class,(test|to_param)*)> - <!ELEMENT model_class (#PCDATA)> -  - <!ELEMENT test (#PCDATA)> -  - <!ATTLIST test - type CDATA #IMPLIED - test_attr CDATA #IMPLIED - result_type CDATA #IMPLIED - > - - <!ELEMENT to_param (#PCDATA)> -  - <!ATTLIST to_param - param_attr CDATA #IMPLIED - assign CDATA #IMPLIED - > - - <!ELEMENT params ((param|param_modifier)*)> -  - <!ELEMENT param (#PCDATA)> -  - <!ATTLIST param - type CDATA #IMPLIED - default CDATA #IMPLIED - required CDATA #IMPLIED - csv CDATA #IMPLIED - constrain_to CDATA #IMPLIED - var_name_in_template CDATA #IMPLIED - > -  - <!ELEMENT param_modifier (#PCDATA)> - <!ATTLIST param_modifier - modifies CDATA #REQUIRED - type CDATA #IMPLIED - default CDATA #IMPLIED - required CDATA #IMPLIED - csv CDATA #IMPLIED - constrain_to CDATA #IMPLIED - var_name_in_template CDATA #IMPLIED - > - -  - <!ELEMENT template_root (#PCDATA)> -  - <!ELEMENT template (#PCDATA)> -  - <!ELEMENT link_text (#PCDATA)> -  -  - <!ELEMENT render_location (#PCDATA)> -]> - - -<visualizations> - <visualization name="trackster"> -  - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="hda">hda_ldda</to_param> - <to_param param_attr="dbkey">dbkey</to_param> - </data_source> - <data_source> - <model_class>LibraryDatasetDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="ldda">hda_ldda</to_param> - </data_source> - </data_sources> - <params> - <param type="visualization">id</param> - <param type="dataset">dataset_id</param> - <param type="genome_region">genome_region</param> - <param type="dbkey">dbkey</param> - </params> - <template_root>tracks</template_root> - <template>browser.mako</template> - <render_location>_top</render_location> - </visualization> - - <visualization name="circster"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="hda">hda_ldda</to_param> - </data_source> - <data_source> - <model_class>LibraryDatasetDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Data</test> - <to_param param_attr="id">dataset_id</to_param> - <to_param assign="ldda">hda_ldda</to_param> - </data_source> - </data_sources> - <params> - <param type="visualization">id</param> - <param type="hda_or_ldda">dataset_id</param> - <param_modifier type="string" modifies="dataset_id">hda_ldda</param_modifier> - <param type="dbkey">dbkey</param> - </params> - <template>circster.mako</template> - <render_location>_top</render_location> - </visualization> - -  - - <visualization name="phyloviz"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Newick</test> - <test type="isinstance" test_attr="datatype" result_type="datatype">data.Nexus</test> - <to_param param_attr="id">dataset_id</to_param> - </data_source> - </data_sources> - <params> - <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> - <param type="integer" default="0">tree_index</param> - </params> - <template>phyloviz.mako</template> - <render_location>_top</render_location> - </visualization> - - <visualization name="scatterplot"> - <data_sources> - <data_source> - <model_class>HistoryDatasetAssociation</model_class> - <test type="isinstance" test_attr="datatype" result_type="datatype">tabular.Tabular</test> - <to_param param_attr="id">dataset_id</to_param> - </data_source> - </data_sources> - <params> - <param type="dataset" var_name_in_template="hda" required="true">dataset_id</param> - </params> - <template>scatterplot.mako</template> - </visualization> - -  - -</visualizations> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Dataproviders: change 'map' providers to 'dict' for better consistency w/ python
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/3422736c168d/ Changeset: 3422736c168d User: carlfeberhard Date: 2013-07-18 18:46:21 Summary: Dataproviders: change 'map' providers to 'dict' for better consistency w/ python Affected #: 5 files diff -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 -r 3422736c168d6d864ec3c478d3e725b1184e3778 lib/galaxy/datatypes/binary.py --- a/lib/galaxy/datatypes/binary.py +++ b/lib/galaxy/datatypes/binary.py @@ -285,23 +285,23 @@ settings[ 'comment_char' ] = '@' return dataproviders.column.ColumnarDataProvider( samtools_source, **settings ) - @dataproviders.decorators.dataprovider_factory( 'map', dataproviders.column.MapDataProvider.settings ) - def map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'dict', dataproviders.column.DictDataProvider.settings ) + def dict_dataprovider( self, dataset, **settings ): samtools_source = dataproviders.dataset.SamtoolsDataProvider( dataset ) settings[ 'comment_char' ] = '@' - return dataproviders.column.MapDataProvider( samtools_source, **settings ) + return dataproviders.column.DictDataProvider( samtools_source, **settings ) - # these can't be used directly - may need BamColumn, BamMap (Bam metadata -> column/map) + # these can't be used directly - may need BamColumn, BamDict (Bam metadata -> column/dict) # OR - see genomic_region_dataprovider #(a)dataproviders.decorators.dataprovider_factory( 'dataset-column', dataproviders.column.ColumnarDataProvider.settings ) #def dataset_column_dataprovider( self, dataset, **settings ): # settings[ 'comment_char' ] = '@' # return super( Sam, self ).dataset_column_dataprovider( dataset, **settings ) - #(a)dataproviders.decorators.dataprovider_factory( 'dataset-map', dataproviders.column.MapDataProvider.settings ) - #def dataset_map_dataprovider( self, dataset, **settings ): + #(a)dataproviders.decorators.dataprovider_factory( 'dataset-dict', dataproviders.column.DictDataProvider.settings ) + #def dataset_dict_dataprovider( self, dataset, **settings ): # settings[ 'comment_char' ] = '@' - # return super( Sam, self ).dataset_map_dataprovider( dataset, **settings ) + # return super( Sam, self ).dataset_dict_dataprovider( dataset, **settings ) @dataproviders.decorators.dataprovider_factory( 'header', dataproviders.line.RegexLineDataProvider.settings ) def header_dataprovider( self, dataset, **settings ): @@ -309,12 +309,12 @@ samtools_source = dataproviders.dataset.SamtoolsDataProvider( dataset, '-H' ) return dataproviders.line.RegexLineDataProvider( samtools_source, **settings ) - @dataproviders.decorators.dataprovider_factory( 'id-seq-qual', dataproviders.column.MapDataProvider.settings ) + @dataproviders.decorators.dataprovider_factory( 'id-seq-qual', dataproviders.column.DictDataProvider.settings ) def id_seq_qual_dataprovider( self, dataset, **settings ): settings[ 'indeces' ] = [ 0, 9, 10 ] settings[ 'column_types' ] = [ 'str', 'str', 'str' ] settings[ 'column_names' ] = [ 'id', 'seq', 'qual' ] - return self.map_dataprovider( dataset, **settings ) + return self.dict_dataprovider( dataset, **settings ) @dataproviders.decorators.dataprovider_factory( 'genomic-region', dataproviders.column.ColumnarDataProvider.settings ) def genomic_region_dataprovider( self, dataset, **settings ): @@ -330,12 +330,12 @@ settings[ 'column_types' ] = [ 'str', 'int', 'int' ] return self.column_dataprovider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', dataproviders.column.MapDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.column.DictDataProvider.settings ) + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'indeces' ] = [ 2, 3, 3 ] settings[ 'column_types' ] = [ 'str', 'int', 'int' ] settings[ 'column_names' ] = [ 'chrom', 'start', 'end' ] - return self.map_dataprovider( dataset, **settings ) + return self.dict_dataprovider( dataset, **settings ) @dataproviders.decorators.dataprovider_factory( 'samtools' ) def samtools_dataprovider( self, dataset, **settings ): diff -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 -r 3422736c168d6d864ec3c478d3e725b1184e3778 lib/galaxy/datatypes/dataproviders/column.py --- a/lib/galaxy/datatypes/dataproviders/column.py +++ b/lib/galaxy/datatypes/dataproviders/column.py @@ -220,9 +220,9 @@ super( FilteredByColumnDataProvider, self ).__init__( source, **kwargs ) -class MapDataProvider( ColumnarDataProvider ): +class DictDataProvider( ColumnarDataProvider ): """ - Data provider that column_names and columns from the source's contents + Data provider that zips column_names and columns from the source's contents into a dictionary. A combination use of both `column_names` and `indeces` allows 'picking' @@ -244,11 +244,11 @@ :type column_names: """ #TODO: allow passing in a map instead of name->index { 'name1': index1, ... } - super( MapDataProvider, self ).__init__( source, **kwargs ) + super( DictDataProvider, self ).__init__( source, **kwargs ) self.column_names = column_names or [] def __iter__( self ): - parent_gen = super( MapDataProvider, self ).__iter__() + parent_gen = super( DictDataProvider, self ).__iter__() for column_values in parent_gen: map = dict( zip( self.column_names, column_values ) ) yield map diff -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 -r 3422736c168d6d864ec3c478d3e725b1184e3778 lib/galaxy/datatypes/dataproviders/dataset.py --- a/lib/galaxy/datatypes/dataproviders/dataset.py +++ b/lib/galaxy/datatypes/dataproviders/dataset.py @@ -203,16 +203,16 @@ super( DatasetColumnarDataProvider, self ).__init__( dataset_source, **kwargs ) -class DatasetMapDataProvider( column.MapDataProvider ): +class DatasetDictDataProvider( column.DictDataProvider ): """ Data provider that uses a DatasetDataProvider as it's source and the - dataset's metadata to buuild settings for the MapDataProvider it's + dataset's metadata to buuild settings for the DictDataProvider it's inherited from. """ def __init__( self, dataset, **kwargs ): """ - All kwargs are inherited from MapDataProvider. - .. seealso:: column.MapDataProvider + All kwargs are inherited from DictDataProvider. + .. seealso:: column.DictDataProvider If no kwargs are given, this class will attempt to get those kwargs from the dataset source's metadata. @@ -255,7 +255,7 @@ if not kwargs.get( 'column_types', None ): kwargs[ 'column_types' ] = dataset_source.get_metadata_column_types( indeces=indeces ) - super( DatasetMapDataProvider, self ).__init__( dataset_source, **kwargs ) + super( DatasetDictDataProvider, self ).__init__( dataset_source, **kwargs ) # ----------------------------------------------------------------------------- provides a bio-relevant datum diff -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 -r 3422736c168d6d864ec3c478d3e725b1184e3778 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py +++ b/lib/galaxy/datatypes/interval.py @@ -339,9 +339,9 @@ def genomic_region_dataprovider( self, dataset, **settings ): return dataproviders.dataset.GenomicRegionDataProvider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.dataset.GenomicRegionDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.genomic_region_dataprovider( dataset, **settings ) @@ -350,9 +350,9 @@ def interval_dataprovider( self, dataset, **settings ): return dataproviders.dataset.IntervalDataProvider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'interval-map', + @dataproviders.decorators.dataprovider_factory( 'interval-dict', dataproviders.dataset.IntervalDataProvider.settings ) - def interval_map_dataprovider( self, dataset, **settings ): + def interval_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.interval_dataprovider( dataset, **settings ) @@ -818,9 +818,9 @@ def genomic_region_dataprovider( self, dataset, **settings ): return dataproviders.dataset.GenomicRegionDataProvider( dataset, 0, 3, 4, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.dataset.GenomicRegionDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.genomic_region_dataprovider( dataset, **settings ) @@ -829,9 +829,9 @@ def interval_dataprovider( self, dataset, **settings ): return dataproviders.dataset.IntervalDataProvider( dataset, 0, 3, 4, 6, 2, **settings ) - @dataproviders.decorators.dataprovider_factory( 'interval-map', + @dataproviders.decorators.dataprovider_factory( 'interval-dict', dataproviders.dataset.IntervalDataProvider.settings ) - def interval_map_dataprovider( self, dataset, **settings ): + def interval_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.interval_dataprovider( dataset, **settings ) @@ -1206,8 +1206,8 @@ dataset_source = dataproviders.dataset.DatasetDataProvider( dataset ) return dataproviders.dataset.WiggleDataProvider( dataset_source, **settings ) - @dataproviders.decorators.dataprovider_factory( 'wiggle-map', dataproviders.dataset.WiggleDataProvider.settings ) - def wiggle_map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'wiggle-dict', dataproviders.dataset.WiggleDataProvider.settings ) + def wiggle_dict_dataprovider( self, dataset, **settings ): dataset_source = dataproviders.dataset.DatasetDataProvider( dataset ) settings[ 'named_columns' ] = True return dataproviders.dataset.WiggleDataProvider( dataset_source, **settings ) diff -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 -r 3422736c168d6d864ec3c478d3e725b1184e3778 lib/galaxy/datatypes/tabular.py --- a/lib/galaxy/datatypes/tabular.py +++ b/lib/galaxy/datatypes/tabular.py @@ -357,16 +357,16 @@ """Attempts to get column settings from dataset.metadata""" return dataproviders.dataset.DatasetColumnarDataProvider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'map', dataproviders.column.MapDataProvider.settings ) - def map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'dict', dataproviders.column.DictDataProvider.settings ) + def dict_dataprovider( self, dataset, **settings ): """Uses column settings that are passed in""" dataset_source = dataproviders.dataset.DatasetDataProvider( dataset ) - return dataproviders.column.MapDataProvider( dataset_source, **settings ) + return dataproviders.column.DictDataProvider( dataset_source, **settings ) - @dataproviders.decorators.dataprovider_factory( 'dataset-map', dataproviders.column.MapDataProvider.settings ) - def dataset_map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'dataset-dict', dataproviders.column.DictDataProvider.settings ) + def dataset_dict_dataprovider( self, dataset, **settings ): """Attempts to get column settings from dataset.metadata""" - return dataproviders.dataset.DatasetMapDataProvider( dataset, **settings ) + return dataproviders.dataset.DatasetDictDataProvider( dataset, **settings ) class Taxonomy( Tabular ): @@ -522,15 +522,15 @@ settings[ 'comment_char' ] = '@' return super( Sam, self ).dataset_column_dataprovider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'map', dataproviders.column.MapDataProvider.settings ) - def map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'dict', dataproviders.column.DictDataProvider.settings ) + def dict_dataprovider( self, dataset, **settings ): settings[ 'comment_char' ] = '@' - return super( Sam, self ).map_dataprovider( dataset, **settings ) + return super( Sam, self ).dict_dataprovider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'dataset-map', dataproviders.column.MapDataProvider.settings ) - def dataset_map_dataprovider( self, dataset, **settings ): + @dataproviders.decorators.dataprovider_factory( 'dataset-dict', dataproviders.column.DictDataProvider.settings ) + def dataset_dict_dataprovider( self, dataset, **settings ): settings[ 'comment_char' ] = '@' - return super( Sam, self ).dataset_map_dataprovider( dataset, **settings ) + return super( Sam, self ).dataset_dict_dataprovider( dataset, **settings ) @dataproviders.decorators.dataprovider_factory( 'header', dataproviders.line.RegexLineDataProvider.settings ) def header_dataprovider( self, dataset, **settings ): @@ -538,12 +538,12 @@ headers_source = dataproviders.line.RegexLineDataProvider( dataset_source, regex_list=[ '^@' ] ) return dataproviders.line.RegexLineDataProvider( headers_source, **settings ) - @dataproviders.decorators.dataprovider_factory( 'id-seq-qual', map_dataprovider.settings ) + @dataproviders.decorators.dataprovider_factory( 'id-seq-qual', dict_dataprovider.settings ) def id_seq_qual_dataprovider( self, dataset, **settings ): - # provided as an example of a specified column map (w/o metadata) + # provided as an example of a specified column dict (w/o metadata) settings[ 'indeces' ] = [ 0, 9, 10 ] settings[ 'column_names' ] = [ 'id', 'seq', 'qual' ] - return self.map_dataprovider( dataset, **settings ) + return self.dict_dataprovider( dataset, **settings ) @dataproviders.decorators.dataprovider_factory( 'genomic-region', dataproviders.dataset.GenomicRegionDataProvider.settings ) @@ -551,9 +551,9 @@ settings[ 'comment_char' ] = '@' return dataproviders.dataset.GenomicRegionDataProvider( dataset, 2, 3, 3, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.dataset.GenomicRegionDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'comment_char' ] = '@' return dataproviders.dataset.GenomicRegionDataProvider( dataset, 2, 3, 3, True, **settings ) @@ -628,9 +628,9 @@ def genomic_region_dataprovider( self, dataset, **settings ): return dataproviders.dataset.GenomicRegionDataProvider( dataset, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.dataset.GenomicRegionDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.genomic_region_dataprovider( dataset, **settings ) @@ -677,9 +677,9 @@ def genomic_region_dataprovider( self, dataset, **settings ): return dataproviders.dataset.GenomicRegionDataProvider( dataset, 0, 1, 1, **settings ) - @dataproviders.decorators.dataprovider_factory( 'genomic-region-map', + @dataproviders.decorators.dataprovider_factory( 'genomic-region-dict', dataproviders.dataset.GenomicRegionDataProvider.settings ) - def genomic_region_map_dataprovider( self, dataset, **settings ): + def genomic_region_dict_dataprovider( self, dataset, **settings ): settings[ 'named_columns' ] = True return self.genomic_region_dataprovider( dataset, **settings ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for discovering types to which a repository can be set.
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/416e08c46ed6/ Changeset: 416e08c46ed6 User: greg Date: 2013-07-18 16:57:29 Summary: Fix for discovering types to which a repository can be set. Affected #: 2 files diff -r d95be6981cc9a862a458bebb218a5180319ecbd7 -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 lib/galaxy/webapps/tool_shed/model/__init__.py --- a/lib/galaxy/webapps/tool_shed/model/__init__.py +++ b/lib/galaxy/webapps/tool_shed/model/__init__.py @@ -164,7 +164,7 @@ return True if self.times_downloaded == 0: return True - if self.type == rt_util.DEFAULT: + if self.type == rt_util.UNRESTRICTED: return True return False diff -r d95be6981cc9a862a458bebb218a5180319ecbd7 -r 416e08c46ed6b03598581c5d6c6b44587aa9f170 lib/tool_shed/util/tool_dependency_util.py --- a/lib/tool_shed/util/tool_dependency_util.py +++ b/lib/tool_shed/util/tool_dependency_util.py @@ -155,7 +155,7 @@ message += "This repository currently contains a single file named <b>%s</b>. If additional files will " % suc.TOOL_DEPENDENCY_DEFINITION_FILENAME message += "not be added to this repository, then it's type should be set to <b>%s</b>.<br/>" % tool_dependency_definition_type_class.label else: - message += "This repository contains no tools, so these tool dependencies are considered orphans within this repository.<br/>" + message += "This repository contains no tools, so it's defined tool dependencies are considered orphans within this repository.<br/>" return message def get_installed_and_missing_tool_dependencies( trans, repository, all_tool_dependencies ): Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Enhance messaging in the tool shed as a result of the introduction of support for repository types.
by commits-noreply＠bitbucket.org 18 Jul '13

18 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/d95be6981cc9/ Changeset: d95be6981cc9 User: greg Date: 2013-07-18 16:51:23 Summary: Enhance messaging in the tool shed as a result of the introduction of support for repository types. Affected #: 7 files diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 lib/galaxy/webapps/tool_shed/controllers/repository.py --- a/lib/galaxy/webapps/tool_shed/controllers/repository.py +++ b/lib/galaxy/webapps/tool_shed/controllers/repository.py @@ -2174,11 +2174,12 @@ key_rd_dicts_to_be_processed=None, all_repository_dependencies=None, handled_key_rd_dicts=None ) - # Handle messaging for orphan tool dependencies. - orphan_message = tool_dependency_util.generate_message_for_orphan_tool_dependencies( metadata ) - if orphan_message: - message += orphan_message - status = 'warning' + if str( repository.type ) != rt_util.TOOL_DEPENDENCY_DEFINITION: + # Handle messaging for orphan tool dependencies. + orphan_message = tool_dependency_util.generate_message_for_orphan_tool_dependencies( trans, repository, metadata ) + if orphan_message: + message += orphan_message + status = 'warning' if is_malicious: if trans.app.security_agent.can_push( trans.app, trans.user, repository ): message += malicious_error_can_push @@ -2976,11 +2977,6 @@ key_rd_dicts_to_be_processed=None, all_repository_dependencies=None, handled_key_rd_dicts=None ) - # Handle messaging for orphan tool dependencies. - orphan_message = tool_dependency_util.generate_message_for_orphan_tool_dependencies( metadata ) - if orphan_message: - message += orphan_message - status = 'warning' else: metadata = None is_malicious = suc.changeset_is_malicious( trans, id, repository.tip( trans.app ) ) diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 lib/galaxy/webapps/tool_shed/controllers/upload.py --- a/lib/galaxy/webapps/tool_shed/controllers/upload.py +++ b/lib/galaxy/webapps/tool_shed/controllers/upload.py @@ -206,15 +206,16 @@ metadata_dict = repository.metadata_revisions[0].metadata else: metadata_dict = {} - # Provide a warning message if a tool_dependencies.xml file is provided, but tool dependencies weren't loaded due to a requirement tag mismatch - # or some other problem. Tool dependency definitions can define orphan tool dependencies (no relationship to any tools contained in the repository), - # so warning messages are important because orphans are always valid. The repository owner must be warned in case they did not intend to define an - # orphan dependency, but simply provided incorrect information (tool shed, name owner, changeset_revision) for the definition. - # Handle messaging for orphan tool dependencies. - orphan_message = tool_dependency_util.generate_message_for_orphan_tool_dependencies( metadata_dict ) - if orphan_message: - message += orphan_message - status = 'warning' + if str( repository.type ) != rt_util.TOOL_DEPENDENCY_DEFINITION: + # Provide a warning message if a tool_dependencies.xml file is provided, but tool dependencies weren't loaded due to a requirement tag mismatch + # or some other problem. Tool dependency definitions can define orphan tool dependencies (no relationship to any tools contained in the repository), + # so warning messages are important because orphans are always valid. The repository owner must be warned in case they did not intend to define an + # orphan dependency, but simply provided incorrect information (tool shed, name owner, changeset_revision) for the definition. + # Handle messaging for orphan tool dependencies. + orphan_message = tool_dependency_util.generate_message_for_orphan_tool_dependencies( trans, repository, metadata_dict ) + if orphan_message: + message += orphan_message + status = 'warning' # Handle messaging for invalid tool dependencies. invalid_tool_dependencies_message = tool_dependency_util.generate_message_for_invalid_tool_dependencies( metadata_dict ) if invalid_tool_dependencies_message: diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 lib/galaxy/webapps/tool_shed/model/__init__.py --- a/lib/galaxy/webapps/tool_shed/model/__init__.py +++ b/lib/galaxy/webapps/tool_shed/model/__init__.py @@ -171,7 +171,7 @@ def can_change_type_to( self, app, new_type_label ): if self.can_change_type( app ): new_type = app.repository_types_registry.get_class_by_label( new_type_label ) - if new_type.is_valid_for_type( self ): + if new_type.is_valid_for_type( app, self ): return True return False diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 lib/tool_shed/repository_types/metadata.py --- a/lib/tool_shed/repository_types/metadata.py +++ b/lib/tool_shed/repository_types/metadata.py @@ -18,7 +18,7 @@ repo = hg.repository( ui.ui(), repository.repo_path( app ) ) return repo.changelog - def is_valid_for_type( self, repository, revisions_to_check=None ): + def is_valid_for_type( self, app, repository, revisions_to_check=None ): raise "Unimplemented Method" diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 lib/tool_shed/util/tool_dependency_util.py --- a/lib/tool_shed/util/tool_dependency_util.py +++ b/lib/tool_shed/util/tool_dependency_util.py @@ -5,6 +5,7 @@ from galaxy import util from galaxy.model.orm import and_ import tool_shed.util.shed_util_common as suc +import tool_shed.repository_types.util as rt_util from tool_shed.util import xml_util log = logging.getLogger( __name__ ) @@ -115,7 +116,7 @@ message = '%s ' % str( error ) return message -def generate_message_for_orphan_tool_dependencies( metadata_dict ): +def generate_message_for_orphan_tool_dependencies( trans, repository, metadata_dict ): """ The introduction of the support for orphan tool dependency definitions in tool shed repositories has resulted in the inability to define an improperly configured tool dependency definition / tool config requirements tag combination as an invalid tool @@ -127,28 +128,34 @@ if metadata_dict: orphan_tool_dependencies = metadata_dict.get( 'orphan_tool_dependencies', None ) if orphan_tool_dependencies: - if 'tools' not in metadata_dict and 'invalid_tools' not in metadata_dict: + if 'tools' in metadata_dict or 'invalid_tools' in metadata_dict: + for td_key, requirements_dict in orphan_tool_dependencies.items(): + if td_key == 'set_environment': + # "set_environment": [{"name": "R_SCRIPT_PATH", "type": "set_environment"}] + message += "The settings for <b>name</b> and <b>type</b> from a contained tool configuration file's <b>requirement</b> tag " + message += "does not match the information for the following tool dependency definitions in the <b>tool_dependencies.xml</b> " + message += "file, so these tool dependencies have no relationship with any tools within this repository.<br/>" + for env_requirements_dict in requirements_dict: + name = env_requirements_dict[ 'name' ] + type = env_requirements_dict[ 'type' ] + message += "<b>* name:</b> %s, <b>type:</b> %s<br/>" % ( str( name ), str( type ) ) + else: + # "R/2.15.1": {"name": "R", "readme": "some string", "type": "package", "version": "2.15.1"} + message += "The settings for <b>name</b>, <b>version</b> and <b>type</b> from a contained tool configuration file's " + message += "<b>requirement</b> tag does not match the information for the following tool dependency definitions in the " + message += "<b>tool_dependencies.xml</b> file, so these tool dependencies have no relationship with any tools within " + message += "this repository.<br/>" + name = requirements_dict[ 'name' ] + type = requirements_dict[ 'type' ] + version = requirements_dict[ 'version' ] + message += "<b>* name:</b> %s, <b>type:</b> %s, <b>version:</b> %s<br/>" % ( str( name ), str( type ), str( version ) ) + message += "<br/>" + elif repository.can_change_type_to( trans.app, rt_util.TOOL_DEPENDENCY_DEFINITION ): + tool_dependency_definition_type_class = trans.app.repository_types_registry.get_class_by_label( rt_util.TOOL_DEPENDENCY_DEFINITION ) + message += "This repository currently contains a single file named <b>%s</b>. If additional files will " % suc.TOOL_DEPENDENCY_DEFINITION_FILENAME + message += "not be added to this repository, then it's type should be set to <b>%s</b>.<br/>" % tool_dependency_definition_type_class.label + else: message += "This repository contains no tools, so these tool dependencies are considered orphans within this repository.<br/>" - for td_key, requirements_dict in orphan_tool_dependencies.items(): - if td_key == 'set_environment': - # "set_environment": [{"name": "R_SCRIPT_PATH", "type": "set_environment"}] - message += "The settings for <b>name</b> and <b>type</b> from a contained tool configuration file's <b>requirement</b> tag " - message += "does not match the information for the following tool dependency definitions in the <b>tool_dependencies.xml</b> " - message += "file, so these tool dependencies are considered orphans within this repository.<br/>" - for env_requirements_dict in requirements_dict: - name = env_requirements_dict[ 'name' ] - type = env_requirements_dict[ 'type' ] - message += "<b>* name:</b> %s, <b>type:</b> %s<br/>" % ( str( name ), str( type ) ) - else: - # "R/2.15.1": {"name": "R", "readme": "some string", "type": "package", "version": "2.15.1"} - message += "The settings for <b>name</b>, <b>version</b> and <b>type</b> from a contained tool configuration file's " - message += "<b>requirement</b> tag does not match the information for the following tool dependency definitions in the " - message += "<b>tool_dependencies.xml</b> file, so these tool dependencies are considered orphans within this repository.<br/>" - name = requirements_dict[ 'name' ] - type = requirements_dict[ 'type' ] - version = requirements_dict[ 'version' ] - message += "<b>* name:</b> %s, <b>type:</b> %s, <b>version:</b> %s<br/>" % ( str( name ), str( type ), str( version ) ) - message += "<br/>" return message def get_installed_and_missing_tool_dependencies( trans, repository, all_tool_dependencies ): diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 test/tool_shed/functional/test_0100_complex_repository_dependencies.py --- a/test/tool_shed/functional/test_0100_complex_repository_dependencies.py +++ b/test/tool_shed/functional/test_0100_complex_repository_dependencies.py @@ -51,7 +51,7 @@ uncompress_file=False, remove_repo_files_not_in_tar=False, commit_message='Uploaded tool_dependencies.xml.', - strings_displayed=[ 'The settings for <b>name</b>, <b>version</b> and <b>type</b> from a contained tool' ], + strings_displayed=[ 'This repository currently contains a single file named <b>tool_dependencies.xml</b>' ], strings_not_displayed=[] ) # Visit the manage repository page for package_bwa_0_5_9_0100. self.display_manage_repository_page( repository, strings_displayed=[ 'Tool dependencies', 'may not be', 'in this repository' ] ) diff -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 -r d95be6981cc9a862a458bebb218a5180319ecbd7 test/tool_shed/functional/test_0170_complex_prior_installation_required.py --- a/test/tool_shed/functional/test_0170_complex_prior_installation_required.py +++ b/test/tool_shed/functional/test_0170_complex_prior_installation_required.py @@ -56,7 +56,7 @@ uncompress_file=True, remove_repo_files_not_in_tar=False, commit_message='Uploaded matplotlib tool dependency tarball.', - strings_displayed=['orphan'], + strings_displayed=[ 'This repository currently contains a single file named <b>tool_dependencies.xml</b>' ], strings_not_displayed=[] ) def test_0010_create_numpy_repository( self ): @@ -80,7 +80,7 @@ uncompress_file=True, remove_repo_files_not_in_tar=False, commit_message='Uploaded numpy tool dependency tarball.', - strings_displayed=['orphan'], + strings_displayed=[ 'This repository currently contains a single file named <b>tool_dependencies.xml</b>' ], strings_not_displayed=[] ) def test_0015_create_complex_repository_dependency( self ): Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Saved histories (and grids in gen.): fix busted query in grids when using log_actions=True
by commits-noreply＠bitbucket.org 17 Jul '13

17 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/3985ecec291f/ Changeset: 3985ecec291f User: carlfeberhard Date: 2013-07-18 00:46:42 Summary: Saved histories (and grids in gen.): fix busted query in grids when using log_actions=True Affected #: 1 file diff -r e008f7f78892ceb35bd1198d9e56528616ddfddb -r 3985ecec291f3b1a52997f0ad4fb6579045f16c2 lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py +++ b/lib/galaxy/web/framework/helpers/grids.py @@ -225,7 +225,13 @@ params = cur_filter_dict.copy() params['sort'] = sort_key params['async'] = ( 'async' in kwargs ) - trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) + + #TODO:?? + # commenting this out; when this fn calls session.add( action ) and session.flush the query from this fn + # is effectively 'wiped' out. Nate believes it has something to do with our use of session( autocommit=True ) + # in mapping.py. If you change that to False, the log_action doesn't affect the query + # Below, I'm rendering the template first (that uses query), then calling log_action, then returning the page + #trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) # Render grid. def url( *args, **kwargs ): @@ -260,7 +266,7 @@ # utf-8 unicode; however, this would require encoding the object as utf-8 before returning the grid # results via a controller method, which is require substantial changes. Hence, for now, return grid # as str. - return trans.fill_template( iff( async_request, self.async_template, self.template ), + page = trans.fill_template( iff( async_request, self.async_template, self.template ), grid=self, query=query, cur_page_num = page_num, @@ -280,6 +286,9 @@ # Pass back kwargs so that grid template can set and use args without # grid explicitly having to pass them. kwargs=kwargs ) + trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) + return page + def get_ids( self, **kwargs ): id = [] if 'id' in kwargs: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: Saved histories (and grids in gen.): fix busted query in grids when using log_actions=True
by commits-noreply＠bitbucket.org 17 Jul '13

17 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/9ebd7732e616/ Changeset: 9ebd7732e616 Branch: stable User: carlfeberhard Date: 2013-07-18 00:42:46 Summary: Saved histories (and grids in gen.): fix busted query in grids when using log_actions=True Affected #: 1 file diff -r fd4113962c32b67ea0623b6cfd37be63e26ef7c6 -r 9ebd7732e616492f4570587496f1b9074cb2eac7 lib/galaxy/web/framework/helpers/grids.py --- a/lib/galaxy/web/framework/helpers/grids.py +++ b/lib/galaxy/web/framework/helpers/grids.py @@ -225,7 +225,13 @@ params = cur_filter_dict.copy() params['sort'] = sort_key params['async'] = ( 'async' in kwargs ) - trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) + + #TODO:?? + # commenting this out; when this fn calls session.add( action ) and session.flush the query from this fn + # is effectively 'wiped' out. Nate believes it has something to do with our use of session( autocommit=True ) + # in mapping.py. If you change that to False, the log_action doesn't affect the query + # Below, I'm rendering the template first (that uses query), then calling log_action, then returning the page + #trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) # Render grid. def url( *args, **kwargs ): @@ -260,7 +266,7 @@ # utf-8 unicode; however, this would require encoding the object as utf-8 before returning the grid # results via a controller method, which is require substantial changes. Hence, for now, return grid # as str. - return trans.fill_template( iff( async_request, self.async_template, self.template ), + page = trans.fill_template( iff( async_request, self.async_template, self.template ), grid=self, query=query, cur_page_num = page_num, @@ -280,6 +286,9 @@ # Pass back kwargs so that grid template can set and use args without # grid explicitly having to pass them. kwargs=kwargs ) + trans.log_action( trans.get_user(), unicode( "grid.view" ), context, params ) + return page + def get_ids( self, **kwargs ): id = [] if 'id' in kwargs: Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: guerler: Dataset display eye-icon, fix context menu
by commits-noreply＠bitbucket.org 17 Jul '13

17 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/e008f7f78892/ Changeset: e008f7f78892 User: guerler Date: 2013-07-17 22:58:56 Summary: Dataset display eye-icon, fix context menu Affected #: 1 file diff -r ff21a344b9e14e0deb896bbe89a45c70ad608331 -r e008f7f78892ceb35bd1198d9e56528616ddfddb static/scripts/mvc/dataset/hda-base.js --- a/static/scripts/mvc/dataset/hda-base.js +++ b/static/scripts/mvc/dataset/hda-base.js @@ -237,7 +237,13 @@ } else { displayBtnData.title = _l( 'View data' ); - displayBtnData.href = "javascript:parent.frame_manager.frame_new({title: 'Data Viewer', type: 'url', location: 'center', content: '" + this.urls.display + "'});"; + + // default link for dataset + displayBtnData.href = this.urls.display; + + // add frame manager option onclick event + var self = this; + displayBtnData.on_click = function() { parent.frame_manager.frame_new({title: "Data Viewer", type: "url", location: "center", content: self.urls.display }); }; } this.displayButton = new IconButtonView({ model : new IconButton( displayBtnData ) }); Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fixes when pushing changes to a repository in the tool shed from the command line: (a) only allow changes to a single file named tool_dependencies.xml to be pushed to a repository whose type is "Tool dependency definition" and (b) for any changes that are made to dependency definition files, validate the attributes of any <repository> tags, making sure that all required attributes (toolshed, name, owner, changeset_revision) are defined since automatically popula
by commits-noreply＠bitbucket.org 17 Jul '13

17 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/ff21a344b9e1/ Changeset: ff21a344b9e1 User: greg Date: 2013-07-17 21:34:54 Summary: Fixes when pushing changes to a repository in the tool shed from the command line: (a) only allow changes to a single file named tool_dependencies.xml to be pushed to a repository whose type is "Tool dependency definition" and (b) for any changes that are made to dependency definition files, validate the attributes of any <repository> tags, making sure that all required attributes (toolshed, name, owner, changeset_revision) are defined since automatically populating these attributes is supported only when using the tool shed's upload utility. Affected #: 2 files diff -r ef5cc1d272d2805d1c6597b200f9df58a291d863 -r ff21a344b9e14e0deb896bbe89a45c70ad608331 lib/galaxy/webapps/tool_shed/framework/middleware/hg.py --- a/lib/galaxy/webapps/tool_shed/framework/middleware/hg.py +++ b/lib/galaxy/webapps/tool_shed/framework/middleware/hg.py @@ -1,19 +1,28 @@ -""" -Middleware for handling hg authentication for users pushing change sets to local repositories. -""" -import os, logging +"""Middle-ware for handling hg authentication for users pushing change sets to local repositories.""" +import os +import logging import sqlalchemy +import sys +import tempfile from paste.auth.basic import AuthBasicAuthenticator from paste.httpheaders import AUTH_TYPE from paste.httpheaders import REMOTE_USER from galaxy.util import asbool +from galaxy.util import json from galaxy.webapps.tool_shed import model from galaxy.util.hash_util import new_secure_hash +import tool_shed.util.shed_util_common as suc +from tool_shed.util import commit_util +import tool_shed.repository_types.util as rt_util + +from galaxy import eggs +eggs.require( 'mercurial' ) import mercurial.__version__ log = logging.getLogger(__name__) +CHUNK_SIZE = 65536 class Hg( object ): @@ -23,10 +32,6 @@ self.config = config # Authenticate this mercurial request using basic authentication self.authentication = AuthBasicAuthenticator( 'hgweb in the tool shed', self.__basic_authentication ) - self.remote_address = None - self.repository = None - self.username = None - self.action = None # Determine the database url if 'database_connection' in self.config: self.db_url = self.config[ 'database_connection' ] @@ -42,26 +47,21 @@ # # Increment the value of the times_downloaded column in the repository table for the cloned repository. if 'PATH_INFO' in environ: - path_info = environ[ 'PATH_INFO' ].lstrip( '/' ) - # An example of path_info is: '/repos/test/column1' - path_info_components = path_info.split( '/' ) - username = path_info_components[1] - name = path_info_components[2] # Instantiate a database connection engine = sqlalchemy.create_engine( self.db_url ) connection = engine.connect() - result_set = connection.execute( "select id from galaxy_user where username = '%s'" % username.lower() ) - for row in result_set: - # Should only be 1 row... - user_id = row[ 'id' ] - result_set = connection.execute( "select times_downloaded from repository where user_id = %d and name = '%s'" % ( user_id, name.lower() ) ) + path_info = environ[ 'PATH_INFO' ].lstrip( '/' ) + user_id, repository_name = self.__get_user_id_repository_name_from_path_info( connection, path_info ) + sql_cmd = "SELECT times_downloaded FROM repository WHERE user_id = %d AND name = '%s'" % ( user_id, repository_name.lower() ) + result_set = connection.execute( sql_cmd ) for row in result_set: # Should only be 1 row... times_downloaded = row[ 'times_downloaded' ] times_downloaded += 1 - connection.execute( "update repository set times_downloaded = %d where user_id = %d and name = '%s'" % ( times_downloaded, user_id, name.lower() ) ) + sql_cmd = "UPDATE repository SET times_downloaded = %d WHERE user_id = %d AND name = '%s'" % ( times_downloaded, user_id, repository_name.lower() ) + connection.execute( sql_cmd ) connection.close() - if cmd in [ 'unbundle', 'pushkey' ]: + elif cmd in [ 'unbundle', 'pushkey' ]: # This is an hg push from the command line. When doing this, the following commands, in order, # will be retrieved from environ (see the docs at http://mercurial.selenic.com/wiki/WireProtocol) # # If mercurial version >= '2.2.3': capabilities -> batch -> branchmap -> unbundle -> listkeys -> pushkey -> listkeys @@ -87,6 +87,71 @@ # If all of these mechanisms fail, Mercurial will fail, printing an error message. In this case, it # will not let you commit until you set up a username. result = self.authentication( environ ) + if not isinstance( result, str ) and cmd == 'unbundle' and 'wsgi.input' in environ: + bundle_data_stream = environ[ 'wsgi.input' ] + # Convert the incoming mercurial bundle into a json object and persit it to a temporary file for inspection. + fh = tempfile.NamedTemporaryFile( 'wb', prefix="tmp-hg-bundle" ) + tmp_filename = fh.name + fh.close() + fh = open( tmp_filename, 'wb' ) + while 1: + chunk = bundle_data_stream.read( CHUNK_SIZE ) + if not chunk: + break + fh.write( chunk ) + fh.close() + fh = open( tmp_filename, 'rb' ) + changeset_groups = json.from_json_string( commit_util.bundle_to_json( fh ) ) + fh.close() + try: + os.unlink( tmp_filename ) + except: + pass + if changeset_groups: + # Check the repository type to make sure inappropriate files are not being pushed. + if 'PATH_INFO' in environ: + # Instantiate a database connection + engine = sqlalchemy.create_engine( self.db_url ) + connection = engine.connect() + path_info = environ[ 'PATH_INFO' ].lstrip( '/' ) + user_id, repository_name = self.__get_user_id_repository_name_from_path_info( connection, path_info ) + sql_cmd = "SELECT type FROM repository WHERE user_id = %d AND name = '%s'" % ( user_id, repository_name.lower() ) + result_set = connection.execute( sql_cmd ) + for row in result_set: + # Should only be 1 row... + repository_type = str( row[ 'type' ] ) + if repository_type == rt_util.TOOL_DEPENDENCY_DEFINITION: + # Handle repositories of type tool_dependency_definition, which can only contain a single file named tool_dependencies.xml. + for entry in changeset_groups: + if len( entry ) == 2: + # We possibly found an altered file entry. + filename, change_list = entry + if filename and isinstance( filename, str ): + if filename == suc.TOOL_DEPENDENCY_DEFINITION_FILENAME: + # Make sure the any complex repository dependency definitions contain valid <repository> tags. + is_valid, error_msg = commit_util.repository_tags_are_valid( filename, change_list ) + if not is_valid: + log.debug( error_msg ) + return self.__display_exception_remotely( start_response, error_msg ) + else: + msg = "Only a single file named tool_dependencies.xml can be pushed to a repository of type 'Tool dependency definition'." + log.debug( msg ) + return self.__display_exception_remotely( start_response, msg ) + else: + # If the changeset includes changes to dependency definition files, make sure tag sets are not missing "toolshed" or + # "changeset_revision" attributes since automatically populating them is not supported when pushing from the command line. + # These attributes are automatically populated only when using the tool shed upload utility. + for entry in changeset_groups: + if len( entry ) == 2: + # We possibly found an altered file entry. + filename, change_list = entry + if filename and isinstance( filename, str ): + if filename in [ suc.REPOSITORY_DEPENDENCY_DEFINITION_FILENAME, suc.TOOL_DEPENDENCY_DEFINITION_FILENAME ]: + # We check both files since tool dependency definitions files can contain complex repository dependency definitions. + is_valid, error_msg = commit_util.repository_tags_are_valid( filename, change_list ) + if not is_valid: + log.debug( error_msg ) + return self.__display_exception_remotely( start_response, error_msg ) if isinstance( result, str ): # Authentication was successful AUTH_TYPE.update( environ, 'basic' ) @@ -95,6 +160,13 @@ return result.wsgi_application( environ, start_response ) return self.app( environ, start_response ) + def __display_exception_remotely( self, start_response, msg ): + # Display the exception to the remote user's command line. + status = "500 %s" % msg + response_headers = [ ("content-type", "text/plain") ] + start_response( status, response_headers, sys.exc_info() ) + return [ msg ] + def __get_hg_command( self, **kwd ): """Pulls mercurial commands from environ[ 'QUERY_STRING" ] and returns them.""" if 'QUERY_STRING' in kwd: @@ -103,6 +175,18 @@ return qry.split( '=' )[ -1 ] return None + def __get_user_id_repository_name_from_path_info( self, db_connection, path_info ): + # An example of path_info is: '/repos/test/column1' + path_info_components = path_info.split( '/' ) + username = path_info_components[ 1 ] + repository_name = path_info_components[ 2 ] + # Get the id of the current user using hg from the command line. + result_set = db_connection.execute( "select id from galaxy_user where username = '%s'" % username.lower() ) + for row in result_set: + # Should only be 1 row... + user_id = row[ 'id' ] + return user_id, repository_name + def __basic_authentication( self, environ, username, password ): """The environ parameter is needed in basic authentication. We also check it if use_remote_user is true.""" if asbool( self.config.get( 'use_remote_user', False ) ): @@ -140,7 +224,7 @@ result_set = connection.execute( "select email, username, password from galaxy_user where email = '%s'" % ru_email ) for row in result_set: # Should only be 1 row... - db_email = row[ 'email' ] + db_email = row[ 'email' ] db_password = row[ 'password' ] db_username = row[ 'username' ] connection.close() diff -r ef5cc1d272d2805d1c6597b200f9df58a291d863 -r ff21a344b9e14e0deb896bbe89a45c70ad608331 lib/tool_shed/util/commit_util.py --- a/lib/tool_shed/util/commit_util.py +++ b/lib/tool_shed/util/commit_util.py @@ -1,7 +1,9 @@ +import cStringIO import logging import os import pkg_resources import shutil +import struct import tempfile from galaxy import util from galaxy.datatypes import checkers @@ -10,19 +12,29 @@ import tool_shed.util.shed_util_common as suc from tool_shed.util import tool_util from tool_shed.util import xml_util -from galaxy import eggs import tool_shed.repository_types.util as rt_util +from galaxy import eggs eggs.require( 'mercurial' ) from mercurial import commands from mercurial import hg from mercurial import ui +from mercurial.changegroup import readbundle +from mercurial.changegroup import readexactly +from mercurial.changegroup import writebundle log = logging.getLogger( __name__ ) UNDESIRABLE_DIRS = [ '.hg', '.svn', '.git', '.cvs' ] UNDESIRABLE_FILES = [ '.hg_archival.txt', 'hgrc', '.DS_Store' ] +def bundle_to_json( fh ): + """Convert the received HG10xx data stream (a mercurial 1.0 bundle created using hg push from the command line) to a json object.""" + # See http://www.wstein.org/home/wstein/www/home/was/patches/hg_json + hg_unbundle10_obj = readbundle( fh, None ) + groups = [ group for group in unpack_groups( hg_unbundle10_obj ) ] + return json.to_json_string( groups, indent=4 ) + def check_archive( repository, archive ): for member in archive.getmembers(): # Allow regular files and directories only @@ -63,6 +75,23 @@ message = 'The file "%s" contains image content.\n' % str( file_path ) return message +def get_change_lines_in_file_for_tag( tag, change_dict ): + """ + The received change_dict is the jsonified version of the changes to a file in a changeset being pushed to the tool shed from the command line. + This method cleans and returns appropriate lines for inspection. + """ + cleaned_lines = [] + data_list = change_dict.get( 'data', [] ) + for data_dict in data_list: + block = data_dict.get( 'block', '' ) + lines = block.split( '\\n' ) + for line in lines: + index = line.find( tag ) + if index > -1: + line = line[ index: ] + cleaned_lines.append( line ) + return cleaned_lines + def get_upload_point( repository, **kwd ): upload_point = kwd.get( 'upload_point', None ) if upload_point is not None: @@ -149,8 +178,8 @@ except OSError, e: # The directory is not empty. pass - # See if any admin users have chosen to receive email alerts when a repository is - # updated. If so, check every uploaded file to ensure content is appropriate. + # See if any admin users have chosen to receive email alerts when a repository is updated. If so, check every uploaded file to ensure + # content is appropriate. check_contents = check_file_contents_for_email_alerts( trans ) for filename_in_archive in filenames_in_archive: # Check file content to ensure it is appropriate. @@ -307,6 +336,39 @@ return altered, root return False, None +def repository_tag_is_valid( filename, line ): + """ + Checks changes made to <repository> tags in a dependency definition file being pushed to the tool shed from the command line to ensure that + all required attributes exist. + """ + required_attributes = [ 'toolshed', 'name', 'owner', 'changeset_revision' ] + defined_attributes = line.split() + for required_attribute in required_attributes: + defined = False + for defined_attribute in defined_attributes: + if defined_attribute.startswith( required_attribute ): + defined = True + break + if not defined: + error_msg = 'The %s file contains a <repository> tag that is missing the required attribute %s. ' % ( filename, required_attribute ) + error_msg += 'Automatically populating dependency definition attributes occurs only when using the tool shed upload utility. ' + return False, error_msg + return True, '' + +def repository_tags_are_valid( filename, change_list ): + """ + Make sure the any complex repository dependency definitions contain valid <repository> tags when pushing changes to the tool shed on the command + line. + """ + tag = '<repository' + for change_dict in change_list: + lines = get_change_lines_in_file_for_tag( tag, change_dict ) + for line in lines: + is_valid, error_msg = repository_tag_is_valid( filename, line ) + if not is_valid: + return False, error_msg + return True, '' + def uncompress( repository, uploaded_file_name, uploaded_file_filename, isgzip, isbz2 ): if isgzip: handle_gzip( repository, uploaded_file_name ) @@ -314,3 +376,60 @@ if isbz2: handle_bz2( repository, uploaded_file_name ) return uploaded_file_filename.rstrip( '.bz2' ) + +def unpack_chunks( hg_unbundle10_obj ): + """ + This method provides a generator of parsed chunks of a "group" in a mercurial unbundle10 object which is created when a changeset that is pushed + to a tool shed repository using hg push from the command line is read using readbundle. + """ + while True: + length, = struct.unpack( '>l', readexactly( hg_unbundle10_obj, 4 ) ) + if length <= 4: + # We found a "null chunk", which ends the group. + break + if length < 84: + raise Exception( "negative data length" ) + node, p1, p2, cs = struct.unpack( '20s20s20s20s', readexactly( hg_unbundle10_obj, 80 ) ) + yield { 'node': node.encode( 'hex' ), + 'p1': p1.encode( 'hex' ), + 'p2': p2.encode( 'hex' ), + 'cs': cs.encode( 'hex' ), + 'data': [ patch for patch in unpack_patches( hg_unbundle10_obj, length - 84 ) ] } + +def unpack_groups( hg_unbundle10_obj ): + """ + This method provides a generator of parsed groups from a mercurial unbundle10 object which is created when a changeset that is pushed + to a tool shed repository using hg push from the command line is read using readbundle. + """ + # Process the changelog group. + yield [ chunk for chunk in unpack_chunks( hg_unbundle10_obj ) ] + # Process the manifest group. + yield [ chunk for chunk in unpack_chunks( hg_unbundle10_obj ) ] + while True: + length, = struct.unpack( '>l', readexactly( hg_unbundle10_obj, 4 ) ) + if length <= 4: + # We found a "null meta chunk", which ends the changegroup. + break + filename = readexactly( hg_unbundle10_obj, length-4 ).encode( 'string_escape' ) + # Process the file group. + yield ( filename, [ chunk for chunk in unpack_chunks( hg_unbundle10_obj ) ] ) + +def unpack_patches( hg_unbundle10_obj, remaining ): + """ + This method provides a generator of patches from the data field in a chunk. As there is no delimiter for this data field, a length argument is + required. + """ + while remaining >= 12: + start, end, blocklen = struct.unpack( '>lll', readexactly( hg_unbundle10_obj, 12 ) ) + remaining -= 12 + if blocklen > remaining: + raise Exception( "unexpected end of patch stream" ) + block = readexactly( hg_unbundle10_obj, blocklen ) + remaining -= blocklen + yield { 'start': start, + 'end': end, + 'blocklen': blocklen, + 'block': block.encode( 'string_escape' ) } + if remaining > 0: + print remaining + raise Exception( "unexpected end of patch stream" ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: carlfeberhard: api/histories.delete: wrap purge in try/catch, raise HTTPForbidden if config.allow_user_dataset_purge == False and purge == True
by commits-noreply＠bitbucket.org 17 Jul '13

17 Jul '13

1 new commit in galaxy-central: https://bitbucket.org/galaxy/galaxy-central/commits/ef5cc1d272d2/ Changeset: ef5cc1d272d2 User: carlfeberhard Date: 2013-07-17 17:42:14 Summary: api/histories.delete: wrap purge in try/catch, raise HTTPForbidden if config.allow_user_dataset_purge == False and purge == True Affected #: 1 file diff -r 1d05c839c1ea7a83112a98734a6887f7ce419567 -r ef5cc1d272d2805d1c6597b200f9df58a291d863 lib/galaxy/webapps/galaxy/api/histories.py --- a/lib/galaxy/webapps/galaxy/api/histories.py +++ b/lib/galaxy/webapps/galaxy/api/histories.py @@ -4,7 +4,7 @@ import pkg_resources pkg_resources.require( "Paste" ) -from paste.httpexceptions import HTTPBadRequest +from paste.httpexceptions import HTTPBadRequest, HTTPForbidden from galaxy import web from galaxy.util import string_as_bool, restore_text @@ -126,30 +126,39 @@ try: history = self.get_history( trans, history_id, check_ownership=True, check_accessible=False ) + history.deleted = True + + if purge: + if not trans.app.config.allow_user_dataset_purge: + raise HTTPForbidden( detail='This instance does not allow user dataset purging' ) + + # First purge all the datasets + for hda in history.datasets: + if hda.purged: + continue + hda.purged = True + trans.sa_session.add( hda ) + trans.sa_session.flush() + + if hda.dataset.user_can_purge: + try: + hda.dataset.full_delete() + trans.sa_session.add( hda.dataset ) + except: + pass + # flush now to preserve deleted state in case of later interruption + trans.sa_session.flush() + + # Now mark the history as purged + history.purged = True + self.sa_session.add( history ) + + trans.sa_session.flush() + + #TODO: better feedback than this... except Exception, e: return str( e ) - history.deleted = True - if purge and trans.app.config.allow_user_dataset_purge: - # First purge all the datasets - for hda in history.datasets: - if hda.purged: - continue - hda.purged = True - trans.sa_session.add( hda ) - trans.sa_session.flush() - if hda.dataset.user_can_purge: - try: - hda.dataset.full_delete() - trans.sa_session.add( hda.dataset ) - except: - pass - trans.sa_session.flush() - # Now mark the history as purged - history.purged = True - self.sa_session.add( history ) - - trans.sa_session.flush() return 'OK' @web.expose_api Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0